Anti-αvβ8 antibodies and compositions and their uses
Antibodies targeting αvβ8 integrin to block TGFβ release in tumor microenvironments address the challenge of non-specific immune suppression, enhancing anti-tumor immunity and tumor regression through selective TGFβ inhibition.
Patent Information
- Application Number
- CN201980057769.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-08-23
- Filing Date
- 2019-09-05
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2039-09-05
AI Technical Summary
Current strategies for targeting TGFβ signaling in tumor microenvironments face challenges due to the widespread effects of TGFβ in the body, leading to non-specific suppression of immune responses, and there is a need for selective inhibition of αvβ8-dependent latent TGFβ activation to enhance anti-tumor immunity.
Development of antibodies and antigen-binding fragments that specifically bind to αvβ8 integrin, preventing the release of active TGFβ by blocking the interaction with latent associated peptide (LAP), thereby reducing TGFβ signaling predominantly in tumor microenvironments.
These antibodies enhance immune responses against tumors by selectively inhibiting TGFβ activity in the tumor microenvironment, leading to growth suppression and potential complete tumor regression when used alone or in combination with other immunomodulators in cancer models.
Smart Images

Figure CN112823167B_ABST
Abstract
Description
[0001] Related Applications
[0002] This application claims priority to U.S. Serial No. 62 / 728,688, filed on September 7, 2018, and U.S. Serial No. 62 / 890,945, filed on August 23, 2019, the entire contents of which are hereby incorporated by reference in their entirety.
[0003] Sequence Listing
[0004] This specification further incorporates by reference the Sequence Listing filed herewith on September 5, 2019. In accordance with 37 C.F.R.§1.52(e)(5), the Sequence Listing text file (identified as PC72413A_SequenceListing_ST25.txt) is 184,211 bytes and was created on September 3, 2019. The Sequence Listing submitted electronically herewith does not exceed the scope of this specification and thus does not contain new matter.
[0005] Parties to a Joint Research Statement
[0006] The presently claimed invention was made by or on behalf of the parties listed below who were parties to a joint research agreement. The joint research agreement was in effect on or before the date the claimed invention was made and the claimed invention was made as a result of activities within the scope of the joint research agreement. The parties to the joint research agreement are the Regents of the University of California, on behalf of its San Francisco campus and Pfizer Inc. Technical Field
[0007] The present invention relates to antibodies that specifically bind to αvβ8 integrin, antigen-binding fragments thereof, and compositions, methods, and uses thereof. Background Art
[0008] Transforming growth factor-β (TGFβ) is a potent inhibitor of adaptive and innate immunity and an important mediator of immunosuppression by regulatory T cell subsets. Induction of Th17 cells requires TGFβ, which can promote tumor progression by inducing granulocytic inflammation and promote epithelial-to-mesenchymal transition of tumor cells and secretion and accumulation of fibrotic tumor stroma, which can promote exclusion of immune cells from some solid tumors. For all these reasons, inhibition of TGFβ has been investigated as an adjuvant immunotherapy, especially in so-called "immune-excluded" tumors (Gorelik et al., Nat. Med. 7:1118-1122, 2001; Tauriello et al., Nature 554:538-543, 2018; Mariathasan et al., Nature 554:544-548, 2018, Dodagatta et al., J Immunother Cancer. 7:62.2019; U.S. Patent No. 10,167,334). However, due to the important homeostatic role of TGFβ in multiple biological systems, systemic targeting of TGFβ signaling presents many challenges due to unwanted side effects (Hata and Akhurst Nat. Rev. Drug Dev. 11, 791-811, 2012; Akhurst et al., Cold Spring Harbor Perspectives. 10, 2017; Flavell et al., Nat. Rev. Immunol. 10:554-567, 2010).
[0009] Previous studies have shown that inhibition of TGFβ signaling, in combination with checkpoint inhibition, can enhance responses to radiation or vaccine therapy (Vanpouille-Box et al., Cancer Res. 75:2232-2242, 2015; Terabe et al., OncoImmunology 6(5):e1308616, 2017). The in vivo activity of TGFβ is regulated by several mechanisms. For example, TGFβ is secreted as an inactive or latent complex, in which the active TGFβ mature peptide is coated by the cleaved latency associated peptide (LAP) domain. Latent-TGFβ can be covalently linked to the extracellular matrix by latent TGFβ binding protein (LTBP) or presented on the cell surface by glycoprotein A repeat predominant protein (GARP). Early in vitro data suggested that the latent complex of TGFβ can be activated by high temperature, acidic pH, and various proteases (Annes et al., J Cell Sci. 116:217-24, 2003), however, the importance of these mechanisms in vivo remains to be determined.
[0010] Members of the αv integrin family, in particular αvβ1, αvβ6, and αvβ8, have been shown to play a role in latent-TGFβ activation. Integrin αvβ8 is a transmembrane non-covalent heterodimer composed of ITGαV and ITGβ8 subunits. The expression of αvβ8 is unique among αv integrins, where its expression by immune cells such as dendritic cells, regulatory T cells, and tumor-associated macrophages has emerged as a context activator of TGFβ for modulating active immune responses. αvβ8 expression in dendritic cells (DCs) serves as a mediator of TGFβ production during T cell stimulation and strongly influences the differentiation and development of Tregs and Th17 cells at the expense of Th1 differentiation during immune responses. Mice with conditional deletion of Itgb8 in DCs or all leukocytes demonstrate significant inhibition of TGFβ-dependent induction of antigen-specific Th17 cells and subsequent protection from organ dysfunction in some preclinical models of autoimmunity such as multiple sclerosis (experimental autoimmune encephalomyelitis) and allergic asthma (Travis et al., Nature. 449(7160):361-5, 2007; Melton et al., J Clin. Invest. 120(12):4436-44, 2010).
[0011] TGFβ plays a role in both the differentiation and recruitment of immunosuppressive cells to tumors and contributes to an immunosuppressive tumor microenvironment as a tumor-intrinsic factor. In some cancers, TGFβ can promote tumors by affecting many aspects of the tumor microenvironment, including angiogenesis, metastasis, epithelial-mesenchymal transition, and most importantly, inhibiting infiltrating immune cells.
[0012] Thus, given the prominent role of TGFβ in the tumor microenvironment and the many challenges associated with systemic targeting of TGFβ signaling (Hata and Akhurst Nat. Rev. Drug Dev. 11, 791-811, 2012; Akhurst et al., Cold Spring Harbor Perspectives 10, 2017; Flavell et al., Nat. Rev. Immunol. 10:554-567, 2010), there is a need to develop strategies for selectively inhibiting αvβ8-dependent latent-TGFβ activation. SUMMARY OF THE INVENTION
[0013] The present disclosure relates to antibodies (e.g., humanized and chimeric antibodies) and antigen-binding fragments thereof that specifically bind to αvβ8 integrin (also interchangeably referred to herein as "AVB8", "αvβ8", or "avb8") (e.g., αvβ8 integrin from human, mouse, cynomolgus monkey, and / or rat). In certain aspects, the antibodies and antigen-binding fragments thereof bind to αvβ8 integrin and ultimately reduce TGFβ (e.g., TGFβ1 and TGFβ3) signaling, for example, in a tumor or tumor microenvironment.
[0014] Mature TGFβ exists in a latent or inactive form in a complex with a latency-associated peptide (LAP) domain. Binding of αvβ8 integrin to LAP results in the release of active TGFβ (e.g., TGFβ1 and TGFβ3). Reducing the binding of αvβ8 integrin to LAP can prevent the release of active TGFβ, thereby reducing TGFβ signaling. TGFβ is known to have immunosuppressive effects, for example, in the tumor microenvironment. Thus, reducing TGFβ activity and / or signaling using the antibodies described herein can lead to the activation of an immune response (e.g., an anti-tumor response in vivo).
[0015] Due to the restricted expression of αvβ8 integrin on immune cells (e.g., dendritic cells, regulatory T cells, tumor-associated macrophages) and tumor cells, the antibodies disclosed herein can result in a more targeted, non-systemic reduction of TGFβ signaling. Thus, the antibodies and antigen-binding fragments of the present disclosure are capable of more selectively antagonizing TGFβ activity in the immune system and / or tumor microenvironment, thereby enhancing the anti-tumor immune response in a subject. In some embodiments disclosed herein, antibodies against αvβ8 integrin have been shown to cause growth inhibition and / or complete tumor regression in animal models of several cancers, including, for example, squamous cell carcinoma, breast cancer, and / or colon cancer, alone or in combination with other immunomodulators (e.g., modulators of checkpoint inhibitors (e.g., inhibitors of PD-1, PD-L1, CTLA-4, or agonists of 4-1BB)) or anti-cancer therapies (e.g., radiation therapy).
[0016] Accordingly, in certain aspects, the present disclosure provides antibodies and antigen-binding fragments thereof that bind to αvβ8 integrin with high affinity and specificity, nucleic acid molecules encoding the antibodies and antigen-binding fragments thereof, expression vectors, host cells, and methods for preparing the same. In certain aspects, the antibodies and antigen-binding fragments thereof exhibit altered effector functions (e.g., having reduced antibody-dependent cell-mediated cytotoxicity (ADCC) activity and / or reduced complement-dependent cytotoxicity (CDC) activity). In certain aspects, the anti-αvβ8 integrin antibodies and antigen-binding fragments thereof exhibit enhanced binding affinity for αvβ8 integrin compared to the murine hybridoma antibodies and antigen-binding fragments thereof from which they are derived. The humanized anti-αvβ8 integrin antibodies and antigen-binding fragments thereof disclosed herein can be used alone or in combination with other agents or therapeutic modalities (e.g., immunomodulators or anti-cancer therapies) to treat, prevent, and / or diagnose disorders, such as cancerous disorders (e.g., solid and soft tissue tumors). Accordingly, compositions and methods for detecting αvβ8 integrin and methods for using the anti-αvβ8 integrin antibodies and antigen-binding fragments thereof to treat various disorders, including cancer, are disclosed.
[0017] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following embodiments (E).
[0018] E1. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or antigen-binding fragment thereof has at least one of the following characteristics:
[0019] i. a binding affinity for human αvβ8 integrin expressed as KD that is lower than the KD of the murine antibody ADWA11 disclosed in U.S. Patent No. 9,969,804, which is incorporated herein by reference in its entirety, the amino acid sequence being confirmed and as set forth, for example, in SEQ ID NOs: 20-33 and 71-76 of the present specification, e.g., the KD of the ADWA11 antibody of the present invention is lower than 536 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 510, 520, 530, 531, 532, 533, 534, or 535 pM);
[0020] ii. KD for human αvβ8 integrin, such as KD for purified human αvβ8 integrin is less than or equal to 200 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 180, 190 or 200 pM);
[0021] iii. KD for human αvβ8 integrin, such as KD for purified human αvβ8 integrin is less than or equal to 100 pM;
[0022] iv. KD for mouse αvβ8 integrin, which is lower than the KD of murine antibody ADWA11, e.g., less than 489 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 460, 470, 480, 485, 486, 487 or 488 pM);
[0023] v. KD for mouse αvβ8 integrin, which is 70.8 + / - 19.9 pM for purified mouse αvβ8 integrin;
[0024] vi. KD for cynomolgus monkey αvβ8 integrin, which is lower than the KD of murine antibody ADWA11, e.g., less than 507 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 501, 502, 503, 504, 505 or 506 pM);
[0025] vii. KD for cynomolgus monkey αvβ8 integrin, which is less than or equal to 100 pM for purified cynomolgus monkey αvβ8 integrin;
[0026] viii. KD for rat αvβ8 integrin, which is approximately 160 pM;
[0027] ix. Roughly equal affinities for at least two, three or all of human, cynomolgus monkey, mouse and rat αvβ8 integrins, e.g., KD less than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 98 pM), e.g., as determined using a Biacore affinity assay;
[0028] x. The IC50 for inhibiting TGFβ transactivation, which is lower than the IC50 of murine antibody ADWA11, such as lower than 183 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 175, 180, 181 or 182 pM);
[0029] xi. The IC50 for inhibiting TGFβ transactivation in U251 cells, which is about 199 + / - 93.6 pM;
[0030] xii. The IC50 for inhibiting TGFβ transactivation, which is about 100 pM to about 300 pM;
[0031] xiii. The EC50 for U251 cells, which is about 126 + / - 34 pM (e.g., about 50, 60, 70, 80, 90, 100, 110, 115, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 150, 160, 170, 180 or 190 pM);
[0032] xiv. The EC50 for U251 cells, which is about 256 + / - 115 pM (e.g., about 120, 140, 160, 180, 200, 220, 240, 260, 280, 290, 300, 320, 340, 360, 380, 400 pM);
[0033] xv. The EC50 for U251 cells, which is about 80 pM to about 400 pM;
[0034] xvi. The EC50 for C8-S cells, which is about 115 pM;
[0035] xvii. The EC50 for C8-S cells, which is about 145 + / - 23.7 pM;
[0036] xviii. The EC50 for C8-S cells, which is about 110 pM to about 180 pM;
[0037] xix. At least one predicted human pharmacokinetic (PK) parameter, which is selected from:
[0038] a. The clearance (CL) of the central compartment, which is about 0.12 - 0.15 mL / h / kg;
[0039] b. The intercompartmental clearance (CLF), which is about 0.15 - 0.51 mL / h / kg;
[0040] c. The volume of distribution (V1) of the central compartment, which is about 36 - 39 mL / kg;
[0041] d. The volume of distribution (V2) of the peripheral compartment, which is about 21 - 33 mL / kg; and / or
[0042] e. The terminal half-life (t 1 / 2 ), which is about 12 days;
[0043] f. The terminal half-life (t 1 / 2 ), which is about 15 - 17 days; or
[0044] xx. No detectable binding to human Fcγ receptors or C1q.
[0045] E2. The isolated antibody or antigen-binding fragment thereof according to embodiment E1, wherein the KD for human αvβ8 integrin is lower than the KD of murine antibody ADWA11, for example, lower than 536 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 510, 520, 530, 531, 532, 533, 534 or 535 pM).
[0046] E3. The isolated antibody or antigen-binding fragment thereof according to embodiment E1 or E2, wherein, for example, for purified human αvβ8 integrin, the KD for human αvβ8 integrin is lower than or equal to 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 pM).
[0047] E4. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the KD for murine αvβ8 integrin is lower than the KD of murine antibody ADWA11, for example, lower than 489 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 460, 470, 480, 485, 486, 487 or 488 pM).
[0048] E5. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the KD for murine αvβ8 integrin is about 70.8 + / - 19.9 pM.
[0049] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the KD for cynomolgus monkey αvβ8 integrin is lower than the KD of murine antibody ADWA11, such as lower than 507 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 501, 502, 503, 504, 505 or 506 pM).
[0050] E7. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the KD for cynomolgus monkey αvβ8 integrin is lower than 100 pM.
[0051] E8. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the KD for rat αvβ8 integrin is about 160 pM.
[0052] E9. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the isolated antibody or antigen-binding fragment thereof exhibits substantially equal affinity for at least two, three or all of human, cynomolgus monkey, mouse and rat αvβ8 integrins, such as a KD lower than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95 pM), such as as determined using a Biacore affinity assay.
[0053] E10. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the isolated antibody or antigen-binding fragment thereof exhibits substantially equal affinity for at least two, three or all of human, cynomolgus monkey, mouse and rat αvβ8 integrins, such as a KD lower than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 98 pM), such as as determined using a Biacore affinity assay.
[0054] E11. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the IC50 for inhibiting TGFβ transactivation is lower than that of murine antibody ADWA11, such as lower than 183 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 175, 180, 181 or 182 pM).
[0055] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the IC50 for inhibiting TGFβ transactivation in U251 cells is about 199+ / -93.6 pM.
[0056] E13. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the IC50 for inhibiting TGFβ transactivation is from about 100 pM to about 300 pM.
[0057] E14. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for U251 cells is about 126 pM, with a standard deviation of plus or minus 34 pM.
[0058] E15. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for U251 cells is about 256 pM, with a standard deviation of plus or minus 115 pM.
[0059] E16. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for U251 cells is from about 100 pM to about 400 pM.
[0060] E17. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for C8-S cells is about 115 pM.
[0061] E18. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for C8-S cells is about 145+ / -23.7 pM.
[0062] E19. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the EC50 for C8-S cells is from about 110 pM to about 180 pM.
[0063] E20. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which has at least one predicted human pharmacokinetic (PK) parameter selected from the group consisting of:
[0064] (i) The clearance rate (CL) of the central compartment, which is about 0.12 - 0.15 mL / h / kg;
[0065] (ii) The intercompartmental clearance rate (CLF), which is about 0.15 - 0.51 mL / h / kg;
[0066] (iii) The volume of distribution (V1) of the central compartment, which is about 36 - 39 mL / kg;
[0067] (iv) The volume of distribution (V2) of the peripheral compartment, which is about 21 - 33 mL / kg; and / or (v) the terminal half-life (t 1 / 2 ), which is about 12 - 17 days.
[0068] E21. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the isolated antibody or antigen-binding fragment thereof shows no detectable binding to human Fcγ receptor or C1q.
[0069] E22. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody or antigen-binding fragment thereof further has at least one of the following characteristics:
[0070] (i) Specifically binds to αvβ8 integrin (e.g., αvβ8 integrin from human, mouse, cynomolgus monkey, and / or rat);
[0071] (ii) Reduces the interaction between αvβ8 integrin and latent-associated peptide (LAP);
[0072] (iii) Reduces TGF-β signaling;
[0073] (iv) Effectively blocks αvβ8 integrin-mediated TGFβ activation with an IC50 ≤ 10 nM;
[0074] (v) Has a comparable Kd (within 5-fold) for non-human primate (NHP) orthologs;
[0075] (vi) Selectively binds to human αvβ8 and shows undetectable binding to homologs of αvβ8 (e.g., αvβ1, αvβ3, αvβ5, and αvβ6);
[0076] (vii) Causes growth inhibition and / or complete tumor regression in animal models of cancer, alone or in combination with an immunomodulator, e.g., a modulator of a checkpoint inhibitor, e.g., an inhibitor of PD-1, PD-L1, CTLA-4 or an agonist of a stimulatory molecule (e.g., 4-1BB);
[0077] (viii) Causes growth inhibition and / or complete tumor regression in animal models of cancer in combination with an anti-cancer therapy (e.g., radiotherapy);
[0078] (ix) Shows at least a 60% reduction in tumor growth in a syngeneic tumor transplantation model, e.g., when administered alone or in combination with an immunomodulator (e.g., an inhibitor of PD-1, PD-L1 or CTLA-4) at ≤ 10 mg / kg;
[0079] (x) When administered to a subject, it increases the anti-tumor response in the presence of one or more immunomodulators, such as antagonists of checkpoint inhibitors, e.g., antagonists of PD-1, PD-L1 or CTLA-4, or activators of the immune response, e.g., 4-1BB agonists;
[0080] (xi) It has efficacy independent of the expression of αvβ8 integrin in tumor models;
[0081] (xii) It increases the abundance of CD8+ GzmB+ T cells in the tumor microenvironment;
[0082] (xiii) When used in combination with antagonists of checkpoint inhibitors (e.g., anti-PD-1 or anti-PD-L1 antibodies), it shows a reduction in tumor growth, e.g., a reduction of at least >80%, in syngeneic models of squamous cell carcinoma, breast cancer, and / or colon cancer;
[0083] (xiv) As determined by Kaplan-Meier analysis, it shows a statistically significant improvement in the overall survival rate of the subject;
[0084] (xv) It has a high degree of thermal stability;
[0085] (xvi) It shows minimal aggregation at high concentrations; and
[0086] (xvii) It can show reproducible expression and purity under large-scale preparation conditions.
[0087] E23. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0088] One, two, or three CDRs from the heavy chain variable region (e.g., H1, H2, or H3), and / or one, two, or three CDRs from the light chain variable region (e.g., L1, L2, or L3), selected from:
[0089] (i) CDR-H1 comprising the amino acid sequence of SEQ ID NO:8 or 14,
[0090] CDR-H2 comprising the amino acid sequence of SEQ ID NO:9 or 15,
[0091] CDR-H3 comprising the amino acid sequence of SEQ ID NO:10 or 16,
[0092] CDR-L1 comprising the amino acid sequence of SEQ ID NO:11 or 17,
[0093] CDR-L2 comprising the amino acid sequence of SEQ ID NO:12 or 18, and
[0094] a CDR-L3 comprising the amino acid sequence of SEQ ID NO:13 or 19, or
[0095] (ii) a CDR-H1 that contains at least one amino acid change relative to SEQ ID NO:8 or 14 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions),
[0096] a CDR-H2 that contains at least one amino acid change relative to SEQ ID NO:9 or 15 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions),
[0097] a CDR-H3 that contains at least one amino acid change relative to SEQ ID NO:10 or 16 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions),
[0098] a CDR-L1 that contains at least one amino acid change relative to SEQ ID NO:11 or 17 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions),
[0099] a CDR-L2 that contains at least one amino acid change relative to SEQ ID NO:12 or 18 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), or
[0100] a CDR-L3 that contains at least one amino acid change relative to SEQ ID NO:13 or 19 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), optionally wherein:
[0101] none of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 contains the amino acid sequence of any of the following:
[0102] (a) SEQ ID NO:22, 23, 24, 25, 26, and 27, respectively,
[0103] (b) SEQ ID NO:28, 29, 30, 31, 32, and 33, respectively,
[0104] (c) SEQ ID NO:22, 23, 24, 71, 72, and 73, respectively, or
[0105] (d) SEQ ID NO:28, 29, 30, 74, 75, and 76, respectively.
[0106] Alternatively, or in combination with any one of the embodiments provided herein (e.g., E1-E23), the antibody or antigen-binding fragment thereof has one or more of the following aspects, features, and embodiments.
[0107] E24. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0108] One, two, or three CDRs from the heavy-chain variable region (e.g., H1, H2, or H3), and / or one, two, or three CDRs from the light-chain variable region (e.g., L1, L2, or L3), selected from:
[0109] (i) CDR-H1 comprising the amino acid sequence of SEQ ID NO:8,
[0110] CDR-H2 comprising the amino acid sequence of SEQ ID NO:9,
[0111] CDR-H3 comprising the amino acid sequence of SEQ ID NO:10,
[0112] CDR-L1 comprising the amino acid sequence of SEQ ID NO:11,
[0113] CDR-L2 comprising the amino acid sequence of SEQ ID NO:12, and
[0114] CDR-L3 comprising the amino acid sequence of SEQ ID NO:13, or
[0115] (ii) CDR-H1 that contains at least one amino acid change relative to SEQ ID NO:8 but no more than two, three, or four changes (e.g., substitution, deletion, or insertion, e.g., conservative substitution),
[0116] CDR-H2 that contains at least one amino acid change relative to SEQ ID NO:9 but no more than two, three, or four changes (e.g., substitution, deletion, or insertion, e.g., conservative substitution),
[0117] CDR-H3 that contains at least one amino acid change relative to SEQ ID NO:10 but no more than two, three, or four changes (e.g., substitution, deletion, or insertion, e.g., conservative substitution),
[0118] CDR-L1 that contains at least one amino acid change relative to SEQ ID NO:11 but no more than two, three, or four changes (e.g., substitution, deletion, or insertion, e.g., conservative substitution),
[0119] A CDR-L2 that contains at least one amino acid change relative to SEQ ID NO:12 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), or
[0120] A CDR-L3 that contains at least one amino acid change relative to SEQ ID NO:13 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), optionally wherein:
[0121] Any one of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 does not contain the amino acid sequence of any of the following:
[0122] (a) SEQ ID NO:22, 23, 24, 25, 26, and 27, respectively, or
[0123] (b) SEQ ID NO:22, 23, 24, 71, 72, and 73, respectively.
[0124] E25. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0125] One, two, or three complementarity-determining regions (CDRs) from the heavy-chain variable region (e.g., H1, H2, or H3), and / or one, two, or three CDRs from the light-chain variable region (e.g., L1, L2, or L3), selected from:
[0126] CDR-H2 comprising the amino acid sequence of SEQ ID NO:9,
[0127] CDR-L1 comprising the amino acid sequence of SEQ ID NO:11,
[0128] CDR-L2 comprising the amino acid sequence of SEQ ID NO:12, and
[0129] CDR-L3 comprising the amino acid sequence of SEQ ID NO:13.
[0130] E26. The isolated antibody or antigen-binding fragment thereof according to embodiment E24 or E25, comprising:
[0131] CDR-H1 comprising the amino acid sequence of SEQ ID NO:8,
[0132] CDR-H2 comprising the amino acid sequence of SEQ ID NO:9, and
[0133] CDR-H3 comprising the amino acid sequence of SEQ ID NO:10.
[0134] An isolated antibody or antigen-binding fragment thereof according to any one of embodiments E24 to E26, comprising:
[0135] CDR-L1 comprising the amino acid sequence of SEQ ID NO:11,
[0136] CDR-L2 comprising the amino acid sequence of SEQ ID NO:12, and
[0137] CDR-L3 comprising the amino acid sequence of SEQ ID NO:13.
[0138] E28. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0139] CDR-H1 comprising the amino acid sequence of SEQ ID NO:8,
[0140] CDR-H2 comprising the amino acid sequence of SEQ ID NO:9,
[0141] CDR-H3 comprising the amino acid sequence of SEQ ID NO:10,
[0142] CDR-L1 comprising the amino acid sequence of SEQ ID NO:11,
[0143] CDR-L2 comprising the amino acid sequence of SEQ ID NO:12, and
[0144] CDR-L3 comprising the amino acid sequence of SEQ ID NO:13.
[0145] E29. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three complementarity-determining regions (CDRs) from the heavy-chain variable region (e.g., H1, H2, or H3), and / or one, two, or three CDRs from the light-chain variable region (e.g., L1, L2, or L3):
[0146] CDR-H1 comprising the amino acid sequence of DYYMN (SEQ ID NO:8);
[0147] CDR-H2 comprising the amino acid sequence of WIDPDX1GNTIYX2PKFQG (SEQ ID NO:131), wherein X1 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N, or Q; and X2 can be any one of the following: amino acid, amino acid other than D, conservative substitution of D, D, or E;
[0148] CDR-H3 comprising the amino acid sequence of RLLMDY (SEQ ID NO:10);
[0149] CDR-L1 comprising the amino acid sequence of RSTKSLX3HFNGNTYLF (SEQ ID NO:132), wherein X3 can be any one of the following: an amino acid, an amino acid other than L, a conservative substitution of L, L, or S;
[0150] CDR-L2 comprising the amino acid sequence of YYMSX4LAS (SEQ ID NO:133), wherein X4 can be any one of the following: an amino acid, an amino acid other than N, a conservative substitution of N, N, or S; and / or
[0151] CDR-L3 comprising the amino acid sequence of X5QSLEYPFT (SEQ ID NO:134), wherein X5 can be any one of the following: an amino acid, an amino acid other than M, a conservative substitution of M, M, or Q;
[0152] For example, wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not comprise the amino acid sequences of SEQ ID NO:22, 23, 24, 25, 26, and 27 or SEQ ID NO:22, 23, 24, 71, 72, and 73, respectively.
[0153] E30. The isolated antibody or antigen-binding fragment thereof according to embodiment E29, wherein X1 is Q and X2 is E.
[0154] E31. The isolated antibody or antigen-binding fragment thereof according to embodiment E29 or E30, wherein X3 is S.
[0155] E32. The isolated antibody or antigen-binding fragment thereof according to any one of embodiments E29 to E31, wherein X4 is S.
[0156] E33. The isolated antibody or antigen-binding fragment thereof according to any one of embodiments E29 to E32, wherein X5 is Q.
[0157] E34. The isolated antibody or antigen-binding fragment thereof according to embodiment E29, wherein X1 is Q, X2 is E, X3 is S, and X5 is Q.
[0158] E35. The isolated antibody or antigen-binding fragment thereof according to embodiment E29, wherein X1 is Q, X2 is E, and X3 is S.
[0159] The isolated antibody or antigen-binding fragment thereof according to embodiment E29, wherein X1 is Q, X2 is E, X3 is S, X4 is S, and X5 is Q.
[0160] E37. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three complementarity-determining regions (CDRs) from the heavy-chain variable region (e.g., H1, H2, or H3), and / or one, two, or three CDRs from the light-chain variable region (e.g., L1, L2, or L3):
[0161] CDR-H1 comprising the amino acid sequence DYYMN (SEQ ID NO:8);
[0162] CDR-H2 comprising the amino acid sequence WIDPDX1GX2TIYX3X4X5X6X7G (SEQ ID NO:167), wherein X1 can be any of the following: amino acid, amino acid other than N, conservative substitution of N, N or Q; X2 can be any of the following: amino acid, amino acid other than N, conservative substitution of N, N or Q; X3 can be any of the following: amino acid, amino acid other than D, conservative substitution of D, D or E; X4 can be any of the following: amino acid, amino acid other than P, conservative substitution of P, P, Q, D or A; X5 can be any of the following: amino acid, amino acid other than K, conservative substitution of K, K, S or A; X6 can be any of the following: amino acid, amino acid other than F, conservative substitution of F, F or V; and X7 can be any of the following: amino acid, amino acid other than Q, conservative substitution of Q, Q or K;
[0163] CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO:10);
[0164] CDR-L1 comprising the amino acid sequence RSTKSX8X9HFNGNXYLF (SEQ ID NO:168), wherein X8 can be any of the following: amino acid, amino acid other than L, conservative substitution of L, L or I; X9 can be any of the following: amino acid, amino acid other than L, conservative substitution of L, L or S; and X 10 can be any of the following: amino acid, amino acid other than T, conservative substitution of T, T or S; 10
[0165] Comprising YX 11 X 12 SX 13 LX 14 CDR-L2 of the amino acid sequence of S (SEQ ID NO: 169), wherein X 11 can be any of the following: an amino acid, an amino acid other than Y, a conservative substitution of Y, Y or A; X 12 can be any of the following: an amino acid, an amino acid other than M, a conservative substitution of M, M or A; X 13 can be any of the following: an amino acid, an amino acid other than N, a conservative substitution of N, N or S; and X 14 can be any of the following: an amino acid, an amino acid other than A, a conservative substitution of A, A or Q; and / or
[0166] comprises X 15 QSX 16 X 17 X 18 PX 19 CDR-L3 of the amino acid sequence of T (SEQ ID NO: 170), wherein X 15 can be any of the following: an amino acid, an amino acid other than M, a conservative substitution of M, M or Q; X 16 can be any of the following: an amino acid, an amino acid other than L, a conservative substitution of L, L or Y; X 17 can be any of the following: an amino acid, an amino acid other than E, a conservative substitution of E, E or S; X 18 can be any of the following: an amino acid, an amino acid other than Y, a conservative substitution of Y, Y or T; and X 19 can be any of the following: an amino acid, an amino acid other than F, a conservative substitution of F, F, L or W;
[0167] For example, wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 do not comprise the amino acid sequences of SEQ ID NO: 22, 23, 24, 25, 26 and 27 or SEQ ID NO: 22, 23, 24, 71, 72 and 73, optionally wherein:
[0168] X1 is Q, X2 is N, X3 is E, X4 is P, X5 is K, X6 is F, and X7 is Q,
[0169] X8 is L, X9 is S, and X 10 is T,
[0170] X 11 is Y, X 12 is M, X 13 is S, and X 14 is A, and / or
[0171] X 15 is Q, X 16 is L, X 17 is E, X 18 is Y, and X 19 is F.
[0172] E38. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three complementarity-determining regions (CDRs) from the heavy-chain variable region (e.g., H1, H2 or H3), and / or one, two or three CDRs from the light-chain variable region (e.g., L1, L2 or L3):
[0173] CDR-H1 comprising the amino acid sequence DYYMN (SEQ ID NO:8);
[0174] CDR-H2 comprising the amino acid sequence WIDPDX1GNTIYX2PKX3QG (SEQ ID NO:171), wherein X1 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or Q; X2 can be any one of the following: amino acid, amino acid other than D, conservative substitution of D, D or E; and X3 can be any one of the following: amino acid, amino acid other than F, conservative substitution of F, F or V;
[0175] CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO:10);
[0176] CDR-L1 comprising the amino acid sequence RSTKSLX4HFNGNTYLF (SEQ ID NO:172), wherein X4 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or S;
[0177] CDR-L2 comprising the amino acid sequence YYX5SX6LAS (SEQ ID NO:173), wherein X5 can be any one of the following: amino acid, amino acid other than M, conservative substitution of M, M or A; and X6 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or S; and / or
[0178] CDR-L3 comprising the amino acid sequence X7QSX8EYPFT (SEQ ID NO:174), wherein X7 can be any one of the following: amino acid, amino acid other than M, conservative substitution of M, M or Q; and X8 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or Y;
[0179] For example, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences of SEQ ID NO: 22, 23, 24, 25, 26, and 27 or SEQ ID NO: 22, 23, 24, 71, 72, and 73, respectively, optionally wherein:
[0180] X1 is Q, X2 is E, and X3 is F,
[0181] X4 is S,
[0182] X5 is M and X6 is S, and / or
[0183] X7 is Q and X8 is L.
[0184] E39. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences from the VH region of the amino acid sequence comprising SEQ ID NO: 6, wherein the CDR sequences are defined as per Kabat.
[0185] E40. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences from the VL region of the amino acid sequence comprising SEQ ID NO: 7, wherein the CDR sequences are defined as per Kabat.
[0186] E41. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences from the VH region of the amino acid sequence comprising SEQ ID NO: 6 and one, two, or three CDR-L1 sequences from the VL region of the amino acid sequence comprising SEQ ID NO: 7, wherein the CDR sequences are defined as per Kabat.
[0187] E42. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences from a polypeptide encoded by the nucleic acid sequence of SEQ ID NO: 189, 190, or 191, wherein the CDR sequences are defined as per Kabat.
[0188] E43. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences from a polypeptide encoded by the nucleic acid sequence of SEQ ID NO: 185 or 186, wherein the CDR sequences are defined as per Kabat.
[0189] E44. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from a polypeptide encoded by the nucleic acid sequence of SEQ ID NO: 189, 190 or 191 and one, two or three CDR sequences from a polypeptide encoded by the nucleic acid sequence of SEQ ID NO: 185 or 186, wherein the CDR sequences are as defined according to Kabat.
[0190] E45. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one or more complementarity determining regions (CDRs) selected from:
[0191] (i) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 14,
[0192] CDR-H2 comprising the amino acid sequence of SEQ ID NO: 15,
[0193] CDR-H3 comprising the amino acid sequence of SEQ ID NO: 16,
[0194] CDR-L1 comprising the amino acid sequence of SEQ ID NO: 17,
[0195] CDR-L2 comprising the amino acid sequence of SEQ ID NO: 18, and
[0196] CDR-L3 comprising the amino acid sequence of SEQ ID NO: 19; or
[0197] (ii) CDR-H1 that contains at least one amino acid change relative to SEQ ID NO: 14 but no more than two, three or four changes (e.g., substitutions, deletions or insertions, e.g., conservative substitutions),
[0198] CDR-H2 that contains at least one amino acid change relative to SEQ ID NO: 15 but no more than two, three or four changes (e.g., substitutions, deletions or insertions, e.g., conservative substitutions),
[0199] CDR-H3 that contains at least one amino acid change relative to SEQ ID NO: 16 but no more than two, three or four changes (e.g., substitutions, deletions or insertions, e.g., conservative substitutions),
[0200] CDR-L1 that contains at least one amino acid change relative to SEQ ID NO: 17 but no more than two, three or four changes (e.g., substitutions, deletions or insertions, e.g., conservative substitutions),
[0201] A CDR-L2 that contains at least one amino acid change relative to SEQ ID NO:18 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), or
[0202] A CDR-L3 that contains at least one amino acid change relative to SEQ ID NO:19 but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions), optionally wherein:
[0203] None of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 contains the amino acid sequence of any of the following:
[0204] (a) SEQ ID NO:28, 29, 30, 31, 32, and 33, respectively, or
[0205] (b) SEQ ID NO:28, 29, 30, 74, 75, and 76, respectively.
[0206] E46. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin and comprises one or more complementarity-determining regions (CDRs) selected from:
[0207] A CDR-H2 comprising the amino acid sequence of SEQ ID NO:15,
[0208] A CDR-L1 comprising the amino acid sequence of SEQ ID NO:17, and
[0209] A CDR-L2 comprising the amino acid sequence of SEQ ID NO:18.
[0210] E47. The isolated antibody or antigen-binding fragment thereof according to embodiment E45 or E46, which comprises:
[0211] A CDR-H1 comprising the amino acid sequence of SEQ ID NO:14,
[0212] A CDR-H2 comprising the amino acid sequence of SEQ ID NO:15, and
[0213] A CDR-H3 comprising the amino acid sequence of SEQ ID NO:16.
[0214] E48. The isolated antibody or antigen-binding fragment thereof according to any one of embodiments E45 to E47, which comprises:
[0215] A CDR-L1 comprising the amino acid sequence of SEQ ID NO:17,
[0216] CDR-L2 comprising the amino acid sequence of SEQ ID NO:18, and
[0217] CDR-L3 comprising the amino acid sequence of SEQ ID NO:19.
[0218] E49. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0219] CDR-H1 comprising the amino acid sequence of SEQ ID NO:14,
[0220] CDR-H2 comprising the amino acid sequence of SEQ ID NO:15,
[0221] CDR-H3 comprising the amino acid sequence of SEQ ID NO:16,
[0222] CDR-L1 comprising the amino acid sequence of SEQ ID NO:17,
[0223] CDR-L2 comprising the amino acid sequence of SEQ ID NO:18, and
[0224] CDR-L3 comprising the amino acid sequence of SEQ ID NO:19.
[0225] E50. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0226] CDR-H1 comprising the amino acid sequence of GFNIKDYYMN (SEQ ID NO:14);
[0227] CDR-H2 comprising the amino acid sequence of WIDPDX1GN (SEQ ID NO:135), wherein X1 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or Q;
[0228] CDR-H3 comprising the amino acid sequence of RLLMDY (SEQ ID NO:16);
[0229] CDR-L1 comprising the amino acid sequence of STKSLX2HFNGNTYL (SEQ ID NO:136), wherein X2 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or S;
[0230] CDR-L2 comprising the amino acid sequence of YYMSX3 (SEQ ID NO: 137), wherein X3 can be any one of the following: an amino acid, an amino acid other than N, a conservative substitution of N, N or S; and
[0231] CDR-L3 comprising the amino acid sequence of QSLEYPFT (SEQ ID NO: 19);
[0232] For example, wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 do not comprise the amino acid sequences of SEQ ID NO: 28, 29, 30, 31, 32 and 33 or SEQ ID NO: 28, 29, 30, 74, 75 and 76, respectively.
[0233] E51. The isolated antibody or antigen-binding fragment thereof according to embodiment E50, wherein X1 is Q, X2 is S, and X3 is S.
[0234] E52. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0235] CDR-H1 comprising the amino acid sequence of GFNIX1DYYMN (SEQ ID NO: 175), wherein X1 can be any one of the following: an amino acid, an amino acid other than K, a conservative substitution of K, K or A;
[0236] CDR-H2 comprising the amino acid sequence of WIDPDX2GX3 (SEQ ID NO: 176), wherein X2 can be any one of the following: an amino acid, an amino acid other than N, a conservative substitution of N, N or Q; and X3 can be any one of the following: an amino acid, an amino acid other than N, a conservative substitution of N, N or Q;
[0237] CDR-H3 comprising the amino acid sequence of RLLMDY (SEQ ID NO: 16);
[0238] CDR-L1 comprising the amino acid sequence of STKSX4X5HFNGNX6YL (SEQ ID NO: 177), wherein X4 can be any one of the following: an amino acid, an amino acid other than L, a conservative substitution of L, L or I; X5 can be any one of the following: an amino acid, an amino acid other than L, a conservative substitution of L, L or S; and X6 can be any one of the following: an amino acid, an amino acid other than T, a conservative substitution of T, T or S;
[0239] CDR-L2 comprising the amino acid sequence of YX7X8SX9 (SEQ ID NO:178), wherein X7 can be any one of the following: amino acid, amino acid other than Y, conservative substitution of Y, Y or A; X8 can be any one of the following: amino acid, amino acid other than M, conservative substitution of M, M or A; and X9 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or S; and
[0240] comprising QSX 10 X 11 X 12 PX 13 CDR-L3 comprising the amino acid sequence of T (SEQ ID NO:197), wherein X 10 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or Y; X 11 can be any one of the following: amino acid, amino acid other than E, conservative substitution of E, E or S; X 12 can be any one of the following: amino acid, amino acid other than Y, conservative substitution of Y, Y or T; and X 13 can be any one of the following: amino acid, amino acid other than F, conservative substitution of F, F, L or W;
[0241] For example, wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 do not comprise the amino acid sequences of SEQ ID NO:28, 29, 30, 31, 32 and 33 or SEQ ID NO:28, 29, 30, 74, 75 and 76 respectively, optionally wherein:
[0242] X1 is Q, X2 is N, X3 is E, X4 is P, X5 is K, X6 is F, and X7 is Q,
[0243] X8 is L, X9 is S, and X 10 is T,
[0244] X 11 is Y, X 12 is M, X 13 is S, and X 14 is A, and / or
[0245] X 15 is Q, X 16 is L, X 17 is E, X 18 is Y, and X 19 is F.
[0246] E53. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0247] CDR-H1 comprising the amino acid sequence GFNIKDYYMN (SEQ ID NO:14);
[0248] CDR-H2 comprising the amino acid sequence WIDPDX1GN (SEQ ID NO:135), wherein X1 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or Q;
[0249] CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO:16);
[0250] CDR-L1 comprising the amino acid sequence STKSLX2HFNGNTYL (SEQ ID NO:136), wherein X2 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or S;
[0251] CDR-L2 comprising the amino acid sequence YYX3SX4 (SEQ ID NO:179), wherein X3 can be any one of the following: amino acid, amino acid other than M, conservative substitution of M, M or A; and X4 can be any one of the following: amino acid, amino acid other than N, conservative substitution of N, N or S; and
[0252] CDR-L3 comprising the amino acid sequence QSX5EYPFT (SEQ ID NO:180), wherein X5 can be any one of the following: amino acid, amino acid other than L, conservative substitution of L, L or Y;
[0253] For example, wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 do not comprise the amino acid sequences of SEQ ID NO:28, 29, 30, 31, 32 and 33 or SEQ ID NO:28, 29, 30, 74, 75 and 76 respectively, optionally wherein:
[0254] X1 is Q,
[0255] X2 is S,
[0256] X3 is M and X4 is S, and / or
[0257] X5 is L.
[0258] E54. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the VH region of the amino acid sequence comprising SEQ ID NO:6, wherein the CDR sequences are defined according to Chothia.
[0259] E55. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the VL region of the amino acid sequence comprising SEQ ID NO:7, wherein the CDR sequences are defined according to Chothia.
[0260] E56. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the VH region of the amino acid sequence comprising SEQ ID NO:6 and one, two or three CDR-L1 sequences from the VL region of the amino acid sequence comprising SEQ ID NO:7, wherein the CDR sequences are defined according to Chothia.
[0261] E57. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the polypeptide encoded by the nucleic acid sequence of SEQ ID NO:189, 190 or 191, wherein the CDR sequences are defined according to Chothia.
[0262] E58. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the polypeptide encoded by the nucleic acid sequence of SEQ ID NO:185 or 186, wherein the CDR sequences are defined according to Chothia.
[0263] E59. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three CDR sequences from the polypeptide encoded by the nucleic acid sequence of SEQ ID NO:189, 190 or 191 and one, two or three CDR sequences from the polypeptide encoded by the nucleic acid sequence of SEQ ID NO:185, 186, wherein the CDR sequences are defined according to Chothia.
[0264] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VH framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VH framework region of the VH region, the VH region comprising the amino acid sequence of any one of SEQ ID NO: 6, 34-46, 88-91, or 93.
[0265] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VL framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VL framework region of the VL region, the VL region comprising the amino acid sequence of any one of SEQ ID NO: 7, 47-69, or 92.
[0266] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VH framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48.
[0267] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VL framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11.
[0268] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VH framework region comprising an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substituted amino acids relative to the VH framework region of the VH region, and the VH region comprising the amino acid sequence of any one of SEQ ID NO: 6, 34-46, 88-91, or 93.
[0269] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VL framework region comprising an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substituted amino acids relative to the VL framework region of the VL region, and the VL region comprising the amino acid sequence of any one of SEQ ID NO: 7, 47-69, or 92.
[0270] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VH framework region comprising an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substituted amino acids relative to the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48.
[0271] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), the VL framework region comprising an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substituted amino acids relative to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11.
[0272] The isolated antibody or antigen-binding fragment thereof according to any of the foregoing embodiments, comprising a murine IgG1 Fc region containing one or more substitutions at positions selected from E233, E318, K320, and R322 (e.g., E233P, E318A, K320A, and R322A), e.g., wherein, as numbered according to the Eu numbering scheme (see, e.g., U.S. Patent No. 5,624,821), the murine IgG1 Fc region comprises one or more of the E233P, E318A, K320A, and R322A substitutions.
[0273] E69. The isolated antibody or antigen-binding fragment thereof according to any of the foregoing embodiments, comprising a human IgG1 Fc region containing one or more substitutions at positions selected from L234, L235, and G237 (e.g., L234A, L235A, and G237A), e.g., wherein, as numbered according to the Eu numbering scheme, the human IgG1 Fc region comprises one or more of the L234A, L235A, and G237A substitutions.
[0274] E70. The isolated antibody or antigen-binding fragment thereof according to any of the foregoing embodiments, wherein the antibody further comprises a VH region comprising a variant of the germline VH amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48, wherein, as numbered according to the amino acid sequence of SEQ ID NO:127, the VH region comprises one or more substitutions at positions T28, F29, A49, R72, N74, A75, and / or L79 (e.g., one or more substitutions selected from T28N, F29I, A49G, R72A, N74T, A75S, and L79A), optionally wherein the VH region comprises the following substitutions:
[0275] (i) T28N and F29I;
[0276] (ii) T28N, F29I, and R72A;
[0277] (iii) T28N, F29I, R72A, A49G, and L79A;
[0278] (iv) T28N, F29I, R72A, N74T, and A75S; or
[0279] (v) T28N, F29I, R72A, A49G, L79A, N74T, and A75S,
[0280] wherein (i)-(v) are numbered according to the amino acid sequence of SEQ ID NO:127, optionally wherein:
[0281] Based on the amino acid sequence numbering of SEQ ID NO: 127, the VH region contains the substitutions T28N, F29I, R72A, A49G, L79A, N74T, and A75S.
[0282] E71. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody further comprises a VH region comprising one or more (e.g., 2, 3, 4, 5, 6, or all) of the following:
[0283] (a) Asn at position 28,
[0284] (b) Ile at position 29,
[0285] (c) Gly at position 49,
[0286] (d) Ala at position 72,
[0287] (e) Thr at position 74,
[0288] (f) Ser at position 75, and
[0289] (g) Ala at position 79, based on the amino acid sequence numbering of SEQ ID NO: 127, optionally wherein the VH region comprises:
[0290] (i) Asn at position 28 and Ile at position 29;
[0291] (ii) Asn at position 28, Ile at position 29, and Ala at position 72;
[0292] (iii) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, and Ala at position 79;
[0293] (iv) Asn at position 28, Ile at position 29, Ala at position 72, Thr at position 74, and Ser at position 75; or
[0294] (v) Asn at position 28, Ile at position 29, Ala at position 721, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75, based on the amino acid sequence numbering of SEQ ID NO: 127, optionally wherein:
[0295] According to the amino acid sequence numbering of SEQ ID NO: 127, the VH region contains Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 743, and Ser at position 75.
[0296] E72. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody further comprises a VL region comprising a variant of the germline VL amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11, wherein according to the amino acid sequence numbering of SEQ ID NO: 128, the VH region comprises one or more substitutions at positions Y36 and / or L46 (e.g., Y36F and / or L46R), optionally wherein the VL region comprises the following substitutions:
[0297] (i) L46R; or
[0298] (ii) L46R and Y36F,
[0299] wherein (i)-(v) are according to the amino acid sequence numbering of SEQ ID NO: 128, optionally wherein according to the amino acid sequence numbering of SEQ ID NO: 128, the VL region comprises the substitution L46R.
[0300] E73. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody further comprises a VL region containing one or both of the following:
[0301] (a) Tyr at position 36, and
[0302] (b) Leu at position 46, which is according to the amino acid sequence numbering of SEQ ID NO: 128, optionally wherein the VL region comprises:
[0303] (i) Leu at position 46; or
[0304] (ii) Leu at position 46 and Tyr at position 36, which are according to the amino acid sequence numbering of SEQ ID NO: 128, optionally wherein:
[0305] According to the amino acid sequence numbering of SEQ ID NO: 128, the VL region comprises Leu at position 46.
[0306] E74. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one or more CDRs as described in any of the foregoing embodiments, wherein one or more CDRs contain at least one amino acid change but no more than two, three, or four changes (e.g., substitutions, deletions, or insertions, such as conservative substitutions); wherein CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences of SEQ ID NO: 22, 23, 24, 25, 26, and 27, SEQ ID NO: 22, 23, 24, 71, 72, and 73, SEQ ID NO: 28, 29, 30, 31, 32, and 33, or SEQ ID NO: 28, 29, 30, 74, 75, and 76, respectively.
[0307] E75. The isolated antibody or antigen-binding fragment thereof as described in any of the foregoing embodiments, further comprising a VH region containing the amino acid sequence set forth in Table 1.
[0308] E76. The isolated antibody or antigen-binding fragment thereof as described in any of the foregoing embodiments, further comprising a VL region containing the amino acid sequence set forth in Table 1.
[0309] E77. The isolated antibody or antigen-binding fragment thereof as described in any of the foregoing embodiments, comprising a VH region containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 6, 34 - 46, 88 - 91, or 93.
[0310] E78. The isolated antibody or antigen-binding fragment thereof according to embodiment E77, comprising a VH region containing the amino acid sequence of SEQ ID NO: 6.
[0311] E79. The isolated antibody or antigen-binding fragment thereof as described in any of the foregoing embodiments, comprising a VL region containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 7, 47 - 69, or 92.
[0312] The isolated antibody or antigen-binding fragment thereof according to embodiment E79, which comprises a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity (e.g., 100%) to the amino acid sequence of SEQ ID NO:7.
[0313] An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, which comprises a VH region containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:6, 34 - 46, 88 - 91 or 93.
[0314] The isolated antibody or antigen-binding fragment thereof according to embodiment E81, which comprises a VH region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity (e.g., 100%) to the amino acid sequence of SEQ ID NO:6.
[0315] The isolated antibody or antigen-binding fragment thereof according to embodiment E81 or E82, which further comprises a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity (e.g., 100%) to the amino acid sequence of SEQ ID NO:7.
[0316] The isolated antibody or antigen-binding fragment thereof according to embodiment E81, which comprises a VH region containing the amino acid sequence of SEQ ID NO:6.
[0317] The isolated antibody or antigen-binding fragment thereof according to embodiment E84, which comprises a VL region containing the amino acid sequence of SEQ ID NO:7.
[0318] An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, which comprises a VL region containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:7, 47 - 69 or 92.
[0319] The isolated antibody or antigen-binding fragment thereof according to embodiment E86, which comprises a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity (e.g., 100%) to the amino acid sequence of SEQ ID NO:7.
[0320] The isolated antibody or antigen-binding fragment thereof according to embodiment E86 or E87, which further comprises a VH region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity (e.g., 100%) to the amino acid sequence of SEQ ID NO:6.
[0321] The isolated antibody or antigen-binding fragment thereof according to embodiment E86, which comprises a VL region containing an amino acid sequence selected from SEQ ID NO:7, 47 - 69 or 92.
[0322] An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, which comprises a VH region containing the amino acid sequence of SEQ ID NO:39, wherein one or more amino acid residues of said SEQ ID NO:39 contain one or more amino acid substitutions selected from K30A, N55Q, N57Q, D61E, P62A, K63A and F64V, numbered according to SEQ ID NO:39.
[0323] An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, which comprises a VH region containing at least one of the following:
[0324] (a) Ala at position 30
[0325] (b) Gln at position 55,
[0326] (c) Gln at position 57,
[0327] (d) Glu at position 61,
[0328] (e) Ala at position 62,
[0329] (f) Ala at position 63, and
[0330] (g) Val at position 64, numbered according to SEQ ID NO:39.
[0331] The isolated antibody or antigen-binding fragment thereof according to embodiment E90, wherein SEQ ID NO: 39 comprises:
[0332] (i) N55Q and D61E; or
[0333] (ii) N55Q, D61E and F64V, numbered according to SEQ ID NO: 39, optionally wherein numbered according to SEQ ID NO: 39, SEQ ID NO: 39 comprises N55Q and D61E substitutions.
[0334] E93. The isolated antibody or antigen-binding fragment thereof according to embodiment E91, wherein the VH region comprises:
[0335] (i) Gln at position 55 and Glu at position 61; or
[0336] (ii) Gln at position 55, Glu at position 61 and Val at position 64, numbered according to SEQ ID NO: 39, optionally wherein numbered according to SEQ ID NO: 39, the VH region comprises Gln at position 55 and Glu at position 61.
[0337] E94. The isolated antibody or antigen-binding fragment thereof according to embodiment E90 or E92, which further comprises a VL region comprising the amino acid sequence of SEQ ID NO: 47, wherein numbered according to SEQ ID NO: 47, one or more amino acid residues of said SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, Y55A, M56A, N58S, A60Q, M94Q, L97Y, F101L, F101W and Q105G or any combination thereof, optionally wherein one or more amino acid residues of said SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, M56A, N58S, M94Q, L97Y and Q105G.
[0338] E95. The isolated antibody or antigen-binding fragment thereof according to embodiment E91 or E93, which further comprises a VL region comprising at least one of the following:
[0339] (a) Ser at position 30,
[0340] (b) Ala at position 55,
[0341] (c) Ala at position 56,
[0342] (d) Ser at position 58,
[0343] (e) Gln at position 60,
[0344] (f) Gln at position 94,
[0345] (g) Tyr at position 97,
[0346] (h) Leu at position 101,
[0347] (i) Trp at position 101, and
[0348] (j) Gly at position 105, numbered according to SEQ ID NO:47, optionally wherein the VL region comprises at least one of the following:
[0349] (a) Ser at position 30,
[0350] (b) Ala at position 56,
[0351] (c) Ser at position 58,
[0352] (d) Gln at position 94,
[0353] (e) Tyr at position 97, and
[0354] (f) Gly at position 105.
[0355] E96. The isolated antibody or antigen-binding fragment thereof according to embodiment E94, wherein numbered according to SEQ ID NO:47, SEQ ID NO:47 comprises L30S, M56A, N58S, M94Q, L97Y and / or Q105G substitutions.
[0356] E97. The isolated antibody or antigen-binding fragment thereof according to embodiment E95, wherein numbered according to SEQ ID NO:47, the VL region comprises Ser at position 30, Ala at position 56, Ser at position 58, Gln at position 94, Tyr at position 97 and / or Gly at position 105.
[0357] E98. The isolated antibody or antigen-binding fragment thereof according to embodiment E94, wherein numbered according to SEQ ID NO:47, SEQ ID NO:47 comprises L30S, N58S, M94Q and / or Q105G substitutions, optionally wherein SEQ ID NO:47 comprises all of the L30S, N58S, M94Q and Q105G substitutions.
[0358] The isolated antibody or antigen-binding fragment thereof according to embodiment E95, wherein, numbered according to SEQ ID NO: 47, the VL region comprises Ser at position 30, Ser at position 58, Gln at position 94, and / or Gly at position 105, optionally wherein the VL region comprises all of the following: Ser at position 30, Ser at position 58, Gln at position 94, and Gly at position 105.
[0359] E100. The isolated antibody or antigen-binding fragment thereof according to embodiment E94, wherein, numbered according to SEQ ID NO: 39, SEQ ID NO: 39 comprises N55Q and D61E substitutions, and, numbered according to SEQ ID NO: 47, SEQ ID NO: 47 comprises L30S, N58S, M94Q, and Q105G substitutions.
[0360] E101. The isolated antibody or antigen-binding fragment thereof according to embodiment E95, wherein, numbered according to SEQ ID NO: 39, the VH region comprises Gln at position 55 and Glu at position 61, and, numbered according to SEQ ID NO: 47, the VL region comprises Ser at position 30, Ser at position 58, Gln at position 94, and Gly at position 105.
[0361] E102. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a VL region having the amino acid sequence of SEQ ID NO: 47, wherein, numbered according to SEQ ID NO: 47, one or more amino acid residues of said SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, Y55A, M56A, N58S, A60Q, M94Q, L97Y, F101L, F101W, and Q105G, or any combination thereof (e.g., all of L30S, M56A, N58S, M94Q, L97Y, and Q105G), optionally wherein one or more amino acid residues of said SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, M56A, N58S, M94Q, L97Y, and Q105G.
[0362] E103. The isolated antibody or antigen-binding fragment thereof according to embodiment E102, wherein, numbered according to SEQ ID NO: 47, SEQ ID NO: 47 comprises L30S, N58S, M94Q, and / or Q105G substitutions.
[0363] The isolated antibody or antigen-binding fragment thereof according to embodiment E102, further comprising a VH region comprising the amino acid sequence of SEQ ID NO:39, wherein, numbered according to SEQ ID NO:39, the sequence of SEQ ID NO:39 comprises one or more amino acid substitutions selected from K30A, N55Q, N57Q, D61E, P62A, K63A and F64V or any combination thereof.
[0364] E105. The isolated antibody or antigen-binding fragment thereof according to embodiment E104, wherein the SEQ ID NO:39 comprises N55Q and D61E substitutions.
[0365] E106. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, comprising a heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2 or 3.
[0366] E107. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, further comprising a light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:5.
[0367] E108. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:6 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:7.
[0368] E109. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or 3 and a light chain comprising the amino acid sequence of SEQ ID NO:5.
[0369] E110. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0370] (a) a light chain comprising the amino acid sequence of SEQ ID NO:5 and
[0371] (b) a heavy chain comprising the amino acid sequence of SEQ ID NO:3, with or without a C-terminal lysine residue.
[0372] E111. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain containing an amino acid sequence encoded by the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124917, a light chain containing an amino acid sequence encoded by the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124918, or both.
[0373] E112. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to SEQ ID NO:2 or 3, optionally wherein the heavy chain comprises the amino acid sequence of SEQ ID NO:2.
[0374] E113. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a light chain containing an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to SEQ ID NO:5, optionally wherein the light chain comprises the amino acid sequence of SEQ ID NO:5, and optionally wherein the isolated antibody or antigen-binding fragment further comprises a heavy chain containing the amino acid sequence of SEQ ID NO:2.
[0375] E114. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain containing the amino acid sequence of SEQ ID NO:2 and a light chain containing the amino acid sequence of SEQ ID NO:5.
[0376] E115. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain containing the amino acid sequence of SEQ ID NO:3 and a light chain containing the amino acid sequence of SEQ ID NO:5.
[0377] E116. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0378] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0379] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0380] The CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0381] The CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0382] The CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0383] The CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0384] wherein the antibody further comprises a VH framework region (e.g., one, two, three, or all four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity with the VH framework region of a VH region comprising the amino acid sequence of any one of SEQ ID NO:6, 34 - 46, 88 - 91, or 93, or having at least one but fewer than twenty alterations, such as amino acid substitutions or deletions in the amino acid sequence of the entire VH framework region (including FR1, FR2, FR3, and FR4).
[0385] E117. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0386] The CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0387] The CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0388] The CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0389] The CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0390] The CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0391] The CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0392] The antibody further comprises a VL framework region (e.g., FR1, FR2, FR3, or FR4) that comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VL framework region of the VL region having an amino acid sequence of any one of SEQ ID NO: 7, 47 - 69, or 92, or having at least one, two, three, four, five, six, seven, ten, fifteen, but less than twenty alterations, such as amino acid substitutions or deletions of the amino acid sequence of the entire VL framework region (including FR1, FR2, FR3, and FR4).
[0393] E118. An isolated antibody or antigen - binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0394] CDR - H1 comprising the amino acid sequence of SEQ ID NO: 22,
[0395] CDR - H2 comprising the amino acid sequence of SEQ ID NO: 23,
[0396] CDR - H3 comprising the amino acid sequence of SEQ ID NO: 24,
[0397] CDR - L1 comprising the amino acid sequence of SEQ ID NO: 25,
[0398] CDR - L2 comprising the amino acid sequence of SEQ ID NO: 26, and
[0399] CDR - L3 comprising the amino acid sequence of SEQ ID NO: 27; and
[0400] wherein the antibody comprises a VH framework region (e.g., FR1, FR2, FR3, or FR4) that comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the VH framework region within the germline amino acid sequence of IGHV3 - 07, IGHV1 - 46, IGHV3 - 23, IGHV3 - 30, IGHV1 - 69, or IGHV3 - 48, or having at least one, two, three, four, five, six, seven, ten, fifteen, but less than twenty alterations, such as amino acid substitutions or deletions of the amino acid sequence of the entire VH framework region (including FR1, FR2, FR3, and FR4).
[0401] E119. An isolated antibody or antigen - binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0402] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0403] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0404] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0405] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0406] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0407] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0408] wherein said antibody comprises a VH region comprising a variant of the germline VH amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69 or IGHV3-48, wherein, as numbered according to the amino acid sequence of SEQ ID NO:127, the VH region comprises a substitution at one or more positions T28, F29, A49, R71, N73, A74 and / or L78 (e.g., one or more substitutions selected from T28N, F29I, A49G, R72A, N74T, A75S and L79A), optionally wherein the VH region comprises the following substitutions:
[0409] (i) T28N and F29I;
[0410] (ii) T28N, F29I and R72A;
[0411] (iii) T28N, F29I, R72A, A49G and L79A;
[0412] (iv) T28N, F29I, R72A, N74T and A75S; or
[0413] (v) T28N, F29I, R72A, A49G, L79A, N74T and A75S,
[0414] wherein (i)-(v) are numbered according to the amino acid sequence of SEQ ID NO:127, optionally wherein:
[0415] As numbered according to the amino acid sequence of SEQ ID NO:127, the VH region comprises the substitutions T28N, F29I, R72A, A49G, L79A, N74T and A75S.
[0416] E120. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0417] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0418] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0419] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0420] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0421] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0422] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0423] wherein the antibody comprises a VH region comprising one or more (e.g., 2, 3, 4, 5, 6, or all) of the following:
[0424] (a) Asn at position 28,
[0425] (b) Ile at position 29,
[0426] (c) Gly at position 49,
[0427] (d) Ala at position 72,
[0428] (e) Thr at position 74,
[0429] (f) Ser at position 75, and
[0430] (g) Ala at position 79, numbered according to the amino acid sequence of SEQ ID NO:127, optionally wherein the VH region comprises:
[0431] (i) Asn at position 28 and Ile at position 29;
[0432] (ii) Asn at position 28, Ile at position 29, and Ala at position 72;
[0433] (iii) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, and Ala at position 79;
[0434] (iv) Asn at position 28, Ile at position 29, Ala at position 72, Thr at position 74, and Ser at position 75; or
[0435] (v) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75, numbered according to the amino acid sequence of SEQ ID NO:127, optionally wherein:
[0436] Numbered according to the amino acid sequence of SEQ ID NO:127, the VH region comprises Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75.
[0437] E121. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0438] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0439] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0440] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0441] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0442] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0443] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0444] wherein the antibody comprises a VL framework region (e.g., FR1, FR2, FR3, or FR4) that comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11, or an amino acid sequence having at least one, two, three, four, five, six, seven, ten, fifteen but less than twenty alterations, such as amino acid substitutions or deletions in the amino acid sequence of the entire VL framework region (including FR1, FR2, FR3, and FR4).
[0445] E122. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0446] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0447] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0448] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0449] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0450] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0451] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0452] wherein said antibody comprises a VL region that comprises a variant of the germline VL amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1 or IGKV3-11, wherein, as numbered according to the amino acid sequence of SEQ ID NO:128, the VL region comprises one or more substitutions at positions Y36 and / or L46 (e.g., Y36F and / or L46R), optionally wherein the VL region comprises the following substitutions:
[0453] (i) L46R; or
[0454] (ii) L46R and Y36F,
[0455] wherein (i) and (ii) are numbered according to the amino acid sequence of SEQ ID NO:128, optionally wherein, as numbered according to the amino acid sequence of SEQ ID NO:128, the VL region comprises the substitution L46R.
[0456] E123. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0457] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0458] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0459] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0460] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0461] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0462] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0463] wherein the antibody comprises a VL region containing one or both of the following:
[0464] (a) Tyr at position 36, and
[0465] (b) Leu at position 46, numbered according to the amino acid sequence of SEQ ID NO:128, optionally wherein the VL region comprises:
[0466] (i) Leu at position 46; or
[0467] (ii) Leu at position 46 and Tyr at position 36, numbered according to the amino acid sequence of SEQ ID NO:128, optionally wherein:
[0468] numbered according to the amino acid sequence of SEQ ID NO:128, the VL region comprises Leu at position 46.
[0469] E124. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0470] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0471] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0472] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0473] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0474] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0475] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0476] It further comprises a murine IgG1 Fc region, numbered according to the Eu numbering scheme, said murine IgG1 Fc region comprising, for example, one or more substitutions selected from positions E233, E318, K320 and R322 (e.g., E233P, E318A, K320A and R322A) relative to the murine IgG1 Fc set forth in Table 1.
[0477] The isolated antibody or antigen-binding fragment thereof according to embodiment E124, wherein, numbered according to the Eu numbering scheme, said murine IgG1 Fc region comprises the E233P, E318A, K320A and R322A substitutions relative to the murine IgG1 Fc set forth in Table 1.
[0478] E126. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0479] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0480] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0481] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0482] CDR-L1 comprising the amino acid sequence of SEQ ID NO:25,
[0483] CDR-L2 comprising the amino acid sequence of SEQ ID NO:26, and
[0484] CDR-L3 comprising the amino acid sequence of SEQ ID NO:27; and
[0485] It further comprises a human IgG1 Fc region, numbered according to the Eu numbering scheme, said human IgG1 Fc region comprising, for example, one or more substitutions selected from positions L234, L235 and G237 (e.g., L234A, L235A and G237A) relative to the human IgG1 Fc set forth in Table 1.
[0486] The isolated antibody or antigen-binding fragment thereof according to embodiment E126, wherein, numbered according to the Eu numbering scheme, said human IgG1 Fc region comprises the L234A, L235A and G237A substitutions relative to the human IgG1 Fc set forth in Table 1.
[0487] E128. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0488] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0489] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0490] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0491] CDR-L1 comprising the amino acid sequence of SEQ ID NO:71,
[0492] CDR-L2 comprising the amino acid sequence of SEQ ID NO:72, and
[0493] CDR-L3 comprising the amino acid sequence of SEQ ID NO:73; and
[0494] wherein said antibody further comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VH framework region of a VH region comprising the amino acid sequence of any one of SEQ ID NO:6, 34-46, 88-91, or 93.
[0495] E129. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0496] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0497] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0498] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0499] CDR-L1 comprising the amino acid sequence of SEQ ID NO:71,
[0500] CDR-L2 comprising the amino acid sequence of SEQ ID NO:72, and
[0501] CDR-L3 comprising the amino acid sequence of SEQ ID NO:73; and
[0502] Wherein the antibody further comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), which comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VL framework region of the VL region comprising the amino acid sequence of any one of SEQ ID NO: 7, 47 - 69, or 92.
[0503] E130. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0504] CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22,
[0505] CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23,
[0506] CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24,
[0507] CDR-L1 comprising the amino acid sequence of SEQ ID NO: 71,
[0508] CDR-L2 comprising the amino acid sequence of SEQ ID NO: 72, and
[0509] CDR-L3 comprising the amino acid sequence of SEQ ID NO: 73; and
[0510] Wherein the antibody further comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4), which comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the VH framework region within the germline amino acid sequence of IGHV3 - 07, IGHV1 - 46, IGHV3 - 23, IGHV3 - 30, IGHV1 - 69, or IGHV3 - 48.
[0511] E131. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0512] CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22,
[0513] CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23,
[0514] CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24,
[0515] A CDR-L1 comprising the amino acid sequence of SEQ ID NO:71,
[0516] a CDR-L2 comprising the amino acid sequence of SEQ ID NO:72, and
[0517] a CDR-L3 comprising the amino acid sequence of SEQ ID NO:73; and
[0518] wherein said antibody further comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11.
[0519] E132. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0520] a CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0521] a CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0522] a CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0523] a CDR-L1 comprising the amino acid sequence of SEQ ID NO:71,
[0524] a CDR-L2 comprising the amino acid sequence of SEQ ID NO:72, and
[0525] a CDR-L3 comprising the amino acid sequence of SEQ ID NO:73; and
[0526] it further comprises a murine IgG1 Fc region, numbered according to the Eu numbering scheme, said murine IgG1 Fc region comprising, for example, one or more substitutions selected from positions E233, E318, K320, and R322 (e.g., E233P, E318A, K320A, and R322A) relative to the murine IgG1 Fc set forth in Table 1.
[0527] The isolated antibody or antigen-binding fragment thereof according to embodiment E132, wherein, when numbered according to the EU numbering scheme, the murine IgG1 Fc region contains, for example, E233P, E318A, K320A and R322A substitutions relative to the murine IgG1 Fc set forth in Table 1.
[0528] E134. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0529] CDR-H1 comprising the amino acid sequence of SEQ ID NO:22,
[0530] CDR-H2 comprising the amino acid sequence of SEQ ID NO:23,
[0531] CDR-H3 comprising the amino acid sequence of SEQ ID NO:24,
[0532] CDR-L1 comprising the amino acid sequence of SEQ ID NO:71,
[0533] CDR-L2 comprising the amino acid sequence of SEQ ID NO:72, and
[0534] CDR-L3 comprising the amino acid sequence of SEQ ID NO:73; and
[0535] It further comprises a human IgG1 Fc region which, when numbered according to the EU numbering scheme, contains, for example, L234A, L235A and G237A substitutions relative to the human IgG1 Fc set forth in Table 1.
[0536] E135. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0537] CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0538] CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0539] CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0540] CDR-L1 comprising the amino acid sequence of SEQ ID NO:31,
[0541] CDR-L2 comprising the amino acid sequence of SEQ ID NO:32, and
[0542] A CDR-L3 comprising the amino acid sequence of SEQ ID NO:33; and
[0543] wherein the antibody further comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VH framework region of a VH region comprising the amino acid sequence of any one of SEQ ID NO:6, 34-46, 88-91, or 93.
[0544] E136. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0545] A CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0546] A CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0547] A CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0548] A CDR-L1 comprising the amino acid sequence of SEQ ID NO:74,
[0549] A CDR-L2 comprising the amino acid sequence of SEQ ID NO:75, and
[0550] A CDR-L3 comprising the amino acid sequence of SEQ ID NO:76; and
[0551] wherein the antibody further comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VH framework region of a VH region comprising the amino acid sequence of any one of SEQ ID NO:6, 34-46, 88-91, or 93.
[0552] E137. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0553] A CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0554] A CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0555] The CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0556] The CDR-L1 comprising the amino acid sequence of SEQ ID NO:31,
[0557] The CDR-L2 comprising the amino acid sequence of SEQ ID NO:32, and
[0558] The CDR-L3 comprising the amino acid sequence of SEQ ID NO:33; and
[0559] wherein said antibody further comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) that comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to the VL framework region of a VL region comprising the amino acid sequence of any one of SEQ ID NO:7, 47-69, or 92.
[0560] E138. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0561] The CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0562] The CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0563] The CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0564] The CDR-L1 comprising the amino acid sequence of SEQ ID NO:31,
[0565] The CDR-L2 comprising the amino acid sequence of SEQ ID NO:32, and
[0566] The CDR-L3 comprising the amino acid sequence of SEQ ID NO:33; and
[0567] wherein said antibody further comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) that comprises an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48.
[0568] E139. An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising:
[0569] CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0570] CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0571] CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0572] CDR-L1 comprising the amino acid sequence of SEQ ID NO:31,
[0573] CDR-L2 comprising the amino acid sequence of SEQ ID NO:32, and
[0574] CDR-L3 comprising the amino acid sequence of SEQ ID NO:33; and
[0575] wherein the antibody further comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11.
[0576] E140. An isolated antibody or antigen-binding fragment thereof, comprising:
[0577] CDR-H1 comprising the amino acid sequence of SEQ ID NO:28,
[0578] CDR-H2 comprising the amino acid sequence of SEQ ID NO:29,
[0579] CDR-H3 comprising the amino acid sequence of SEQ ID NO:30,
[0580] CDR-L1 comprising the amino acid sequence of SEQ ID NO:31,
[0581] CDR-L2 comprising the amino acid sequence of SEQ ID NO:32, and
[0582] CDR-L3 comprising the amino acid sequence of SEQ ID NO:33; and
[0583] It further comprises a human IgG1 Fc region which, when numbered according to the Eu numbering scheme, contains, relative to the human IgG1 Fc set forth in Table 1, one or more substitutions selected from positions L234, L235 and G237 (e.g., L234A, L235A and G237A).
[0584] E141. The isolated antibody or antigen-binding fragment thereof according to embodiment E140, wherein, when numbered according to the Eu numbering scheme, the human IgG1 Fc region contains L234A, L235A and G237A substitutions relative to the human IgG1 Fc set forth in Table 1.
[0585] E142. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody is a multispecific antibody (e.g., a bispecific antibody).
[0586] E143. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody is a multivalent antibody (e.g., a bivalent antibody).
[0587] E144. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody is a humanized antibody, a human antibody, a murine antibody, a chimeric antibody or a camel antibody.
[0588] E145. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin and comprises a VH region and a VL region, wherein the VH region and the VL region comprise the following amino acid sequences:
[0589] (i) SEQ ID NO:6 and 7, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0590] (ii) SEQ ID NO:34 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0591] (iii) SEQ ID NO:34 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0592] (iv) SEQ ID NO:34 and 66 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0593] (v) SEQ ID NO:34 and 63 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0594] (vi) SEQ ID NO:34 and 64 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0595] (vii) SEQ ID NO:37 and 65 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0596] (viii) SEQ ID NO:37 and 62 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0597] (ix) SEQ ID NO:37 and 66 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0598] (x) SEQ ID NO:37 and 63 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0599] (xi) SEQ ID NO:37 and 64 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0600] (xii) SEQ ID NO:36 and 65 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0601] (xiii) amino acid sequences that are SEQ ID NO:36 and 62 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0602] (xiv) amino acid sequences that are SEQ ID NO:36 and 66 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0603] (xv) amino acid sequences that are SEQ ID NO:36 and 63 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0604] (xvi) amino acid sequences that are SEQ ID NO:36 and 64 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0605] (xvii) amino acid sequences that are SEQ ID NO:35 and 65 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0606] (xviii) amino acid sequences that are SEQ ID NO:35 and 62 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0607] (xix) amino acid sequences that are SEQ ID NO:35 and 66 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0608] (xx) amino acid sequences that are SEQ ID NO:35 and 63 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0609] (xxi) amino acid sequences that are SEQ ID NO:35 and 64 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0610] (xxii) are the amino acid sequences of SEQ ID NO:38 and 65 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0611] (xxiii) are the amino acid sequences of SEQ ID NO:38 and 62 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0612] (xxiv) are the amino acid sequences of SEQ ID NO:38 and 66 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0613] (xxv) are the amino acid sequences of SEQ ID NO:38 and 63 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0614] (xxvi) are the amino acid sequences of SEQ ID NO:38 and 64 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0615] (xxvii) are the amino acid sequences of SEQ ID NO:20 and 21 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0616] (xxviii) are the amino acid sequences of SEQ ID NO:88 and 47 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0617] (xxix) are the amino acid sequences of SEQ ID NO:89 and 47 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0618] (xxx) are the amino acid sequences of SEQ ID NO:90 and 47 respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0619] (xxxi) are the amino acid sequences of SEQ ID NO: 90 and 92, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0620] (xxxii) are the amino acid sequences of SEQ ID NO: 39 and 47, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0621] (xxxiii) are the amino acid sequences of SEQ ID NO: 6 and 67, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0622] (xxxiv) are the amino acid sequences of SEQ ID NO: 6 and 68, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0623] (xxxv) are the amino acid sequences of SEQ ID NO: 6 and 69, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0624] (xxxvi) are the amino acid sequences of SEQ ID NO: 93 and 67, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0625] (xxxvii) are the amino acid sequences of SEQ ID NO: 93 and 68, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto;
[0626] (xxxviii) are the amino acid sequences of SEQ ID NO: 93 and 69, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; or
[0627] (xxxix) are amino acid sequences that are SEQ ID NO:93 and 7, respectively, or have at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto, optimally wherein:
[0628] The VH region and the VL region comprise the following amino acid sequences:
[0629] (i) are SEQ ID NO:6 and 7, respectively;
[0630] (ii) are SEQ ID NO:34 and 65, respectively;
[0631] (iii) are SEQ ID NO:34 and 62, respectively;
[0632] (iv) are SEQ ID NO:34 and 66, respectively;
[0633] (v) are SEQ ID NO:34 and 63, respectively;
[0634] (vi) are SEQ ID NO:34 and 64, respectively;
[0635] (vii) are SEQ ID NO:37 and 65, respectively;
[0636] (viii) are SEQ ID NO:37 and 62, respectively;
[0637] (ix) are SEQ ID NO:37 and 66, respectively;
[0638] (x) are SEQ ID NO:37 and 63, respectively;
[0639] (xi) are SEQ ID NO:37 and 64, respectively;
[0640] (xii) are SEQ ID NO:36 and 65, respectively;
[0641] (xiii) are SEQ ID NO:36 and 62, respectively;
[0642] (xiv) are SEQ ID NO:36 and 66, respectively;
[0643] (xv) are SEQ ID NO:36 and 63, respectively;
[0644] (xvi) are SEQ ID NO:36 and 64, respectively;
[0645] (xvii) are SEQ ID NO:35 and 65, respectively;
[0646] (xviii) are SEQ ID NO:35 and 62 respectively;
[0647] (xix) are SEQ ID NO:35 and 66 respectively;
[0648] (xx) are SEQ ID NO:35 and 63 respectively;
[0649] (xxi) are SEQ ID NO:35 and 64 respectively;
[0650] (xxii) are SEQ ID NO:38 and 65 respectively;
[0651] (xxiii) are SEQ ID NO:38 and 62 respectively;
[0652] (xxiv) are SEQ ID NO:38 and 66 respectively;
[0653] (xxv) are SEQ ID NO:38 and 63 respectively;
[0654] (xxvi) are SEQ ID NO:38 and 64 respectively;
[0655] (xxvii) are SEQ ID NO:20 and 21 respectively;
[0656] (xxviii) are SEQ ID NO:88 and 47 respectively;
[0657] (xxix) are SEQ ID NO:89 and 47 respectively;
[0658] (xxx) are SEQ ID NO:90 and 47 respectively;
[0659] (xxxi) are SEQ ID NO:90 and 92 respectively;
[0660] (xxxii) are SEQ ID NO:39 and 47 respectively;
[0661] (xxxiii) are SEQ ID NO:6 and 67 respectively;
[0662] (xxxiv) are SEQ ID NO:6 and 68 respectively;
[0663] (xxxv) are SEQ ID NO:6 and 69 respectively;
[0664] (xxxvi) are SEQ ID NO:93 and 67 respectively;
[0665] (xxxvii) are SEQ ID NO:93 and 68 respectively;
[0666] (xxxviii) are SEQ ID NO:93 and 69, respectively; or
[0667] (xxxix) are SEQ ID NO:93 and 7, respectively.
[0668] E146. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which comprises or has a heavy chain constant region (Fc) selected from heavy chain constant regions such as IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE.
[0669] E147. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, wherein the antibody is of an isotype selected from IgG1, IgG2, IgG3, IgG4, or any variant thereof.
[0670] E148. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, wherein the antibody comprises a heavy chain constant region of IgG1 or IgG2 (e.g., human IgG1 or human IgG2).
[0671] E149. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which comprises or has a heavy chain constant region of human IgG1.
[0672] E150. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which comprises or has a light chain constant region selected from light chain constant regions such as κ or λ.
[0673] E151. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which comprises or has a κ (e.g., human κ) light chain constant region.
[0674] E152. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which comprises an Fc region of a heavy chain having an altered hinge region to reduce effector cell function.
[0675] E153. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, which has reduced antibody-dependent cell cytotoxicity (ADCC) and / or reduced complement-dependent cell cytotoxicity (CDC).
[0676] E154. An isolated antibody or antigen-binding fragment thereof as described in any one of the foregoing embodiments, numbered according to the Eu numbering scheme, the isolated antibody or antigen-binding fragment, for example, comprises a hinge region having a substitution at at least one position of L234, L235, or G237 compared to human IgG1.
[0677] The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which comprises a human IgG1 Fc region, numbered according to the Eu numbering scheme, wherein the human IgG1 Fc region comprises at least one substitution selected from L234A, L235A and G237A.
[0678] E156. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which has a hinge region comprising the amino acid sequence EPKSCDKTHTCPPCPAPEAAGAP (SEQ ID NO:126).
[0679] E157. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which is altered to remove immunogenic T cell epitopes.
[0680] E158. The isolated antibody or antigen-binding fragment thereof according to embodiment E157, which comprises a VL, numbered according to SEQ ID NO:47, wherein the VL comprises at least one substitution selected from the group consisting of L30S, N58S, M56A, M94Q, L97Y and Q105G.
[0681] E159. The antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody or antigen-binding fragment has at least one of the following characteristics:
[0682] (i) The binding affinity for human αvβ8 integrin, expressed as KD, which is lower than that of the murine antibody ADWA11, for example lower than 536 pM;
[0683] (ii) The KD for human αvβ8 integrin, which is lower than or equal to 100 pM for purified human αvβ8 integrin;
[0684] (iii) The KD for murine αvβ8 integrin, which is lower than 100 pM;
[0685] (iv) The KD for cynomolgus monkey αvβ8 integrin, which is lower than 100 pM;
[0686] (v) The KD for rat αvβ8 integrin, which is approximately 160 pM;
[0687] (vi) Substantially equal affinities for at least two, three or all of human, cynomolgus monkey, murine and rat αvβ8 integrins, for example KD lower than 100 pM, for example as determined using a Biacore affinity assay;
[0688] (vii) The IC50 for inhibiting TGFβ transactivation, which is lower than 183 pM;
[0689] (viii) The IC50 for inhibiting TGFβ trans - activation in U251 cells, which is from about 100 pM to about 300 pM;
[0690] (ix) The EC50 for U251 cells, which is from about 100 pM to about 400 pM;
[0691] (x) The EC50 for C8 - S cells, which is from about 110 pM to about 180 pM;
[0692] (xi) At least one predicted human pharmacokinetic (PK) parameter selected from:
[0693] a. The clearance (CL) of the central compartment, which is from about 0.12 - 0.15 mL / h / kg;
[0694] b. The inter - compartmental clearance (CLF), which is from about 0.15 - 0.51 mL / h / kg;
[0695] c. The volume of distribution (V1) of the central compartment, which is from about 36 - 39 mL / kg;
[0696] d. The volume of distribution (V2) of the peripheral compartment, which is from about 21 - 33 mL / kg; and / or
[0697] e. The terminal half - life (t 1 / 2 ), which is from about 12 - 17 days; and
[0698] (xii) No detectable binding to human Fcγ receptors or C1q.
[0699] E160. The antibody or antigen - binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody or antigen - binding fragment has at least one of the following characteristics:
[0700] (i) Specifically binds to αvβ8 integrin without binding to other integrins;
[0701] (ii) Reduces the interaction between αvβ8 integrin and the latency - associated peptide (LAP);
[0702] (iii) Reduces TGF - β signaling;
[0703] (iv) Effectively blocks αvβ8 integrin - mediated TGFβ activation with an IC50 ≤ 10 nM;
[0704] (v) Has a comparable Kd (within 5 - fold) for non - human primate (NHP) orthologs;
[0705] (vi) selectively binds to human αvβ8 and undetectably binds to homologues of αvβ8 (e.g., αvβ1, αvβ3, αvβ5, and αvβ6);
[0706] (vii) causes growth inhibition and / or complete tumor regression in human subjects or animal models of cancer (e.g., squamous cell carcinoma, breast cancer, and / or colon cancer) when administered alone or in combination with an immunomodulator, e.g., a modulator of a checkpoint inhibitor, e.g., an inhibitor of PD-1, PD-L1, CTLA-4, or an agonist of a stimulatory molecule (e.g., 4-1BB);
[0707] (viii) causes growth inhibition and / or complete tumor regression in an animal model of cancer when combined with an anti-cancer therapy (e.g., radiotherapy);
[0708] (ix) shows at least a 60% reduction in tumor growth in a syngeneic tumor transplantation model when administered at ≤ 10 mg / kg, either alone or in combination with an immunomodulator (e.g., an inhibitor of PD-1, PD-L1, or CTLA-4);
[0709] (x) increases the anti-tumor response in the presence of one or more immunomodulators, e.g., an antagonist of a checkpoint inhibitor or an agonist of a checkpoint activator, e.g., an antagonist of PD-1, PD-L1, or CTLA-4, or an activator of the immune response, e.g., a 4-1BB agonist, when administered to a subject (e.g., a mouse or a human subject);
[0710] (xi) has efficacy independent of the expression of αvβ8 integrin in a tumor model;
[0711] (xii) can increase the abundance of CD8+GzmB+ T cells in the tumor microenvironment, e.g., as a single therapy;
[0712] (xiii) shows a reduction in tumor growth, e.g., at least > 80% reduction, in a syngeneic model of squamous cell carcinoma, breast cancer, and / or colon cancer when used in combination with an antagonist of a checkpoint inhibitor (e.g., an anti-PD-1 or anti-PD-L1 antibody);
[0713] (xiv) shows a statistically significant improvement in the overall survival rate of a subject as determined by Kaplan-Meier analysis;
[0714] (xv) shows a high degree of thermal stability;
[0715] (xvi) shows minimal aggregation at high concentrations; and
[0716] (xvii) can show reproducible expression and purity under large-scale preparation conditions.
[0717] The antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody or antigen-binding fragment thereof has at least one of the following characteristics:
[0718] (i) The binding affinity for human αvβ8 integrin expressed as KD is lower than the KD of the murine antibody ADWA11, for example, lower than 536 pM;
[0719] (ii) The KD for human αvβ8 integrin, the KD for purified human αvβ8 integrin is lower than or equal to 100 pM;
[0720] (iii) The KD for murine αvβ8 integrin is lower than 100 pM;
[0721] (iv) The KD for cynomolgus monkey αvβ8 integrin is lower than 100 pM;
[0722] (v) The KD for rat αvβ8 integrin is about 160 pM;
[0723] (vi) Substantially equal affinities for at least two, three, or all of human, cynomolgus monkey, murine, and rat αvβ8 integrins, for example, a KD lower than 100 pM, as determined using a Biacore affinity assay;
[0724] (vii) The IC50 for inhibiting TGFβ transactivation is lower than 183 pM;
[0725] (viii) The IC50 for inhibiting TGFβ transactivation in U251 cells is about 100 pM to about 300 pM;
[0726] (ix) The EC50 for U251 cells is about 126 pM, with a standard deviation of plus or minus 34 pM;
[0727] (x) The EC50 for U251 cells is about 256 pM, with a standard deviation of plus or minus 115 pM;
[0728] (xi) The EC50 for U251 cells is about 80 pM to about 400 pM;
[0729] (xii) The EC50 for C8-S cells is about 115 pM;
[0730] (xiii) The EC50 for C8-S cells is about 145 pM, with a standard deviation of plus or minus 23.7 pM;
[0731] (xiv) The EC50 for C8-S cells is about 110 pM to about 180 pM;
[0732] (xv) At least one predicted human pharmacokinetic (PK) parameter selected from:
[0733] a. Clearance (CL) of the central compartment, which is about 0.12 - 0.15 mL / h / kg;
[0734] b. Intercompartmental clearance (CLF), which is about 0.15 - 0.51 mL / h / kg;
[0735] c. Volume of distribution of the central compartment (V1), which is about 36 - 39 mL / kg;
[0736] d. Volume of distribution of the peripheral compartment (V2), which is about 21 - 33 mL / kg; and / or
[0737] e. Terminal half-life (t 1 / 2 ), which is about 12 - 17 days; and
[0738] (xvi) No detectable binding to human Fcγ receptors or C1q.
[0739] E162. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which binds to human αvβ8 integrin with a K D less than or equal to 100 pM to purified human αvβ8 integrin.
[0740] E163. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which binds to human αvβ8 integrin with a K D less than 536 pM.
[0741] E164. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which inhibits TGFβ activation with an IC50 less than 183 pM.
[0742] E165. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which inhibits TGFβ activation with an IC50 of 100 pM to about 300 pM.
[0743] E166. The isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which inhibits TGFβ activation in U251 cells with an IC50 of 199 + / - 93.6 pM.
[0744] E167. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments and a pharmaceutically acceptable carrier or excipient.
[0745] E168. A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof as described in any one of embodiments E1 to E166.
[0746] E169. A nucleic acid molecule comprising:
[0747] (i) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 1, 183, 189 or 191 and encoding a heavy chain;
[0748] (ii) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 190 and encoding a heavy chain variable region;
[0749] (iii) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 192 or 193 and encoding a heavy chain constant region; or
[0750] (iv) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with the nucleic acid sequence of the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124917.
[0751] E170. A nucleic acid molecule comprising:
[0752] (i) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 4 or 185 and encoding a light chain;
[0753] (ii) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 186 and encoding a light chain variable region;
[0754] (iii) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO: 194 and encoding a light chain constant region; or
[0755] (iv) A nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with the nucleic acid sequence of the insertion sequence of the plasmid deposited with ATCC and having the accession number PTA-124918.
[0756] E171. A nucleic acid molecule comprising a nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO:1 or 183 and a nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO:4.
[0757] E172. A nucleic acid molecule comprising a nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO:189 or 191 and a nucleotide sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity with SEQ ID NO:185.
[0758] E173. A vector comprising the nucleic acid molecule according to any one of embodiments E168 to E172.
[0759] E174. A host cell comprising the nucleic acid molecule according to any one of embodiments E168 to E172 or the vector according to embodiment E173.
[0760] E175. The host cell according to embodiment E174, wherein the host cell is a mammalian cell, such as a human cell.
[0761] E176. The host cell according to embodiment E175, wherein the host cell is a CHO cell, a COS cell, a HEK-293 cell, an NS0 cell, a cell or a Sp2.0 cell.
[0762] E177. A method for preparing an isolated antibody or an antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, the method comprising culturing the host cell according to any one of embodiments E174 to E176 under conditions in which the antibody or antigen-binding fragment is expressed by the host cell.
[0763] E178. The method according to embodiment E177, which further comprises isolating the antibody or its antigen-binding fragment.
[0764] E179. A method of reducing TGFβ signaling in a subject in need thereof, the method comprising administering to the subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to any one of embodiments E167.
[0765] E180. A method of reducing αvβ8 integrin activity in a subject in need thereof, the method comprising administering to the subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to embodiment E167.
[0766] E181. A method of treating a disease, disorder or condition associated with or mediated by abnormal (e.g., increased) TGFβ signaling, the method comprising administering to the subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to embodiment E167.
[0767] E182. A method of inducing an anti-tumor response in a subject, the method comprising administering to the subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to any one of embodiments E167, optionally wherein the antibody or antigen-binding fragment is administered in combination with a second therapy, optionally wherein the antibody or antigen-binding fragment is administered simultaneously with, sequentially or separately from the second therapy, optionally wherein:
[0768] (i) the antibody or antigen-binding fragment is administered before the second therapy, or
[0769] (ii) the antibody or antigen-binding fragment is administered after the second therapy.
[0770] E183. An antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to embodiment E167 for reducing the activity of αvβ8 integrin in a subject.
[0771] E184. A method of treating cancer, the method comprising administering to the subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or a pharmaceutical composition according to embodiment E167.
[0772] E185. The method according to embodiment E184, wherein the antibody or antigen-binding fragment has at least one of the following characteristics:
[0773] (i) Specifically binds to αvβ8 integrin (e.g., αvβ8 integrin from human, mouse, cynomolgus monkey, and / or rat);
[0774] (ii) Reduces the interaction between αvβ8 integrin and latent associated peptide (LAP);
[0775] (iii) Reduces TGF-β signaling;
[0776] (iv) Blocks αvβ8 integrin-mediated TGFβ activation with an IC50 ≤ 10 nM;
[0777] (v) Has a comparable Kd (within 5-fold) for non-human primate (NHP) orthologs;
[0778] (vi) Selectively binds to human αvβ8 and binds undetectably to homologs of αvβ8 (e.g., αvβ1, αvβ3, αvβ5, and αvβ6);
[0779] (vii) Causes growth inhibition and / or complete tumor regression in animal models of cancers selected from, e.g., squamous cell carcinoma, breast cancer, and colon cancer, alone or in combination with an immunomodulator, e.g., a modulator of a checkpoint inhibitor, e.g., an inhibitor of PD-1, CTLA-4, or an agonist of a stimulatory molecule (e.g., 4-1BB);
[0780] (viii) Causes growth inhibition and / or complete tumor regression in animal models of cancer in combination with an anticancer therapy (e.g., radiotherapy);
[0781] (ix) Shows at least a 60% reduction in tumor growth in a syngeneic tumor transplantation model, e.g., when administered at ≤ 10 mg / kg;
[0782] (x) Increases the anti-tumor response in the presence of one or more immunomodulators, e.g., an antagonist of a checkpoint inhibitor, e.g., an antagonist of PD-1 or CTLA-4, or an activator of the immune response, e.g., a 4-1BB agonist, when administered to a subject (e.g., a mouse or a human subject);
[0783] (xi) Has efficacy independent of the expression of αvβ8 integrin in the tumor model;
[0784] (xiii) Is sufficient to increase the abundance of CD8+ GzmB+ T cells in the tumor microenvironment, e.g., as a single therapy;
[0785] (xiii) Shows at least an 80% reduction in tumor growth in a syngeneic model of squamous cell carcinoma, breast cancer, and / or colon cancer when used in combination with an antagonist of a checkpoint inhibitor (e.g., an anti-PD-1 or anti-PD-L1 antibody);
[0786] (xiv) showing a statistically significant improvement in the overall survival rate of a subject (such as a human or a mouse) as determined by Kaplan-Meier analysis;
[0787] (xv) showing a high degree of thermal stability;
[0788] (xvi) showing minimal aggregation at high concentrations; and
[0789] (xvii) showing reproducible expression and purity under large-scale preparation conditions.
[0790] The method according to embodiment E184 or E185, wherein the antibody or its antigen-binding fragment has at least one of the following characteristics:
[0791] (i) The binding affinity for human αvβ8 integrin expressed as KD, which is lower than the KD of the murine antibody ADWA11, for example lower than 536 pM;
[0792] (ii) The KD for human αvβ8 integrin, which is lower than or equal to 100 pM for purified human αvβ8 integrin;
[0793] (iii) The KD for murine αvβ8 integrin, which is lower than 100 pM;
[0794] (iv) The KD for cynomolgus monkey αvβ8 integrin, which is lower than 100 pM;
[0795] (v) The KD for rat αvβ8 integrin, which is about 160 pM;
[0796] (vi) Showing substantially equal affinity for at least two, three, or all of human, cynomolgus monkey, murine, and rat αvβ8 integrins, for example a KD lower than 100 pM, for example as determined using a Biacore affinity assay;
[0797] (vii) The IC50 for inhibiting TGFβ transactivation, which is lower than 183 pM;
[0798] (viii) The IC50 for inhibiting TGFβ transactivation in U251 cells, which is about 199 + / - 93.6 pM;
[0799] (ix) The IC50 for inhibiting TGFβ transactivation, which is about 100 pM to about 300 pM;
[0800] (x) The EC50 for U251 cells, which is about 126 pM, with a standard deviation of plus or minus 34 pM;
[0801] (xi) The EC50 for U251 cells, which is about 256 pM, with a standard deviation of plus or minus 115 pM;
[0802] (xii) The EC50 for U251 cells, which is from about 80 pM to about 400 pM;
[0803] (xiii) The EC50 for C8-S cells, which is about 115 pM;
[0804] (xiv) The EC50 for C8-S cells, which is about 145 pM, with a standard deviation of plus or minus 23.7 pM;
[0805] (xv) The EC50 for C8-S cells, which is from about 110 pM to about 180 pM;
[0806] (xvi) At least one predicted human pharmacokinetic (PK) parameter selected from:
[0807] a. The clearance (CL) of the central compartment, which is about 0.12 - 0.15 mL / h / kg;
[0808] b. The intercompartmental clearance (CLF), which is about 0.15 - 0.51 mL / h / kg;
[0809] c. The volume of distribution (V1) of the central compartment, which is about 36 - 39 mL / kg;
[0810] d. The volume of distribution (V2) of the peripheral compartment, which is about 21 - 33 mL / kg; and / or
[0811] e. The terminal half-life (t 1 / 2 ), which is about 12 - 17 days; and
[0812] (xvii) Showing no detectable binding to human Fcγ receptor or C1q.
[0813] E187. The method according to any one of embodiments E184 to E186, wherein the antibody or its antigen-binding fragment is the pharmaceutical composition according to any one of embodiments E1 to E166 or embodiment E167.
[0814] E188. The method according to any one of embodiments E184 to E187, wherein the antibody or its antigen-binding fragment is administered in an amount sufficient to increase the infiltration of CD45+ cells, CD3+ T cells, CD4+ T cells, CD8+ T cells, and / or granzyme B-expressing cells.
[0815] The method according to any one of embodiments E184 to E188, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase the infiltration of CD8+ T cells.
[0816] E190. The method according to any one of embodiments E184 to E189, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase the expression of granzyme B on CD8+ T cells.
[0817] E191. The method according to any one of embodiments E184 to E190, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase the accumulation of inflammatory macrophages having an elevated Ly6G expression level.
[0818] E192. The method according to any one of embodiments E184 to E191, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase the accumulation of CD45+CD11b+CD11c-Ly6G-Ly6C 高 CD206 低 inflammatory macrophages.
[0819] E193. The method according to any one of embodiments E184 to E192, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase the response to a second therapy.
[0820] E194. The method according to any one of embodiments E184 to E193, wherein when administered to an animal tumor model, the efficacy of the antibody or antigen-binding fragment thereof is independent of the expression of αvβ8 integrin in the tumor model.
[0821] E195. The method according to any one of embodiments E184 to E194, wherein the antibody or antigen-binding fragment thereof is administered in combination with a second therapy.
[0822] E196. The method according to embodiment E195, wherein the second therapy comprises an anti-cancer therapy, a cytotoxic agent or a cell growth inhibitor, such as a chemotherapeutic agent, a hormone therapy, a vaccine and / or an immunotherapy.
[0823] E197. The method according to embodiment E195 or E196, wherein the second therapy is or comprises surgery, radiation, cryosurgery and / or thermotherapy.
[0824] The method according to any one of embodiments E195 to E197, wherein the second therapy comprises a modulator of an immune checkpoint molecule, such as an inhibitor or an agonist, optionally wherein the second therapy is or comprises a modulator of an immune checkpoint molecule selected from the group consisting of: PD1, PD-L1, 4-1BB, OX40, CTLA-4, PD-L2, TIM-3, LAG-3, VISTA, CD160, BTLA, TIGIT, 2B4, TGFβ, LAIR1, and combinations thereof.
[0825] E199. The method according to embodiment E198, wherein the inhibitor of the immune checkpoint molecule is an inhibitor of PD1, PD-L1, CTLA-4, PD-L2, TIM-3, LAG-3, VISTA, BTLA, TIGIT, 2B4, TGFβ, or LAIR1.
[0826] E200. The method according to embodiment E199, wherein the inhibitor of the immune checkpoint molecule is an inhibitor of PD1, such as an anti-PD1 antibody.
[0827] E201. The method according to embodiment E199, wherein the inhibitor of the immune checkpoint molecule is an inhibitor of CTLA-4, such as an anti-CTLA-4 antibody or a soluble CTLA-4 fusion.
[0828] E202. The method according to any one of embodiments E195 to E201, wherein the second therapy comprises an agonist of a co-stimulatory molecule.
[0829] E203. The method according to embodiment E202, wherein the agonist of the co-stimulatory molecule is selected from at least one of the following: 4-1BB (CD137), OX40, CD2, CD27, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), GITR, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, or B7-H3.
[0830] E204. The method according to embodiment E202, wherein the agonist of the co-stimulatory molecule is a 41-BB agonist.
[0831] The method according to embodiments E195 to E204, wherein the second therapy comprises an inhibitor of PARP1 (for example, olaparib, rucaparib, niraparib, veliparib, iniparib, talazoparib, 3-aminobenzamide, CEP9722, E7016, BSI-201, KU-0059436, AG014699, MK-4827 or BGB-290).
[0832] E206. The method according to embodiments E184 to E205, wherein the cancer is selected from the group consisting of: solid tumors, blood cancers (for example, leukemia, lymphoma, myeloma, such as multiple myeloma), and metastatic lesions.
[0833] E207. The method according to embodiment E206, wherein the cancer is a solid tumor.
[0834] E208. The method according to embodiment E206 or E207, wherein the cancer is a solid tumor and is selected from malignant tumors, such as sarcomas and carcinomas, such as adenocarcinomas of various organ systems, such as those affecting the lung (for example, non-small cell lung cancer (NSCLC)), breast, ovary, lymph, gastrointestinal tract (for example, colon), anus, genital and urogenital tract (for example, kidney, urothelial, bladder cells, prostate), pharynx, CNS (for example, brain, nerve or glial cells), head and neck (for example, head and neck squamous cell carcinoma (HNSCC), skin (for example, melanoma, such as advanced melanoma), pancreas, colon, rectum, kidney (for example, renal cell carcinoma), liver adenocarcinoma, small intestine cancer and esophageal cancer, gastroesophageal cancer, thyroid cancer and cervical cancer.
[0835] E209. The method according to any one of embodiments E184 to E208, wherein the cancer is a lymphoproliferative disorder (for example, post-transplant lymphoproliferative disorder) or a blood cancer, T-cell lymphoma, B-cell lymphoma, non-Hodgkin lymphoma or leukemia (for example, myeloid leukemia or lymphoid leukemia).
[0836] E210. The method according to any one of embodiments E184 to E209, wherein the cancer is early-stage, mid-stage, late-stage or metastatic cancer.
[0837] E211. The method according to any one of embodiments E184 to E210, wherein the cancer is selected from the group consisting of: renal cell carcinoma, ovarian cancer and head and neck squamous cell carcinoma.
[0838] The method according to embodiment E211, further comprising administering an inhibitor of a checkpoint inhibitor, such as an inhibitor of PD-1, PD-L1 or CTLA-4.
[0839] E213. The method according to embodiment E212, wherein the inhibitor of PD-L1 is not avelumab.
[0840] E214. The method according to embodiment E211 or E212, wherein the cancer is renal cancer, such as renal cell carcinoma (RCC).
[0841] E215. The method according to embodiment E214, wherein the renal cancer is a renal cancer selected from the group consisting of metastatic RCC, clear cell renal cell carcinoma (ccRCC), non-clear cell renal cell carcinoma (ncRCC), and high-risk renal cell carcinoma.
[0842] E216. The method according to embodiment E215, wherein the antibody or antigen-binding fragment thereof is administered as a first-line or second-line therapy.
[0843] E217. The method according to any one of embodiments E184 to E216, wherein the antibody or antigen-binding fragment thereof is administered as a first-line therapy.
[0844] E218. The method according to any one of embodiments E184 to E216, wherein the antibody or antigen-binding fragment thereof is administered as a second-line therapy.
[0845] E219. The method according to any one of embodiments E184 to E212, wherein the cancer is ovarian cancer.
[0846] E220. The method according to embodiment E219, wherein the second therapy is an inhibitor of PARP1 (e.g., olaparib, rucaparib, niraparib, veliparib, iniparib, talazoparib, 3-aminobenzamide, CEP 9722, E7016, BSI-201, KU-0059436, AG014699, MK-4827 or BGB-290).
[0847] E221. The method according to embodiment E219, wherein the antibody or antigen-binding fragment thereof is administered as a second-line therapy, optionally wherein the subject is platinum-resistant.
[0848] E222. The method according to embodiment E219, wherein the antibody or antigen-binding fragment thereof is administered as a first-line therapy.
[0849] The method according to any one of embodiments E184 to E222, wherein the cancer is squamous cell carcinoma of the head and neck.
[0850] E224. The method according to embodiment E223, wherein the method further comprises administering radiation therapy.
[0851] E225. The method according to embodiment E223 or E224, wherein the cancer is platinum-resistant and / or recurrent cancer.
[0852] E226. The method according to any one of embodiments E179 to E225, wherein the subject is human.
[0853] E227. The method according to any one of embodiments E179 to E226, which comprises intravenously administering the antibody or its antigen-binding fragment or the pharmaceutical composition.
[0854] E228. The method according to any one of embodiments E179 to E227, which comprises subcutaneously administering the antibody or its antigen-binding fragment or the pharmaceutical composition.
[0855] E229. The method according to any one of embodiments E179 to E228, wherein the antibody or its antigen-binding fragment or the pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months or once every twelve months.
[0856] E230. The method according to any one of embodiments E179 to E229, wherein the antibody or its antigen-binding fragment is administered every two weeks, for example up to 12 times (for example, up to 10, 8, 6, 5, 4 or 3 times).
[0857] E231. The method according to embodiment E230, wherein each administration comprises 5 - 10 mg / kg (for example, 5, 6, 7, 8, 9 or 10 mg / kg) of the antibody or its antigen-binding fragment.
[0858] E232. The method according to embodiment E231, wherein each administration comprises about 7 mg / kg.
[0859] E233. The method according to any one of embodiments E179 to E229, wherein the antibody or its antigen-binding fragment is administered every four weeks, for example up to 6 times (for example, up to 6, 5, 4, 3, 2 or 1 time).
[0860] The method according to embodiment E233, wherein each administration comprises 10-15 mg / kg (e.g., 10, 11, 12, 13, 14, or 15 mg / kg) of said antibody or antigen-binding fragment thereof.
[0861] The method according to embodiment E234, wherein each administration comprises about 12 mg / kg.
[0862] E236. A method of detecting ανβ8 integrin (e.g., human ανβ8 integrin) in a sample, tissue, or cell using the antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or the pharmaceutical composition according to embodiment E167, the method comprising contacting the sample, tissue, or cell with the antibody and detecting the antibody.
[0863] E237. A kit comprising the antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or the pharmaceutical composition according to embodiment E167.
[0864] The antibody or antigen-binding fragment thereof according to any one of embodiments E1 to E166 or the pharmaceutical composition according to embodiment E167, which is used as a drug, for example, in any one of the method embodiments described herein.
[0865] E239. An isolated antibody or antigen-binding fragment thereof that specifically binds to ανβ8 integrin, wherein the antibody or fragment is at least one antibody or fragment selected from the group consisting of:
[0866] (a) An antibody or antigen-binding fragment thereof comprising: a light chain complementarity-determining region 1 (CDR-L1) comprising the amino acid sequence of SEQ ID NO:11; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:12; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:13; a heavy chain CDR1 (CDR-H1) comprising the amino acid sequence of SEQ ID NO:8; a CDR-H2 comprising the amino acid sequence of SEQ ID NO:9; and a CDR-H3 comprising the amino acid sequence of SEQ ID NO:10;
[0867] (b) An antibody or an antigen-binding fragment thereof comprising: CDR-L1 comprising the amino acid sequence of SEQ ID NO:17; CDR-L2 comprising the amino acid sequence of SEQ ID NO:18; CDR-L3 comprising the amino acid sequence of SEQ ID NO:19; CDR-H1 comprising the amino acid sequence of SEQ ID NO:14; CDR-H2 comprising the amino acid sequence of SEQ ID NO:15; and CDR-H3 comprising the amino acid sequence of SEQ ID NO:16;
[0868] (c) An antibody or an antigen-binding fragment thereof comprising a variable light chain (VL) region and a variable heavy chain (VH) region, wherein the VL region comprises the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC and having the deposit number PTA-124918, and the VH region comprises the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC and having the deposit number PTA-124917;
[0869] (d) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region comprises the amino acid sequence of SEQ ID NO:7 and the VH region comprises the amino acid sequence of SEQ ID NO:6;
[0870] (e) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:62-66, and the VH region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:34-38;
[0871] (f) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:47 and 92, and the VH region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:39 and 88-91;
[0872] (g) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:7 and 67-69, and the VH region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:6 and 93;
[0873] (h) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:7, 47-69 and 92, and the VH region comprises an amino acid sequence selected from the group consisting of SEQ ID NO:6, 34-46, 88-91 and 93;
[0874] (i) An antibody or an antigen-binding fragment thereof comprising a light chain (LC) region and a heavy chain (HC) region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:2;
[0875] (j) An antibody or an antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:3;
[0876] (k) An antibody or an antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:123 and the HC region comprises the amino acid sequence of SEQ ID NO:124 or 182;
[0877] (l) An antibody or an antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region is encoded by the nucleic acid sequence of SEQ ID NO:186 and the VH region is encoded by the nucleic acid sequence of SEQ ID NO:190; and
[0878] (m) An antibody or an antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region is encoded by the nucleic acid sequence of SEQ ID NO:185 and the HC region is encoded by the nucleic acid sequence of SEQ ID NO:189 or 191.
[0879] E240. The isolated antibody or an antigen-binding fragment thereof according to embodiment E239, which comprises a VL region and a VH region, wherein the VL region comprises the amino acid sequence of SEQ ID NO:7 and the VH region comprises the amino acid sequence of SEQ ID NO:6.
[0880] E241. The isolated antibody or an antigen-binding fragment thereof according to embodiment E239 or E240, which comprises a VL region and a VH region, wherein the VL region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:7 and the VH region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:6.
[0881] E242. The isolated antibody or an antigen-binding fragment thereof according to embodiment E239, which comprises an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:2 or 3.
[0882] The isolated antibody or antigen-binding fragment thereof according to embodiment E239 or E242, comprising an LC region and an HC region, wherein the LC region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:5, and the HC region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:2 or 3.
[0883] E244. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or fragment comprises a VH region and / or a VL region, and the VH region comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:6, 34 - 46, 88 - 91 and 93, and the VL region comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:7, 47 - 69 and 92.
[0884] E245. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or fragment comprises:
[0885] (i) an antibody HC that comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2 or 3; and / or
[0886] (ii) an antibody LC that comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:5.
[0887] E246. An isolated antibody that specifically binds to αvβ8 integrin, comprising an LC and an HC, wherein the LC consists of the amino acid sequence of SEQ ID NO:5 and the HC consists of the amino acid sequence of SEQ ID NO:2 or 3.
[0888] E247. An isolated antibody that specifically binds to αvβ8 integrin, comprising:
[0889] an antibody VL region that comprises CDR-L1, CDR-L2 and CDR-L3 from the VL region comprising the amino acid sequence of SEQ ID NO:7; and
[0890] An antibody VH region comprising CDR-H1, CDR-H2, and CDR-H3 from the VH region of the amino acid sequence comprising SEQ ID NO:6.
[0891] E248. The isolated antibody of embodiment E247, comprising an antibody heavy chain constant region and an antibody light chain constant region, the antibody heavy chain constant region comprising the amino acid sequence of SEQ ID NO:181 or 184, and the antibody light chain constant region comprising the amino acid sequence of SEQ ID NO:83.
[0892] E249. An isolated antibody that specifically binds to αvβ8 integrin, comprising:
[0893] a) An antibody VL region comprising the first, second, and third CDRs from the VL region of the amino acid sequence comprising SEQ ID NO:7;
[0894] An antibody VH region comprising the first, second, and third CDRs from the VH region of the amino acid sequence comprising SEQ ID NO:6;
[0895] An antibody light chain constant (CL) region comprising the amino acid sequence of SEQ ID NO:83; and
[0896] An antibody heavy chain (CH) constant region comprising the amino acid sequence of SEQ ID NO:181 or 184;
[0897] b) An antibody VL region comprising an amino acid sequence that is at least 95% identical to SEQ ID NO:7; and an antibody VH region comprising an amino acid sequence that is at least 95% identical to SEQ ID NO:6; or
[0898] c) An antibody LC region comprising an amino acid sequence that is at least 95% identical to SEQ ID NO:5; and an antibody HC comprising an amino acid sequence that is at least 95% identical to SEQ ID NO:2 or 3.
[0899] E250. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, comprising an antibody VH and an antibody VL, the antibody VH comprising the amino acid sequence encoded by the insert sequence deposited with the ATCC and having accession number PTA-124917, and the antibody VL comprising the amino acid sequence encoded by the insert sequence deposited with the ATCC and having accession number PTA-124918.
[0900] E251. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or fragment has at least one of the following characteristics:
[0901] a. The binding affinity for human αvβ8 integrin, designated as KD, which is lower than the KD of murine antibody ADWA11, e.g., lower than about 536 pM;
[0902] b. The KD for human αvβ8 integrin, which is lower than or equal to about 100 pM;
[0903] c. The KD for murine αvβ8 integrin, which is lower than the KD of murine antibody ADWA11, e.g., lower than about 489 pM;
[0904] d. The KD for murine αvβ8 integrin, which is lower than about 100 pM;
[0905] e. The KD for cynomolgus monkey αvβ8 integrin, which is lower than the KD of murine antibody ADWA11, e.g., lower than about 507 pM;
[0906] f. The KD for cynomolgus monkey αvβ8 integrin, which is lower than or equal to about 100 pM;
[0907] g. The KD for rat αvβ8 integrin, which is about 160 pM;
[0908] h. Substantially equal affinities for at least two, three, or all of human, cynomolgus monkey, murine, and rat αvβ8 integrins, e.g., KD lower than 100 pM as determined using a Biacore affinity assay;
[0909] i. The IC50 for inhibiting TGFβ transactivation, which is about 100 pM to about 300 pM;
[0910] j. The EC30 for U251 cells, which is about 100 pM to about 400 pM;
[0911] k. The EC50 for C8 - S cells, which is about 110 pM to about 180 pM; and
[0912] l. At least one predicted human pharmacokinetic (PK) parameter selected from:
[0913] i. The clearance (CL) of the central compartment, which is about 0.12 mL / h / kg;
[0914] ii. The inter - compartmental clearance (CLF), which is about 0.51 mL / h / kg;
[0915] iii. The volume of distribution in the central compartment (V1), which is about 36 mL / kg;
[0916] iv. The volume of distribution in the peripheral compartment (V2), which is about 33 mL / kg;
[0917] v. terminal half-life (t 1 / 2 ), which is about 15 to 17 days; and
[0918] vi. no detectable binding to human Fcγ receptor or C1q.
[0919] E252. An isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, which comprises a human IgG1 Fc region numbered according to the Eu numbering of Kabat, and the human IgG1 Fc region comprises one or more substitutions selected from positions L234, L235 and G237 (e.g., one or more of L234A, L235A and G237A).
[0920] E253. An isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the antibody is a humanized antibody, a human antibody, a murine antibody, a chimeric antibody or a camel antibody.
[0921] E254. An isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the heavy chain isotype of the antibody is selected from IgG1, IgG2, IgG3, IgG4 or any variant thereof; and / or wherein the light chain constant region is selected from κ or λ.
[0922] E255. An isolated antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments, wherein the heavy chain isotype of the antibody is IgG1 and / or wherein the light chain constant region is the κ light chain.
[0923] E256. An antibody or antigen-binding fragment thereof that competes with the antibody or antigen-binding fragment of embodiment E242 for binding to αvβ8 integrin.
[0924] E257. A pharmaceutical composition comprising an antibody or antigen-binding fragment thereof according to any one of the foregoing embodiments and a pharmaceutically acceptable carrier or excipient.
[0925] E258. The pharmaceutical composition according to embodiment E257, comprising: i) an antibody or antigen-binding fragment thereof comprising an antibody heavy chain and an antibody light chain, the antibody heavy chain being encoded by the amino acid sequence of SEQ ID NO:2 and the antibody light chain being encoded by the amino acid sequence of SEQ ID NO:5, ii) an antibody or antigen-binding fragment thereof comprising an antibody heavy chain and an antibody light chain, the antibody heavy chain being encoded by the amino acid sequence of SEQ ID NO:3 and the antibody light chain being encoded by the amino acid sequence of SEQ ID NO:5, or iii) both.
[0926] E259. An isolated nucleic acid molecule encoding an antibody or antigen-binding fragment thereof according to any one of embodiments E239 to E256.
[0927] E260. The isolated nucleic acid of embodiment E259, wherein the isolated nucleic acid encodes the VH region, the VL region, or both, of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 190, the nucleic acid sequence of SEQ ID NO: 186, or both.
[0928] E261. The isolated nucleic acid of embodiment E259, wherein the isolated nucleic acid encodes the heavy chain constant region, the light chain constant region, or both, of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 192 or 193; the nucleic acid sequence of SEQ ID NO: 194; or both.
[0929] E262. The isolated nucleic acid of embodiment E259, wherein the isolated nucleic acid encodes the HC, LC, or both, of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 189 or 190; the nucleic acid sequence of SEQ ID NO: 185; or both.
[0930] E263. The isolated nucleic acid of embodiment E259, wherein the isolated nucleic acid comprises the nucleic acid sequence of the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124917, the nucleic acid sequence of the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124918, or both.
[0931] E264. The isolated nucleic acid of embodiment E259, wherein the isolated nucleic acid comprises a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity with SEQ ID NO: 189 or SEQ ID NO: 191; a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity with SEQ ID NO: 185; or both.
[0932] E265. A vector comprising the nucleic acid of any one of embodiments E259 to E264.
[0933] E266. A host cell comprising the nucleic acid of any one of embodiments E259 to E264 or the vector of embodiment E265.
[0934] The host cell according to embodiment E265, wherein the host cell is a mammalian cell selected from the group consisting of: CHO cells, COS cells, HEK-293 cells, NS0 cells, cells and Sp2.0 cells.
[0935] E268. A method for preparing an isolated antibody or an antigen-binding fragment thereof, comprising culturing the host cell under conditions in which the antibody or fragment is expressed by the host cell according to embodiment 266 and isolating the antibody or fragment.
[0936] E269. A method for reducing αvβ8 integrin activity in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the antibody or an antigen-binding fragment thereof according to any one of embodiments E239 to E256 or the pharmaceutical composition according to embodiment E257 or E258.
[0937] E270. A method for treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody or an antigen-binding fragment thereof according to any one of embodiments E239 to E256 or the pharmaceutical composition according to embodiment E257 or E258.
[0938] E271. The method according to embodiment E270, further comprising administering a cytotoxic agent, a cell growth inhibitor, a chemotherapeutic agent, a hormonal therapy, a vaccine, an immunotherapy, surgery, radiation, cryosurgery, thermotherapy, or a combination thereof.
[0939] E272. The method according to embodiment E271, wherein the further administration is simultaneous with, sequential to, or separate from the therapeutically effective amount of the antibody or an antigen-binding fragment thereof or the pharmaceutical combination.
[0940] E273. The method according to embodiment E271, wherein the immunotherapy comprises a modulator of an immune checkpoint molecule selected from the group consisting of: an anti-PD1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, a soluble CTLA-4 fusion protein, and combinations thereof, and wherein the anti-PD-L1 antibody is not avelumab.
[0941] E274. The method according to any one of embodiments E270 to E273, wherein the cancer is selected from the group consisting of: head and neck squamous cell carcinoma, renal cell carcinoma of the clear cell type or papillary cell type, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, gastroesophageal junction cancer, esophageal cancer, lung squamous cell carcinoma, pancreatic ductal adenocarcinoma, cholangiocarcinoma, uterine cancer, melanoma, urothelial carcinoma, and combinations thereof.
[0942] E275. A method for detecting αvβ8 integrin in a sample, tissue, or cell using the antibody or antigen-binding fragment thereof described in embodiments E239 to E256, comprising contacting the sample, tissue, or cell with the antibody or antigen-binding fragment thereof and detecting the antibody or antigen-binding fragment thereof.
[0943] E276. A kit comprising the antibody or fragment thereof described in any one of embodiments E239 to E256 or the pharmaceutical composition described in embodiments E257 or E258 and optionally comprising the modulator described in embodiment E273.
[0944] E277. The antibody or antigen-binding fragment thereof described in any one of embodiments E239 to E256 or the pharmaceutical composition described in embodiments E257 or E258, which is used to reduce αvβ8 integrin activity in a subject in need thereof for treating cancer.
[0945] E278. The antibody or antigen-binding fragment thereof described in any one of embodiments E239 to E256 or the pharmaceutical composition described in embodiments E257 or E258, which is used to treat cancer, optionally wherein the antibody or antigen-binding fragment thereof or the pharmaceutical composition is used for co-administering simultaneously, sequentially, or separately with immunotherapy, and wherein the combination optionally provides a synergistic therapeutic effect.
[0946] E279. The antibody or antigen-binding fragment thereof or the pharmaceutical composition described in embodiment E278, wherein the cancer is selected from the group consisting of head and neck squamous cell carcinoma, renal cell carcinoma of clear cell type or papillary cell type, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, gastroesophageal junction cancer, esophageal cancer, lung squamous cell carcinoma, pancreatic ductal adenocarcinoma, cholangiocarcinoma, uterine cancer, melanoma, urothelial carcinoma, and combinations thereof, optionally wherein the antibody or antigen-binding fragment thereof or the pharmaceutical composition or combination is used in combination with the administration of immunotherapy or radiation therapy.
[0947] E280. Use of the antibody or antigen-binding fragment thereof described in any one of embodiments E239 to E256 or the pharmaceutical composition described in embodiments E257 or E258 for treating cancer.
[0948] E281. Use of the antibody or antigen-binding fragment thereof described in any one of embodiments E239 to E256 in the preparation of a medicament for treating cancer.
[0949] E282. A method for treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of (i) an antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, and (ii) a modulator of an anti-PD1, anti-PD-L1, or anti-PD-L2 immune checkpoint molecule.
[0950] E283. The method according to embodiment E282, wherein the cancer is squamous cell carcinoma.
[0951] E284. The method according to embodiment E282, wherein the cancer is breast cancer or colon cancer.
[0952] E285. The method according to any one of embodiments E282 to E284, wherein the modulator is selected from the group consisting of: anti-PD1 antibody, anti-PD-L1 antibody, and anti-PD-L2 antibody. BRIEF DESCRIPTION OF THE DRAWINGS
[0953] The above-described summary of the invention and the following detailed description of the invention will be better understood when read in conjunction with the accompanying drawings. For purposes of illustrating the invention, one or more of the following drawing embodiments are shown, however, it should be understood that the invention is not limited to the exact arrangements and means shown.
[0954] Figure 1A Shows a sequence alignment of the heavy chain variable region amino acid sequences comparing the murine hybridoma antibody ADWA11 (referred to as "mADWA11", "ADWA11", or "hybridoma mouse ADWA11"; SEQ ID NO:20), the humanized ADWA11 VH05-2 / VK01(2.4) antibody ("huADWA11-2.4", "ADWA11 2.4", or "humanized ADWA11-2.4"; SEQ ID NO:6), and the IGHV3-07 germline ("IMGT" or "DP-54"; SEQ ID NO:195). According to Kabat, the underlined amino acid residues are the CDR sequences.
[0955] Figure 1B Shows a sequence alignment of the light chain variable region amino acid sequences comparing the murine hybridoma antibody ADWA11 (referred to as "mADWA11", "AWDA11", or "hybridoma mouse ADWA11"; SEQ ID NO:21), the humanized ADWA11 VH05-2 / VK01(2.4) antibody ("huADWA11-2.4", "ADWA11 2.4", or "humanized ADWA11 2.4"; SEQ ID NO:7), and the IGKV1-39 germline ("IMGT" or "DPK-9"; SEQ ID NO:196). According to Kabat, the underlined amino acid residues are the CDR sequences.
[0956] Figure 2Shows a representative graph comparing the binding specificities of murine hybridoma antibodies ADWA2 and ADWA11 to human integrin αvβ3 (“AVB3”) and αvβ6 (“AVB6”), as determined by ELISA. ADWA2 and ADWA11 do not bind integrin αvβ3 (“AVB3”) and αvβ6 (“AVB6”), while the control αV binding antibody (“AlphaV mAb”) binds both αvβ3 and αvβ6.
[0957] Figure 3A Shows a representative graph showing that the murine hybridoma ADWA11 antibody binds to human αvβ8, as determined by ELISA.
[0958] Figure 3B Shows a representative graph showing that the humanized antibody ADWA11 VH05 / VK01 (2.4) binds to human αvβ8, as determined by ELISA.
[0959] Figure 4A Shows a representative graph showing the binding affinity of ADWA11 VH05 / VK01 Fab with amino acid substitutions K30A, N55Q, N57Q, D61E, P62A or K63A in the heavy chain variable region to human αvβ8, as determined by ELISA, compared to the binding affinity of the parental humanized ADWA11_VH05 / VK01 (ADWA VH_1.5 and ADWA VL_1.1) antibody to human αvβ8. The Fab with amino acid substitutions K30A, N55Q, N57Q, D61E, P62A or K63A in the heavy chain variable region retains the binding affinity to human αvβ8.
[0960] Figure 4B Shows a representative graph showing the binding affinity of ADWA11 VH05-2 / VK01 Fab with amino acid substitutions in the heavy chain variable region (e.g., F64V) or amino acid substitutions in the light chain variable region (e.g., L30S, Y55A, A60Q, M94Q, L97Y, F101L, F101W or Q105G) to human αvβ8, as determined by ELISA, compared to the binding affinity of the parental ADWA11 VH05-2 / VK01 antibody to human αvβ8. Compared to the humanized ADWA11 VH05-2 / VK01 antibody, the Fab with amino acid substitutions Y55A, A60Q, F101L or F101W in the light chain variable region shows a reduced binding affinity to human αvβ8. The other Fabs tested retain the binding affinity to human αvβ8.
[0961] Figure 4CShows representative graphs that show the binding affinities of ADWA11 VH05-2 / VK01 Fabs designated as VH05-2 / VK01(2.1) (ADWA112.1), VH05-2 / VK01(2.2) (ADWA 2.2), VH05-2 / VK01(2.3) (ADWA 2.3), VH05-2 / VK01(2.4) (ADWA 2.4), VH05-2(F64V) / VK01(2.1), VH05-2(F64V) / VK01(2.3), and VH05-2(F64V) / VK01(2.4) having the combinations of amino acid substitutions as determined by ELISA and compared to the parental antibody (VH05-2_VK01 parental) for human αvβ8. Each Fab tested retained binding affinity for human αvβ8.
[0962] Figure 5 Shows representative graphs comparing the binding specificities of murine hybridoma ADWA11 (“MsADWA11” or “mADWA11”) and humanized ADWA11 VH05-1 / VK01 (“ADWA11 5-1_1”) and ADWA11 VH05-2 / VK01 (“ADWA11 5-2_1”) for human integrins αvβ3 (avb3) and αvβ6 (avb6) as determined by Biacore. The ADWA11 antibody does not bind integrins αvβ3 (avb3) and αvβ6 (avb6), while the control αV binding antibody (“anti-av”) binds both αvβ3 and αvβ6.
[0963] Figure 6A Shows a representative Biacore binding trace of hybridoma ADWA11 (“Ms ADWA11”) Fab to human αvβ8.
[0964] Figure 6B Shows a representative Biacore binding trace of humanized ADWA11_5-2 2.4 Fab, also designated as ADWA11 VH05-2 / VK01(2.4) or “ADWA11 2.4” Fab, to human αvβ8.
[0965] Figure 6CA representative table is shown which shows that the humanized Fab ADWA11, herein referred to as ADWA11 5-2 2.4 (also referred to as ADWA11 2.4 and ADWA11 VH05-2 / VK01(2.4)), maintains affinity for human αvβ8 and cross-species reactivity compared to the parental murine antibody Fab (“MsADWA11”) as assessed by Biacore. ADWA11 5-2 2.4 exhibits equivalent affinity for human, cynomolgus monkey, murine, and rat αvβ8, with KD < 200 pM. The parental murine antibody exhibits equivalent affinity for human, cynomolgus monkey, and murine αvβ8, with KD of 489 - 536 pM.
[0966] Figure 7A A representative graph is shown comparing the U251 cell binding data of ADWA11 VH05-2 / VK01 (parental) Fab (“ADWA11”) with a single amino acid substitution in the heavy chain variable region (e.g., F64V) or a single amino acid substitution in the light chain variable region (e.g., L30S, M94Q, L97Y, F101L, or Q105G). Compared to the parental antibody, the Fab with the F101L amino acid substitution in the light chain variable region exhibits reduced binding to U251 cells (human αvβ8). The other Fabs tested maintain binding to U251 cells (human αvβ8).
[0967] Figure 7B A representative graph is shown comparing the U251 cell binding data of ADWA11 VH05-2 / VK01 (parental) Fab (“ADWA11”) with a single amino acid substitution in the light chain variable region (e.g., M56A or N58S). The M56A and N58S Fabs maintain binding to U251 cells (human αvβ8).
[0968] Figure 7C A representative graph is shown which shows the U251 cell binding data of ADWA11 VH05-2 / VK01 Fab (“ADWA11”) with combinations of amino acid substitutions designated as 2.1, 2.2, 2.3, 2.4, 2.1(F64V), 2.3(F64V), and 2.4(F64V) according to Table 5 compared to the parental antibody. Each Fab tested maintains binding to fixed U251 cells.
[0969] Figure 8 A representative graph is shown comparing the binding affinity of the antibodies ADWA11 mIgG_4mut and ADWA11 VH05 / VK01 to U251 cells.
[0970] Figure 9AShows representative graphs showing the binding of ADWA11 VH05-2 / VK01, designated as ADWA11_VH05-2 / VK01(2.1) and ADWA11_VH05-2 / VK01(2.4), with amino acid substitutions, to U251 (human glioblastoma) or C8-S (mouse astrocyte) cells. ADWA11 VH05-2 / VK01(2.1) and ADWA11 VH05-2 / VK01(2.4) antibodies retain binding to U251 cells (human avb8) and C8-S (mouse avb8).
[0971] Figure 9B Shows representative graphs depicting the binding of an integrin-specific antibody, e.g., ADWA11 VH05-2 / VK01(2.4), to HEK cells expressing αvβ3, αvβ5, αvβ6, and αvβ8. The results show saturation binding of ADWA11 VH05-2 / VK01(2.4) to HEK cells expressing αvβ8 and no binding to cells expressing αvβ3, αvβ5, αvβ6. The results demonstrate specific binding of ADWA11 VH05-2 / VK01(2.4) to human αvβ8.
[0972] Figure 10A Shows representative graphs comparing the effects of murine hybridoma ADWA11 (“mFab”) and humanized ADWA11 Fabs: ADWA11VH01 / VK01, ADWA11 VH02 / VK01, ADWA11 VH02 / VK02, ADWA11 VH05 / VK02, and ADWA11 VH05 / VK01 on TGFβ transactivation in U251 cells. VH01 / VK01, VH02 / VK01, and VH02 / VK02 Fabs show reduced activity, while VH05 / VK01 retains activity, and VH05 / VK02 exhibits improved activity to block TGFβ activation in the U251 transactivation assay compared to murine hybridoma ADWA11 Fab (“mFab”).
[0973] Figure 10BShows a representative graph comparing the effect of the designated ADWA11 VH05-2 / VK01 Fab with amino acid substitutions in the heavy chain variable region (such as F64V) or amino acid substitutions in the light chain variable region (such as L30S, M94Q, L97Y, F101L, F101W, or Q105G) on TGFβ transactivation in U251 cells. Compared with the humanized parental ADWA11 VH05-2 / VK01 Fab, the Fab with a single amino acid substitution of F101L or F101W in the light chain variable region showed a reduced effect on TGFβ transactivation. The other Fabs tested remained active in the TGFβ transactivation assay.
[0974] Figure 10C Shows a representative graph comparing the effect of ADWA11 VH05-2 / VK01 Fab with combinations of amino acid substitutions, including those designated as 2.1, 2.2, 2.3, 2.4, 2.1 (F64V), 2.3 (F64V), and 2.4 (F64V) according to Table 5. Compared with the parental ADWA11 VH05-2 / VK01 Fab, the VH02-2 / VK01 (2.3) and VH05-2 (F64V) / VK01 (2.3) Fabs showed a reduced effect on TGFβ transactivation. The other Fabs tested remained active in the TGFβ transactivation assay.
[0975] Figure 10D Shows a representative graph comparing the effect of the ADWA11 VH05-2 / VK01 (parental) Fab with designated amino acid substitutions in the heavy chain variable region (such as F64V) or designated amino acid substitutions in the light chain variable region (such as L30S, M94Q, L97Y, Q105G, M56A, or N58S). Compared with the parental ADWA11 VH05-2 / VK01 Fab, the Fabs tested remained active in the TGFβ transactivation assay.
[0976] Figure 10E Shows a representative graph showing the effect of humanized ADWA11 VH05 / VK01, VH05 / VK01-D61E (VH05-1 / VK01), and VH05 / VK01-N55Q-D61E (VH05-2 / VK01) IgG on TGFβ transactivation in U251 cells. The antibodies tested remained active in the TGFβ transactivation assay.
[0977] Figure 10FDepicts a representative figure that shows the effect of ADWA11_VH05-2_VK01(2.4) on TGFβ transactivation in U251 cells (left panel) and C8-S (right panel) compared to an isotype control antibody. Additional experiments demonstrated that the IC50 of ADWA11 VH05-2 / VK01(2.4) in the TGFβ transactivation assay using U251 cells was 199 ± 93.6 pM (mean ± standard deviation).
[0978] Figure 11 Shows a representative figure that shows the percentage of responders (antigenicity) of different ADWA11VH05-2VK01 CDR peptides compared to the positive control peptide set forth in Table 1. Peptide antigenicity scores were used to select possible CDR sequences with reduced immunogenicity risk.
[0979] Figure 12A Shows a representative figure that shows the efficacy of combinations of anti-αvβ8 (ADWA11), anti-PD1 antibody (“PD-1”, RMP1-14), mIgG1_4mut isotype (2B8), and rat IgG2a isotype (2A3) treatment in the EMT6 breast cancer tumor model. Tumor growth was measured three times a week using a digital caliper and reported as tumor volume (length × width × width × 0.5). Mean tumor volume + / - SEM was plotted for each treatment group until fewer than 8 of 10 mice remained in each group. Survival was defined as the time to reach 1000 mm 3 . The combination of anti-PD1 and ADWA11 inhibited tumor growth and improved overall survival to a greater extent compared to the other combinations tested.
[0980] Figure 12B Shows a representative figure that shows the efficacy of the anti-αvβ8 antibody (ADWA11) at 1, 3, 10, and 20 mg / kg as a single therapy and an isotype control (mIgG1_4mut isotype (2B8)) in the EMT6 breast cancer model as shown in the upper panel. Also shown is the combination of the anti-αvβ8 antibody ADWA11 at 1, 3, 10, and 20 mg / kg and the anti-PD1 antibody (RMP1-14, 10 mg / kg) and rat IgG2a isotype (2A3) in the EMT6 breast cancer tumor model. Mice were treated with the antibodies on days 0, 4, and 8 of the study, and tumor growth was measured three times a week using a digital caliper and reported as tumor volume (length × width × width × 0.5).
[0981] Figure 13Shows a representative graph that shows the efficacy of the combination of anti-αvβ8 (ADWA11), anti-4-1BB (MAB9371), anti-CTLA4 (9D9), mIgG1_4mut isotype (2B8), and rat IgG2a isotype (2A3) treatment in the EMT6 tumor model. Tumor growth was measured three times a week using a digital caliper and reported as tumor volume (length × width × width × 0.5). The mean tumor volume + / − SEM in each treatment group was plotted until fewer than 8 out of 10 mice remained in each group, and survival was defined as the time to reach 1000 mm 3 . The combination of anti-4-1BB and ADWA11 or anti-CLTA4 and ADWA11 treatment inhibited tumor growth and improved overall survival to a greater extent compared to the other combinations tested.
[0982] Figure 14A Depicts a representative graph that shows that in the CT26 tumor model, the combination of anti-αvβ8 antibody and radiation therapy (ADWA11 + 5 Gy radiation group) inhibited tumor growth and improved overall survival to a greater extent compared to radiation therapy and isotype control (mIgG4mut (2B8) + 5 Gy radiation group). Tumor growth was measured three times a week using a digital caliper and reported as tumor volume (length × width × width × 0.5). The mean tumor volume + / − SEM in each treatment group was plotted, and survival was defined as the time to reach 1000 mm 3 . *p < 0.05 compared to no treatment, **P < 0.05 compared to radiation + 2B8.
[0983] Figure 14B The upper figure depicts the density of CD45, CD8, and cells expressing granzyme B in CT26 tumor tissues collected from mice treated with 10 mg / kg isotype control (control) or ADWA11 antibody (anti-ITGαVβ8) on day 0, day 4, and day 8 on day 12, n = 6; p = P value. The lower figure depicts the gene expression of CD45, CD8, granzyme B, and IFNγ in tumor tissues collected 12 days after the first 10 mg / kg dose of isotype control (isotype), ADWA11 antibody (anti-ITGαVβ8), isotype combined with 5 Gy of tumor-targeted radiation, or ADWA11 antibody combined with 5 Gy of tumor-targeted radiation. Antibody treatment was administered intravenously on day 1, day 4, and day 8 of the study, and radiation therapy was administered on day 5 of the study. Five mice were included in each treatment group; the mean and standard error of the mean are represented graphically.
[0984] Figure 15Depicts a representative graph that shows the IHC analysis of the densities of CD45 (total lymphocytes and myeloid cells), CD3 (total T cells), CD4 T cells, CD8 T cells, and granzyme B (activated CD8 and NK cells) in the EMT6 tumor model. Treatment with ADWA11 (2.4) (also referred to herein as ADWA11VH05-2 / VK01(2.4)) increases the densities of all cell types analyzed. N = 10 for each group, and the p-value is for a two-tailed t-test marked on the graph.
[0985] Figure 16A Shows a schematic diagram that shows the treatment protocol for the CCK168 tumor model. The timeline of tumor cell implantation and intraperitoneal (i.p.) antibody injection for four treatment groups is provided.
[0986] Figure 16B Shows the representative Kaplan-Meier survival curve using a tumor volume of 2000 mm 3 as the survival cutoff in the CCK168 tumor model. n = 10 in each group. By log-rank and Mantel-Cox tests, **p < 0.01.
[0987] Figure 16C Depicts a representative graph that shows Figure 16B the individual growth curves of the tumors shown in 3 . Mice were sacrificed before the 45-day endpoint when the tumor reached ≥2000 mm
[0988] Figure 17A Depicts the gating strategy for identifying tumor-infiltrating monocytes, macrophages, and dendritic cells. Live single cells were first gated with a dump gate including Ly6G, SiglecF, CD90, and B220 to eliminate neutrophils, eosinophils, lymphocytes, and B cells. Subsequently, negatively stained cells were analyzed and gated by flow cytometry. Macrophages were identified as CD45+CD11b+CD64 高 F4 / 80 高 , and dendritic cells were identified as CD45+CD11b+F4 / 80-CD64-MHCII 高 CD11c 高 . Among the macrophage population, the characteristics identical to immunostimulatory macrophages were identified as Ly6C 高 CD206低 and immunosuppressive macrophages were identified as Ly6C 低 CD206 高 . The cell cluster channels were Ly6G+SiglecF+CD90.2+B220+.
[0989] Figure 17B Shown are representative plots that show cell surface staining of integrin αvβ8 analyzed as part of a multicolor flow cytometry plot in the disaggregated tumors as described in Figure 17A . Representative flow cytometry plots show fluorescence minus one (FMO) control staining and ADWA11 antibody staining in the CCK168 tumor model. N = 4 tumors.
[0990] Figure 18A Depicted are representative plots that show ADWA11 staining on CD45-negative cells isolated from CCK168. Live single cells were analyzed for the presence of CD45. Using the ADWA11 antibody, 4% of the CD45-negative cells in the CCK168 tumor model were positive for αvβ8 expression.
[0991] Figure 18B Depicted is the expression of αvβ8 in the CCK168, CT26, and EMT6 cell lines. αvβ8 expression of live single cells was analyzed by flow cytometry using isotype and anti-αvβ8 (ALDWA11) staining antibodies. The CCK168 and EMT6 cell lines had detectable αvβ8 expression, while the CT26 cell line did not have detectable αvβ8 expression.
[0992] Figure 19A Depicted are representative plots that show the total number of intratumoral CD8+ T cells in mice bearing CCK168 tumors, which were treated with control antibody alone, anti-PD1, ADWA11, or a combination of anti-PD1 and ADWA11. Representative flow cytometry plots of CD4 and CD8 expression of all CD45+ cells and the ratio of CD8+ cells to CD45+ cells for each mouse in each group are shown.
[0993] Figure 19B Shown are representative immunofluorescence micrographs of CCK168 tumor sections harvested from mice in each treatment group and stained for anti-CD8 and DAPI. Scale bar is 50 μm.
[0994] Figure 19C Shown are representative flow cytometry plots that show intracellular staining of granzyme B in cells gated for CD8 expression and the percentage of CD8+ cells expressing detectable granzyme B in each mouse in each group.
[0995] Figure 19D shows representative flow cytometry plots that show gating for CD45+Ly6G-CD11b+CD64 高 F4 / 80 高 of immunostimulatory macrophages (Ly6c 高 , CD206 低 ) and immunosuppressive macrophages (CD206 高 , Ly6c 低 ). Among the macrophage population, immunostimulatory macrophages were identified as Ly6C 高 CD206 低 , and immunosuppressive macrophages were identified as Ly6C 低 CD206 高 , and the percentage of immunostimulatory macrophages for each mouse. Data in the figure are mean ± SEM, n = 10 per group. By one-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.001.
[0996] Figure 20 Depicts representative plots that show ADWA11 staining on CD4+ and CD8+ T cells in the CCK168 tumor microenvironment. Live single CD45+ cells were gated for CD4 and CD8 and stained with ADWA11. Representative plots from mice in each of 4 treatment groups are shown.
[0997] Figure 21A Shows representative plots that show immune exhaustion of CD8+ T cells. Micrographs show immunostaining for anti-CD8 counterstained with DAPI in CCK168 tumors isolated after combinatorial anti-PD-1 / ADWA11 therapy with or without prior treatment with anti-CD8 depleting antibody or isotype control antibody.
[0998] Figure 21B Shows representative plots that show the mean tumor growth curves of CCK168 tumors pretreated with anti-CD8 depleting antibody or isotype control antibody 24 hours before ADWA11 / anti-PD-1 combination therapy.
[0999] Figure 21C Shows representative plots that show the survival of mice bearing CCK168 tumors pretreated one day in advance with anti-CD8 depleting antibody or isotype control antibody after ADWA11 / anti-PD-1 combination therapy. Data are reported as percentage survival, n = 10 in each group. By log-rank and Mantel-Cox tests, **p < 0.01.
[1000] Figure 22AShows a representative figure that shows CCK168 tumors harvested from mice treated with ADWA-11 or control antibody and stained with antibodies against CD8, F4 / 80 to detect macrophages and phosphorylated SMAD3 (pS3) to detect TGFβ signaling. The left side shows a low magnification merged image and an image showing only pSMAD3, and the right side shows a magnified merged image and images of each individual antibody from the square region.
[1001] Figure 22B Shows a representative figure that depicts the quantification of pSmad3 (pS3) staining density in control and ADWA11-treated mice. ADWA11 treatment reduces the pSmad3 density in CCK168 tumors.
[1002] Figure 23A Shows a representative figure that illustrates data extracted from The Cancer Genome Atlas (TCGA) for integrin-β8 mRNA expression in 30 different human cancers. Each point represents an individual tumor sample. The results shown in this figure are based on data generated by the TCGA Research Network.
[1003] Figure 23B Shows a representative figure that shows flow cytometry data of dissociated cells from fresh, de-identified ovarian cancer and renal cell carcinoma gated for mature monocytes (CD16+ monocytes), tumor-associated macrophages (CD14+ macrophages), two monocyte-derived dendritic cell populations (BCDA1+ moDC and BCDA3+ moDC), or eosinophils and stained for αvβ8 expression. Tissue from normal tonsils was also analyzed as a control. The gating strategy is shown in Figure 23C ; n = 2 for each tumor type.
[1004] Figure 23C Is a representative figure that shows human tumor biopsy samples. Live single CD45+ cells were gated for SSC-A (hi) to remove granulocytes. SSC-A (lo) was gated for HLA-DR+CD3- and stained with CD14 and CD16. CD14+CD16+ was designated as CD16+ monocytes. CD16- cells were further stained for CD11c. CD14+CD11c+ cells were further stained with CD1c and CD141. CD1c+CD141- was designated as CD1c+ MoDC. CD141+CD1c- was designated as CD141+ MoDC. CD1c-CD141- cells were further stained with CD64, and the CD64+ population was designated as CD14+ TAM.
[1005] Figure 24A Shows a representative graph that shows the results of a TMLC cell co - culture bioassay with ADWA11 in the concentration range of 0.01 to 10 mg / ml. TGFβ activity was reported as relative luciferase units based on PAI - 1 luciferase reporter activity. n = 3 for each ADWA11 dose, repeated 3 times.
[1006] Figure 24B Shows a representative graph that shows the results of a cell adhesion assay performed on culture dishes coated with the latent - associated peptide (LAP) of TGFβ1 in the presence of ADWA - 11 at concentrations of 0.001 to 10 mg / ml. Adherent cells were stained with crystal violet and adhesion was expressed as absorbance at 595 nm. n = 3 for each ADWA11 dose, repeated 3 times.
[1007] Figure 24C Depicts a representative graph that shows flow cytometry of antibodies against integrin αvβ3, αvβ5, αvβ6, and αvβ8 for wild - type colon cancer cells, SW - 480 (which does not express any of these integrins), or SW - 480 cells transfected to express β3 (SW - itgb3), β6 (SW - itgb6), or β8 (SW - itgb8). Representative flow cytometry plots are shown for each antibody and cell type tested.
[1008] Figure 25A Shows a representative graph that depicts a two - compartment non - linear pharmacokinetic model fitted to ADWA11 (2.4) administered at 0.1, 0.3, and 3 mg / kg i.v. in TG32 mice. Circles: Observed data. Lines: Model fit.
[1009] Figure 25B Shows a representative graph that depicts a two - compartment pharmacokinetic model fitted to ADWA11 2.4 administered at 3 mg / kg i.v. in TG32 mice. Circles: Observed data. Lines: Model fit.
[1010] Figure 26 Shows a representative graph that depicts the two - compartment pharmacokinetics of ADWA11 2.4 in cynomolgus monkeys after single IV bolus administrations at 4, 40, and 100 mg / kg, respectively. Circles: Observed data. Lines: Model fit.
[1011] Figure 27A-27BDisplays a representative graph that illustrates the predicted human ADWA11 2.4 pharmacokinetics after 12 mg / kg Q28D and 7 mg / kg Q14D. CP is the predicted plasma concentration; CAVG is the Cavg or mean plasma concentration; the rodent NOAEL is the C at the no-observed-adverse-effect level in rodents ave ; and the NHP NOAEL is the C at the no-observed-adverse-effect level in non-human primates ave .
[1012] Figure 28 Depicts a representative graph that shows the Kaplan-Meier survival curves using the tumor volume at 2000 mm 3 as the survival threshold for the CCK168 tumor model. The treatment groups are isotype control, anti-PD1 antibody, ADWA11_4mut, and the combination of anti-PD1 antibody and ADWA11_4mut. The combination of anti-PD1 antibody and ADWA11_4mut treatment synergistically improves the overall survival to a greater extent compared to the expected additive effects of anti-PD1 antibody, ADWA11_4mut, or isotype control treatment alone or in combination
[1013] Figure 29A Shows a graph depicting representative survival curves, and Figure 29B shows the representative individual tumor growth curves of mice implanted with subcutaneous CT26 cells on day 5 and treated with isotype control antibody, anti-PD1, ADWA11_4mut, or the combination of anti-PD1 and ADWA11_4mut plus a 5 Gy radiation dose. A group of mice treated with isotype control antibody did not receive radiation therapy. Data are reported as percentage survival, n = 10 in each group. By log-rank and Mantel-Cox tests, ***p < 0.001, ****p < 0.0001
[1014] Figure 29C Shows a graph depicting representative tumor rechallenge in CT26-cured mice that survived 50 days after treatment initiation. On day 51 after the start of immunotherapy combined with radiation therapy, parental CT26 cells were implanted into the contralateral abdomen at the original tumor implantation site of CT-26-cured mice. Control mice did not receive radiation and were not previously exposed to tumor cells. The rechallenged mice were followed for 30 days. Control, n = 10; RT plus anti-PD1, n = 3; RT plus ADWA11_mut, n = 5; RT plus ADWA11_mut and anti-PD1, n = 7
[1015] Figure 30A Shows a graph depicting representative survival curves, and Figure 30BShows a graph depicting the representative individual growth curves of mice orthotopically implanted with EMT6 cells after treatment with isotype control antibody, ADWA11_4mut, 4-1BB, anti-CTLA4, anti-PD-1, or combinations of ADWA-11_4mut and 4-1BB, anti-CTLA4, or anti-PD-1. Data are reported as percentage survival, n = 10 in each group. By log-rank and Mantel-Cox tests, ****p < 0.0001
[1016] Figure 30C Shows a graph depicting representative survival curves, and Figure 30D Shows a graph depicting the representative individual growth curves of mice treated with an activator of anti-CTLA4 or 4-1BB.
[1017] Figure 30E Shows a representative graph depicting the results of tumor rechallenge in mice that survived for 50 days with complete tumor regression after treatment with a synergistic combination of ADWA-11_4mut and anti-CTLA4 or a synergistic combination of an activator of ADWA-11_4mut and 4-1BB. Control mice were not previously exposed to tumors. Rechallenged mice were evaluated for 30 days. Control n = 5, ADWA-11_4mut + anti-CTLA4 n = 6, ADWA-11_4mut + 4-1BB n = 5.
[1018] Figure 31A Depicts mRNA gene expression analysis in MC38 tumor tissue using CD8a and granzyme B specific taqman probes. Tumor tissue was collected 12 days after the first dose of isotype control or ADWA11 2.4 antibody at the indicated dose levels. Treatments were administered intravenously on days 1, 5, and 9 of the study, with 5 mice in each treatment group. * = p-value < 0.05.
[1019] Figure 31B Shows a representative graph depicting the tumor growth rate of the MC38 tumor model in mice treated with isotype (10 mg / kg), ADWA11 2.4 (10 mg / kg), anti-PD-1 antibody (RMP1-14, 10 mg / kg), and the combination of ADWA11 2.4 (10 mg / kg) and anti-PD1 antibody (RMP1-14, 10 mg / kg). Additionally, the representative graph shows the tumor growth rate of the MC38 tumor in mice treated with doses of 0.03, 0.3, 3, and 30 mg / kg of ADWA11 (anti-ITGAVB8 (ADWA11_mIgG_4mut) antibody) in combination with 10 mg / kg anti-PD-1 antibody (RMP1-14). For all graphs, antibodies were administered on days 1, 5, and 9 of the study. DETAILED DESCRIPTION OF THE INVENTION
[1021] The present disclosure relates to antibodies and antigen-binding fragments thereof that specifically bind to αvβ8 integrin (e.g., human αvβ8 integrin), and further relates to antibodies that antagonize αvβ8 integrin activity (e.g., antagonize the activation of TGFβ, antagonize the mediation of TGFβ production, antagonize the regulation of Tregs and Th17 cells) or its interaction with TGFβ1 and TGFβ3 or the release of active TGFβ. Methods for preparing anti-αvβ8 integrin antibodies, compositions comprising anti-αvβ8 integrin antibodies, and methods of using anti-αvβ8 integrin antibodies are provided. In some embodiments, recombinant (e.g., humanized) antibodies that bind αvβ8 integrin (e.g., human αvβ8 integrin) are provided. In some embodiments, humanized heavy and light antibody chains capable of forming antibodies that bind αvβ8 integrin are also provided. In some embodiments, humanized antibodies, heavy chains, and light chains comprising one or more specific complementarity-determining regions (CDRs) are provided. In some embodiments, the humanized anti-αvβ8 integrin antibodies have altered effector functions. In some embodiments, the antibodies of the present invention have reduced antibody-dependent cell-mediated cytotoxicity (ADCC) activity and / or complement-dependent cytotoxicity (CDC) activity relative to other identical anti-αvβ8 integrin antibodies of the present invention.
[1022] Polynucleotides encoding antibodies or antigen-binding fragments thereof that bind αvβ8 integrin (e.g., human αvβ8 integrin) are provided. Polynucleotides encoding heavy or light antibody chains are also provided. Host cells expressing anti-αvβ8 integrin antibodies (including humanized antibodies) are provided. Therapeutic methods using anti-αvβ8 integrin antibodies (including humanized antibodies) are provided.
[1023] Anti-αvβ8 integrin antibodies and antigen-binding fragments thereof, including humanized antibodies, can be used to prevent, treat, and / or ameliorate diseases, disorders, or conditions caused by and / or associated with abnormal (e.g., increased) TGFβ signaling. Such diseases, disorders, or conditions include cancer (e.g., controlling the proliferation of cancer cells with abnormal (e.g., increased) TGFβ signaling).
[1024] Without wishing to be bound by any particular theory, mature TGFβ exists in an inactive or latent form in a complex with a latency-associated peptide (LAP) domain. Binding of ανβ8 integrin to the LAP results in the release of active TGFβ (e.g., TGFβ1 and TGFβ3). Reducing the binding of ανβ8 integrin to the LAP can prevent the release of active TGFβ, thereby reducing TGFβ signaling. TGFβ is known to have immunosuppressive effects, for example, in the tumor microenvironment, and thus reducing TGFβ activity and / or signaling using the antibodies described herein can result in the activation of an immune response (e.g., an anti-tumor response in vivo). Accordingly, the antibodies and antigen-binding fragments thereof of the present disclosure are capable of selectively antagonizing TGFβ activity in the immune system and / or the tumor microenvironment, and thus enhancing the anti-tumor immune response in a subject. In some embodiments disclosed in the examples herein, it has been shown that antibodies and antigen-binding fragments thereof against ανβ8 integrin alone or in combination with other immunomodulators (e.g., modulators of checkpoint inhibitors (e.g., inhibitors of PD-1, PD-L1, CTLA-4 or agonists of 4-1BB)) or anti-cancer therapies (e.g., radiotherapy) result in growth inhibition and / or complete tumor regression of several cancers in animal models, including squamous cell carcinoma, breast cancer, and colon cancer. Accordingly, anti-ανβ8 integrin antibodies, including humanized antibodies, and antigen-binding fragments thereof alone or in combination with a second therapy can be used to prevent, treat, and / or ameliorate cancer, such as solid tumors, such as solid tumors selected from: renal cell carcinoma (RCC), ovarian cancer, or squamous cell carcinoma of the head and neck (SCCHN).
[1025] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.
[1026] All references cited herein (including patent applications, patent publications, and Genbank accession numbers) are incorporated herein by reference as if each individual reference was specifically and individually indicated to be incorporated by reference in its entirety.
[1027] Those skilled in the art generally fully understand and typically use conventional methods to adopt the technologies and procedures described or referenced herein, such as the widely used methods described in the following: Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd Edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (edited by F.M. Ausubel et al., (2003)); METHODS IN ENZYMOLOGY series (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (edited by M.J. MacPherson, B.D. Hames and G.R. Taylor (1995)), Harlow and Lane (1988) ANTIBODIES, A LABORATORY MANUAL and ANIMAL CELL CULTURE (edited by R.I. Freshney (1987)); Oligonucleotide Synthesis (edited by M.J. Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by J.E. Cellis, 1998) Academic Press; Animal Cell Culture (edited by R.I. Freshney, 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture Laboratory Procedures (edited by A.D. Doyle, J.B. Griffiths and D.G. Newell, 1993 - 8) J.Wiley and Sons; Handbook of Experimental Immunology (edited by D.M. Weir and C.C. Blackwell); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P.(edited by Calos, 1987); PCR: The Polymerase Chain Reaction, (edited by Mullis et al., 1994); Current Protocols in Immunology (edited by J.E. Coligan et al., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (edited by D. Catty, IRL Press, 1988 - 1989); Monoclonal Antibodies: A Practical Approach (edited by P. Shepherd and C. Dean, Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999)); The Antibodies (edited by M. Zanetti and J.D. Capra, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (edited by V.T. DeVita et al., J.B. Lippincott Company, 1993); and their updated versions.
[1028] I. Definitions
[1029] The present invention can be more readily understood by reference to the following detailed description of the exemplary embodiments of the invention and the examples included therein.
[1030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present specification, including definitions, will control.
[1031] In addition, unless the context requires otherwise or is otherwise specifically indicated, singular terms shall include the plural and plural terms shall include the singular.
[1032] It should be understood that the aspects and embodiments of the invention described herein include "consisting of" the aspects and embodiments and / or "consisting essentially of" the aspects and embodiments. Unless otherwise indicated, as used herein, the singular forms "a", "an", and "the" include plural referents.
[1033] In this application, unless expressly stated or understood by one of ordinary skill in the art, the use of "or" means "and / or". In the case of multiple dependent claims, the use of "or" refers to more than one of the foregoing independent or dependent claims.
[1034] When used in conjunction with a measurable numerical variable, "about" or "substantially" refers to the specified value of the variable and means all values of the variable within the experimental error of the specified value (e.g., within the 95% confidence interval of the mean value) or within 10% of the specified value, whichever is greater. Numerical ranges include the numbers defining the range.
[1035] Although the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. However, any numerical value inherently contains certain errors necessarily resulting from the standard deviations found in their respective testing measurements. In addition, all ranges disclosed herein should be understood to encompass any and all sub-ranges subsumed therein. For example, the stated range of "1 to 10" should be considered to include any and all sub-ranges between the minimum value 1 and the maximum value 10 (and including the end values); that is, all sub-ranges starting with the minimum value 1 or greater (e.g., 1 to 6.1) and ending with the maximum value 10 or less (e.g., 5.5 to 10).
[1036] Throughout this specification and the claims, the word "comprising" or variations such as "includes" or "containing" shall be understood to mean including the stated integer or group of integers but not excluding any other integer or group of integers. Unless the context requires otherwise, the singular terms shall include the plural and the plural terms shall include the singular. Any one or more instances following the terms "such as" or "for example" are not meant to be exhaustive or limiting.
[1037] It should be understood that the embodiments anywhere in this text are described in the language of "comprising", or similar embodiments described in the terms of "consisting of" and / or "consisting essentially of" are also provided.
[1038] When aspects or embodiments of the present invention are described in terms of Markush groups or other alternative groups, the present invention covers not only all of the groups listed as a whole, but also each member of the group and all possible subgroups of the main group, individually, and also the main group lacking one or more members of the group. The present invention also contemplates expressly excluding one or more of any of the members of the claimed invention.
[1039] It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. In this specification and the subsequent claims, numerous terms will be referenced, and such terms are to be defined to have the following meanings.
[1040] The term "isolated molecule" (wherein the molecule is, for example, a polypeptide, polynucleotide, or antibody or fragment thereof) is a molecule that by virtue of its source or the source from which it is derived (1) is not associated with the natural associated components with which it is associated in its natural state; (2) is substantially free of other molecules from the same species; (3) is expressed by cells from a different species, or (4) does not exist in nature. Thus, a molecule that is chemically synthesized or expressed in a cell system different from the cell of its natural source will be "isolated" from its natural associated components. Molecules can also be made substantially free of natural associated components by isolation using purification techniques well known in the art. The purity or homogeneity of a molecule can be determined in a variety of ways well known in the art. For example, using techniques well known in the art, the purity of a polypeptide sample can be determined using polyacrylamide gel electrophoresis and gel staining to visualize the polypeptide. For some purposes, higher resolution can be provided by using HPLC or other means well known in the art for purification.
[1041] As used herein, "substantially pure" means that the species of interest is the major species present (i.e., it is more abundant on a molar basis than any other single species in the composition), and preferably, the substantially purified fraction is a composition in which the species of interest (e.g., a glycoprotein, including an antibody or receptor) comprises at least about 50% (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will contain more than about 80%, more preferably more than about 85%, 90%, 95%, and 99% of all macromolecular species present in the composition. Most preferably, the species of interest is purified to substantial homogeneity (species of contamination that cannot be detected in the composition by conventional detection methods), where the composition consists essentially of a single macromolecular species. In certain embodiments, the substantially pure material is at least 50% pure (i.e., free of contaminants), more preferably at least 90% pure, more preferably at least 95% pure, still more preferably at least 98% pure, and most preferably at least 99% pure.
[1042] As is known in the art, the term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparing said sequences. In the art, depending on the context, "identity" also refers to the degree of sequence relatedness between polypeptide or nucleic acid molecule sequences, as determined by matches between nucleotide or amino acid sequence strings. "Identity" measures the percentage of identical matches between two or more sequences, where gap alignments are resolved by specific mathematical models (i.e., "algorithms") of computer programs.
[1043] The term "similarity" is a related concept, but in contrast to "identity", it refers to a measure of similarity that includes both identical matches and conservative substitution matches. Since conservative substitutions apply to polypeptide rather than nucleic acid molecules, similarity only pertains to polypeptide sequence comparisons. If two polypeptide sequences have, for example, 10 / 20 identical amino acids and all the rest are non-conservative substitutions, then both the identity and similarity percentages will be 50%. If in the same example there are also 5 positions with conservative substitutions, the identity percentage will still be 50%, but the similarity percentage will be 75% (15 / 20). Thus, in the presence of conservative substitutions, the degree of similarity between two polypeptide sequences will be higher than the percentage of identity between those two sequences.
[1044] A "fragment" or "portion" of a polypeptide or antibody according to the invention can be prepared by truncation, for example, by removing one or more amino acids from the N-terminal and / or C-terminal ends of the polypeptide. Up to 10, up to 20, up to 30, up to 40 or more amino acids can be removed in this way from the N-terminal and / or C-terminal ends. Fragments can also be generated by one or more internal deletions.
[1045] Variant antibodies can contain 1, 2, 3, 4, 5, up to 10, up to 20, up to 30 or more amino acid substitutions and / or deletions and / or insertions of the specific sequences and fragments discussed above. "Deletion" variants can contain the deletion of a single amino acid; the deletion of smaller groups of amino acids, such as 2, 3, 4 or 5 amino acids; or the deletion of larger amino acid regions, such as the deletion of a specific amino acid domain or other feature. "Insertion" variants can contain the insertion of a single amino acid; the insertion of smaller groups of amino acids, such as 2, 3, 4 or 5 amino acids; or the insertion of larger amino acid regions, such as the insertion of a specific amino acid domain or other feature. "Substitution" variants preferably involve replacing one or more amino acids with the same number of amino acids and making conservative amino acid substitutions. For example, an amino acid can be replaced with an alternative amino acid having similar properties, such as another basic amino acid, another acidic amino acid, another neutral amino acid, another charged amino acid, another hydrophilic amino acid, another hydrophobic amino acid, another polar amino acid, another aromatic amino acid or another aliphatic amino acid.
[1046] A substitution variant removes at least one amino acid residue in an antibody molecule and inserts a different residue in its place. The sites of most interest for substitution mutagenesis include the hypervariable regions, but framework alterations are also considered. Conservative substitutions are shown under the heading "Conservative Substitutions". If such substitutions result in a change in biological activity, then "Exemplary Substitutions" as shown below or more substantial changes further described below in terms of amino acid classes can be introduced, and the products screened.
[1047] Amino Acids and Substitutions
[1048]
[1049]
[1050]
[1051] Substantial modifications of the biological properties of the antibody are accomplished by selecting substitutions that are significantly different in their effect on maintaining: (a) the structure of the polypeptide backbone in the area of substitution, e.g., as a β-sheet or helical conformation; (b) the charge or hydrophobicity of the molecule at the target site; or (c) the packing of the side chains. Naturally occurring residues are divided into the following groups based on common side-chain properties:
[1052] i. Nonpolar: norleucine, Met, Ala, Val, Leu, Ile;
[1053] ii. Polar, uncharged: Cys, Ser, Thr, Asn, Gln;
[1054] iii. Acidic (negatively charged): Asp, Glu;
[1055] iv. Basic (positively charged): Lys, Arg;
[1056] v. Residues that affect chain orientation: Gly, Pro; and
[1057] vi. Aromatic: Trp, Tyr, Phe, His.
[1058] Non-conservative substitutions are made by exchanging a member of one of these classes for a member of another class.
[1059] One type of substitution that can be performed, for example, is to change one or more cysteines that are capable of chemical reactions in an antibody to another residue such as, for example, but not limited to, alanine or serine. For example, there may be substitutions of atypical (e.g., not preferred or common) cysteines. The substitution can be performed in the CDR or framework region or constant region of the antibody variable domain. In some embodiments, the cysteine is typical (e.g., preferred or most common). Any cysteine residue that does not participate in maintaining the proper conformation of the antibody can generally be substituted with serine to improve the oxidative stability of the molecule and prevent abnormal cross-linking. Conversely, especially when the antibody is an antibody fragment such as an Fv fragment, one or more cysteine bonds can be added to the antibody to improve its stability.
[1060] "Antibody" is an immunoglobulin molecule capable of specifically binding to a target such as, for example, a carbohydrate, polynucleotide, lipid, polypeptide, etc. via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term encompasses not only intact polyclonal or monoclonal antibodies, but also, unless otherwise specified, any antigen-binding fragment that competes with the intact antibody for specific binding, a fusion protein comprising the antigen-binding fragment, and any other modified conformation of the immunoglobulin molecule comprising the antigen recognition site. Antigen-binding fragments include, for example, Fab, Fab’, F(ab’)2, Fd, Fv, domain antibodies (dAb, e.g., shark and camel antibodies), fragments comprising complementarity-determining regions (CDR), single-chain variable fragment antibodies (scFv), gigabodies, minibodies, intrabodies, diabodies, triabodies, tetra-bodies, v-NAR, and bis-scFv and polypeptides containing at least a portion of an immunoglobulin sufficient to enable a particular antigen to bind to the polypeptide.
[1061] Antibodies include antibodies of any class, such as IgG, IgA, or IgM (or their subclasses), and the antibodies need not be of any particular class. Depending on the amino acid sequence of the constant region of the immunoglobulin heavy chain (HC), immunoglobulins can be divided into different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these immunoglobulins can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different classes of immunoglobulins are designated α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional conformations of the different classes of immunoglobulins are well known.
[1062] As used interchangeably herein, an "antigen-binding portion" or "antigen-binding fragment" of an antibody (or just "antibody portion") refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., αvβ8 integrin). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include (i) Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) F(ab’)2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; (iii) Fd fragment consisting of the VH and CH1 domains; (iv) Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of the VH domain; and (vi) isolated complementarity determining regions (CDRs), disulfide-linked Fv (dsFv), and idiotypic (anti-Id) antibodies and intrabodies. Furthermore, although the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that enables them to be made as a single protein chain, where the VL and VH regions pair to form a monovalent molecule (called single-chain Fv (scFv)); see, e.g., Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)). Such single-chain antibodies are also intended to be encompassed by the term "antigen-binding fragment" of an antibody. Other forms of single-chain antibodies are also encompassed, such as diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains on other chains and form two antigen-binding sites (see, e.g., Holliger et al. Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993); Poljak et al., 1994, Structure 2:1121-1123).
[1063] Antibodies can be derived from any mammalian or other animal including but not limited to humans, monkeys, pigs, horses, rabbits, dogs, cats, mice, etc., such as birds (e.g., chickens), fish (e.g., sharks), and camels (e.g., llamas).
[1064] The "variable region" of an antibody refers to the variable region of the antibody light chain (VL) or the variable region of the antibody heavy chain (VH), either alone or in combination. As is known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three "complementary determining regions (CDRs)" (also known as hypervariable regions (HVRs)), and contribute to the formation of the antigen-binding site of the antibody. If variants of the subject variable region are desired, particularly with substitutions in amino acid residues outside the CDR regions (i.e., in the framework regions), suitable amino acid substitutions can be identified by comparing the subject variable region with the variable regions of other antibodies that contain the same canonical classes of CDR1 and CDR2 sequences as the subject variable region (Chothia and Lesk, J. Mol. Biol. 196(4):901-917, 1987).
[1065] In certain embodiments, the definitive delineation of the CDRs and the identification of the residues that comprise the antibody-binding site are accomplished by resolving the structure of the antibody and / or the structure of the antibody-ligand complex. In certain embodiments, this can be accomplished by any of a variety of techniques known to those of skill in the art, such as X-ray crystallography. In certain embodiments, a variety of analytical methods can be employed to identify or approximate the CDR regions. In certain embodiments, a variety of analytical methods can be employed to identify or approximate the CDR regions. Examples of such methods include, but are not limited to, the Kabat definition, the Chothia definition, the AbM definition, the contact definition, and the conformational definition.
[1066] For numbering the amino acid residues that form the CDRs, there are several numbering schemes in the art. The Kabat numbering scheme is the standard for numbering residues in antibodies and is commonly also used to identify the CDRs. See, e.g., Johnson and Wu, 2000, Nucleic Acids Res., 28:214-8. The Chothia definition is similar to the Kabat definition, but the Chothia definition takes into account the positions of certain structural loop regions. See, e.g., Chothia et al., 1986, J. Mol. Biol., 196:901-17; Chothia et al., 1989, Nature, 342:877-83. The AbM definition uses an integrated suite of computer programs produced by Oxford Molecular Group for antibody structure modeling. See, e.g., Martin et al., 1989, Proc Natl Acad Sci (USA), 86:9268-9272; "AbM" TM"A Computer Program for Modeling Variable Regions of Antibodies," Oxford, UK; Oxford Molecular, Ltd. The AbM definition uses a combination of knowledge databases and ab initio methods to model the tertiary structure of antibodies from primary sequences, such as those described below: Samudrala et al., 1999, "Ab Initio Protein Structure Prediction Using a Combined Hierarchical Approach," in PROTEINS, Structure, Function and Genetics Suppl., 3:194-198.
[1067] The contact definition is based on the analysis of available complex crystal structures. See, e.g., MacCallum et al., 1996, J. Mol. Biol., 5:732-45. In another method (referred to herein as the "conformational definition" of CDRs), the positions of CDRs can be identified as the residues that contribute enthalpy to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166. Although other CDR boundary definitions may not strictly follow one of the above methods, they will still overlap with at least a portion of the Kabat CDRs, but they can be shortened or lengthened based on the following predictive or experimental findings: specific residues or groups of residues do not significantly affect antigen binding. As used herein, a CDR can refer to a CDR defined by any method known in the art, including combinations of methods. The methods used herein can utilize CDRs defined according to any of these methods. For any given embodiment containing more than one CDR, the CDRs can be defined according to any one of the Kabat definition, the Chothia definition, the extended definition, the AbM definition, the contact definition, and / or the conformational definition.
[1068] As used herein, a "contact residue" with respect to an antibody or an antigen specifically bound thereby refers to an amino acid residue present on the antibody / antigen that contains at least one heavy atom (i.e., non-hydrogen), the heavy atoms of which are within or a smaller range of the heavy atoms of the amino acid residues present on a homologous antibody / antigen.
[1069] "Framework" (FR) residues are the antibody variable domain residues other than CDR residues. The VH or VL domain framework contains four framework sub-regions FR1, FR2, FR3, and FR4, interspersed with CDRs having the following structure: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[1070] Residues in the variable domains are generally numbered according to Kabat, which provides a numbering system for the compiled heavy-chain variable domain or light-chain variable domain of an antibody. See Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids that correspond to insertions into or deletions of the FRs or CDRs of the variable domain. For example, the heavy-chain variable domain may contain a single amino acid insertion sequence after residue 52 of H2 (residue 52a according to Kabat) and insertion residues after heavy-chain FR residue 82 (e.g., residues 82a, 82b, and 82c according to Kabat). For a given antibody, the Kabat numbering of residues can be determined by aligning the homologous regions of the antibody sequence with the "standard" Kabat-numbered sequence. A variety of algorithms for assigning Kabat numbers are available. The algorithm implemented in version 2.3.3 of Abysis (www.abysis.org) can be used to assign Kabat numbers to variable-region CDR-L1, CDR-L2, CDR-L3, CDR-H2, and CDR-H3, and the AbM definition can then be used for CDR-H1.
[1071] As used herein, a "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies (i.e., each antibody constituting the population is identical except for possible naturally occurring mutations that may be present in minor amounts). Monoclonal antibodies are highly specific for a single antigenic site. In addition, in contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates that the antibody is characterized by being obtained from a substantially homogeneous population of antibodies and should not be construed as requiring that the antibody be made by any particular method. For example, monoclonal antibodies used in accordance with the present invention may be prepared by the hybridoma method first described by Kohler and Milstein, 1975, Nature 256:495, or may be prepared by recombinant DNA methods such as those described in U.S. Patent No. 4,816,567. For example, monoclonal antibodies may also be isolated from phage libraries using the techniques described in McCafferty et al., 1990, Nature 348:552-554. As used herein, a "humanized" antibody is a form of a non-human (e.g., murine) antibody that is a chimeric immunoglobulin, immunoglobulin chain, or fragment thereof (e.g., Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of an antibody) that contains minimal sequences derived from non-human immunoglobulins. Preferably, a humanized antibody is a human immunoglobulin (recipient antibody) having the desired specificity, affinity, and capacity, wherein residues of the CDRs from the recipient are replaced by residues of the CDRs from a non-human species such as mouse, rat, or rabbit (donor antibody). A humanized antibody may contain residues that are neither present in the recipient antibody nor in the imported CDR or framework sequences, but include such residues to further refine and optimize antibody potency.
[1072] The antibodies or antigen-binding fragments thereof of the present invention may be affinity matured. For example, affinity matured antibodies may be generated by procedures known in the art (Marks et al., 1992, Bio / Technology, 10:779-783; Barbas et al., 1994, Proc Nat. Acad. Sci, USA 91:3809-3813; Schier et al., 1995, Gene, 169:147-155; Yelton et al., 1995, J. Immunol., 155:1994-2004; Jackson et al., 1995, J. Immunol., 154(7):3310-9; Hawkins et al., 1992, J. Mol. Biol., 226:889-896; and WO2004 / 058184).
[1073] "Human antibody" refers to an antibody having the following amino acid sequence: corresponding to the amino acid sequence of an antibody produced by a human and / or prepared using any of the techniques for preparing human antibodies disclosed herein. This definition of a human antibody specifically excludes humanized antibodies that contain non-human antigen-binding residues.
[1074] The term "chimeric antibody" means an antibody in which the variable region sequence is derived from one species and the constant region sequence is derived from another species, for example, an antibody in which the variable region sequence is derived from a murine antibody and the constant region sequence is derived from a human antibody, and vice versa. The term also encompasses antibodies that contain the V region from one individual of a species (e.g., a first mouse) and the constant region from another individual of the same species (e.g., a second mouse).
[1075] The term "antigen (Ag)" refers to a molecular entity used to immunize an immunocompetent vertebrate to generate antibodies (Abs) that recognize the Ag or to screen an expression library (e.g., a phage, yeast, or ribosome display library and other libraries). In the present application, Ag is referred to by the more general name and generally intends to include the target molecule specifically recognized by the Ab, and thus includes fragments or mimics of said molecule used in the immunization process for generating the Ab or in the library screening for selecting the Ab. Thus, for the antibodies of the present invention that bind to αvβ8 integrin, the full-length αvβ8 integrin from mammalian species (e.g., human, monkey, mouse, and rat αvβ8 integrin), including monomers and multimers, such as its dimer, trimer, etc., and truncated and other variants of αvβ8 integrin are referred to as antigens.
[1076] Generally speaking, the term "epitope" refers to the region or domain of an antigen (e.g., a protein, nucleic acid, carbohydrate, or lipid, etc.) that specifically binds to an antibody, i.e., the region or domain that physically contacts the antibody. Thus, the term "epitope" refers to the molecular moiety that can be recognized and bound by an antibody at the antigen-binding region of one or more antibodies. Usually, epitopes are defined in the context of the molecular interaction between an "antibody or its antigen-binding portion" (Ab) and its corresponding antigen. Epitopes typically consist of surface groupings of molecules such as amino acids or sugar side chains, and have specific three-dimensional structural features as well as specific charge characteristics. In some embodiments, the epitope can be a protein epitope. Protein epitopes can be linear or conformational. In a linear epitope, all interaction points between the protein and the interacting molecule (e.g., an antibody) are linearly present along the primary amino acid sequence of the protein. A "non-linear epitope" or "conformational epitope" comprises non-adjacent polypeptides (or amino acids) within the antigen protein that is bound by an antibody specific for the epitope. As used herein, the term "antigenic epitope" is defined as the part of an antigen that can specifically bind to an antibody, as determined by any method well known in the art (e.g., by conventional immunoassays). Alternatively, during the discovery process, the generation and characterization of antibodies can elucidate information about the desired epitope. Based on this information, antibodies that bind to the same epitope can subsequently be competitively screened. A way to achieve this is to conduct competition and cross-competition studies to find antibodies that compete or cross-compete with each other for binding to αvβ8 integrin, e.g., antibodies that compete for binding to an antigen.
[1077] Antibodies that "bind preferentially" or "bind specifically" (used interchangeably herein) to an epitope are well-known terms in the art, and methods for determining such specific or preferential binding are also well-known in the art. A molecule is said to exhibit "specific binding" or "preferential binding" if it reacts or associates more frequently, more rapidly, for a longer duration, and / or with greater affinity with a particular cell or substance than with alternative cells or substances. An antibody "specifically binds" or "preferentially binds" to a target if it binds to the target with greater affinity, avidity, more readily, and / or for a longer duration compared to its binding to other substances. Further, an antibody "specifically binds" or "preferentially binds" to a target in a sample if it binds to the target in the sample with greater affinity, avidity, more readily, and / or for a longer duration compared to its binding to other substances present in the sample. For example, an antibody that specifically or preferentially binds to an αvβ8 integrin epitope binds to that epitope with greater affinity, avidity, more readily, and / or for a longer duration compared to its binding to other αvβ8 integrin epitopes or non-αvβ8 integrin epitopes. It should also be understood from this definition that, for example, an antibody (or portion or epitope) that specifically or preferentially binds to a first target may or may not specifically or preferentially bind to a second target. Thus, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. Generally, but not necessarily, reference to binding implies preferential binding. "Specific binding" or "preferential binding" includes compounds (such as proteins, nucleic acids, antibodies, etc.) that recognize and bind to a particular molecule but do not substantially recognize or bind to other molecules in a sample. For example, an antibody or peptide receptor that recognizes and binds to a cognate ligand or binding partner in a sample (such as an anti-αvβ8 integrin antibody that binds αvβ8 integrin) but does not substantially recognize or bind to other molecules in the sample specifically binds to that cognate ligand or binding partner. Thus, under specified assay conditions, a specified binding moiety (such as, for example, an antibody or its antigen-binding fragment or a receptor or its ligand-binding portion) preferentially binds to a particular target molecule and does not bind substantially to other components present in a test sample.
[1078] A variety of assay formats can be used to select antibodies or peptides that specifically bind to a molecule of interest. For example, solid-phase ELISA immunoassays, immunoprecipitation, Biacore TM (GE Healthcare, Piscataway, NJ), KinExA, fluorescence-activated cell sorting (FACS), Octet TM(FortéBio, Inc., Menlo Park, CA) and Western blot analysis are used in many assays that can be used to identify antibodies or their antigen-binding fragments or receptors or their ligand-binding portions, where the antibody specifically reacts with an antigen and the receptor or its ligand-binding portion specifically binds to a cognate ligand or binding partner. Typically, the specific or selective reaction will be at least twice the background signal or noise, more typically more than 10-fold the background, even more typically more than 50-fold the background, more typically more than 100-fold the background, still more typically more than 500-fold the background, even more typically more than 1000-fold the background, and even more typically more than 10,000-fold the background. Additionally, an antibody is said to "specifically bind" an antigen when the equilibrium dissociation constant (K D ) ≤ 1 μM, preferably ≤ 100 nM, more preferably ≤ 10 nM, even more preferably ≤ 100 pM, still more preferably ≤ 10 pM, and even more preferably ≤ 1 pM. In some embodiments, an antibody is said to "specifically bind" an antigen when the equilibrium dissociation constant (K D ) ≤ 7 nM.
[1079] The term "binding affinity" is used herein as a measure of the strength of non-covalent interactions between two molecules (e.g., an antibody or its fragment and an antigen). The term "binding affinity" is used to describe a monovalent interaction (intrinsic activity).
[1080] Additionally, to determine the binding affinity of an anti-αvβ8 integrin antibody to cells expressing αvβ8 integrin, a cell-binding assay can be performed to determine the apparent affinity. The apparent affinity of an antibody for cells expressing the target can be calculated as the EC 50 of the equilibrium binding titration curve, where the geometric mean fluorescence intensity (gMFI) of the antigen-binding population is quantified by flow cytometry.
[1081] The binding affinity between two molecules (e.g., an antibody or its fragment and an antigen) through a monovalent interaction can be quantified by determining the dissociation constant (K D ). Conversely, K D can be determined by kinetic measurements of complex formation and dissociation using, for example, surface plasmon resonance (SPR) methods (Biacore). The rate constants corresponding to the association and dissociation of the monovalent complex are referred to as the association rate constant k a (or k on ) and the dissociation rate constant k d (or k off ), respectively. K D is related to k D and k d via the equation K a = k a / kd is related. Dissociation constant values can be directly determined by well-known methods, and the dissociation constant values of complex mixtures can even be calculated by these methods such as those described by Caceci et al. (1984, Byte 9:340-362). For example, K D can be established using, for example, the double-filter nitrocellulose filter binding assay disclosed by Wong and Lohman (1993, Proc. Natl. Acad. Sci. USA 90:5428-5432). Other standard assays for evaluating the binding ability of ligands (such as antibodies against a target antigen) are known in the art, including, for example, ELISA, Western blotting, RIA, and flow cytometry analysis and other assays exemplified elsewhere in this text. The binding kinetics and binding affinity of antibodies can also be evaluated by standard assays known in the art, such as by using Biacore TM system or KinExA for surface plasmon resonance (SPR).
[1082] Competitive binding assays can be performed, in which the binding of an antibody to an antigen is compared to the binding of another ligand of the target (such as another antibody or soluble receptor that binds the target in another way) to the target. The concentration at which 50% inhibition occurs is called K i . Under ideal conditions, K i is equal to K D . K i values should never be less than K D , so the measurement of K i can be conveniently replaced to provide an upper limit for K D .
[1083] Following the above definitions, the binding affinity associated with different molecular interactions (such as comparing the binding affinities of different antibodies for a given antigen) can be compared by comparing the K D values of individual antibody / antigen complexes. The K D values of antibodies or other binding partners can be determined using methods recognized in the art. One method for determining K D is by using surface plasmon resonance, typically using a biosensor system (such as system).
[1084] Similarly, the specificity of an interaction can be evaluated by determining and comparing the K D values of the interaction of interest (such as the specific interaction between an antibody and an antigen) with the K D values of non-interactions of interest (such as a control antibody known not to bind αvβ8 integrin).
[1085] An antibody that specifically binds to its target may bind to its target with high affinity, which as discussed above exhibits a low K. D , and can bind to other non-target molecules with lower affinity. For example, an antibody can bind to 1×10 -6 M or more, more preferably 1×10 -5 M or more, more preferably 1×10 -4 M or more, more preferably 1×10 -3 M or more, even more preferably 1×10 -2 M or larger K D Binding to Non-Target Molecules. An antibody of the invention is preferably capable of binding to its target with an affinity that is at least two-fold, 10-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1,000-fold, or 10,000-fold or greater than the affinity of the antibody binding to another non-αvβ8 integrin molecule.
[1086] As used herein, the term "competition" with respect to antibodies refers to the binding of a first antibody or its antigen-binding fragment to an epitope in a manner sufficiently similar to the binding of a second antibody or its antigen-binding fragment, so that the result of the binding of the first antibody to its cognate epitope in the presence of the second antibody is detectably reduced compared to the binding of the first antibody in the absence of the second antibody. An alternative is possible but not necessarily so: the binding of the second antibody to its epitope in the presence of the first antibody may also be detectably reduced. That is, the first antibody may inhibit the binding of the second antibody to its epitope, while the second antibody does not inhibit the binding of the first antibody to its corresponding epitope. However, in the case where each antibody detectably inhibits the binding of another antibody to its cognate epitope or ligand, whether the degree is the same, greater or less, the antibodies are referred to as "cross-competing" with each other to bind to their corresponding one or more epitopes. The present invention encompasses both competing and cross-competing antibodies. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational changes, or binding to a common epitope or portion thereof), those skilled in the art will understand based on the teachings provided herein that such competing and / or cross-competing antibodies are covered by the methods disclosed herein and may be applicable to the methods disclosed herein.
[1087] Standard competition assays can be used to determine whether two antibodies compete with each other. One suitable assay for antibody competition involves the use of Biacore technology, which can use surface plasmon resonance (SPR) technology, typically using a biosensor system (e.g. The degree of interaction can be measured by using a SPR system. For example, SPR can be used in an in vitro competitive binding inhibition assay to determine the ability of one antibody to inhibit the binding of a second antibody. Another assay for measuring antibody competition uses an ELISA-based method.
[1088] In addition, high-throughput methods for "grouping" antibodies based on antibody competition are described in International Patent Application No. WO2003 / 48731. Competition exists if one antibody (or fragment) reduces the binding of another antibody (or fragment) to αvβ8 integrin. For example, a sequential binding competition assay can be used, in which different antibodies are added sequentially. A first antibody can be added to achieve near-saturating binding. Then, a second antibody is added. If binding of the second antibody to αvβ8 integrin is not detected, or is significantly reduced (e.g., reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%) compared to a parallel assay in the absence of the first antibody (the value of which can be set at 100%), the two antibodies are considered to compete with each other.
[1089] Additionally, in Example 9, an exemplary antibody epitope grouping assay is provided that uses domain swapping between human and murine αvβ8 integrin proteins to evaluate possible epitopes among several antibodies. Those skilled in the art, in light of the teachings provided herein, will understand that there are various assays known in the art that can be used to determine the binding of at least two to a target relative to each other, and such assays are included herein.
[1090] Anti-αvβ8 integrin antibodies can be characterized using methods well known in the art. For example, one method is to identify the epitope to which it binds, or "epitope mapping". Many methods for mapping and characterizing the location of epitopes on proteins are known in the art, including solving the crystal structure of the antibody-antigen complex, competition assays, gene fragment expression assays, and synthetic peptide-based assays, such as those described in Chapter 11 of Harlow and Lane, Using Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1999. In additional examples, epitope mapping can be used to determine the sequence to which an anti-αvβ8 integrin antibody binds. Epitope mapping can be obtained commercially from various sources, such as Pepscan Systems (Edelhertweg 15, 8219 PH Lelystad, The Netherlands). Epitopes can be linear epitopes, i.e., contained in a single segment of amino acids; or conformational epitopes, which are formed by three-dimensional interactions of amino acids that may not necessarily be contained in a single segment. Peptides of different lengths (e.g., at least 4-6 amino acids long) can be isolated or (e.g., recombinantly) synthesized and used in binding assays for anti-αvβ8 integrin antibodies.
[1091] In addition, the epitopes bound by anti-αvβ8 integrin antibodies can be determined in a systematic screen by using overlapping peptides derived from the αvβ8 integrin sequence (e.g., the human αvβ8 integrin sequence) and assaying antibody binding. Based on gene fragment expression assays, the open reading frame encoding αvβ8 integrin can be fragmented randomly or by specific genetic constructs and the reactivity of the expressed fragments of αvβ8 integrin with the antibody to be tested can be assayed. The gene fragments can be generated, for example, by PCR and then in vitro transcribed and translated into protein in the presence of radiolabeled amino acids. Subsequently, the binding of the antibody to the radiolabeled αvβ8 integrin fragment is assayed by immunoprecipitation and gel electrophoresis.
[1092] Certain epitopes can also be identified by using large libraries of random peptide sequences displayed on the surface of phage particles (phage libraries) or yeast (yeast display). Alternatively, defined libraries of overlapping peptide fragments can be tested for binding to the test antibody in a simple binding assay. In additional examples, mutagenesis of the antigen, domain swapping experiments, and alanine scanning mutagenesis can be performed to identify residues required, sufficient, and / or essential for epitope binding. For example, alanine scanning mutagenesis experiments can be performed using mutant αvβ8 integrin in which various residues of the αvβ8 integrin polypeptide have been replaced with alanine. By evaluating the binding of the antibody to the mutant αvβ8 integrin, the importance of specific αvβ8 integrin residues for antibody binding can be evaluated.
[1093] Another method that can be used to characterize anti-αvβ8 integrin antibodies is to use a competition assay that uses other antibodies known to bind to the same antigen (i.e., various fragments on αvβ8 integrin) to determine whether the anti-αvβ8 integrin antibody binds to the same epitope as the other antibodies. Competition assays are well known to those skilled in the art.
[1094] In addition, various experimental and computational epitope mapping methods can be used to define and characterize the epitope of a given antibody / antigen binding pair with different levels of detail. The experimental methods include mutagenesis, X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, hydrogen / deuterium exchange mass spectrometry (H / D-MS), and various competition binding methods well known in the art. Since each method relies on unique principles, the description of the epitope is closely related to the method used to determine the epitope. Thus, depending on the epitope mapping method employed, the epitope of a given antibody / antigen pair will be defined differently.
[1095] At its most detailed level, an epitope for the interaction between an Ag and an Ab can be defined by defining the spatial coordinates of the atomic contacts present in the Ag-Ab interaction and information regarding their relative contribution to the binding thermodynamics. At a less detailed level, an epitope can be characterized by defining the spatial coordinates of the atomic contacts between the Ag and the Ab. At an even less detailed level, an epitope can be characterized by the amino acid residues it contains, as defined by specific criteria, such as by the distance between atoms (e.g., heavy atoms, i.e., non-hydrogen atoms) in the Ab and the Ag. At an even less detailed level, an epitope can be characterized by function, e.g., by competitive binding with other Abs. An epitope can also be more generally defined as containing amino acid residues for which replacement by another amino acid would alter the characteristics of the interaction between the Ab and the Ag (e.g., using alanine scanning).
[1096] Due to the fact that descriptions and definitions of epitopes are obtained at different levels of detail depending on the epitope mapping method used, comparisons of epitopes of different Abs on the same Ag can thus similarly be carried out at different levels of detail.
[1097] If, when described at the amino acid level, e.g., an epitope determined from an X-ray structure contains the same set of amino acid residues, the epitopes are said to be identical. If the epitopes share at least one amino acid, the epitopes are said to be overlapping. If the epitopes do not share amino acid residues, the epitopes are said to be independent (unique).
[1098] If the binding of the corresponding Abs is mutually exclusive, i.e., the binding of one Ab precludes the simultaneous or consecutive binding of the other Ab, epitopes characterized by competitive binding are said to be overlapping. If the antigen can accommodate the binding of two corresponding Abs simultaneously, the epitopes are said to be independent (unique).
[1099] The definition of the term "paratope" is derived from the definition of "epitope" above by reversing the perspective. Thus, the term "paratope" refers to the region or area on an antibody that specifically binds an antigen, i.e., the amino acid residues on the antibody that make contact with the antigen (αvβ8 integrin or a portion thereof), as defined elsewhere herein as "contact".
[1100] The epitopes and paratopes of a given antibody / antigen pair can be identified by conventional methods. For example, the general location of an epitope can be determined by evaluating the ability of an antibody to bind to different fragments or variant αvβ8 integrin polypeptides. The specific amino acids within αvβ8 integrin that contact the antibody (epitope) and the specific amino acids within the antibody that contact αvβ8 integrin (paratope) can also be determined using conventional methods (such as the methods described in the examples). For example, an antibody and a target molecule can be combined and the antibody / antigen complex can be crystallized. The crystal structure of the complex can be determined and used to identify the specific sites of interaction between the antibody and its target.
[1101] The antibodies according to the invention can bind to the same epitope as the antibodies of the invention specifically disclosed herein or to a domain of αvβ8 integrin (such as human αvβ8 integrin). For such identification purposes, the assays and determinations that can be used include assays evaluating the binding competition of αvβ8 integrin between an antibody of interest and the αvβ8 integrin receptor in the bioactivity assays described in Examples 1-26.
[1102] An antibody or an antigen-binding fragment thereof can have the ability to compete or cross-compete with another antibody of the invention for binding to αvβ8 integrin (such as, human αvβ8 integrin) as described herein. For example, the antibodies of the invention can compete or cross-compete with the antibodies described herein for binding to αvβ8 integrin or for binding to a suitable fragment or variant of αvβ8 integrin that binds to the antibodies disclosed herein.
[1103] That is, if a first antibody competes with a second antibody for binding to αvβ8 integrin, but does not compete when the second antibody binds to αvβ8 integrin first, it is considered to compete with the second antibody (also referred to as one-way competition). When an antibody competes with another antibody regardless of which antibody binds to αvβ8 integrin first, then the antibody "cross-competes" with the other antibody for binding to αvβ8 integrin. Such competing or cross-competing antibodies can be identified based on their ability to compete / cross-compete with a known antibody of the invention in a standard binding assay. For example, competition / cross-competition can be demonstrated using SPR by a system such as Biacore, TM ELISA assay or flow cytometry. Such competition / cross-competition can indicate that the two antibodies bind to the same, overlapping or similar epitopes.
[1104] Thus, the antibodies of the present invention can be identified by methods including binding assays that evaluate whether a test antibody is able to compete / cross-compete with a reference antibody for a binding site on a target molecule. Methods for performing competitive binding assays are disclosed herein and / or are well known in the art. For example, it can involve binding a reference antibody of the present invention to a target molecule using conditions under which the antibody can bind to the target molecule. Subsequently, the antibody / target complex can be exposed to a test antibody / second antibody and the extent to which the test antibody is able to displace the reference antibody of the present invention from the antibody / target complex can be evaluated. An alternative method can involve contacting a test antibody with a target molecule under conditions that permit antibody binding, subsequently adding a reference antibody of the present invention that is able to bind to that target molecule, and evaluating the extent to which the reference antibody of the present invention is able to displace the test antibody in the antibody / target complex or bind to the target simultaneously (i.e., non-competing antibody).
[1105] The ability of a test antibody to inhibit the binding of a reference antibody of the present invention to a target demonstrates that the test antibody can compete with the reference antibody of the present invention for binding to the target and thus that the test antibody binds to an epitope or region on the αvβ8 integrin protein that is the same or substantially the same as that of the reference antibody of the present invention. A test antibody identified as competing with the reference antibody of the present invention in such methods is also an antibody of the present invention. The fact that the test antibody can bind to the same αvβ8 integrin region as the reference antibody of the present invention and can compete with the reference antibody of the present invention indicates that the test antibody can act as a ligand at the same binding site as the antibody of the present invention and that the test antibody can thus mimic the action of the reference antibody and is therefore an antibody of the present invention. This can be confirmed by comparing the activity of αvβ8 integrin in the presence of the test antibody with the activity of αvβ8 integrin in the presence of the reference antibody using an assay as more fully described elsewhere herein under otherwise identical conditions.
[1106] The reference antibody of the present invention or an antigen-binding fragment thereof can be an antibody as described herein, such as the antibodies in Table 1 described herein and any variants or fragments thereof that retain the ability to bind to αvβ8 integrin.
[1107] As previously described elsewhere herein, specific binding can be evaluated by reference to the binding of an antibody to a molecule that is not the target. This comparison can be made by comparing the ability of the antibody to bind to the target with the ability of the antibody to bind to another molecule. This comparison can be made as described above in the evaluation of K D or K i . Other molecules for use in such a comparison can be any molecule that is not the target molecule. Preferably, the other molecule is not the same as the target molecule. Preferably, the target molecule is not a fragment of the target molecule.
[1108] Other molecules for determining specific binding can be structurally or functionally unrelated to the target. For example, the other molecules can be unrelated or concomitant materials in the environment.
[1109] Other molecules for determining specific binding can be another molecule involved in the same in vivo pathway as the target molecule, such as αvβ8 integrin (e.g., human αvβ8 integrin). By ensuring that the antibody of the present invention is specific for αvβ8 integrin compared to another such molecule, unwanted in vivo cross-reactions can be avoided.
[1110] The antibodies of the present invention can retain the ability to bind to some molecules associated with the target molecule.
[1111] Alternatively, the antibodies of the present invention can be specific for a particular target molecule. For example, it can bind to a target molecule as described herein, but may not bind or may bind with significantly reduced affinity to a different target molecule as described herein. For example, full-length mature human αvβ8 integrin can be used as a target, but an antibody that binds to this target may not bind or may bind with lower affinity to other αvβ8 integrin proteins from other species, such as other mammalian αvβ8 integrins. In some embodiments, the antibody binds to both human and mouse αvβ8 integrins.
[1112] An "Fc fusion" protein is a protein in which one or more polypeptides are operably linked to an Fc polypeptide. Fc fusions combine the Fc region of an immunoglobulin with a fusion partner.
[1113] A "native sequence Fc region" contains an amino acid sequence that is the same as the amino acid sequence of the Fc region found in nature. A "variant Fc region" contains an amino acid sequence that is different from the amino acid sequence of the native sequence Fc region by virtue of at least one amino acid modification but retains at least one effector function of the native sequence Fc region. Preferably, compared to the native sequence Fc region or to the Fc region of the parental polypeptide, the variant Fc region has at least one amino acid substitution in the native sequence Fc region or in the Fc region of the parental polypeptide, such as from about one to about ten amino acid substitutions, and preferably from about one to about five amino acid substitutions. In the present context, the variant Fc region preferably has at least about 80% sequence identity with the native sequence Fc region and / or with the Fc region of the parental polypeptide, and most preferably has at least about 90% sequence identity therewith, more preferably has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity therewith.
[1114] As is known in the art, the "constant region" of an antibody refers to the constant region of the antibody light chain or the constant region of the antibody heavy chain, either alone or in combination.
[1115] The terms “IgG Fc region”, “Fc region”, “Fc domain” and “Fc”, used interchangeably herein, refer to a part of an IgG molecule that is related to the crystallizable fragment obtained by pepsin digestion of the IgG molecule. As used herein, the term refers to the antibody constant region excluding the first constant region immunoglobulin domain and also to portions of that region. Thus, Fc refers to the last two constant region immunoglobulin domains of IgA, IgD and IgG, and the last three constant region immunoglobulin domains of IgE and IgM and the flexible hinge N-terminus of these domains or portions thereof. For IgA and IgM, Fc may include the J chain. For IgG, Fc contains the immunoglobulin domains Cγ2 and Cγ3 (C gamma 2 and C gamma 3) and the hinge between Cγ1 (C gamma 1) and Cγ2 (C gamma 2). Although the boundaries of the Fc region may be altered, the human IgG heavy chain Fc region is generally defined as containing residue C226 or P230 relative to its carboxyl terminus, where numbering is according to the Eu index of Edelman et al., 1969, Proc. Natl. Acad. Sci. USA 63(1):78-85 as described by Kabat et al., 1991. Generally, the Fc domain contains from about amino acid residue 236 to about 447 of the human IgG1 constant domain. Exemplary human wild-type IgG1 Fc domain amino acid sequences are set forth in SEQ ID NO:81 and SEQ ID NO:82 (including optionally terminal lysine (K) residues). An Fc polypeptide may refer to this isolated region, or to this region in the context of an antibody or its antigen-binding fragment, or an Fc fusion protein.
[1116] The heavy chain constant domain contains the Fc region and further contains the CH1 domain and hinge and the CH2 and CH3 (and optionally the CH4 of IgA and IgE) domains of the IgG heavy chain.
[1117] A “functional Fc region” possesses at least one effector function of a native sequence Fc region. Exemplary “effector functions” include C1q binding; complement-dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity; phagocytosis; downregulation of cell surface receptors (e.g., B cell receptors), etc. Such effector functions generally require the Fc region to be combined with a binding domain (e.g., an antibody variable domain or its antigen-binding fragment), and can be evaluated using various assays known in the art for evaluating such antibody effector functions.
[1118] "Native sequence Fc region" encompasses an amino acid sequence identical to the amino acid sequence of an Fc region found in nature. Native sequence human Fc regions include the native sequence human IgG1 Fc region (non-A and A allotypes); the native sequence human IgG2 Fc region; the native sequence human IgG3 Fc region; and the native sequence human IgG4 Fc region, as well as their naturally-occurring variants.
[1119] "Variant Fc region" encompasses an amino acid sequence that differs from the amino acid sequence of a native sequence Fc region by at least one amino acid modification.
[1120] "Fc receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. In some embodiments, an FcγR is a native human FcR. In some embodiments, an FcR is an FcR that binds an IgG antibody (γ receptor) and includes receptors of the FcγRI, FcγRII, and FcγRIII subclasses, including allelic variants and alternatively spliced forms of these receptors. The FcγRII receptor includes FcγRIIA ("activating receptor") and FcγRIIB ("inhibitory receptor"), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. The activating receptor FcγRIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. The inhibitory receptor FcγRIIB contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain (see, e.g., Daeron, Annu. Rev. Immunol. 15:203-234 (1997)). FcRs are reviewed, for example, in Ravetch and Kinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab. Clin. Med. 126:330-41 (1995). Other FcRs, including those to be identified in the future, are encompassed by the term "FcR" herein.
[1121] The term "Fc receptor" or "FcR" also includes the neonatal receptor FcRn, which is responsible for the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)) and regulates the homeostasis of immunoglobulins. Methods for measuring binding to FcRn are known (see, e.g., Ghetie and Ward., Immunol. Today 18(12):592-598 (1997); Ghetie et al., Nature Biotechnology, 15(7):637-640 (1997); Hinton et al., J. Biol. Chem. 279(8):6213-6216 (2004); WO 2004 / 92219 (Hinton et al.)).
[1122] "Effector function" refers to the biological activities attributable to the Fc region of an antibody, which vary with antibody isotype. Examples of antibody effector functions include: Clq binding and complement-dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation.
[1123] "Human effector cells" are leukocytes that express one or more FcRs and perform effector functions. In certain embodiments, the cells express at least FcγRIII and perform one or more ADCC effector functions. Examples of human leukocytes that mediate ADCC include peripheral blood mononuclear cells (PBMC), natural killer (NK) cells, monocytes, macrophages, cytotoxic T cells, and neutrophils. Effector cells can be isolated from natural sources, such as blood.
[1124] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fc receptors (FcRs) present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) enables these cytotoxic effector cells to specifically bind to target cells bearing an antigen and subsequently kill the target cells with cytotoxins. The primary cells used to mediate ADCC, NK cells, express only FcγRIII, while monocytes express FcγRI, FcγRII, and FcγRIII. The expression of FcRs on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9:457-92 (1991). To assess the ADCC activity of a molecule of interest, an in vitro ADCC assay can be performed, such as the in vitro ADCC assays described in U.S. Patent No. 5,500,362 or 5,821,337 or U.S. Patent No. 6,737,056 (Presta). Effector cells suitable for such assays include PBMC and NK cells. Alternatively or additionally, the ADCC activity of a molecule of interest can be evaluated in vivo, such as in an animal model, for example, the animal model disclosed in Clynes et al., Proc. Natl. Acad. Sci. (USA) 95:652-656 (1998). Additional antibodies with altered Fc region amino acid sequences and enhanced or reduced ADCC activity are described, for example, in U.S. Patent Nos. 7,923,538 and 7,994,290.
[1125] An antibody with "enhanced ADCC activity" refers to an antibody that is more effective than the parental antibody in mediating ADCC in vitro or in vivo, where the antibody and the parental antibody differ in at least one structural aspect and the amounts of such antibody and parental antibody are substantially the same when used in an assay. In some embodiments, the antibody and the parental antibody have the same amino acid sequence, but the antibody is non-fucosylated while the parental antibody is fucosylated. In some embodiments, the ADCC activity will be determined using the in vitro ADCC assay disclosed herein, but other assays or methods for determining ADCC activity are encompassed, such as in an animal model, etc. In some embodiments, an antibody with enhanced ADCC activity has enhanced affinity for FcγRIIIA.
[1126] An antibody having an "altered" FcR binding affinity or ADCC activity is an antibody having enhanced or diminished FcR binding activity and / or ADCC activity compared to a parental antibody, wherein the antibody and the parental antibody differ in at least one structural aspect. An antibody that "exhibits increased binding to FcR" binds at least one FcR with a greater affinity than the parental antibody. An antibody that "exhibits decreased binding to FcR" binds at least one FcR with a lower affinity than the parental antibody. Such an antibody that exhibits decreased binding to FcR may bind to the FcR rarely or with no apparent binding compared to a native sequence IgG Fc region, e.g., 0 - 20% binding to the FcR.
[1127] "Enhanced affinity for FcγRIIIA" means that the antibody has a higher affinity for FcγRIIIA (also referred to as CD 16a in some instances) compared to the parental antibody, wherein the antibody and the parental antibody differ in at least one structural aspect.
[1128] "Glycan" refers to a complex oligosaccharide structure that contains linkages of various carbohydrate units. Such structures are described, for example, in Essentials of Glycobiology, edited by Varki et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999), which also provides a review of standard glycobiology nomenclature. Such glycans include, but are not limited to, G2, G1, G0, G - 1, and G - 2 (see, e.g., International Patent Publication No. WO 99 / 22764).
[1129] "Glycosylation pattern" is defined as the pattern of carbohydrate units that are covalently attached to a protein (e.g., a glycan) and at one or more sites at which one or more glycans are covalently attached to the peptide backbone of the protein, more specifically to the peptide backbone of an immunoglobulin.
[1130] "Complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by binding of the first component of the complement system (Clq) to an antibody (of the appropriate subclass) that is bound to its cognate antigen. To assess complement activation, a CDC assay can be performed, for example, as described in Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996). Antibodies having altered Fc region amino acid sequences and increased or decreased Clq binding ability are described, for example, in U.S. Patent No. 6,194,551 B1, U.S. Patent No. 7,923,538, U.S. Patent No. 7,994,290, and WO 1999 / 51642. See also, for example, Idusogie et al., J.
[1131] As used herein, the terms "wild-type amino acid", "wild-type IgG", "wild-type antibody", or "wild-type mAb" refer to the sequences of amino acids or nucleic acids that occur naturally within a population (e.g., humans, mice, rats, cells, etc.).
[1132] As used herein, the term "αvβ8 integrin" generally refers to a protein complex comprising an α integrin subunit (e.g., integrin α-V subunit, e.g., ITGAV, e.g., comprising the amino acid sequence of SEQ ID NO:77) and a β integrin subunit (e.g., integrin subunit β8, e.g., ITGB8, e.g., comprising the amino acid sequence of SEQ ID NO:78). As used herein, "human αvβ8 integrin" generally refers to αvβ8 integrin that, for example, comprises a human ITGAV α subunit, e.g., comprising the sequence of SEQ ID NO:77; and a human ITGB8 β subunit, e.g., comprising the sequence of SEQ ID NO:78. As used herein, "murine αvβ8 integrin" or "mouse αvβ8 integrin" generally refers to αvβ8 integrin that, for example, comprises a murine ITGAV α subunit, e.g., comprising the sequence of SEQ ID NO:79; and a murine ITGB8 β subunit, e.g., comprising the sequence of SEQ ID NO:80. The term αvβ8 integrin generally includes αvβ8 integrin homologs and orthologs, including but not limited to human, cynomolgus monkey, rat, rabbit, and mouse. As used herein, "αvβ8 integrin" generally refers to mammalian αvβ8 integrin, such as human, rat, mouse, non-human primate, bovine, ovine, or porcine αvβ8 integrin (e.g., comprising an integrin α-V subunit and an integrin β8 subunit from human, rat, mouse, non-human primate, bovine, ovine, or porcine, respectively). Non-limiting exemplary instances of the integrin α-V subunit include human (see, e.g., Genbank accession number P06756.2, SEQ ID NO:77), cynomolgus monkey (see, e.g., SEQ ID NO:84), and mouse (see, e.g., SEQ ID NO:79) αvβ8 integrin. Non-limiting exemplary instances of the integrin β8 subunit include human (see, e.g., Genbank accession number P26012.1, SEQ ID NO:78), cynomolgus monkey (see, e.g., SEQ ID NO:85), and mouse (see, e.g., SEQ ID NO:80) αvβ8 integrin. The term "αvβ8 integrin" also encompasses fragments, variants, isotypes, and other homologs of such αvβ8 integrin subunit molecules. Variant αvβ8 integrin molecules are generally characterized as having the same type of activity as the naturally occurring αvβ8 integrin, such as the ability to bind an αvβ8 integrin ligand, e.g., as described herein, the ability to induce receptor-mediated activity, and the ability to bind or not bind to an antibody or antigenic fragment thereof of the present invention.
[1133] Exemplary amino acid and nucleotide sequences of TGFβ and LAP are known in the art. For example, a precursor polypeptide comprising TGFβ1 and LAP (e.g., human sequence UniProt accession number P01137) is post-translationally processed into approximately amino acids 30 - 278 of UniProt accession number P01137 corresponding to LAP and approximately amino acids 279 - 390 of UniProt accession number P01137 corresponding to human TGFβ1. Similarly, a precursor polypeptide comprising TGFβ3 and LAP (e.g., human sequence UniProt accession number P10600) is post-translationally processed into approximately amino acids 24 - 300 of UniProt accession number P10600 corresponding to LAP and approximately amino acids 301 - 412 of UniProt accession number 10600 corresponding to human TGFβ3.
[1134] αvβ8 integrin can comprise one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twelve or more or fifteen or more surface-accessible residues of αvβ8 integrin. The target molecule can comprise an epitope known from αvβ8 integrin.
[1135] As outlined elsewhere herein, certain positions of an antibody molecule can vary. As used herein, "position" means a position in a protein sequence. Positions can be numbered sequentially or according to an established format, for example, the EU index and Kabat index can be used to number the amino acid residues of an antibody. For example, position 297 is a position in human antibody IgG1. As outlined above, the corresponding positions are generally determined by alignment with other parental sequences.
[1136] As used herein, "residue" means a position in a protein and its associated amino acid identity. For example, asparagine 297 (also known as Asn297, also known as N297) is a residue in human antibody IgG1.
[1137] As is known in the art, "polynucleotide" or "nucleic acid", which may be used interchangeably herein, refers to a nucleotide chain of any length and includes DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or any substrate that can be incorporated into the chain by DNA or RNA polymerase. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and their analogs. If present, the nucleotide structure can be modified either before or after chain assembly. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, for example, by conjugation with a label component. Other types of modifications include, for example, "capping"; replacement of one or more naturally occurring nucleotides with analogs; internucleotide modifications, such as modifications with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) and charged linkages (e.g., phosphorothioates, dithiophosphates, etc.), modifications containing pendant moieties (e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.)), modifications with intercalators (e.g., acridine, psoralen, etc.), modifications containing chelating agents (e.g., metals, radioactive metals, boron, metal oxides, etc.), modifications containing alkylating agents, modifications with modified linkages (e.g., α-anomeric nucleic acids, etc.), and unmodified forms of one or more polynucleotides. Additionally, any hydroxyl group normally present in the sugar can be, for example, replaced with a phosphonate group, a phosphate group, protected with a standard protecting group, or activated to prepare additional linkages with additional nucleotides, or can be conjugated to a solid support. The 5' and 3' terminal OHs can be phosphorylated or replaced in part with an amine or organic capping group of 1 to 20 carbon atoms. Other hydroxyl groups can also be derivatized with standard protecting groups. Polynucleotides can also contain ribose or deoxyribose in analogous forms commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl-, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, α- or β-anomeric sugars, epimeric sugars (e.g., arabinose, xylose or lyxose); pyranose, furanose, sedoheptulose, acyclic analogs and non-base nucleoside analogs (e.g., methyl riboside). One or more phosphodiester bonds can be replaced with alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which the phosphate is replaced with P(O)S ("thioate"), P(S)S ("dithioate"), (O)NR2 ("amidate"), P(O)R, P(O)OR', CO or CH2 ("acetal"), where R or R' are each independently H or a substituted or unsubstituted alkyl (1-20 C), optionally containing an ether (-O-) bond, aryl, alkenyl, cycloalkyl, cycloalkenyl or aryl aldehyde group. Not all bonds in a polynucleotide need to be the same. The foregoing description applies to all polynucleotides described herein, including RNA and DNA.
[1138] As used herein, "vector" means a construct capable of delivering and preferably expressing one or more genes or one or more sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
[1139] "Host cell" includes a single cell or cell culture that can be or has become a recipient of one or more vectors for incorporation of a polynucleotide insert. Host cells include the progeny of a single host cell, and the progeny may not necessarily be identical to the original parental cell (in terms of morphology or genomic DNA complement) due to natural, accidental or deliberate mutations. Host cells include cells transfected and / or transformed in vivo with the polynucleotides of the present invention.
[1140] Host cells can be prokaryotic or eukaryotic cells. Exemplary eukaryotic cells include mammalian cells, such as primate or non-primate cells; fungal cells, such as yeast; plant cells; and insect cells.
[1141] Any host cell sensitive to cell culture and sensitive to protein or polypeptide expression can be used according to the present invention. In certain embodiments, the host cell is mammalian. Mammalian cell lines that can be used as hosts for expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). Non-limiting exemplary mammalian cells include, but are not limited to, NS0 cells, HEK 293, and Chinese hamster ovary (CHO) cells and their derivatives, such as 293-6E and CHO DG44 cells, CHO DXB11, and CHO K1SV cells (BioWa / Lonza, Allendale, NJ). Mammalian host cells also include, but are not limited to, human cervical cancer cells (HeLa, ATCC CCL 2), baby hamster kidney (BHK, ATCC CCL 10) cells, monkey kidney cells (COS), and human hepatocellular carcinoma cells (e.g., Hep G2). Other non-limiting examples of mammalian cells that can be used according to the present invention include human retinoblastoma CruCell, Leiden, The Netherlands); monkey kidney CV1 cell line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney cell line 293 (HEK 293) or 293 cells (Graham et al., 1977, J. Gen Virol. 36:59) subcloned for growth in suspension culture; mouse Sertoli cells (TM4, Mather, 1980, Biol. Reprod. 23:243-251); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); dog kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor cells (MMT 060562, ATCC CCL51); TR1 cells (Mather et al., 1982, Annals N.Y. Acad. Sci. 383:44-68); MRC 5 cells; FS4 cells; human hepatoma cell line (HepG2); and a number of myeloma cell lines including but not limited to BALB / c mouse myeloma cell lines (NS0 / 1, ECACC No.: 85110503), NS0 cells, and Sp2 / 0 cells.
[1142] In addition, any number of commercially available and non-commercially available cell lines expressing polypeptides or proteins can be used according to the present invention. Those skilled in the art will understand that different cell lines may have different nutritional requirements and / or may require different culture conditions to achieve optimal growth and polypeptide or protein expression, and will be able to change the conditions as needed.
[1143] The present invention includes any eukaryotic expression system known in the art or disclosed herein for producing a protein of interest, such as expression in an insect cell system, a yeast expression system, or a mammalian cell system, such as but not limited to CHO cells.
[1144] As used herein, "expression control sequence" means a nucleic acid sequence that directs the transcription of a nucleic acid. The expression control sequence can be a promoter, such as a constitutive or inducible promoter or enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed.
[1145] The terms "leader peptide" or "leader sequence" or "leader signal sequence" or "signal sequence", which may be used interchangeably herein, mean any nucleic acid sequence or the amino acid sequence encoded thereby that may be present at the 5' end of a nucleic acid molecule and / or at or near the N-terminus of a polypeptide and, when present, may mediate the transport of the polypeptide to a target organelle, including but not limited to the secretion of the polypeptide from the cell. Such leader sequences include but are not limited to nucleic acid sequences containing, for example, ATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGCGTGCACTCC (SEQ ID NO:187) and the amino acid sequences encoded thereby, such as but not limited to MGWSCIILFLVATATGVHS (SEQ ID NO:188). The present invention encompasses these and any other leader signals (nucleic acid and amino acid sequences) known or to be identified in the art that result in the transport of a polypeptide to a desired organelle (such as the endoplasmic reticulum) and / or the secretion of the polypeptide from the cell. Generally, the signal peptide is removed from and / or absent in the mature polypeptide.
[1146] As used herein, "treatment" is a method for obtaining a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: improved survival (decreased mortality), reduced inflammatory response to a disease, reduced amount of tissue fibrosis, improved appearance of disease lesions, confinement of pathological lesions to local sites, reduced extent of damage caused by the disease, reduced duration of the disease and / or the number, severity or duration of symptoms associated with the disease. The term includes the administration of a compound or agent of the present invention to prevent or delay the onset of symptoms, complications or biochemical markers of a disease, alleviate the symptoms or arrest or inhibit the further development of a disease, condition or disorder. Treatment may be prophylactic (to prevent or delay the onset of a disease or prevent the manifestation of its clinical or subclinical symptoms) or therapeutic to inhibit or alleviate symptoms after the manifestation of the disease. In some embodiments, the disease, condition or disorder is cancer.
[1147] As used herein, the term "cancer" is intended to include all types of cancerous growths or carcinogenic processes, metastatic tissues or malignant transformed cells, tissues or organs, regardless of histopathological type or stage of invasion. Examples of cancerous disorders include, but are not limited to, solid tumors, blood cancers, soft tissue tumors, and metastatic lesions. Examples of solid tumors include malignancies of various organ systems, such as sarcomas and carcinomas (including adenocarcinomas and squamous cell carcinomas), such as malignancies affecting the liver, lung, breast, lymph, gastrointestinal tract (e.g., colon), urogenital tract (e.g., kidney, uroepithelium), prostate, and pharynx. Adenocarcinomas include malignancies such as most colon cancers, rectal cancers, renal cell carcinomas, liver cancers, non-small cell lung cancers, small intestine cancers, and esophageal cancers. Squamous cell carcinomas include malignancies such as those in the lung, esophagus, skin, head and neck region, oral cavity, anus, and cervix. In one embodiment, the cancer is melanoma, such as advanced melanoma. The methods and compositions of the invention can also be used to treat metastatic lesions of the foregoing cancers. Exemplary cancers that can be treated using the antibody molecules disclosed herein, such as to reduce their growth, include cancers that are generally responsive to immunotherapy.
[1148] "Improve" means that one or more symptoms are reduced or improved compared to when the anti-αvβ8 integrin antibody is not administered. "Improve" also includes a shorter duration or reduction of symptoms.
[1149] As used herein, an "effective dose" or "effective amount" of a drug, compound, or pharmaceutical composition is an amount sufficient to effect any one or more beneficial or desired results. In a more specific aspect, the effective amount prevents, alleviates, or improves the symptoms of a disease (such as cancer) and / or prolongs the survival of the subject being treated. For prophylactic use, beneficial or desired results include eliminating or reducing the risk of a disease, alleviating the severity of the disease, or delaying the onset of the disease, including biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes presented during the development of the disease. For therapeutic use, beneficial or desired results include, for example, reducing one or more of the symptoms of an αvβ8 integrin-mediated disease, disorder, or condition, reducing the dose of other drugs required to treat the disease, enhancing the effect of another drug, and / or delaying the clinical progression of the patient's disease. The effective dose can be administered in one or more administrations. For the purposes of the present invention, an effective dose of a drug, compound, or pharmaceutical composition is an amount sufficient to directly or indirectly accomplish a prophylactic or therapeutic treatment. As understood in a clinical context, an effective dose of a drug, compound, or pharmaceutical composition may or may not be achieved in combination with another drug, compound, or pharmaceutical composition. Thus, an "effective dose" can be considered to be a single agent given in an amount that, when administered with one or more other agents, achieves or has achieved the desired result, if the desired result can be achieved or has been achieved.
[1150] An antibody or antigen-binding fragment thereof can be administered in combination with one or more therapies (e.g., referred to herein as a "second therapy"). "In combination with" does not mean that the therapies or therapeutic agents must be administered simultaneously and / or formulated for co-delivery, but such delivery methods are within the scope described herein. The anti-αvβ8 integrin antibody or antigen-binding fragment thereof can be administered simultaneously with, before, or after one or more other therapies or therapeutic agents. The anti-αvβ8 integrin antibody or antigen-binding fragment thereof and the second therapy, such as other agents or treatment regimens, can be administered in any order. Generally, the various agents will be administered at the doses and / or schedules determined for that agent. It will be further understood that additional therapeutic agents used in the combination can be administered together in a single composition or separately in different compositions. In some embodiments, the levels used in the combination will be lower than those used alone.
[1151] A "synergistic combination" or a combination that "acts synergistically" is a combination that exhibits an unpredicted increased effect compared to the merely additive effect of the combination of the individual therapies.
[1152] An "individual" or "subject" is a mammal, more preferably a human. Mammals also include, but are not limited to, farm animals (e.g., cows, pigs, horses, chickens, etc.), sport animals, pets, primates, horses, dogs, cats, mice, and rats. In some embodiments, the individual is at risk of a disease, disorder, or condition mediated or associated with αvβ8 integrin binding to its receptor and the resulting signal transduction. In certain embodiments, the subject has a disorder or condition as described herein, such as cancer.
[1153] As used herein, a "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" includes any material that, when combined with an active ingredient, maintains the biological activity of the ingredient and is non-reactive with the immune system of the subject. Examples include, but are not limited to, any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water, emulsions (e.g., oil / water emulsions), and various types of wetting agents. A preferred diluent for aerosol or parenteral administration is phosphate buffered saline (PBS) or normal saline (0.9%). Compositions containing such carriers are formulated by known conventional methods (see, e.g., Remington’s Pharmaceutical Sciences, 18th Edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990; and Remington, The Science and Practice of Pharmacy 20th Edition MackPublishing, 2000).
[1154] This description relates to exemplary methods and materials, but methods and materials similar or equivalent to those described herein can also be used to practice or test the present invention. The materials, methods, and examples are illustrative only and are not intended to be limiting.
[1155] II. Anti-αvβ8 integrin antibodies
[1156] The present invention relates to antibodies and antigen-binding fragments thereof that bind to αvβ8 integrin. Preferably, the antibodies specifically bind to αvβ8 integrin, i.e., they bind to αvβ8 integrin but do not detectably bind or bind with lower affinity to other αv integrins (e.g., αvβ3 integrin, αvβ5 integrin, and αvβ6 integrin). The present invention also relates to anti-αvβ8 integrin antibodies that exhibit altered effector functions. In some embodiments, the altered effector function is reduced ADCC. In some embodiments, the altered effector function is reduced CDC. The present invention also relates to compositions comprising such antibodies; and uses of such antibodies, including therapeutic and pharmaceutical uses.
[1157] In one embodiment, the present disclosure provides any one or a composition (including a pharmaceutical composition) comprising an antibody having a light chain sequence or a fragment thereof and a heavy chain or a fragment thereof that is derived from but not identical to the murine hybridoma antibody ADWA-11 (also known as ADWA11, mADWA11, mADWA-11), as disclosed in U.S. Patent No. 9,969,804, which is incorporated herein by reference in its entirety, and as set forth, for example, in SEQ ID NOs: 20-33 and 71-76 of this specification.
[1158] Antibodies suitable for use in the present invention can include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab’, F(ab’)2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heteroconjugate antibodies, single-chain (ScFv), mutants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and any other modified conformation of an immunoglobulin molecule that contains the antigen recognition site of the desired specificity, including glycosylation variants of the antibody, amino acid sequence variants of the antibody, and covalently modified antibodies. The antibodies can be murine, rat, human, or from any other source (including chimeric or humanized antibodies). In some embodiments, the anti-αvβ8 integrin antibody is a monoclonal antibody. In some embodiments, the anti-αvβ8 integrin antibody is a human or humanized antibody. In some embodiments, the anti-αvβ8 integrin antibody is a chimeric antibody.
[1159] The anti-αvβ8 integrin antibodies of the present invention can be prepared by any method known in the art. General techniques for generating human and murine antibodies are known in the art and / or described herein.
[1160] After initial identification, the activity of a candidate anti-αvβ8 integrin antibody can be further confirmed and optimized by bioassays known for testing targeting bioactivity. In some embodiments, in vitro cell assays are used to further characterize the candidate anti-αvβ8 integrin antibody. For example, bioassays can be used to directly screen candidates. Some of the methods for identifying and characterizing anti-αvβ8 integrin antibodies are described in detail in the examples.
[1161] Table 1 below is an overview of the amino acid and nucleotide sequences of murine, chimeric, and humanized anti-αvβ8 integrin antibodies as described herein, the amino acid and nucleotide sequences of the heavy and light chain CDRs, the amino acid and nucleotide sequences of the heavy and light chain variable regions, and the amino acid and nucleotide sequences of the heavy and light chains are shown in this table. Generally, unless otherwise specified, the anti-αvβ8 integrin antibodies of the present invention can include any combination of one or more Kabat CDRs and / or Chothia hypervariable loops as set forth in Table 1. In some embodiments, the anti-αvβ8 integrin antibodies of the present invention can include any combination of one or more VH and / or VL sequences as set forth in Table 1. In some embodiments, the anti-αvβ8 integrin antibodies of the present invention can include any combination of one or more framework regions (e.g., FR1, FR2, FR3, and FR4) as described in Table 1. It is generally understood, and as shown in Table 1, each VH and VL sequence typically includes three CDRs and four FRs, which are arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[1162] In some embodiments, where the anti-αvβ8 integrin antibody contains a C-terminal lysine (K) amino acid residue on the heavy chain polypeptide (e.g., a human IgG1 heavy chain contains a terminal lysine), those skilled in the art will understand that the lysine residue can be clipped to produce an antibody with a heavy chain lacking the C-terminal lysine residue. Additionally, the antibody heavy chain can be produced using nucleic acid that does not encode lysine. Thus, in some embodiments, the anti-αvβ8 integrin antibody contains a heavy chain in which the additional terminal lysine is absent.
[1163] Table 1: Amino Acid and Nucleotide Sequences of αvβ8 Integrin Antibodies and Other Peptides
[1164]
[1165]
[1166]
[1167]
[1168]
[1169]
[1170]
[1171]
[1172]
[1173]
[1174]
[1175]
[1176]
[1177]
[1178]
[1179]
[1180]
[1181]
[1182]
[1183]
[1184]
[1185]
[1186]
[1187]
[1188]
[1189]
[1190]
[1191] *In some peptides, methionine is replaced by norleucine.
[1192]
[1193]
[1194]
[1195] Table 15: Exemplary light chain CDRs according to Kabat
[1196]
[1197]
[1198] Table 16: Exemplary heavy chain CDRs according to Chothia
[1199]
[1200]
[1201]
[1202] Table 17: Exemplary light chain CDRs according to Chothia
[1203]
[1204]
[1205]
[1206] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 as set forth in at least one of the amino acid sequences of SEQ ID NO: 11-13, 17-19, 25-27, 31-33, or 71-76.
[1207] In some aspects, the antibody or antigen-binding fragment thereof further comprises CDR-H1, CDR-H2, and CDR-H3 as set forth in at least one of the amino acid sequences of SEQ ID NO: 8-10, 14-16, 22-24, or 28-30.
[1208] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO: 7 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO: 6.
[1209] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:7 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:20.
[1210] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:7 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of any one of SEQ ID NO:34-46, 88-91, or 93.
[1211] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:21 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:6.
[1212] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of any one of SEQ ID NO:47-69 or 92 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:6.
[1213] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:5 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:2.
[1214] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:5 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:3.
[1215] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO:5 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO:124 or SEQ ID NO:182.
[1216] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO: 123 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO: 124 or SEQ ID NO: 182.
[1217] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, CDR-L3 as set forth in the amino acid sequence of SEQ ID NO: 123 and CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
[1218] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 as set forth in the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124918.
[1219] In some aspects, the antibody or antigen-binding fragment thereof comprises CDR-H1, CDR-H2, and CDR-H3 as set forth in the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124917.
[1220] In some aspects, the antibody or antigen-binding fragment thereof comprises the CDR-L1, CDR-L2, and CDR-L3 amino acid sequences encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124918, and the CDR-H1, CDR-H2, and CDR-H3 amino acid sequences encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124917.
[1221] In some aspects, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124918.
[1222] In some aspects, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence encoded by the insert sequence of the plasmid deposited with ATCC under accession number PTA-124917.
[1223] In some aspects, the antibody or antigen-binding fragment...
Claims
1. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or fragment is at least one antibody or fragment selected from the group consisting of: (a) an antibody or antigen-binding fragment thereof comprising, numbered according to the EU numbering of Kabat: light chain complementarity-determining region 1 (CDR-L1) consisting of the amino acid sequence of SEQ ID NO:11; CDR-L2 consisting of the amino acid sequence of SEQ ID NO:12; CDR-L3 consisting of the amino acid sequence of SEQ ID NO:13; heavy chain CDR1 (CDR-H1) consisting of the amino acid sequence of SEQ ID NO:8; CDR-H2 consisting of the amino acid sequence of SEQ ID NO:9; and CDR-H3 consisting of the amino acid sequence of SEQ ID NO:10; and (b) an antibody or antigen-binding fragment thereof comprising, numbered according to the Chothia numbering: CDR-L1 consisting of the amino acid sequence of SEQ ID NO:17; CDR-L2 consisting of the amino acid sequence of SEQ ID NO:18; CDR-L3 consisting of the amino acid sequence of SEQ ID NO:19; CDR-H1 consisting of the amino acid sequence of SEQ ID NO:14; CDR-H2 consisting of the amino acid sequence of SEQ ID NO:15; and CDR-H3 consisting of the amino acid sequence of SEQ ID NO:
16.
2. The isolated antibody or antigen-binding fragment thereof according to claim 1, which comprises a VL region and a VH region, wherein the VL region comprises the amino acid sequence of SEQ ID NO:7 and the VH region comprises the amino acid sequence of SEQ ID NO:
6.
3. The isolated antibody or antigen-binding fragment thereof according to claim 1 or 2, which comprises a VL region and a VH region, wherein the VL region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:7 and the VH region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:
6.
4. The isolated antibody or antigen-binding fragment thereof according to claim 1, which comprises an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:2 or 3.
5. The isolated antibody or antigen-binding fragment thereof according to claim 1 or 4, which comprises an LC region and an HC region, wherein the LC region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:5 and the HC region comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:2 or 3.
6. An isolated antibody that specifically binds to αvβ8 integrin, which comprises an LC and an HC, wherein the LC consists of the amino acid sequence of SEQ ID NO:5 and the HC consists of the amino acid sequence of SEQ ID NO:2 or 3.
7. An isolated antibody that specifically binds to αvβ8 integrin, comprising: An antibody VL region comprising CDR-L1, CDR-L2, and CDR-L3 from the VL region consisting of the amino acid sequence of SEQ ID NO:7; and An antibody VH region comprising CDR-H1, CDR-H2, and CDR-H3 from the VH region consisting of the amino acid sequence of SED ID NO:
6.
8. The isolated antibody according to claim 7, comprising an antibody heavy chain constant region and an antibody light chain constant region, wherein the antibody heavy chain constant region comprises the amino acid sequence of SEQ ID NO:181 or 184, and the antibody light chain constant region comprises the amino acid sequence of SEQ ID NO:
83.
9. An isolated antibody that specifically binds to αvβ8 integrin, comprising: An antibody VL region comprising the first, second, and third CDRs from the VL region consisting of the amino acid sequence of SEQ ID NO:7; An antibody VH region comprising the first, second, and third CDRs from the VH region consisting of the amino acid sequence of SEQ ID NO:6; an antibody light chain constant (CL) region comprising the amino acid sequence of SEQ ID NO:83; and an antibody heavy chain constant (CH) region comprising the amino acid sequence of SEQ ID NO:181 or 184.
10. An isolated antibody or an antigen-binding fragment thereof that specifically binds to αvβ8 integrin, comprising an antibody VH and an antibody VL, wherein the antibody VH consists of the amino acid sequence encoded by a plasmid deposited with ATCC and having the deposit number PTA-124917, and the antibody VL consists of the amino acid sequence encoded by a plasmid deposited with ATCC and having the deposit number PTA-124918.
11. The isolated antibody or an antigen-binding fragment thereof according to any one of claims 1, 6-7, and 9-10, comprising a human IgG1 Fc region numbered according to the EU numbering of Kabat, wherein the human IgG1 Fc region comprises one or more substitutions selected from positions L234, L235, and G237.
12. The isolated antibody or an antigen-binding fragment thereof according to any one of claims 1, 6-7, and 9-10, wherein the antibody is a human antibody, a murine antibody, or a chimeric antibody.
13. The isolated antibody or an antigen-binding fragment thereof according to any one of claims 1, 6-7, and 9-10, wherein the antibody heavy chain isotype is selected from IgG1, IgG2, IgG3, IgG4, or any variant thereof; and / or wherein the light chain constant region is selected from κ or λ.
14. The isolated antibody or an antigen-binding fragment thereof according to any one of claims 1, 6-7, and 9-10, wherein the antibody heavy chain isotype is IgG1 and / or wherein the light chain constant region is the κ light chain.
15. A pharmaceutical composition comprising the antibody or an antigen-binding fragment thereof according to any one of the preceding claims and a pharmaceutically acceptable carrier or excipient.
16. The pharmaceutical composition according to claim 15, comprising: i) an antibody or an antigen-binding fragment thereof comprising an antibody heavy chain and an antibody light chain, wherein the antibody heavy chain is encoded by the amino acid sequence of SEQ ID NO: 2 and the antibody light chain is encoded by the amino acid sequence of SEQ ID NO: 5; ii) an antibody or an antigen-binding fragment thereof comprising an antibody heavy chain and an antibody light chain, wherein the antibody heavy chain is encoded by the amino acid sequence of SEQ ID NO: 3 and the antibody light chain is encoded by the amino acid sequence of SEQ ID NO: 5; or iii) both.
17. An isolated nucleic acid molecule encoding the antibody or an antigen-binding fragment thereof according to any one of claims 1 to 14.
18. The isolated nucleic acid according to claim 17, wherein the isolated nucleic acid encodes the VH region and the VL region of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 190 and the nucleic acid sequence of SEQ ID NO:
186.
19. The isolated nucleic acid according to claim 17, wherein the isolated nucleic acid encodes the heavy chain constant region and the light chain constant region of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 192 or 193; and the nucleic acid sequence of SEQ ID NO:
194.
20. The isolated nucleic acid according to claim 17, wherein the isolated nucleic acid encodes the HC and LC of the antibody or an antigen-binding fragment thereof, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 189 or 190; and the nucleic acid sequence of SEQ ID NO:
185.
21. The isolated nucleic acid according to claim 17, wherein the isolated nucleic acid comprises the nucleic acid sequence of the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124917 and the nucleic acid sequence of the insert sequence of the plasmid deposited with the ATCC and having the deposit number PTA-124918.
22. A vector comprising the nucleic acid according to any one of claims 17 to 21.
23. A host cell comprising the nucleic acid according to any one of claims 17 to 21 or the vector according to claim 22.
24. The host cell according to claim 23, wherein the host cell is a mammalian cell selected from the group consisting of: CHO cells, COS cells, HEK-293 cells, NS0 cells, PER.C6® cells, and Sp2.0 cells.
25. A method for preparing an isolated antibody or an antigen-binding fragment thereof, comprising culturing the host cell according to claim 23 under conditions in which the antibody or fragment is expressed by the host cell and isolating the antibody or fragment.
26. Use of the antibody or an antigen-binding fragment thereof according to any one of claims 1 to 14 or the pharmaceutical composition according to claim 15 or 16 in the preparation of a medicament for treating cancer, wherein the cancer is selected from the group consisting of: squamous cell carcinoma, colon cancer, and breast cancer.
27. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 14 for preparing an antibody or antigen-binding fragment thereof for detecting the expression of αvβ8 integrin in a sample, tissue or cell.
28. A kit comprising the antibody or fragment according to any one of claims 1 to 14 or the pharmaceutical composition according to claim 15 or 16.
29. The kit of claim 28, further comprising a modulator of an immune checkpoint molecule selected from the group consisting of: anti-PD1 antibody, anti-PD-L1 antibody, anti-PD-L2 antibody, anti-CTLA-4 antibody, soluble CTLA-4 fusion protein, and combinations thereof, and wherein the anti-PD-L1 antibody is not avelumab.
30. Use of (i) an antibody or antigen-binding fragment thereof that specifically binds αvβ8 integrin according to any one of claims 1 to 14 and (ii) a modulator of an anti-PD1, anti-PD-L1 or anti-PD-L2 immune checkpoint molecule in the preparation of a medicament for treating cancer, wherein the cancer is selected from the group consisting of: squamous cell carcinoma, colon cancer and breast cancer.
31. The use according to claim 30, wherein the modulator is selected from the group consisting of: anti-PD1 antibody, anti-PD-L1 antibody and anti-PD-L2 antibody.
32. An isolated antibody or antigen-binding fragment thereof that specifically binds αvβ8 integrin, wherein the antibody or fragment is at least one antibody or fragment selected from the group consisting of: (a) an antibody or antigen-binding fragment thereof comprising a variable light chain (VL) region and a variable heavy chain (VH) region, the VL region comprising an amino acid sequence encoded by the insert sequence of a plasmid deposited with the ATCC and having the deposit number PTA-124918, the VH region comprising an amino acid sequence encoded by the insert sequence of a plasmid deposited with the ATCC and having the deposit number PTA-124917; (b) an antibody or antigen-binding fragment thereof comprising a VL region and a VH region, the VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 47 and 92, the VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 39 and 88-91; (c) an antibody or antigen-binding fragment thereof comprising a VL region and a VH region, the VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 7 and 67-69, the VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 6 and 93; (d) an antibody or antigen-binding fragment thereof comprising a VL region and a VH region, the VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 7, 47-69 and 92, the VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 6, 34-46, 88-91 and 93; (e) An antibody or antigen-binding fragment thereof comprising a light chain (LC) region and a heavy chain (HC) region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:2; and (f) An antibody or antigen-binding fragment thereof comprising a VL region and a VH region, wherein the VL region is encoded by the nucleic acid sequence of SEQ ID NO:186 and the VH region is encoded by the nucleic acid sequence of SEQ ID NO:
190.
33. An isolated antibody or antigen-binding fragment thereof that specifically binds αvβ8 integrin, wherein the antibody or fragment is at least one antibody or fragment selected from the group consisting of: (a) An antibody or antigen-binding fragment thereof comprising a light chain (LC) region and a heavy chain (HC) region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:2; (b) An antibody or antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:5 and the HC region comprises the amino acid sequence of SEQ ID NO:3; (c) An antibody or antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region comprises the amino acid sequence of SEQ ID NO:123 and the HC region comprises the amino acid sequence of SEQ ID NO:124 or 182; and (d) An antibody or antigen-binding fragment thereof comprising an LC region and an HC region, wherein the LC region is encoded by the nucleic acid sequence of SEQ ID NO:185 and the HC region is encoded by the nucleic acid sequence of SEQ ID NO:189 or 191.
34. The isolated antibody or antigen-binding fragment thereof according to any one of claims 1, 6-7, and 9-10, wherein the antibody is a humanized antibody.
35. The isolated antibody or antigen-binding fragment thereof according to claim 11, wherein the one or more substitutions correspond to L234A, L235A, and G237A, numbered according to Kabat's EU numbering.
Citation Information
Patent Citations
Human antithrombin III, DNA sequences therefor, expression vehicles and cloning vectors containing such sequences and cell cultures transformed thereby, a process for expressing human antithrombin III, and pharmaceutical compositions comprising it
EP0090505B1
Modified antibodies
EP0388151A1
GITR binding molecules and uses therefor
EP1866339A2
Mammalian cell surface antigens; related reagents
EP1947183B1
Treatment of cancer using anti-TGF-BETA and PD-1 antibodies
US10167334B2