Immunity-inducing agent comprising antigen peptide-adjuvant nucleotide conjugate and pharmaceutical composition comprising the same

Abstract

The present invention provides an immunity inducing agent and a pharmaceutical composition comprising the same. The immunity inducing agent comprises a polynucleotide / peptide conjugate as an active ingredient. The polynucleotide / peptide conjugate is a single-stranded polynucleotide or polynucleotide derivative comprising a CpG motif and an antigenic peptide bonded via a spacer. The spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the antigenic peptide at the other end.

Description

Technical Field

[0001] The present invention relates to an immunity inducing agent comprising a novel antigen peptide-adjuvant nucleotide conjugate for inducing antigen peptide-specific immune response and a pharmaceutical composition comprising the same. Background Art

[0002] The basic principle of preventing infection through vaccines is to induce acquired immunity by artificially simulating infection, inducing the production of antibodies against specific pathogens and cellular immunity. In acquired immunity, it is known that T cells and B cells responsible for immune "memory" play a core role, and the diversity of antibody variable regions achieved through DNA rearrangement can produce specific immune responses to a large number of antigens. On the other hand, traditionally, innate immunity, in which phagocytes such as leukocytes, macrophages, and dendritic cells play a core role, is a non-specific process of engulfing pathogens and foreign bodies, and is believed to only play a "pause" role before establishing acquired immunity, but with the advancement of research on the molecular mechanism of innate immunity, it has been clarified that innate immunity also carries out specific recognition of self / non-self; and innate immunity is essential for the establishment of acquired immunity. More specifically, according to recent studies, it has been clarified that the Toll-like receptor (TLR) family present in antigen-presenting cells such as dendritic cells, macrophages, and B cells reacts with various pathogens, induces the production of cytokines, and induces acquired immunity by promoting the differentiation of initial T cells into Th1 cells and activating killer T cells.

[0003] The components of pathogens recognized by a series of TLR families are diverse, and one of them is DNA (CpG DNA) with a CpG motif, which is a ligand for TLR9. The CpG motif is based on six bases, with cytosine (C) and guanine (G) arranged in the center, and two purine bases and pyrimidine bases arranged in the front and back. It is a sequence represented by -PuPu-CG-PyPy- (Pu represents a purine base, and Py represents a pyrimidine base.) (In the case of humans, GTCGTT is known to also have ligand activity for TLR9.) It is a base sequence that is rare in mammals but often observed in microorganisms (at a frequency calculated by probability). In addition, most of the CpG motifs that exist in a small number of mammals are methylated. Unmethylated CpG motifs that are almost non-existent in mammals have strong immune activation activity (for example, refer to non-patent documents 1 to 3). CpG DNA taken into cells by endocytosis is recognized by TLR9 present in the phagosome-like endoplasmic reticulum, and strongly induces Th1 response. Th1 response inhibits allergic reactions dominated by Th2 response and has strong anti-tumor activity. Therefore, in addition to preventing infection, CpG DNA can also be expected to be used as an adjuvant for allergic diseases and tumor diseases (for example, refer to non-patent document 4).

[0004] However, when CpG DNA is used as an adjuvant for immunotherapy, there is a problem of how to allow CpG DNA to reach the interior of target cells while avoiding degradation by nucleases in the cytoplasm and plasma and nonspecific binding to proteins.

[0005] The present inventors have focused on a polysaccharide having a β-1,3-glucan backbone (hereinafter sometimes referred to as "β-1,3-glucan") as a novel gene carrier, and have discovered that β-1,3-glucan forms a novel complex with a variety of nucleic acids, including nucleic acid drugs (antisense DNA, CpG DNA) (for example, see Patent Documents 1 and 2, and Non-Patent Documents 5 to 7).

[0006] It was found that after dissolving β-1,3-glucan, which exists as a triple helix in nature, in a non-protonic polar organic solvent such as dimethyl sulfoxide (DMSO) or an alkaline solution of 0.1N or higher to dissociate into single strands, a single-stranded nucleic acid is added and the solvent is changed to water or restored to neutrality, a triple helix complex containing one molecule of nucleic acid and two molecules of β-1,3-glucan is formed. In this case, it is believed that the β-1,3-glucan molecules and nucleic acid molecules in the triple helix complex form intermolecular bonds mainly through hydrogen bonds and hydrophobic interactions (see Non-Patent Document 8).

[0007] As described above, by making the nucleic acid and β-1,3-glucan complex, it is possible to inhibit the hydrolysis of nucleic acid molecules by nucleases, the non-specific binding of plasma proteins to nucleic acids, and other undesirable interactions between nucleic acid molecules and proteins in the body, and to allow nucleic acids to reach the inside of cells. CpG DNA has been successfully delivered to cells using a ternary complex comprising a complex of β-1,3-glucan and nucleic acid and a protein having antigenicity (for example, see Patent Documents 3 and 4, and Non-Patent Documents 9 to 11).

[0008] However, the above-mentioned prior art has the following problems. For example, in the method for producing a ternary complex of β-1,3-glucan / antigenic protein / CpG DNA described in Non-Patent Document 11, a formyl group is generated on the glucose residue of the side chain of β-1,3-glucan by periodic acid oxidation, and the formyl group is reacted with the amino group of an antigenic peptide (hereinafter, sometimes referred to as "antigenic peptide") by a reductive amination reaction to form a complex in which β-1,3-glucan and the antigenic peptide are covalently bonded, but there is a problem of extremely low yield. In view of the above, for example, in the method for producing a ternary complex of β-1,3-glucan / antigenic protein (antigenic peptide) / CpG DNA described in Patent Document 4, the reactivity and yield of the formyl group on the side chain of β-1,3-glucan with the amino group of the antigenic peptide are improved by reacting β-1,3-glucan having a formyl group on the side chain with the antigenic peptide in an alkaline aqueous solution while neutralizing, or reacting in an alkaline aqueous solution and neutralizing successively. However, since there are multiple amino groups in the peptide, it is difficult to control the reaction point. Therefore, there are concerns that the following problems may occur: the difference in immunogenicity of the antigenic peptide due to the reaction position; the reaction product with β-1,3-glucan becomes a complex mixture, making it difficult to separate and purify; etc. In addition, compared with the formation of the complex of β-1,3-glucan and DNA, which forms the complex by hydrogen bonding, the formation of the complex formed by covalent bonding of β-1,3-glucan and the antigenic peptide is more complicated. In these respects, the method for producing a ternary complex of β-1,3-glucan / antigenic peptide / CpG DNA described in Patent Document 4 still has problems in terms of productivity and the like.

[0009] In view of the above problems, the present inventors proposed a peptide / β-1,3-glucan complex as a peptide / β-1,3-glucan complex with excellent productivity and high immunostimulating activity, characterized in that it comprises a polysaccharide having a β-1,3-glucan backbone, and a peptide / polynucleotide conjugate formed by covalently bonding an antigenic peptide to a polynucleotide or a polynucleotide derivative, wherein the polynucleotide or polynucleotide derivative of the peptide / polynucleotide conjugate is bonded to the polysaccharide having a β-1,3-glucan backbone through hydrogen bonding to form a complex having a triple helical structure formed by one molecular chain of the polynucleotide or polynucleotide derivative and two molecular chains of the polysaccharide having a β-1,3-glucan backbone (see Patent Document 5). However, Patent Document 5 does not describe the immunoinducing activity of the peptide / polynucleotide conjugate itself constituting the peptide / β-1,3-glucan complex.

[0010] Several reports have revealed the immune-inducing activity of conjugates of CpG DNA and antigenic peptides or proteins (see non-patent literature 12, 13). However, in non-patent literature 12, although the OVA antigen presentation activity in CD8-positive T cells (CTLs) was shown by administering a conjugate of CpG DNA and an 18-24mer peptide derived from an ovalbumin (OVA) antigen, no clear induction of CTL cytotoxicity was shown. In addition, in non-patent literature 13, although the induction of CTL cytotoxicity was shown by administering a conjugate of CpG DNA and an OVA antigen protein, the dosage was as high as 10 μg / mouse, and during its manufacture, it is necessary to produce it through chemical synthesis of DNA and culture / purification of antigen proteins and complex manufacturing processes such as their conjugation, so there are problems in terms of activity and productivity at low dosages.

[0011] Prior art literature

[0012] Patent Literature

[0013] Patent Document 1: International Publication No. 01 / 34207

[0014] Patent document 2: International Publication No. 02 / 072152

[0015] Patent Document 3: Japanese Patent Application Publication No. 2010-174107

[0016] Patent Document 4: Japanese Patent Application Publication No. 2007-70307

[0017] Patent Document 5: International Publication No. 2015 / 118789

[0018] Non-patent literature

[0019] Non-patent literature 1: Bacterial CpG DNA Activates Immune Cells to Signal Infectious Danger, H. Wagner, Adv. Immunol., 73, 329-368 (1999).

[0020] Non-patent document 2: CpG Motifs in Bacterial DNA and Their Immune Effects, M. Krieg, Annu. Rev. Immunol., 20, 709-760 (2002).

[0021] Non-patent document 3: The discovery of immunostimulatory DNA sequence, S. Yamamoto, T. Yamamoto, and T. Tokunaga, Springer Seminars in Immunopathology, 22, 11-19 (2000).

[0022] Non-patent document 4: "Standard Immunology" 2nd edition, Medical College, 2002, page 333

[0023] Non-patent literature 5: Molecular Recognition of Adenine, Cytosine, and Uracil in a Single-Stranded RNA by a Natural Polysaccharide: Schizophyllan. K. Sakurai and S. Shinkai, J. Am. Chem. Soc., 122, 4520-4521 (2000).

[0024] Non-patent document 6: Polysaccharide-Polynucleotide Complexes. 2. Complementary Polynucleotide Mimic Behavior of the Natural Polysaccharide Schizophyllan in the Macromolecular Complex with Single-Stranded RNA and DNA. K. Sakurai, M. Mizu and S. Shinkai, Biomacromolecules, 2, 641-650 (2001).

[0025] Non-patent document 7: Dectin-1 targeting delivery of TNF-αantisense ODNscomplexed with β-1,3-glucan protects mice from LPS-induced hepatitis. S. Mochizuki and K. Sakurai, J. Control. Release, 151 (2011) 155-161.

[0026] Volume 8: Structural Analysis of the Curdlan / Poly(cytidylic acid) Complex with Semiempirical Molecular Orbital Calculations.

[0027] Chapter 9: A Polysaccharide Carrier for Immunostimulatory CpG DNAsto Enhance Cytokine Secretion,M.Mizu,K.Koumoto,T.Anada,T.Matsumoto,M.Numata,S.Shinkai,T.Nagasaki and K. Sakurai, J. Am. Chem. Soc., 126,8372–8373(2004).

[0028] Protection of Polynucleotides Against Nuclease-Mediated Hydrolysis by Complexation with Schizophyllan, M. Mizu, K. Koumoto, T. Kimura, K. Sakurai and S. Shinkai, Biomaterials, 25,15,3109-3116(2004).

[0029] Material 11:Synthesis and in Vitro Characterization of Antigen-Conjugated Polysaccharide as a CpG DNA Carrier, N. Shimada, KJIshii, Y. Takeda, C. Coban, Y. Torii, S. Shinkai, S. Akira and K. Sakurai, Bioconjugate Chem.,17 1136–1140(2006).

[0030] Non-patent literature 12: Distinct Uptake Mechanisms but Similar Intracellular Processing of Two Different Toll-like Receptor Ligand-Peptide Conjugates in Dendritic Cells, Khan S. et al., J. Biol. Chem. 282, 21145-21159 (2007).

[0031] Non-patent document 13: Intracellular Cleavable CpG Oligodeoxynucleotide-AntigenConjugate Enhances Anti-tumor Immunity, Kramer K. et al., Mol. Ther. 25, 62-70 (2017). Summary of the invention

[0032] Problem that the invention aims to solve

[0033] No clear immune-inducing activity is known when the peptide / polynucleotide conjugate is used alone.

[0034] The present inventors have found that a peptide / polynucleotide conjugate that does not form a complex with β-1,3-glucan, in particular a peptide / polynucleotide conjugate containing a CpG motif, has high immunoinduction activity alone, and have completed the present invention. Thus, an object of the present invention is to provide an immunoinducer having excellent productivity and high immunostimulation activity and a pharmaceutical composition containing the same.

[0035] Solutions for solving problems

[0036] The first mode of the present invention according to the aforementioned purpose solves the above-mentioned problem by providing the following immune inducer, wherein the immune inducer comprises a polynucleotide / peptide conjugate as an active ingredient, wherein the polynucleotide / peptide conjugate is a single-stranded polynucleotide or polynucleotide derivative comprising a CpG motif and an antigenic peptide bonded via a spacer, and the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the antigenic peptide at the other end.

[0037] In the immunity-inducing agent of the first aspect of the present invention, the peptide having antigenicity may have an amino acid length of 5 or more and 30 or less.

[0038] In the immunity-inducing agent of the first aspect of the present invention, the peptide having antigenicity may have an amino acid length of 8 or more and 11 or less.

[0039] In the immunity-inducing agent of the first aspect of the present invention, the polynucleotide or polynucleotide derivative may be a polydeoxyribonucleotide (DNA) or a DNA derivative containing two or more CpG motifs.

[0040] In the immunity-inducing agent of the first aspect of the present invention, the polynucleotide or polynucleotide derivative may have a base length of 15 or more and 40 or less.

[0041] In the immunity-inducing agent of the first aspect of the present invention, the polynucleotide or polynucleotide derivative may have a base length of 20 or more and 30 or less.

[0042] In the immunity-inducing agent of the first aspect of the present invention, the polynucleotide or polynucleotide derivative may be a polynucleotide derivative in which at least a part of phosphodiester bonds are replaced with phosphorothioate bonds.

[0043] In the immunity-inducing agent of the first aspect of the present invention, in the polynucleotide derivative in which at least a part of the phosphodiester bonds are replaced with phosphorothioate bonds, 50% or more of the phosphodiester bonds may be replaced with phosphorothioate bonds.

[0044] In the aforementioned polynucleotide derivative in which at least a part of the phosphodiester bonds are replaced by phosphorothioate bonds, more than 90% of the phosphodiester bonds can be replaced by phosphorothioate bonds.

[0045] In the immunity-inducing agent of the first aspect of the present invention, one or both of the covalent bond between the spacer and the polynucleotide or polynucleotide derivative and the covalent bond between the spacer and the antigenic peptide are preferably covalent bonds that can be broken in a biological environment.

[0046] In the first embodiment of the immune inducer of the present invention, the aforementioned antigenic peptide constituting the aforementioned polynucleotide / peptide conjugate and the aforementioned spacer bonded to the aforementioned polynucleotide or polynucleotide derivative can be bonded by means of a covalent bond (disulfide bond) generated by the reaction of the thiol group of the cysteine ​​residue at the N-terminus of the aforementioned antigenic peptide with the thiol group of the aforementioned spacer.

[0047] In the immunity-inducing agent of the first aspect of the present invention, the spacer may include a repeating unit represented by the following formula.

[0048]

[0049] In the above formula,

[0050] X represents an oxygen atom or a sulfur atom (where each X is optionally the same or different),

[0051] R stands for (CH2) p O, (CH2)q NH, (CH2CH2O) m Any of (m, p and q each independently represent a natural number less than 10.),

[0052] n represents a natural number less than 10.

[0053] In the immunity-inducing agent of the first aspect of the present invention, the spacer may have a structure represented by any of the following formulas.

[0054]

[0055] In the immunity-inducing agent of the first aspect of the present invention,

[0056] The amino acid length of the peptide having antigenicity is 5 or more and 30 or less,

[0057] The aforementioned polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or a DNA derivative containing two or more CpG motifs,

[0058] The aforementioned polynucleotide derivative is a polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced by phosphorothioate bonds, and

[0059] One or both of the covalent bond between the spacer and the polynucleotide or polynucleotide derivative and the covalent bond between the spacer and the antigenic peptide preferably has a covalent bond structure that can be cleaved in a biological environment.

[0060] In the immunity-inducing agent of the first aspect of the present invention,

[0061] The amino acid length of the peptide having antigenicity is 8 or more and 11 or less,

[0062] The polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or a DNA derivative containing two or more CpG motifs and having a base length of 20 or more and 30 or less,

[0063] The aforementioned polynucleotide derivative is a polynucleotide derivative in which more than 90% of the phosphodiester bonds are replaced by phosphorothioate bonds,

[0064] The antigenic peptide constituting the polynucleotide / peptide conjugate is bonded to the spacer bound to the polynucleotide or polynucleotide derivative via a covalent bond (disulfide bond) generated by a reaction between a thiol group of a cysteine ​​residue at the N-terminus of the antigenic peptide and a thiol group of the spacer, and

[0065] The aforementioned spacer group more preferably has a structure represented by any of the following formulas,

[0066]

[0067] The immunity-inducing agent of the first aspect of the present invention may further contain a substance having an immunostimulating activity as an adjuvant.

[0068] The second aspect of the present invention solves the above-mentioned problems by providing a pharmaceutical composition comprising the immunity-inducing agent of the first aspect of the present invention.

[0069] The second embodiment of the present invention may be a pharmaceutical composition for treating tumors.

[0070] According to another aspect of the present invention, there is provided a method for treating or preventing a disease, comprising administering an effective amount of the immunity-inducing agent of the first aspect of the present invention to a subject in need thereof. In this aspect, the disease may be a tumor.

[0071] According to another aspect of the present invention, there is provided use of the immunity-inducing agent of the first aspect of the present invention in the manufacture of a medicament for treating or preventing a disease. In this aspect, the disease may be a tumor.

[0072] Effects of the Invention

[0073] The peptide / polynucleotide conjugate of the present invention can be used as a highly active immune-inducing agent with excellent productivity. In addition, by appropriately combining an antigenic peptide with a polynucleotide or a polynucleotide derivative, an immune-inducing agent having immune-inducing activity against a variety of antigens can be easily designed. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is a diagram showing the measurement results of the flow cytometer in Example 2.

[0075] Figure 2 This is a diagram showing the measurement results of the flow cytometer in Example 3.

[0076] Figure 3 This is a diagram showing the measurement results of the flow cytometer in Example 4.

[0077] Figure 4 This is a diagram showing the measurement results of the flow cytometer in Example 4.

[0078] Figure 5 This is a diagram showing the measurement results of the flow cytometer in Example 5.

[0079] Figure 6 This is a diagram showing the measurement results of the flow cytometer in Example 7.

[0080] Figure 7 This is a diagram showing the measurement results of the flow cytometer in Example 7. DETAILED DESCRIPTION

[0081] The immune inducer of the first embodiment of the present invention (hereinafter sometimes referred to as "immune inducer") contains a polynucleotide / peptide conjugate as an active ingredient, wherein the polynucleotide / peptide conjugate is a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif and an antigenic peptide bonded via a spacer, and the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the antigenic peptide at the other end.

[0082] Peptide / polynucleotide conjugate is a complex in which an antigenic peptide is bonded to a polynucleotide or a polynucleotide derivative by a covalent bond. As an "antigenic peptide", as long as it is antigenic, that is, it is recognized as a foreign body in the immune system of an organism and causes the production of specific antibodies (inducing immune response), a peptide with any amino acid sequence and number of amino acid residues can be used without particular restrictions. In the case where there is no cysteine ​​(Cys) in the sequence of the antigenic peptide, in this embodiment, a peptide artificially endowed with a cysteine ​​at the N-terminus of the antigenic epitope peptide derived from the antigen protein can be used as an antigenic peptide. For the antigenic peptide used in the manufacture of the peptide / polynucleotide conjugate as the active ingredient of the immune inducer of the present embodiment, it can be listed: a protein that is the cause of allergic reactions such as food allergies, a protein originating from pathogens such as bacteria and viruses, a tumor cell, etc., and a peptide having an amino acid sequence of a part that can act as an epitope. The number of amino acid residues constituting the antigenic peptide is not particularly limited as long as it can act as an epitope. In most cases, it is within the range of 5 to 30, and most of them are within the range of about 8 to 17.

[0083] The peptide having antigenicity can be obtained by any known method such as enzymatic degradation of the originating protein, peptide synthesis, etc. In addition, the amino acid sequence of the peptide having antigenicity can be determined by any known method such as epitope analysis using a peptide array.

[0084] Examples of peptides that can be used as antigenic peptides include MHC-1 T cell epitopes registered in the epitope peptide database IEDB (www.iedb.org, last accessed: 08 / 11 / 2014), peptides described in the paper by Chowell et al. (TCR contact residue hydrophobicity is a hallmark of immunogenic CD8+ T cell epitopes PNAS April 7, 2015 112 (14) E1754-E1762), Table. S1), and peptides shown in the following Tables 1 to 7. Peptides to which a cysteine ​​residue is further added to the N-terminus of these antigenic peptides can be used as antigenic peptides in this embodiment (however, the case where a cysteine ​​residue is already present in the sequence of the antigenic peptide is not included).

[0085] [Table 1]

[0086] Target diseases: Infectious diseases

[0087]

[0088] [Table 2]

[0089] Target diseases: Infectious diseases

[0090]

[0091] [Table 3]

[0092] Target disease: Cancer

[0093]

[0094] [Table 4]

[0095] Target disease: Cancer

[0096]

[0097] [Table 5]

[0098] Target disease: Cancer

[0099]

[0100] [Table 6]

[0101] Target disease: Cancer

[0102]

[0103] [Table 7]

[0104] Source of peptides Amino acid sequence Serial Number Ovalbumin (OVA) SIINFEKL 196 Mouse melanin-producing cell gp100 EGSRNQDWL 197 Human melanin-producing cell gp100 KVPRNQDW 198 CT26 (colorectal cancer cell line) SPSYVYHQ 199 Influenza virus HA IYSTVASSL 200 Influenza virus NP ASNENMDTM 201 Influenza virus PA SSLENFRAYV 202 β-Galactosidase DAPIYTNV 203 MuLV (murine leukemia virus) p15E KSPWFTTL 204 SeV (Sendai virus) FAPGNYPAL 205 MCMV (murine cytomegalovirus) IE1 YPHFMPTNL 206 LCMV (lymphocytic choriomeningitis virus) gp33 KAVYNFATM 207 LCMV NP396 FQPQNGQFI 208 LCMV NP118 RPQASGVYM 209 Plasmodium Pb9 SYIPSAEKI 210 HIV P18-I10 RGPGRAFVTI 211 BCG MPT51 GGPHAVYLL 212 Human CEA (human carcinoembryonic antigen) EAQNTTYL 213 P815 (mouse antigen presenting cells) LPYLGWLVF 214 HBsAg (Hepatitis B virus antigen) IPQSLDSWWTSL 215 HSV-1 (herpes simplex virus of mice) gB SSIEFARL 216 HY (Male-specific Antigen) Uty WMHHNMDLI 217 EGFP (High Sensitivity Green Fluorescent Protein) HYLSTQSAL 218 HER2 TYLPTNASL 219 VSV (Vesicular Stomatitis Virus) NP RGYVYQGL 220 Poliovirus MT RRLGRTLLL 221

[0105] As long as the single-stranded polynucleotide or polynucleotide derivative constituting the polynucleotide / peptide conjugate contains one or more (preferably multiple) CpG motifs, a polynucleotide or its derivative having any base sequence and base number can be used without particular limitation. Specific examples of CpG motifs include AGCGTT, GACGTT, GACGTC, GTCGTT, etc. The number of CpG motifs contained in the polynucleotide is not particularly limited, preferably 1 to 6 CpG motifs, and more preferably 2 to 4 CpG motifs. The aforementioned polynucleotide or polynucleotide derivative is preferably a polydeoxyribonucleotide (DNA) or a thiophosphate-modified DNA derivative containing more than two CpG motifs, and a portion may contain RNA or RNA derivatives. When RNA or RNA derivatives are included, the content of any one or more of them is preferably 20% or less (specifically, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% or less).

[0106] The number of bases contained in the polynucleotide or polynucleotide derivative is preferably 15 to 40 (specifically, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40), and more preferably 20 to 30 (specifically, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30). Specific examples of preferred polynucleotides or polynucleotide derivatives include those shown in Table 8 below.

[0107] [Table 8]

[0108]

[0109] Polynucleotides are easily degraded by nucleases in vivo, so in order to improve the stability in vivo, polynucleotide derivatives can be used instead of polynucleotides. Examples of polynucleotide derivatives include polynucleotides in which all or part of the hydroxyl groups at the 2' position of ribonucleotides are substituted with fluorine or methoxy groups, polynucleotides in which all or part of the phosphodiester bonds of polyribonucleotides (RNA) or polydeoxyribonucleotides (DNA) are replaced with phosphorothioate bonds, etc. When a part of the phosphodiester bonds of polyribonucleotides or polydeoxyribonucleotides is replaced with phosphorothioate bonds, preferably more than 50% (specifically, more than 50, 60, 70, 80 or 90%) of the phosphodiester bonds are replaced with phosphorothioate bonds, more preferably more than 90% (specifically, more than 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%) are replaced with phosphorothioate bonds, and substantially all of them can be replaced with phosphorothioate bonds. The position of the phosphodiester bond replaced by the phosphorothioate bond is not particularly limited, and a plurality of consecutive phosphodiester bonds may be replaced, or the phosphorothioate bonds may be replaced in a manner that they are not adjacent to each other.

[0110] The polynucleotide or polynucleotide derivative covalently bonded to the antigenic peptide by the spacer can be bonded to any of the N-terminal, C-terminal or side chains of the antigenic peptide, preferably bonded to the N-terminal side of the antigenic peptide. When the antigenic peptide does not contain a Cys residue, a peptide further endowed with a cysteine ​​residue can be used on the N-terminal side. The polynucleotide or polynucleotide derivative and the antigenic peptide are bonded by a spacer, and the spacer is covalently bonded to the polynucleotide or polynucleotide derivative with one end side and covalently bonded to the antigenic peptide with the other end side. As a reactive functional group used in the bonding of the spacer and the polynucleotide or polynucleotide derivative and the antigenic peptide, the functional group present in the antigenic peptide and the polynucleotide or polynucleotide derivative can be directly used, or any reactive functional group that can react with the activator by chemical modification and form a covalent bond. The polynucleotide or polynucleotide derivative is preferably bonded to the spacer on the oxygen atom of the hydroxyl at its 5' end side or 3' end. The antigenic peptide is preferably bonded to a spacer at the sulfur atom of the thiol group on the side chain of the Cys residue.

[0111] An example of a preferred peptide / polynucleotide conjugate is shown in the following formula (A), which has a structure in which the 3' or 5' terminal of a polynucleotide or a polynucleotide derivative is bonded to the N-terminal of an antigenic peptide via a spacer Sp.

[0112] Formula (A): [polynucleotide or polynucleotide derivative]-Sp-[antigenic peptide]

[0113] Examples of the spacer Sp include an alkylene group and polyethylene glycol (PEG), and the spacer Sp may include a repeating unit having a phosphodiester structure represented by the following formula.

[0114]

[0115] In the above formula, X represents an oxygen atom or a sulfur atom (where each X is the same or different), R represents (CH2) p O, (CH2) q NH, (CH2CH2O) m Any of (m, p and q each independently represent a natural number less than 10.), n represents a natural number less than 10.

[0116] These repeating units will not be hydrolyzed by nucleases, so even if X is an oxygen atom, the stability in the organism will not be greatly reduced. For example, when R is (CH2)3, the size of the repeating unit is almost equal to that of a ribonucleotide or a deoxyribonucleotide, so by replacing a part of a polynucleotide or a polynucleotide derivative with the spacer, a reduction in production costs can be expected. As specific examples of the spacer Sp, the following examples can be listed.

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125] As more preferable examples of the spacer Sp, there can be mentioned spacers Sp having any of the following structures.

[0126]

[0127] Examples of combinations of reactive functional groups used in the bond formation between a spacer and a polynucleotide or a polynucleotide derivative and an antigenic peptide include, in addition to ester bonds, amide bonds, phosphate bonds, etc., combinations of reactive functional groups used to fix biological molecules to the surface of a biochip, and more specifically, those shown below.

[0128] (a) Alkynes and Azides

[0129] Alkynes and azides (azides) form 1,2,3-triazole rings through the addition cyclization reaction (Huisgen reaction) shown below. Both are stable functional groups that can be introduced into many organic compounds including biomolecules. They react quickly and almost quantitatively in solvents containing water, with almost no side reactions and no extra waste. Therefore, they are widely used in the field of biochemistry as the core reaction of the so-called "click chemistry". Alkyne derivatives and azides can be introduced into antigenic peptides or polynucleotides or polynucleotide derivatives using any known method. As alkyne derivatives, alkyne derivatives with reactive functional groups such as propargyl alcohol and propargylamine can be easily obtained. Alkyne derivatives can be introduced by directly reacting these with reactive functional groups such as carboxyl and hydroxyl groups, or reacting them together with carbonyldiimidazole, etc., through the generated amide bonds, ester bonds, aminoester bonds, etc. For azides, any known method can also be used to introduce antigenic peptides or polynucleotides or polynucleotide derivatives. It should be noted that the Huisgen reaction is carried out in the presence of a copper catalyst, but in antigenic peptides and polynucleotide derivatives in which the phosphodiester bond is replaced by a sulfur-containing functional group such as a phosphorothioate bond, there is a concern that the catalytic activity of copper may be reduced due to the presence of sulfur atoms coordinated with copper ions. In order to increase the reaction rate, it is preferred to add an excess of copper.

[0130]

[0131] (b) Maleimide or vinyl sulfone with thiol

[0132] As shown below, maleimide or vinyl sulfone having a double bond adjacent to an electron-withdrawing carbonyl or sulfone group generates a stable thioether derivative by an addition reaction (Michael addition reaction) with a thiol group at a pH near neutral. Maleimide and vinyl sulfone derivatives with appropriate spacers are commercially available, so it is easy to introduce these functional groups into antigenic peptides or polynucleotides or polynucleotide derivatives. When a thiol group is introduced into an antigenic peptide, the thiol group of the side chain of a cysteine ​​residue can be utilized in the case of an antigenic peptide containing cysteine. Among them, since cysteine ​​is an amino acid with a low existence ratio, a peptide is used to introduce cysteine ​​into the N-terminal side of an antigenic peptide. As a polynucleotide or polynucleotide derivative containing a thiol group, a thiolated polynucleotide in which the hydroxyl group at the 5' end of these is converted into a thiol group can be used.

[0133]

[0134] (c) The thiol group of the cysteine ​​side chain interacts with the thiol group of the thiolated polynucleotide

[0135] As described above, the sulfhydryl group of the side chain of the cysteine residue of the antigenic peptide with cysteine introduced at the N-terminal side is reacted with the sulfhydryl group of the thiolated polynucleotide to form a disulfide group. Disulfide bonds are cleaved in the presence of a reducing agent, and thus are inferior in terms of stability compared to the above two. When introducing a sulfhydryl group into a polynucleotide or a polynucleotide derivative, any known method can be used. As a specific example, the reaction of an aminoated polynucleotide or a polynucleotide derivative represented by the following formula with the N-succinimidyl ester of ω-(2-pyridyldithio) fatty acid can be cited.

[0136]

[0137] Among these, disulfide bonds formed by the combination of the sulfhydryl group of the cysteine side chain that can be easily cleaved in vivo and the sulfhydryl group of the thiolated polynucleotide are preferred.

[0138] The polynucleotide / peptide conjugate that can be used as an active ingredient of the immunizing agent of the present embodiment can take the form of a free body and a pharmaceutically acceptable salt. As pharmaceutically acceptable salts, for example, alkali metal (potassium, sodium, lithium, etc.) salts, alkaline earth metal (calcium, magnesium, etc.) salts, ammonium salts (including tetramethylammonium salts, tetrabutylammonium salts, etc.), organic amine (triethylamine, methylamine, dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tris(hydroxymethyl)methylamine, lysine, arginine, N-methyl-D-glucamine, etc.) salts, acid addition salts (including inorganic acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, nitrate, etc.; and organic acid salts such as acetate, trifluoroacetate, lactate, tartrate, oxalate, fumarate, maleate, benzoate, citrate, mesylate, ethanesulfonate, benzenesulfonate, toluenesulfonate, isethionate, glucuronate, gluconate, etc.) can be cited. In addition, hydrates are also included in pharmaceutically acceptable salts.

[0139] The pharmaceutical composition of the second embodiment of the present invention (hereinafter, sometimes referred to as "pharmaceutical composition") contains the immune inducer of the first embodiment of the present invention. In the manufacture of the pharmaceutical composition, in addition to the peptide / polynucleotide conjugate as an active ingredient, any known ingredients (any carrier, excipient and additive acceptable in pharmaceutical use) and formulation methods can be used. In the manufacture of the pharmaceutical composition containing the immune inducer, in addition to the peptide / polynucleotide conjugate as an active ingredient, any known ingredients (any carrier, excipient and additive acceptable in pharmaceutical use) and formulation methods can be used. The substances for preparation include, but are not limited to, amino acids such as glycine, alanine, glutamine, asparagine, arginine or lysine, antioxidants such as ascorbic acid, sodium sulfate or sodium bisulfite, buffers such as phosphoric acid, citric acid, boric acid buffer, sodium bicarbonate, Tris-hydrochloric acid (Tris-HCl) solution, fillers such as mannitol and glycine, chelating agents such as ethylenediaminetetraacetic acid (EDTA), caffeine, complexing agents such as polyvinyl pyrrolidone, β-cyclodextrin, hydroxypropyl-β-cyclodextrin, bulking agents such as glucose, mannose or dextrin, other carbohydrates such as monosaccharides and disaccharides, colorants, flavoring agents, diluents, emulsifiers, polyvinyl pyrrolidone, Hydrophilic polymers such as ketone, low molecular weight polypeptides, salt-forming counterions, benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenylethyl alcohol, methylparaben, propylparaben, chlorhexidine, preservatives such as sorbic acid or hydrogen peroxide, solvents such as glycerol, propylene glycol or polyethylene glycol, sugar alcohols such as mannitol or sorbitol, suspending agents, polysorbates such as sorbitan esters, polysorbate 20 and polysorbate 80, surfactants such as triton, tromethamine, lecithin or cholesterol, stabilizing enhancers such as sucrose and sorbitol, elasticity enhancers such as sodium chloride, potassium chloride, mannitol and sorbitol, transport agents, excipients and / or pharmaceutical adjuvants. The amount of these substances for preparation is preferably 0.01 to 100 times, particularly preferably 0.1 to 10 times, relative to the weight of the drug. Those skilled in the art can appropriately determine the composition of the appropriate pharmaceutical composition in the preparation according to the applicable disease, the applicable administration route, and the like.

[0140] The pharmaceutical composition can be provided in the form of a dosage form suitable for oral or parenteral administration. For example, injections, suppositories, etc. can be used, and the injections can include intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections and other dosage forms. Such injections can be prepared according to known methods. As a method for preparing an injection, for example, the polynucleotide / peptide conjugate of the present invention can be prepared by dissolving or suspending the polynucleotide / peptide conjugate of the present invention in a sterile aqueous solvent commonly used in injections. As an aqueous solvent for injection, for example, distilled water, physiological saline, phosphate buffer, carbonate buffer, Tris buffer, acetate buffer and other buffers can be used. The pH of such an aqueous solvent can be listed as 5 to 10, preferably 6 to 8. The prepared injection is preferably filled in an appropriate vial. It can also be made into a freeze-dried preparation. In addition to injectable preparations, dosage forms for transdermal and mucosal absorption (liquid sprays, ointments, gels, lotions, patches), dosage forms for subcutaneous local sustained release (suspensions containing nanogels, biodegradable micro / nanocapsules, etc., temperature-responsive gels), preparations with transdermal devices for skin penetration (ion introduction, microneedles), powders, tablets, capsules, syrups, aerosols, dry powders and other inhalants can be used.

[0141] The pharmaceutical composition may further include a substance with immune activation activity as an adjuvant. The adjuvant is not limited and is a substance that activates natural immunity. The adjuvant is preferably an agonist of a natural immune receptor. As a natural immune receptor agonist, examples include TLR agonists (e.g., TLR2 agonists, TLR3 agonists, TLR4 agonists, TLR7 agonists, TLR8 agonists, TLR9 agonists), retinoic acid-inducible gene-I-like receptors (RLR: retinoic acid-inducible gene I (RIG-1)-like receptors) agonists, interferon gene stimulators (STING: stimulator of Interferon genes) agonists, nucleotide-binding oligomerization domain receptor NOD-like receptors (NLR: nucleotide-binding oligomerization domain (NOD)-like receptors) agonists, C-type lectin receptors (CLR: C-type lectin receptors) agonists, etc. As TLR agonists, for example, lipopeptides, Poly IC RNA, imiquimod, resiquimod, monophosphoryl lipid A (MPL), CpG-ODN, etc. can be listed. As RLR agonists, pppRNA, Poly IC RNA, etc. can be listed, as STING agonists, cGAMP, c-di-AMP, c-di-GMP, etc. can be listed, as NLR agonists, iE-DAP, FK565, MDP, moradinate, etc. can be listed, as CLR agonists, β-glucan, trehalose dimycolate, etc. can be listed. The adjuvant is preferably a TLR agonist, more preferably a TLR4 agonist, a TLR7 agonist or a TLR9 agonist, and even more preferably imiquimod, resiquimod, MPL or CpG-ODN. In a certain embodiment, the adjuvant is imiquimod, MPL or CpG-ODN. The adjuvant can be appropriately selected based on the antigenic peptide introduced into the peptide / polynucleotide conjugate, and can be, for example, CpG DNA, or a polynucleotide / β-1,3-glucan complex having a triple helical structure formed by one molecular chain of the polynucleotide or polynucleotide derivative and two molecular chains of the polysaccharide having a β-1,3-glucan backbone as described in International Publication No. 2015 / 118789, in which a polynucleotide or polynucleotide derivative having a partial base sequence with immunostimulating activity is hydrogen-bonded to a polysaccharide having a β-1,3-glucan backbone.

[0142] The pharmaceutical composition can be administered to humans or warm-blooded animals (mice, rats, rabbits, sheep, pigs, cattle, horses, chickens, cats, dogs, monkeys, etc.) by any of the oral and parenteral routes. Examples of parenteral routes of administration include subcutaneous, intradermal, and intramuscular injections, intraperitoneal administration, drips, and sprays to the nasal mucosa or pharynx.

[0143] The dosage of the peptide / polynucleotide conjugate as the active ingredient of the pharmaceutical composition varies depending on the activity, the disease to be treated, the type of animal to be administered, the weight, sex, age, severity of the disease, and the method of administration. Taking an adult weighing 60 kg as an example, in the case of oral administration, the daily dosage is usually about 0.1 to about 100 mg, preferably about 1.0 to about 50 mg, and more preferably about 1.0 to about 20 mg. In the case of parenteral administration, the daily dosage is usually about 0.01 to about 30 mg, preferably about 0.1 to about 20 mg, and more preferably about 0.1 to about 10 mg. When administering to other animals, the above dosage is converted to the dosage per unit body weight, multiplied by the weight of the animal to be administered, and the dosage thus obtained is used.

[0144] By administering the pharmaceutical composition of the present embodiment to pathogen infection, cancer patients, objects that may suffer from cancer / pathogen infection, the cytotoxic T lymphocytes (CTL) in the object that has received the administration are activated by antigen specificity, inducing the production of the antigen-specific antibodies, that is, by inducing the defensive immune response of warm-blooded animals (preferably humans), it is possible to prevent / treat the infection and cancer. That is, the composition is useful as a vaccine for preventing or treating diseases such as the above-mentioned infection, cancer, etc. In the present invention, the terms "tumor" and "cancer" can be used interchangeably. In addition, in the present invention, tumors, malignant tumors, cancers, malignant neoplasms, carcinomas, sarcomas, etc. are sometimes collectively referred to as "tumors" or "cancers". In addition, the terms "tumor" and "cancer" also include myelodysplastic syndromes and other conditions that are classified as precancerous stages according to circumstances.

[0145] The type of tumor to be treated is not particularly limited as long as it is confirmed to be sensitive to the pharmaceutical composition of the present invention, and examples thereof include breast cancer, colon cancer, prostate cancer, lung cancer (including small cell lung cancer, non-small cell lung cancer, etc.), gastric cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine cancer, kidney cancer, hepatocellular carcinoma, thyroid cancer, esophageal cancer, osteosarcoma, skin cancer (including melanoma, etc.), glioblastoma, neuroblastoma, ovarian cancer, head and neck cancer, testicular cancer, colorectal cancer, blood cancer (including leukemia, malignant lymphoma, multiple myeloma, etc.), retinoblastoma, pancreatic cancer, etc.

[0146] The pharmaceutical composition of this embodiment can be used in combination with other anti-tumor agents, such as anti-tumor antibiotics, anti-tumor plant ingredients, biological response modifiers (BRMs), hormones, vitamins, anti-tumor antibodies, molecular targeted drugs, alkylating agents, metabolic antagonists and the like.

[0147] More specifically, examples of the alkylating agent include nitrogen mustard, nitrogen mustard N-oxide, alkylating agents such as bendamustine or chlorambucil, aziridine-based alkylating agents such as carbaquinone or thiotepa, epoxide-based alkylating agents such as dibromomannitol or dibromodulcitol, carmustine, lomustine, semustine, nimustine hydrochloride, nitrosourea-based alkylating agents such as streptozocin, chlorozotocin or ranimustine, busulfan, improsulfan tosylate, temozolomide or dacarbazine, and the like.

[0148] Examples of various metabolic antagonists include purine metabolic antagonists such as 6-mercaptopurine, 6-thioguanine or thioinosine, pyrimidine metabolic antagonists such as fluorouracil, tegafur, tegafur / uracil, carmofur, deoxyfluridine, bromouridine, cytarabine or enocitabine, and folic acid metabolic antagonists such as methotrexate or trimetrexate.

[0149] Examples of the antitumor antibiotic include mitomycin C, bleomycin, pyromycin, daunorubicin, aclarubicin, doxorubicin, idarubicin, pirarubicin, THP-doxorubicin, 4′-epirubicin or epirubicin, chromomycin A3, and actinomycin D.

[0150] Examples of antitumor plant ingredients and their derivatives include vinca alkaloids such as vindesine, vincristine, or vinblastine, taxanes such as paclitaxel, docetaxel, and cabazitaxel, and podophyllotoxins such as etoposide and teniposide.

[0151] Examples of the BRM include tumor necrosis factor and indomethacin.

[0152] Examples of the hormone include hydrocortisone, dexamethasone, methylprednisolone, prednisolone, prasterone, betamethasone, triamcinolone acetonide, oxymetholone, nandrolone, methenolone, fosfostilbene, ethinyl estradiol, chlormadinone, melastosterone, and medroxyprogesterone.

[0153] Examples of vitamins include vitamin C and vitamin A.

[0154] Examples of the anti-tumor antibodies and molecular targeted drugs include trastuzumab, rituximab, cetuximab, panitumumab, nimotuzumab, denosumab, bevacizumab, infliximab, ipilimumab, nivolumab, pembrolizumab, avelumab, pidilizumab, atezolizumab, ramucirumab, imatinib mesylate, dasatinib, sunitinib, lapatinib, dabrafenib, trametinib, cobimetinib, pazopanib, palbociclib, panobinostat, sorafenib, crizotinib, vemurafenib, quizartinib, bortezomib, carfilzomib, ixazomib, midostaurin, and gilteritinib.

[0155] Examples of other antitumor agents include cisplatin, carboplatin, oxaliplatin, tamoxifen, letrozole, anastrozole, exemestane, toremifene citrate, fulvestrant, bicamide, flutamide, mitotane, leuprolide, goserelin acetate, camptothecin, ifosfamide, cyclophosphamide, melphalan, L-asparaginase, acetoglucuronolactone, schizophyllan, sapelin, procarbazine, pipobroman, neocarzinostatin, hydroxyurea, ubenimex, thalidomide, lenalidomide, pomalidomide, eribulin, retinoic acid, and versicolor intracellular polysaccharide.

[0156] As the kind of the infectious disease that becomes the treatment object, the infectious disease caused by pathogens such as virus, fungus, and bacteria can be exemplified.As virus, influenza virus, hepatitis virus, human immunodeficiency virus (HIV), RS virus, rubella virus, measles virus, mumps virus, herpes virus, polio virus, rotavirus, Japanese encephalitis virus, varicella virus, adenovirus, rabies virus, yellow fever virus, etc. can be exemplified.As bacterium, diphtheria bacillus, clostridium tetani, pertussis bacillus, influenzae haemophilus, tuberculosis bacillus, pneumonia streptococcus, helicobacter pylori, anthrax bacillus, typhoid bacillus, meningococcus, shigella, vibrio cholerae, etc. can be listed.As fungus, candida fungi, histoplasma fungi, cryptococcus fungi, aspergillus fungi, etc. can be exemplified.It is also possible to use the pharmaceutical composition of the present invention in combination with the existing therapeutic drugs of these infectious diseases.

[0157] When the pharmaceutical composition of the present embodiment is administered in combination with adjuvants and other drugs, it means that within a certain period, the object of administration takes two drugs into its body. A preparation containing two drugs can be given in a single preparation, and in addition, it can also be prepared and administered separately. When the preparations are prepared separately, the period of administration is not particularly limited, and it can be administered simultaneously, or it can be administered at different times or different days at intervals. When the administration is performed at different times or days, the order of administration is not particularly limited. Usually, each preparation is administered according to its own administration method, so their administration can also be the same number of times or different numbers of times. In addition, when the preparations are prepared separately, the administration method (administration route) of each preparation can be the same, or it can be administered with different administration methods (administration routes). In addition, the two drugs do not need to be present in the body at the same time, as long as they are taken into the body within a certain period (e.g., 1 month, preferably 1 week, more preferably several days, and more preferably 1 day), when any administration is performed, another active ingredient may also disappear from the body.

[0158] Example

[0159] Next, the embodiment for confirming the effect of the present invention is described. It should be noted that, in the present embodiment, "CpG DNA (S)" represents a DNA derivative (an example of a polynucleotide derivative) having a base sequence containing a CpG motif and a phosphodiester bond replaced by a thiophosphate bond. In the chemical structural formula recorded in the embodiment, the polynucleotide derivative is marked with a one-letter base sequence mark and the left side is marked as the 5' terminal side (the right side is marked as the 3' terminal side), and the peptide is marked with three letters other than the cysteine ​​at the N-terminus and the left side is marked as the N-terminal side (the right side is the C-terminal side). In the polynucleotide derivatives marked with a one-letter base sequence, the phosphodiester bonds are all replaced by thiophosphate bonds. In addition, for the terminal structure, when bonded to the spacer, it represents the oxygen atom of the 5' or 3' hydroxyl of the terminal nucleoside, and when not bonded to the spacer, it represents the 5' or 3' hydroxyl of the terminal nucleoside (including the hydrogen atom). In addition, the CpG DNA (S)-peptide conjugate in the present embodiment is made into a salt with added triethylamine and acetic acid.

[0160] Example 1: Preparation of CpG DNA(S)-peptide conjugate

[0161] 1 mol of amino-modified CpG DNA (S) synthesized by any known method (CpG DNA (S) derivative with an amino group having a structure shown in the following formula introduced at the 5' end. Base sequence: ATCGACTCTCGAGCGTTCTCATCGACTCTCGAGCGTTCTC (sequence number 229: hereinafter referred to as "CpG40 (S)."). All phosphodiester bonds are phosphorothioate bonds.) and 30 mol of succinimidyl 6-[3'-(2-pyridyldisulfide)-propionamide]hexanoate (LC-SPDP) are mixed in a phosphate buffer (pH 8.0). After standing at 40°C for 3 hours, the SPDP-modified CpG DNA (S) is purified using a NAP-5 column.

[0162]

[0163] Hereinafter, the structure represented by the following formula is abbreviated as "ssH amino linker".

[0164]

[0165] A peptide (amino acid sequence: CSIINFEKL (sequence number 250: hereinafter referred to as "OVApep9") with cysteine ​​added to the N-terminus of an antigenic peptide derived from ovalbumin (OVA) (amino acids at positions 257 to 264; amino acid sequence: SIINFEKL: sequence number 196) was mixed in a 30% N,N-dimethylformamide (DMF) aqueous solution at a ratio of 25 mol to 1 mol of SPDP-modified CpG DNA (S). After standing at 40°C for 3 hours, the CpG DNA (S)-peptide conjugate was fractionated by HPLC. The HPLC conditions were: solution A was 0.1 M triethylammonium acetate (TEAA; pH 7.0), solution B was acetonitrile, a ZORBAX Eclipse Plus C18 column was used, and the following gradient conditions were used.

[0166] 0 minutes A: 90% B: 10%

[0167] ~25 minutes 70% 30%

[0168] ~30 minutes 0% 100%

[0169] When the solution after the reaction of SPDP-modified CpG DNA (S) and OVA-derived peptide was fractionated using HPLC, the absorption of dA40 (S) at 260 nm was monitored for detection. It was confirmed that the elution time of the CpG DNA (S)-peptide conjugate after fractionation was slower than that of the SPDP-modified CpG DNA (S). It is believed that this is due to the slower elution time due to binding to the hydrophobic peptide. In addition, the peak of unreacted SPDP-modified CpG DNA (S) was not observed in the chromatogram after preparation, and only the peak of the CpG DNA (S)-peptide conjugate was detected, thereby confirming that the target CpG DNA (S)-peptide conjugate (CpG40 (S)-OVApep9 conjugate: refer to the structural formula below) can be obtained with high purity.

[0170]

[0171] Example 2: Evaluation of cytotoxic T cell induction by CpG DNA(S)-peptide conjugates

[0172] The CpG DNA (S)-peptide conjugate as an antigen was intradermally administered to mice (C57BL / 6 mice (♂, 7 weeks old)) (20 ng per mouse, once). One week after the administration, spleen cells were taken from individuals of the same strain of mice that had not been administered the drug, and the mice were divided into two groups. An antigenic peptide (peptide sequence; SIINFEKL: sequence number 196) derived from ovalbumin (ovalbumin, OVA) as an antigen was added to one group, and the group was left to stand for 90 minutes to prepare antigen-retaining spleen cells, and spleen cells to which the peptide was not added were designated as antigen-non-retaining spleen cells. Both antigen-retaining spleen cells and antigen-non-retaining spleen cells were fluorescently modified using 5,6-carboxyfluorescein succinimidyl ester (CFSE). At this time, by changing the concentration of CFSE, the fluorescence intensity of antigen-retaining spleen cells (CFSE: 5 μM) was higher than that of antigen-non-retaining spleen cells (CFSE: 0.5 μM). The same number of spleen cells with antigen administration and spleen cells without antigen administration were mixed and administered to the mouse individuals to which the CpG DNA (S)-peptide conjugate as the antigen was administered one week after administration by tail vein administration. The dosage of the CpG DNA (S)-peptide conjugate was 20 ng per mouse in terms of peptide conversion (in this case, 250 ng in terms of CpG40 (S) conversion).

[0173] 24 hours after the above-mentioned tail vein administration, spleen cells were removed from the mice, and the ratio of antigen-retaining spleen cells to antigen-non-retaining spleen cells was quantified by flow cytometry, and the reduction in antigen-retaining spleen cells was evaluated, thereby evaluating the activity of induced cytotoxic T cells. The results of flow cytometry are shown in Figure 1 ( Figure 1 For comparison, mice to which PBS (phosphate buffered saline) was administered instead of CpG DNA (S)-peptide conjugate were used as a control group ( Figure 1 (a)) and mice given antigenic peptides and CpG DNA (S), respectively, were measured under the same conditions, and the results are shown together in Figure 1 ( Figure 1 (c)).

[0174] like Figure 1 As shown in (a), spleen cells collected from mice given PBS contain antigen-retaining spleen cells and non-retaining spleen cells in equal proportions, but Figure 1 As shown in (b), about 95% of the spleen cells collected from mice that were given CpG DNA (S)-peptide conjugates disappeared. This shows that the peptide antigen-specific immune response was induced by the administration of CpG DNA (S)-peptide conjugates. Figure 1 Comparison with (c) shows that the effect is greater than that of mice to which the antigenic peptide and CpG DNA (S) were administered separately.

[0175] Example 3: Dose dependence of CpG DNA(S)-peptide conjugate

[0176] The mice were immunized by changing the dosage of CpG DNA (S) -peptide conjugate. In the same manner as in Example 2, a mixture of the same number of antigen-retaining spleen cells and antigen-non-retaining spleen cells was administered via the tail vein to individual mice. The ratio of antigen-retaining spleen cells to antigen-non-retaining spleen cells in spleen cells collected from the individual mice was quantified by flow cytometry, and the reduction in the amount of antigen-retaining spleen cells was evaluated, thereby evaluating the activity of the induced cytotoxic T cells.

[0177] The results of flow cytometry are shown in Figure 2 It is known that when the dosage of CpG DNA (S)-peptide conjugate is reduced to less than 20 ng in terms of peptide, the effect gradually disappears. Generally, peptide immunization requires a dosage of several μg, but for the CpG DNA (S)-peptide conjugate prepared in Example 1, the dosage was successfully reduced to 1 / 100 to 1 / 1000.

[0178] Example 4: Dependence of base length and base sequence of CpG DNA (S) contained in CpG DNA (S)-peptide conjugate

[0179] The CpG DNA (S) contained in the CpG DNA (S)-peptide conjugate was changed to a sequence having a base length of 30 (base sequence: GAGCGTTCTCATCGACTCTCGAGCGTTCTC (sequence number 227: hereinafter referred to as “CpG30 (S)a”) and a sequence having a base length of 30 (base sequence: ATCGACTCTCGAGCGTTCTCGAGCGTTCTC (sequence number 228: hereinafter referred to as “CpG40 (S)”)) used in Example 1. Referred to as "CpG30(S)b". )), a sequence with a base length of 24 (base sequence: TCTCGAGCGTTCTCGAGCGTTCTC (sequence number 225: hereinafter referred to as "CpG24(S)".)) and a sequence with a base length of 20 (sequence number 222: base sequence: ATCGACTCTCGAGCGTTCTC (hereinafter referred to as "CpG20(S)a".) and base sequence: GAGCGTTCTCGAGCGTTCTC (sequence number 223: hereinafter referred to as "CpG20(S)b".)) (the structural formula is referred to as follows), and a CpG DNA(S)-peptide conjugate was prepared by the same method as in Example 1 (for the structural formula and base sequence, refer to the following formula and the following Table 9. In Table 9, the base sequences in bold and underlined are CpG motifs. All phosphodiester bonds are phosphorothioate bonds.).

[0180] [Table 9]

[0181]

[0182]

[0183]

[0184] Mice were immunized with CpG DNA(S)-peptide conjugates (20 ng per mouse in terms of peptide conversion) having different base lengths of CpG DNA(S). The ratio of antigen-retaining spleen cells to antigen-non-retaining spleen cells administered to the mice via the tail vein was quantified using flow cytometry in the same manner as in Example 2. The reduction in the amount of antigen-retaining spleen cells was evaluated, thereby evaluating the activity of the induced cytotoxic T cells.

[0185] The results of flow cytometry are shown in Figure 3 ,4 . It can be seen that even when the base length of CpG DNA (S) is shortened to 30, antigen-retaining spleen cells completely disappear. When the base length of CpG DNA (S) is reduced to 20, when the number of CpG motifs contained in CpG DNA (S) is only 1, no decrease in antigen-retaining spleen cells is observed, but when the number of CpG motifs contained in CpG DNA (S) is 2, a decrease in antigen-retaining spleen cells is observed, indicating that the activity of peptide-specific cytotoxic T cells is induced.

[0186] Example 5: Amino Acid Length Dependence of Peptides Contained in CpG DNA(S)-Peptide Conjugates

[0187] CpG DNA (S) -peptide conjugates (structural formula see below) were prepared by extending the N-terminal side of the antigenic peptide of the CpG DNA (S) -peptide conjugate prepared in Example 1 to peptides having an amino acid length of 18 (amino acid sequence: CEVSGLEQLESIINFEKL (sequence number 251: hereinafter referred to as "OVApep18")) and an amino acid length of 27 (amino acid sequence: CMSMLVLLPDEVSGLEQLESIINFEKL (sequence number 252: hereinafter referred to as "OVApep27")), and mice were immunized with them (20 ng per mouse in terms of peptide). The ratio of antigen-retaining spleen cells and antigen-non-retaining spleen cells administered intravenously to the tail of the mice was quantified by flow cytometry in the same manner as in Example 2, and the reduction in the amount of antigen-retaining spleen cells was evaluated, thereby evaluating the activity of the induced cytotoxic T cells.

[0188]

[0189] The results of flow cytometry are shown in Figure 5 It was found that when the amino acid length of the antigenic peptide was extended to 18 or 27, the activity of peptide-specific cytotoxic T cells tended to decrease.

[0190] Example 6: Dependence of CpG DNA(S)-peptide conjugates on the structure of the spacer and the bonding position of the peptide

[0191] The activity of induced cytotoxic T cells was evaluated by the same procedure as in Example 2 using a CpG DNA (S) -peptide conjugate (hereinafter referred to as Compound (I)) in which the ssH amino linker in the CpG DNA (S) -peptide conjugate prepared in Example 1 was changed to the following structure (hereinafter referred to as "C6 amino linker"), a CpG DNA (S) -peptide conjugate in which a C18 spacer having PEG was inserted between the CpG DNA (S) and the ssH amino linker, and a CpG DNA (S) -peptide conjugate in which an antigenic peptide was covalently bonded to the 3' end of the CpG DNA (S) rather than the 5' side via the same spacer structure as Compound (I). The results confirmed that in all cases, a strong peptide-specific cytotoxic T cell activity was induced to the same extent as that of the CpG DNA (S) -peptide conjugate prepared in Example 1.

[0192]

[0193] Example 7: Evaluation of antigen presentation in peritoneal macrophages

[0194] Peritoneal macrophages collected from mice were placed in a 48-well plate (1.5×10 5 Cells / well), CpG DNA (S)-peptide conjugates prepared using antigenic peptides of different amino acid lengths (OVApep9, OVApep18, OVApep27) and CpG DNA (S) of different base lengths (CpG40 (S), CpG30 (S) a, CpG30 (S) b, CpG20 (S) a) were added to the wells at 2 μg / mL in terms of peptide conversion, and cultured for 24 hours. After culture, antibodies specific to the molecular complex of OVApep8 and MHC (fluorescently labeled with phycoerythrin (PE): (hereinafter referred to as "PE labelled H-2K b / FIINFEKL") were added, and peritoneal macrophages bound to the antibodies were quantified by flow cytometry to evaluate the amount of antigen presentation.

[0195] The results of flow cytometry are shown in Figure 6 and 7 Based on these results, it was confirmed that the base length of CpG DNA (S) has almost no effect on the amount of antigen presentation, and when the amino acid length of the antigenic peptide increases to 18 or 27, there is a tendency for the amount of antigen presentation to decrease. Figure 7 In the CpG40(S)-OVApep9 conjugate having a polyoxyethylene group in the spacer, which is represented by "CpG40(S)-PEG-OVApep9", the polyoxyethylene group on the spacer has almost no effect on the amount of antigen presentation.

Claims

1. An immunity inducing agent comprising a polynucleotide / peptide conjugate as an active ingredient, wherein the polynucleotide / peptide conjugate is formed by bonding a single-stranded polynucleotide derivative containing a CpG motif to an antigenic peptide via a spacer, wherein the spacer is covalently bonded to the polynucleotide derivative at one end and to the antigenic peptide at the other end, The antigenic peptide is an epitope peptide; wherein the antigenic peptide constituting the polynucleotide / peptide conjugate and the spacer bonded to the polynucleotide derivative are bonded via a covalent bond, i.e., a disulfide bond, generated by the reaction of the thiol group of the cysteine ​​residue at the N-terminus of the antigenic peptide with the thiol group of the spacer; The spacer comprises a repeating unit of the following formula: In the above formula, X represents an oxygen atom or a sulfur atom, where each X is optionally the same or different, R stands for (CH2) p O, (CH2) q NH, (CH2CH2O) m In any of the above, m, p and q each independently represent a natural number less than 10, n represents a natural number less than 10; The amino acid length of the antigenic peptide is 9 or more and 27 or less; The polynucleotide derivative has a base length of 20 or more and 40 or less; The polynucleotide derivative is a polydeoxyribonucleotide derivative containing 2 CpG motifs; The polynucleotide derivative is a polynucleotide derivative in which all phosphodiester bonds are replaced by phosphorothioate bonds.

2. The immune inducing agent according to claim 1, characterized in that The polynucleotide derivative has a base length of 20 or more and 30 or less.

3. The immune inducing agent according to claim 1, characterized in that The covalent bond between the spacer and the polynucleotide derivative is a covalent bond that can be broken in an organism environment.

4. The immune inducing agent according to claim 1, characterized in that The spacer has a structure shown in any of the following formulas:

5. The immune inducing agent according to claim 1, characterized in that A substance having immunostimulatory activity is also contained as an adjuvant. A pharmaceutical composition comprising the immunity inducing agent according to claim 1.

7. Use of the immune inducer according to claim 1 in preparing a pharmaceutical composition for treating tumors. A pharmaceutical composition comprising the immunity inducing agent according to claim 3.

9. Use of the immune inducer according to claim 3 in preparing a pharmaceutical composition for treating tumors.

10. A pharmaceutical composition comprising the immunity inducing agent according to claim 2.

11. Use of the immune inducer according to claim 2 in preparing a pharmaceutical composition for treating tumors.

12. An immune inducing agent according to claim 1, characterized in that: The polynucleotide derivative has a base length of 20 or more and 30 or less, and The spacer has a structure shown in any of the following formulas:

13. A pharmaceutical composition comprising the immunity inducing agent according to claim 12.

14. Use of the immune inducer according to claim 12 in preparing a pharmaceutical composition for treating tumors.

Images