Improved high-throughput combinatorial gene modification system and optimized Cas9 enzyme variants

Abstract

The present invention provides an improved high-throughput system and method for generating and screening gene variants by combinatorial modification. Also provided are optimized SpCas9 enzyme variants generated by the system.

Description

[0001] Related Applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 733,410, filed on September 19, 2018, the contents of which are hereby incorporated by reference in their entirety for all purposes.

[0003] background

[0004] Recombinant proteins are of increasing importance in a wide variety of applications, including uses in industrial and medical settings. Since the functionality of recombinant proteins, especially enzymes and antibodies, can be improved by genetic mutation, there are ongoing efforts to generate and select a wide range of possible genetic variants of recombinant proteins in order to identify those recombinant proteins with more desirable properties, so that increased efficiency can be achieved in their applications.

[0005] Cas9 (CRISPR-associated protein 9) is an RNA-guided DNA endonuclease associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immune system in bacteria, such as Streptococcus pyogenes, a Gram-positive bacterium of the genus Streptococcus. Cas9 is an enzyme that has attracted great interest due to the increasing use of CRISPR for gene editing in recent years, and many people have tried to improve its performance through genetic modification. However, currently available systems for systematically generating and screening large numbers of gene variants for any particular protein are generally cumbersome, labor-intensive, and therefore inefficient.

[0006] Therefore, there is a clear need for new high-throughput combinatorial gene modification systems / methods and engineered proteins (such as Cas9 enzymes) with improved properties. The present invention satisfies this and other related needs.

[0007] Summary of the invention Previously, a research team led by the inventors designed a system for high-throughput functional analysis of high-order barcoded combinatorial gene libraries, called combinatorial genetic en masse or CombiGEM. The system has been used to generate, for example, a library of barcoded dual guide RNA (gRNA) combinations and a library of two- or three-dimensional barcoded human microRNA (miRNA) precursors to further screen for desired functionality, see, for example, Wong et al. (Nat. Biotechnol. 2015 September; 33 (9): 952-961), Wong et al. (Proc. Nat. Acad. Sci., 2016 March 1, 113 (9): 2544-2549), WO2016 / 070037 and WO2016 / 115033. See also U.S. Patent No. 9315806. The inventors have now further modified the CombiGEM system and developed an improved CombinSEAL platform that provides seamless connections between any two adjacent gene components of each member of a high-order combinatorial mutant library. In other words, the platform does not introduce any artificial or foreign amino acid sequences at each junction site, thereby allowing the generation of a large number of protein variants containing combinatorial mutations while retaining the natural amino acid sequence of the wild-type protein.

[0008] Therefore, the present invention first provides an improved high-throughput gene modification system for systematically generating and screening combinatorial mutants. On the one hand, the present invention provides a DNA construct, which comprises in the 5' to 3' direction of the DNA chain: a first recognition site for a first IIS type restriction enzyme; a DNA element; a first and a second recognition site for a second IIS type restriction enzyme, a barcode uniquely assigned to the DNA element; and a second recognition site for the first IIS type restriction enzyme. In some embodiments, the DNA construct is a linear construct; in other embodiments, the DNA construct is a circular construct or a DNA vector, including a bacterial-based DNA plasmid or a DNA viral vector. The DNA construct is preferably isolated, i.e., in the absence of any large amount of other DNA sequences. In some embodiments, the present invention provides a library comprising at least two possible more kinds of DNA constructs described above and herein, each library member having a different DNA element, the DNA element having a different polynucleotide sequence and a uniquely assigned barcode.

[0009] In another aspect of the present invention, another DNA construct is provided: the DNA construct comprises in the 5' to 3' direction of the DNA chain: a recognition site for a first IIS type restriction enzyme; a plurality of DNA elements; a primer binding site; and a plurality of barcodes each uniquely assigned to one of the plurality of DNA elements, and a recognition site for a second IIS type restriction enzyme, wherein the plurality of DNA elements are connected to each other to form a coding sequence for a protein (such as a coding sequence for a natural or wild-type protein), and there is no foreign sequence at any connection point between any two of the plurality of DNA elements, and wherein the plurality of barcodes are placed in the reverse order of the DNA elements to which they are assigned. In some embodiments, the DNA construct is a linear construct; in other embodiments, the DNA construct is a circular construct, such as a DNA vector including a bacterial-based DNA plasmid or a DNA viral vector. A library of such a construct is also provided to include at least two or more constructs, each member having a different set of DNA elements with different polynucleotide sequences and a uniquely assigned set of barcodes.

[0010] In some embodiments of any of the DNA constructs described above and herein, the first Type IIS restriction enzyme and the second Type IIS restriction enzyme produce compatible ends after cutting the DNA molecule. In some embodiments, the first Type IIS restriction enzyme is BsaI. In some embodiments, the second Type IIS restriction enzyme is BbsI.

[0011] In another aspect, the present invention relates to a method for producing a combined gene construct. The method comprises the steps of: (a) cutting a first DNA vector with a first Type IIS restriction enzyme to release a first DNA fragment, the first DNA fragment comprising a first DNA segment, a first and a second recognition site for a second Type IIS restriction enzyme, and a first barcode flanked by a first and a second end produced by the first Type IIS restriction enzyme, the first DNA vector comprising from 5' to 3': a first recognition site for the first Type IIS restriction enzyme, a DNA element, a first and a second recognition site for the second Type IIS restriction enzyme, a barcode uniquely assigned to the DNA element; and a second recognition site for the first Type IIS restriction enzyme; (b) cutting a first DNA vector with a second Type IIS restriction enzyme The method comprises cutting an initial expression vector comprising a promoter to linearize the initial expression vector near the 3' end of the promoter and generate two ends compatible with the first and second ends of the DNA fragment of (a); (c) annealing and ligating the first DNA fragment of (a) into the linearized expression vector of (b) to form a unidirectional composite expression vector, wherein the first DNA fragment and the first barcode are operably linked to the 3' end of the promoter; (d) cutting a second DNA vector with a first Type IIS restriction enzyme to release a second DNA fragment, wherein the second DNA fragment comprises a second DNA segment, a first and second recognition site of a second Type IIS restriction enzyme, and a second DNA segment flanked by the first Type IIS restriction enzyme. The second barcode at the first and second ends of the DNA fragment of (d) is generated by an S-type restriction enzyme, wherein the second DNA vector comprises from 5' to 3': a first recognition site of a first IIS restriction enzyme, a DNA element, a first and second recognition site of a second IIS restriction enzyme, a barcode uniquely assigned to the DNA element; and a second recognition site of the first IIS restriction enzyme; (e) cutting the composite expression vector of (c) with a second IIS restriction enzyme to linearize the composite expression vector between the first DNA element and the first barcode and generate two ends compatible with the first and second ends of the DNA fragment of (d); and (f) annealing and ligating the second DNA fragment of (d) to the The invention relates to a method for linearizing a protein expressed in a linearized composite expression vector of (e) between the first DNA element and the first barcode to form a bidirectional composite expression vector, wherein the first DNA fragment, the second DNA fragment, the second barcode and the first barcode are operably linked to the 3' end of the promoter in this order, wherein the first and second DNA elements encode the first and second segments of the preselected protein starting from their N-termini immediately adjacent to each other, and wherein the first and second DNA fragments are linked to each other in the bidirectional composite expression vector without any foreign nucleotide sequence that results in any amino acid residue not found in the preselected protein, and wherein each of the first and second DNA elements comprises one or more mutations.

[0012] In some embodiments of the method, steps (d)-(f) are repeated up to the nth time to incorporate the nth DNA fragment comprising the nth DNA element, the first and second recognition sites of the second Type IIS restriction enzyme, and the nth barcode into the n-way composite expression vector, wherein the nth DNA element encodes the nth or second to last segment of the preselected protein starting from its C-terminus. The method further comprises the following steps: (x) providing a final DNA vector comprising the (n+1)th DNA element, the primer binding site, and the (n+1)th barcode between the first and second recognition sites of the first Type IIS restriction enzyme; (y) cleaving the final DNA vector with the first Type IIS restriction enzyme to release a final DNA fragment, wherein the final DNA fragment comprises, from 5' to 3', the (n+1)th DNA element, the primer binding site, and the (n+1)th barcode flanked by the first and second termini generated by the first Type IIS restriction enzyme; (z) annealing and ligating the final DNA fragment to the n-way composite expression vector repeated in steps (d)-(f). The n-way composite expression vector generated after the nth time and linearized by the second Type IIS restriction enzyme to form a final composite expression vector, wherein the first, second, and so on up to the nth and (n+1)th DNA elements encode the first, second, and so on up to the nth and last segments of the preselected protein starting from their N-termini immediately adjacent to each other, and wherein the first, second, and so on up to the nth and last DNA fragments are connected to each other in the final composite expression vector without any foreign nucleotide sequence that results in any amino acid residue not found in the preselected protein, and wherein each DNA element comprises one or more mutations.

[0013] In some embodiments of the methods described above or herein, the first Type IIS restriction enzyme and the second Type IIS restriction enzyme produce compatible ends after cutting the DNA molecule. In some embodiments, the first Type IIS restriction enzyme is BsaI. In some embodiments, the second Type IIS restriction enzyme is BbsI.

[0014] In another aspect, the present invention provides a library comprising at least two and possibly more final composite expression vectors produced by the methods described above and herein.

[0015] Secondly, the present invention provides SpCas9 mutants with improved on-target cleavage and reduced off-target cleavage capabilities, which are produced and identified by using the improved high-throughput gene modification system described above and herein. On the one hand, the present invention provides a polypeptide (preferably an isolated polypeptide) comprising an amino acid sequence shown in any one of SEQ ID NO:1 and 4-13 used as a basic sequence, wherein at least one of residues 661, 695, 848, 923, 924, 926, 1003 or 1060 corresponding to SEQ ID NO:1 may be modified, for example, by substitution. Some exemplary polypeptides of the present invention are provided in Table 2 of the present disclosure. In some embodiments, the residue corresponding to residue 1003 of SEQ ID NO:1 is substituted and the residue corresponding to residue 661 of SEQ ID NO:1 is substituted. In some embodiments, the polypeptide further has a substitution at the residue corresponding to residue 926 of SEQ ID NO:1. For example, the polypeptide has the residue corresponding to residue 1003 of SEQ ID NO: 1 substituted with histidine and the residue corresponding to residue 661 of SEQ ID NO: 1 substituted with alanine. In another example, the polypeptide has the basic amino acid sequence shown in SEQ ID NO: 1, wherein residue 1003 is substituted with histidine and residue 661 is substituted with alanine, which optionally further includes a substitution with alanine at residue 926. In another example, the polypeptide has the basic amino acid sequence shown in SEQ ID NO: 1, wherein residues 695, 848 and 926 are substituted with alanine, residue 923 is substituted with methionine and residue 924 is substituted with valine. A composition is also provided, comprising (1) the polypeptide described above and herein; and (2) a physiologically acceptable excipient.

[0016] On the other hand, the present invention provides a nucleic acid (preferably an isolated nucleic acid) comprising a polynucleotide sequence encoding a polypeptide as described above and herein and a composition containing the nucleic acid. The present invention also provides an expression cassette comprising a promoter operably linked to a polynucleotide sequence encoding a polypeptide of the present invention and a vector (such as a bacterial-based plasmid or a viral-based vector) comprising the expression cassette, a host cell comprising the expression cassette or polypeptide of the present invention.

[0017] On the other hand, the present invention provides a method for cutting a DNA molecule at a target site. The method includes contacting a DNA molecule comprising a target DNA site with a polypeptide described above and herein and a short guide RNA (sgRNA) that specifically binds to the target DNA site, thereby causing the DNA molecule to be cut at the target DNA site. In some embodiments of the method, the DNA molecule is genomic DNA in a living cell, and the cell has been transfected with a polynucleotide sequence encoding sgRNA and a polypeptide. In some cases, the cell has been transfected with a first vector encoding sgRNA and a second vector encoding a polypeptide. In other cases, the cell has been transfected with a vector encoding both sgRNA and a polypeptide. In some embodiments of the method, each of the first and second vectors is a viral vector, such as a retroviral vector, especially a lentiviral vector.

[0018] The high-throughput combinatorial gene modification system, method and related compositions described above and herein are suitable for use in prokaryotic cells and eukaryotic cells when modified. Some equivalents can also be drawn from the above and the description herein. For example, the placement of DNA elements and their corresponding barcodes in each DNA construct can be converted, i.e., the DNA construct comprises from 5' to 3': the first recognition site of the first IIS type restriction enzyme, the barcode uniquely assigned to the DNA element, the first and second recognition sites of the second IIS type restriction enzyme, the DNA element and the second recognition site of the first IIS type restriction enzyme. Except for correspondingly converting the relative positions of the DNA elements and the barcodes in these vectors, the library of DNA constructs and such DNA constructs can be used in the same manner as described herein to produce intermediate and final vectors similar to those described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1. Generation of a high-coverage combinatorial mutant library of SpCas9 and efficient delivery of the library to human cells. a, Strategy for assembling a combinatorial mutant library of SpCas9. The coding sequence of SpCas9 was modularized into four combinable components (i.e., P1 to P4), each of which contained a library of barcoded fragments encoding predetermined amino acid residue mutations at defined positions as shown. Through continuous rounds of one-pot seamless ligation of components, a library of 952 SpCas9 variants was assembled, and barcodes uniquely marking the ligation of each variant were generated (see Figure 7 for details). b, Cumulative distribution of sequencing reads of the barcoded combinatorial mutant library from a plasmid pool extracted from Escherichia coli and an infected OVCAR8-ADR cell pool. High coverage of the library within the plasmid and infected cell pools (~99.9% and ~99.6%, respectively) was detected from ~800,000 reads per sample, and most combinations detected at least 300 absolute barcode reads (highlighted by the shaded area).

[0021] Figure 2. Strategy for analyzing on-target and off-target activities of SpCas9 variants in human cells. a,

[0022] The SpCas9 library was delivered to the OVCAR8-ADR reporter cell line via lentivirus at a multiplicity of infection of ~0.3, and the OVCAR8-ADR reporter cell line expressed RFP and GFP genes driven by UBC and CMV promoters, respectively, and a tandem U6 promoter-driven expression cassette of gRNA targeting the RFP (RFPsg5 or RFPsg8) site. The expression of RFP and GFP was analyzed by flow cytometry. The on-target activity of SpCas9 was measured when the gRNA spacer sequence perfectly matched the RFP target site, and its off-target activity was measured when the RFP target site contained a synonymous mutation. Cells containing active SpCas9 variants are expected to lose RFP fluorescence. Based on RFP fluorescence, cells were sorted into boxes containing ~5% of the population, and their genomic DNA was extracted to quantify the barcoded SpCas9 variants by Illumina HiSeq. b, scatter plot comparing the barcode counts of each SpCas9 variant between the sorted boxes (i.e., A, B, and C) and the unsorted population. Each point represents a SpCas9 variant, and WT SpCas9 and eSpCas9 (1.1) are labeled in the graph. The reference solid line indicates 1.5-fold enrichment and 0.5-fold depletion in barcode counts, and the reference dashed line indicates no change in barcode counts in the sorted bins compared to the unsorted population.

[0023] Figure 3. High-throughput analysis reveals broad-spectrum specificity and efficiency of SpCas9 combinatorial mutants. a, SpCas9 combinatorial mutants were ranked by their log-transformed enrichment ratios (i.e., log2(E)) based on analysis data from two biological replicates, which represents their relative abundance in sorted RFP-depleted cell populations for each on-target (x-axis) and off-target (y-axis) reporter cell line (see Table 2 and Methods for details). Each point in the scatter plot represents a SpCas9 variant, and WT SpCas9, eSpCas9(1.1), Opti-SpCas9, and OptiHF-SpCas9 are labeled. In the two off-target reporter lines RFPsg5-OFF5-2 and RFPsg8-OFF5, >99% of the combinatorial mutants had lower log2(E) than WT, while in the two on-target reporter lines RFPsg5-ON and RFPsg8-ON, 16.2% and 2.5% of the mutants had higher log2(E) than WT, respectively. b, OVCAR8-ADR reporter cells containing on-target (upper panel) and off-target (lower panel) sites were infected with individual SpCas9 combo mutants. Editing efficiency of SpCas9 variants was measured by the percentage of cells depleted of RFP levels and compared with WT.

[0024] Figure 4 .Heatmap depicting editing efficiency and epistasis of on-target and off-target sites. As described in the methods, the editing efficiency (upper figure; measured by log2(E)) and epistasis (lower figure; ε) scores were determined for each SpCas9 combination mutant. Amino acid residues that are expected to contact the target DNA strand or are located at the linker region connecting the HNH and RuvC domains of SpCas9 are grouped on the y-axis, while those amino acid residues that are expected to interact with non-target DNA strands are shown on the x-axis to aid visualization. The P value of log2(E) for each combination was calculated by comparing log2(E) with those contained within the entire population obtained from two independent biological replicates using a two-tailed Student's t-test for two samples (MATLAB function 'ttest2'). The adjusted P value (i.e., Q value) was calculated based on the distribution of P values ​​(MATLAB function 'mafdr') to correct for multiple hypothesis testing. Based on a Q value cutoff of <0.1, log2(E) was considered statistically significant relative to the entire population and was framed with a box. The complete heatmap is fully displayed in Fig.10 Middle. Combinations for which no enrichment ratio or epistasis score was measured are shown in grey.

[0025] Figure 5. Opti-SpCas9 exhibits robust on-target and reduced off-target activity. ab, Evaluation of efficient on-target editing of SpCas9 variants with gRNAs targeting endogenous loci. The percentage of indels was measured using the T7 endonuclease I (T7E1) assay. The ratio of on-target activity of SpCas9 variants to WT (in (a)) and Opti-SpCas9 (in (b)) was determined, and the median and interquartile range of the normalized percentage of indels formed for the 10-16 loci tested are shown. Each locus was measured once or twice, and the full data set is shown in Figure 5. Fig.12 c, GUIDE-Seq genome-wide specificity profiles of a panel of SpCas9 variants, each paired with the indicated gRNA. The locations of mismatches in off-target sites are highlighted in color, and GUIDE-Seq read counts are used as a measure of the efficiency of cutting at a given site. A list of gRNA sequences used is shown in Table 5.

[0026] Figure 6 .Examples of strategies used to characterize combinatorial mutations in protein sequences.

[0027] Figure 7. Strategy for seamless assembly of a pool of barcoded combinatorial mutant libraries. a, To create barcoded DNA components in storage vectors, gene inserts were generated by PCR or synthesis and cloned into storage vectors containing random barcodes (pAWp61 and pAWp62; digested with EcoRI and BamHI) by Gibson assembly reaction. BsaI digestion was performed to generate barcoded DNA components (i.e., P1, P2, ..., P(n)). BbsI sites and primer binding sites for barcode sequencing were introduced between the inserts and the barcodes of pAWp61 and pAWp62, respectively. b, To create a barcoded combinatorial mutant library, the combined DNA components and the target assembly vector were digested with BsaI and BbsI, respectively. One-pot ligation created a combined vector library, which was further iteratively digested and ligated with subsequent pools of DNA components to generate higher-order combinatorial mutants. After digestion with type IIS restriction enzymes (i.e., BsaI and BbsI), the barcoded inserts were ligated with compatible overhangs derived from protein coding sequences, so that no fusion scars were formed in the ligation reaction. All barcodes were located in continuous DNA fragments. The final combinatorial mutant library was encoded in a lentivirus and delivered to target human cells. The integrated barcodes representing each combination were amplified from genomic DNA within the pooled cell population in an unbiased manner and quantified using high-throughput sequencing to identify changes in performance under different experimental conditions. c. In order to show highly reproducible performance between plasmids and infected cell pools and between biological replicates of infected cell pools.

[0028] Figure 8 . Fluorescence activated cell sorting of human cells infected with a SpCas9 library containing on-target and off-target reporters. The OVCAR8-ADR reporter cell line expressing RFP and GFP genes driven by UBC and CMV promoters, respectively, and a tandem U6 promoter-driven expression cassette of a gRNA targeting the RFP site (RFPsg5 or RFPsg8) was not infected or infected with the SpCas9 library. The RFPsg5-ON and RFPsg8-ON lines contain sites that fully match the gRNA sequence, while the RFPsg5-OFF5-2 and RFPsg8-OFF5 lines contain synonymous mutations on RFP and mismatch with the gRNA. Cells were sorted by flow cytometry into boxes that each contained ~5% of a population with low RFP fluorescence. These experiments were repeated twice independently with similar results.

[0029] Fig. 9Positive correlation between enrichment scores determined from the pooled screen and individual validation data. The normalized log2(E) for each SpCas9 combination mutant is the mean score determined from the pooled screen in two biological replicates, and the normalized RFP disruption value is the mean percentage of cells depleted of RFP levels compared to WT determined from three biological replicates. R is the Pearson correlation coefficient.

[0030] Fig.10 .Heat map depicting editing efficiency of on-target and off-target sites. Editing efficiency is measured by logarithmically transformed enrichment ratios (log2(E)) determined for each SpCas9 combination mutant. Enriched and depleted mutants have >0 and <0, respectively. To aid visualization, amino acid residues that are expected to contact the target DNA strand or are located at the linker region connecting the HNH and RuvC domains of SpCas9 are grouped on the y-axis, while those amino acid residues that are expected to contact non-target DNA strands are shown on the x-axis. Combinations without enrichment are shown in gray.

[0031] Fig.11 . The frequency of N20-NGG and G-N19-NGG sites in the reference human genome. A custom Python code was used to find the frequencies of N20-NGG and G-N19-NGG sites in both strands of the reference human genome hg19. 20 -NGG and GN 19 -NGG sites as an estimate of the targeting range of Opti-SpCas9 and other engineered SpCas9 variants, including eSpCas9(1.1), SpCas9-HF1, HypaCas9, and evoCas9, respectively. 20 The frequency of -NGG sites in the human genome is GN 19 -NGG sites are approximately 4.3 times higher.

[0032] Fig.12 .Summary of the results of the T7 endonuclease I (T7E1) assay for DNA mismatch cleavage in OVCAR8-ADR cells. Cells were infected with SpCas9 variants and the indicated gRNAs, and genomic DNA was collected for T7E1 assays 11-16 days after infection. Indel quantification of infected samples is shown as a bar graph.

[0033] Fig.13.Expression of SpCas9 variants in OVCAR8-ADR cells. Cells were infected with lentivirus encoding WT SpCas9, Opti-SpCas9, eSpCas9(1.1), HypaCas9, SpCas9-HF1, Sniper-Cas9, evoCas9, xCas9, or OptiHF-SpCas9. Protein lysates were extracted for Western blot analysis and immunoblotted with anti-SpCas9 antibodies. β-Actin was used as a loading control. No expression of SpCas9-HF1 and xCas9 was detected in OVCAR8-ADR cells, which may be due to their non-optimized sequences for expression in mammalian cells. 24,49 , thus SpCas9-HF1 and xCas9 were not included in other activity assays. These experiments were repeated 3 times independently with similar results.

[0034] Fig.14 .Using GFP disruption assay, the editing efficiency of SpCas9 variants was evaluated with gRNAs carrying or lacking additional mismatched 5'guanine (5'G). OVCAR8-ADR cells expressing WTSpCas9, Opti-SpCas9, eSpCas9 (1.1) or HypaCas9 were infected with lentivirus encoding gRNAs carrying or lacking additional mismatched 5'G. Editing efficiency was measured using flow cytometry by the percentage of cells depleted of GFP levels. Values ​​and error bars reflect the mean and standard deviation of 4 independent biological replicates.

[0035] Fig.15 Opti-SpCas9 exhibits reduced off-target activity compared to wild-type SpCas9. SpCas9 variants were evaluated for off-target editing caused by VEGFA site 3 or DNMT1 site 4 gRNA at eight endogenous loci. The percentage of indels was measured using the T7E1 assay (averaged from 3 independent experiments). Dashes indicate none detected. Specificity of WTSpCas9 and its variants for VEGFA site 3 gRNA at the OFF1 locus is presented as the ratio of on-target:off-target activity (on-target activity data from Fig.12 Get) drawing.

[0036] Fig.16. Characterization of SpCas9 variants for editing target sites containing sequences that fully match or contain mismatches with the gRNA spacer using a GFP disruption assay. OVCAR8-ADR cells expressing WT SpCas9, Opti-SpCas9, eSpCas9 (1.1), or HypaCas9 were infected with lentivirus encoding gRNAs that carry no mismatches or 1-4 base mismatches relative to the target. Editing efficiency was measured using flow cytometry by the percentage of cells depleted of GFP levels. Values ​​and error bars reflect the mean and standard deviation of 3 independent biological replicates.

[0037] Fig.17 .Activity of on-target editing of SpCas9 variants using truncated gRNAs. a, b, OVCAR8-ADR cells expressing WTSpCas9, Opti-SpCas9, eSpCas9 (1.1), or HypaCas9 were infected with lentivirus encoding gRNAs of varying lengths (17-19 nucleotides) targeting GFP sequences (a) and endogenous loci (b). Editing efficiency was measured by the percentage of cells depleted of GFP levels using flow cytometry (a) and T7E1 assay (b). A list of gRNA sequences used is shown in Table 5. For (a), values ​​and error bars reflect the mean and standard deviation of 4 independent biological replicates.

[0038] Fig.18 Multiple sequence alignment - comparison of Cas9 homologs from Streptococcus pyogenes. Conserved amino acid residues in Cas9 homologs are marked, especially those corresponding to residues 661 and 1003 of SpCas9.

[0039] definition

[0040] As used herein, "CRISPR-Cas9" or "Cas9" refers to a CRISPR-associated protein 9, which is an RNA-guided DNA endonuclease associated with the CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune system found in some bacterial species, including Streptococcus pyogenes. The Cas9 protein SpCas9 derived from Streptococcus pyogenes has the amino acid sequence shown in SEQ ID NO: 1, which is encoded by the polynucleotide sequence shown in SEQ ID NO: 2. Additional Cas9 enzymes with significant sequence homology that include at least some (e.g., at least 2, 3, 4, 5 or more, such as at least half but not necessarily all) known key conserved residues, such as residues 661, 695, 848, 923, 924, 926, 1003 and 1060 of SEQ ID NO: 1, see Fig.18 . As used herein, the term "Cas9 protein" encompasses any RNA-guided DNA endonuclease that has a significant amino acid sequence identity, such as at least 50%, 60%, 70%, 75%, up to 80%, 85% or more overall sequence identity with SEQ ID NO: 1. Exemplary wild-type Cas9 proteins include those from bacterial species Streptococcus mutans, Streptococcus dysgalactiae, Streptococcus equi, Streptococcus oralis, Streptococcus mitis, Listeria monocytogenes, Enterococcus timonensis, Streptococcus thermophilus, and Streptococcus parasanguinis, respectively, having the amino acid sequence set shown in SEQ ID NO: 4-13.

[0041] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as explicitly indicated sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem., 260: 2605-2608 (1985); and Cassol et al., (1992);

[0042] Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994). The terms nucleic acid and polynucleotide are used interchangeably with gene, cDNA, and mRNA encoded by a gene.

[0043] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acids as well as naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked by covalent peptide bonds.

[0044] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as naturally occurring amino acids, i.e., an alpha carbon bonded to a hydrogen, carboxyl, amino, and R groups, such as homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. "Amino acid mimetics" refer to compounds that have a structure that is different from the general chemical structure of an amino acid but function in a manner similar to naturally occurring amino acids.

[0045] Amino acids may be referred to herein by either their well-known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

[0046] "Expression cassette" is a nucleic acid construct having a series of specified nucleic acid elements that allow transcription of a specific polynucleotide sequence in a host cell that is recombinant or synthetically produced. The expression cassette can be a part of a plasmid, a viral genome, or a nucleic acid fragment. Generally, an expression cassette includes a polynucleotide to be transcribed that is operably connected to a promoter. In this context, "operably connected" means that two or more gene elements (such as a polynucleotide coding sequence and a promoter) are placed in a relative position that allows the appropriate biological function of an element (such as a promoter that instructs transcription of a coding sequence). Other elements that may be present in the expression cassette include those elements that enhance transcription (such as enhancers) and terminate transcription (such as terminators), as well as those elements that confer certain binding affinity or antigenicity to the recombinant protein produced from the expression cassette.

[0047] "Vector" is a circular nucleic acid construct recombinantly produced from a bacterial-based structure (e.g., plasmid) or a virus-based structure (e.g., viral genome). Generally, in addition to one or more target gene components (e.g., polynucleotide sequences encoding one or more proteins), the vector also contains a starting point for self-replication. In some cases, the vector may contain an expression cassette, making the vector an expression vector. In other cases, the vector may not include a device for expressing a coding sequence, but rather serves as a carrier or shuttle for storing one or more target gene components (e.g., coding sequences) and / or transferring them from one gene construct to another. Optionally, the vector may further include one or more selection or recognition marker coding sequences, which may encode proteins such as antibiotic resistance proteins (e.g., for detecting bacterial host cells) or fluorescent proteins (e.g., for detecting eukaryotic host cells) so as to enable easy detection of transformed or transfected host cells containing the vector and allowing protein expression from the vector.

[0048] The term "heterologous", when used in the context of describing the relationship between two elements (such as two polynucleotide sequences or two polypeptide sequences) in a recombinant construct, describes the two elements as being derived from two different sources and now placed in a position relative to each other that is not found in nature. For example, a "heterologous" promoter that directs the expression of a protein coding sequence is a promoter that is not found in nature to direct the expression of the coding sequence. As another example, in the case of a peptide fused to a "heterologous" peptide to form a recombinant polypeptide, the two peptide sequences are either derived from two different parent proteins, or derived from two separate parts of the same protein, but not immediately adjacent to each other. In other words, placing two elements "heterologous" to each other does not result in a longer polynucleotide or polypeptide sequence that can be found in nature.

[0049] As used herein, the term "barcode" refers to a short polynucleotide sequence segment (generally no longer than 30 nucleotides, for example between about 4 or 5 to about 6, 7, 8, 9, 10, 12, 20 or 25 nucleotides) that is uniquely assigned to another predetermined polynucleotide sequence (e.g., a segment of a target protein coding sequence, such as SpCas9) so that the predetermined polynucleotide sequence or the amino acid sequence encoded by it can be detected / identified based on the presence of the barcode.

[0050] "IIS type restriction enzymes" are endonucleases that recognize asymmetric DNA sequences and cut outside their recognition sequences (3' or 5'). Their action is opposite to that of IIP type restriction enzymes, which can recognize symmetrical or palindromic DNA sequences and cut within their recognition sequences. Since IIS type restriction enzymes cut DNA chains outside their recognition sequences, they can produce overhangs of virtually any sequence unrelated to their recognition sequences. Therefore, it is possible to use two different IIS type restriction enzymes to not only produce overhangs of the same size and in the same direction (i.e., the overhangs are all 3' or 5' overhangs and have the same number of nucleotides), but also to produce matching overhangs or compatible ends (i.e., the overhangs on the two opposite chains are completely complementary), which allows annealing and connection between the two ends produced by the two different IIS type restriction enzymes.

[0051] As used herein, the term "short guide RNA" or "sgRNA" refers to an RNA molecule of about 15-50 (e.g., 20, 25, or 30) nucleotides in length that specifically binds to a DNA molecule at a predetermined target site and guides the CRISPR nuclease to cleave the DNA molecule adjacent to the target site.

[0052] A nucleotide sequence "specifically binds to" another when two polynucleotide sequences (especially two single-stranded DNA or RNA sequences) complex with each other to form a double-stranded structure based on significant or complete (e.g., at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to 100%) Watson-Crick complementarity between the two sequences.

[0053] "Physiologically acceptable excipients / carriers" and "pharmaceutically acceptable excipients / carriers" refer to substances that aid in the administration of the active agent to the delivery target (cell, tissue or living organism) - and are generally absorbed by it, and can be included in the compositions of the present invention without causing significant effects on the recipient. Non-limiting examples of physiologically / pharmaceutically acceptable excipients include water, NaCl, physiological saline solution, lactated Ringer's solution, physiological sucrose, physiological glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings and coloring agents, etc. As used herein, the term "physiologically / pharmaceutically acceptable excipients / carriers" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. that are compatible with the intended use.

[0054] The term "about" when used with respect to a predetermined value means covering a range of ±10% of that value.

[0055] Details

[0056] I. General Concepts

[0057] The present invention relates to a newly improved high-level gene modification and screening platform for efficiently producing and identifying recombinant proteins with desired biological functions. The present invention also provides recombinant proteins produced by the platform.

[0058] A. Recombinant Technology

[0059] Basic texts disclosing general methods and techniques in the field of recombinant genetics include: Sambrook and Russell, Molecular Cloning, A Laboratory Manual (3rd ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Ausubel et al., eds., Current Protocols in Molecular Biology (1994).

[0060] For nucleic acids, sizes are given in kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Protein sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.

[0061] As described in Van Devanter et al., Nucleic Acids Res. 12: 6159-6168 (1984), an automatic synthesizer can be used, for example, according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981), chemical synthesis of oligonucleotides that are not commercially available. Oligonucleotides are purified using any art-recognized strategy such as native acrylamide gel electrophoresis or anion exchange HPLC as described in Pearson & Reanier, J. Chrom. 255: 137-149 (1983).

[0062] The polynucleotide sequences and synthetic oligonucleotides encoding the polypeptide of interest (eg, SpCas9 protein or fragment thereof) can be verified after cloning or subcloning using, for example, the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16:21-26 (1981).

[0063] B. Modification of Polynucleotide Coding Sequences

[0064] Given a known amino acid sequence of a preselected target protein (e.g., SpCas9), modifications may be made to achieve desirable characteristics or improved biological functions of the protein, as determined by in vitro or in vivo methods known in the art and described herein. Possible modifications of the amino acid sequence may include substitutions (conservative or non-conservative) at one or more positions of the amino acid sequence; deletion or addition of one or more amino acid residues.

[0065] A variety of mutation generation protocols are established and described in the art and can be readily used to modify a polynucleotide sequence encoding a target protein. See, for example, Zhang et al., Proc. Natl. Acad. Sci. USA, 94: 4504-4509 (1997); and Stemmer, Nature, 370: 389-391 (1994). The procedures can be used alone or in combination to generate a set of nucleic acid variants, thereby generating variants of the encoded protein.

[0066] Mutational methods for generating diversity include, for example, site-directed mutagenesis (Botstein and Shortle, Science, 229: 1193-1201 (1985)), mutagenesis using templates containing uracil (Kunkel, Proc. Natl. Acad. Sci. USA, 82: 488-492 (1985)), oligonucleotide-directed mutagenesis (Zoller and Smith, Nucl. Acids Res., 10: 6487-6500 (1982)), phosphorothioate-modified DNA mutagenesis (Taylor et al., Nucl. Acids Res., 13: 8749-8764 and 8765-8787 (1985)), and mutagenesis using nicked double-stranded DNA (Kramer et al., Nucl. Acids Res., 12: 9441-9456 (1984)).

[0067] Other possible methods for generating mutations include site-specific mismatch repair (Kramer et al., Cell, 38:879-887 (1984)), mutagenesis using a repair-deficient host strain (Carter et al., Nucl. Acids Res., 13:4431-4443 (1985)), deletion mutagenesis (Eghtedarzadeh and Henikoff, Nucl. Acids Res., 14:5115 (1986)), restriction selection and restriction purification (Wells et al., Phil. Trans. R. Soc. Lond. A, 317:415-423 (1986)), mutagenesis by total gene synthesis (Nambiar et al., Science, 223:1299-1301 (1984)), double-strand break repair (Mandecki, Proc. Natl. Acad. Sci. USA, 83:7177-7181 (1986)), mutagenesis by the polynucleotide chain termination method (U.S. Pat. No. 5965408) and error-prone PCR (Leung et al., Biotechniques, 1:11-15 (1989)).

[0068] C. Nucleic Acid Modifications for Optimizing Codon Usage

[0069] The polynucleotide sequence encoding the target protein or its fragment can be further altered based on the principle of codon degeneracy to conform to the preferred codon usage, thereby enhancing recombinant expression in a specific type of host cell or facilitating further genetic manipulation, such as allowing the construction of restriction endonuclease recognition sequences at desired sites for potential cutting / reconnection. The latter use is particularly important in the present invention because the seamless connection of multiple coding segments of the target protein (e.g., SpCas9 protein) undergoing combinatorial mutagenesis relies on digestion of the coding segments by IIS type restriction enzymes, thereby generating overhangs specifically derived from the coding sequence of the natural protein, so as to eliminate any foreign sequences or so-called scar sequences at the junction between any two of these segments.

[0070] When modification is complete, the coding sequence is verified by sequencing and then subcloned into an appropriate vector for further manipulation or recombinant expression of the protein.

[0071] D. Expression of recombinant polypeptides

[0072] Conventional techniques in the field of recombinant genetics can be used to express a recombinant polypeptide of interest (e.g., an improved Cas9 protein), which relies on a polynucleotide sequence encoding a polypeptide as disclosed herein.

[0073] (i) Expression system

[0074] In order to obtain high-level expression of nucleic acids encoding target polypeptides, polynucleotide coding sequences are generally subcloned into expression vectors containing strong promoters, transcription / translation terminators, and ribosome binding sites for translation initiation that guide transcription. Suitable bacterial promoters are well known in the art and are described in, for example, Sambrook and Russell above and Ausubel et al. above. Bacterial expression systems for expressing recombinant polypeptides can be obtained in, for example, Escherichia coli, Bacillus species (Bacillus sp.), Salmonella, and Caulobacter. Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. Some exemplary eukaryotic expression vectors include adenoviral vectors, adeno-associated vectors, and retroviral vectors, such as viral vectors derived from slow viruses.

[0075] The promoter used to direct the expression of the heterologous polynucleotide sequence encoding the target protein depends on the specific application. The promoter is optionally located at a distance from the heterologous transcription start site that is approximately the same distance from the transcription start site in its natural environment. However, as known in the art, some changes in this distance can be accommodated without losing the function of the promoter.

[0076] In addition to the promoter, the expression vector generally includes a transcription unit or expression cassette containing all other elements required for expressing the desired polypeptide in the host cell. Therefore, a typical expression cassette contains a promoter operably connected to the nucleic acid sequence of the coded polypeptide and the signal, ribosome binding site and translation termination required for the effective polyadenylation of the transcript. In the case of the recombinant expression of secretory proteins, the polynucleotide sequence of the coded protein is generally connected to a cleavable signal peptide sequence to promote the secretion of the recombinant polypeptide by the transformed cells. On the other hand, if it is intended to express the recombinant polypeptide on the host cell surface, a suitable anchor sequence is used together with the encoding sequence. The other elements of the box may include an enhancer, and if the genomic DNA is used as a structural gene, an intron with a functional splicing donor and an acceptor site is included.

[0077] In addition to the promoter sequence, the expression cassette should also contain a transcription termination region downstream of the coding sequence to provide efficient termination. The termination region can be obtained from the same gene as the promoter sequence, or can be obtained from a different gene.

[0078] Expression vectors containing regulatory elements from eukaryotic viruses are generally used for eukaryotic expression vectors, such as SV40 vectors, papillomavirus vectors, lentiviral vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009 / A + 、pMTO10 / A + , pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of proteins under the direction of the SV40 early promoter, the SV40 late promoter, the metallothionein promoter, the mouse mammary tumor virus promoter, the Rous sarcoma virus promoter, the polyhedrin promoter, or other promoters shown to be efficiently expressed in eukaryotic cells.

[0079] The elements generally included in the expression vector may also include a replicon that works in E. coli, a gene encoding antibiotic resistance to allow selection of bacteria containing the recombinant plasmid, and a unique restriction site that allows insertion of eukaryotic sequences in the non-essential region of the plasmid. The specific antibiotic resistance gene selected is not critical, and any of the many resistance genes known in the art is suitable. If necessary, the prokaryotic sequence is optionally selected so that it does not interfere with the replication of the DNA in the eukaryotic cell. Similar to the antibiotic resistance selection marker, metabolic selection markers based on known metabolic pathways can also be used as a means for selecting transformed host cells.

[0080] As mentioned above, those skilled in the art will recognize that various conservative substitutions can be made to a protein or its coding sequence while still retaining the biological activity of the protein. In addition, modifications of the polynucleotide coding sequence can also be made to adapt to preferred codon usage in a particular expression host or to create restriction enzyme cleavage sites without changing the resulting amino acid sequence.

[0081] (ii) Transfection method

[0082] Standard transfection methods are used to generate bacterial, mammalian, yeast, insect or plant cell lines expressing large amounts of recombinant polypeptides, which are then purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264: 17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells is performed according to standard techniques (see, e.g., Morrison, J. Bact. 132: 349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362 (Wu et al., eds, 1983).

[0083] Any well-known procedure for introducing exogenous nucleotide sequences into host cells may be used. These procedures include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors, and any other well-known method for introducing cloned genomic DNA, cDNA, synthetic DNA or other exogenous genetic material into host cells (see, e.g., Sambrook and Russell, supra). It is only necessary that the specific genetic engineering procedure used is capable of successfully introducing at least one gene into a host cell capable of expressing the recombinant polypeptide.

[0084] II. Improved Combinatorial Gene Modification System

[0085] Based on the previously developed high-throughput CombiGEM combinatorial gene modification system, etc., the inventors have further modified these systems with the goal of seamlessly connecting DNA elements encoding protein segments, each of which corresponds to a portion of a target protein (e.g., SpCas9) and contains at least one, possibly multiple, mutations in its amino acid sequence, such that the resulting composite protein variant will have no foreign amino acid residues except for the mutations intentionally introduced. Since previous methods utilize IIP-type restriction endonucleases to cut and reconnect DNA sequences (segments encoding combined protein variants), the properties of this type of endonuclease (binding to and cutting within short palindromic segments of nucleotide sequences) generally require the user to engineer the cleavage site by introducing additional nucleotides at each junction between two segments in the protein variants generated by the system (which in turn results in foreign nucleotide residues or "scar" sequences). These foreign amino acid residues further alter the protein sequence and can potentially interfere with the functional screening of variants.

[0086] In their efforts to avoid the introduction of these unwanted additional amino acid residues, the inventors discovered that if IIS type restriction enzymes were instead used to construct and connect multiple DNA coding sequences encoding protein segments to create a library of combinatorial gene variants, this undesirable "scar" sequence between segments could be completely eliminated. This strategy exploits the fact that IIS type endonucleases are able to cleave DNA chains outside of their asymmetric recognition sites, allowing for the generation of compatible ends or matching overhangs with a portion of the native DNA coding sequence of the wild-type protein following DNA cleavage by these enzymes. The use of native protein-derived coding sequences in the compatible ends or matching overhangs not only supports seamless joining between protein segments, but also allows for specific directional connections, thereby further improving efficiency in the process of building combinatorial protein variants.

[0087] A. Generation of a library of DNA segments encoding protein segments

[0088] The first step in generating a library of combinatorial protein variants is to generate a library for each segment of the protein: the protein variant can be designed so that it is generated by connecting a predetermined number (e.g., 3, 4, 5, 6 or more) of protein segments or modules end to end. As in the present disclosure, the predetermined number is represented as n+1, and then the target protein is designed to consist of 6 segments, n=5. A library or collection of single members of the DNA element encoding the first protein segment can be first generated by known methods (such as recombinant production or chemical synthesis), the protein segment corresponding to the most N-terminal part of the wild-type protein, and containing one or more possible mutations in this part of the protein; and then the library or collection is incorporated into a DNA vector (a so-called storage vector for its purpose), the vector contains appropriate restriction enzyme sites and a barcode sequence uniquely assigned to the DNA element containing the predetermined mutation (or predetermined mutation group). If the DNA element is relatively long, it can first be prepared by connecting shorter fragments by known methods (such as Gibson assembly), and then incorporated into the storage vector. As described above, methods for generating mutations in DNA sequences are well known to those skilled in the art and can be readily used to create sequence variants by modifying the native form or wild-type sequence, for example by deleting, inserting and / or substituting one or more nucleotides.

[0089] FIG5a depicts an example of how a DNA element encoding a protein segment is inserted and ligated into a vector to form a DNA construct comprising, from 5′ to 3′: a first recognition site for a first Type IIS restriction enzyme (e.g., BsaI), a DNA element, a first and a second recognition site for a second Type IIS restriction enzyme (e.g., BbsI), a barcode uniquely assigned to the DNA element due to the specific mutation it contains, and a second recognition site for the first Type IIS restriction enzyme (e.g., BsaI). For a protein that has been designed or "deconstructed" to have (n+1) segments or modules for combinatorial mutagenesis studies, a library of storage vectors containing DNA segments can be constructed in the same manner for each subsequent DNA element (the second, third, and so on, up to the nth DNA element (encoding the second, third, and so on, respectively, up to the nth protein segment)), the nth protein segment corresponding to the penultimate or most C-terminal portion of the protein.

[0090] For the DNA element of the last or most C-terminal segment of the encoded protein, a vector library containing the (n+1)th DNA element is constructed using a structurally different storage vector. As shown in Figure 5a, the last or (n+1)th DNA element is inserted into the storage vector to form a DNA construct comprising the following from 5' to 3': a first recognition site for a first IIS type restriction enzyme (e.g., BsaI), the (n+1)th DNA element, a short nucleotide sequence segment used as a primer binding site, a barcode uniquely assigned to the DNA element due to the specific mutation it contains, and a second recognition site for the first IIS type restriction enzyme (e.g., BsaI). The presence and placement of the primer binding site allows the combined barcode to be rapidly sequenced using a universal primer (which specifically binds to the primer binding site) after the composite coding sequence of the protein variant is generated (combining all n+1 DNA elements), so as to allow easy identification of the mutation contained in the variant, thereby eliminating the need for cumbersome sequencing of the entire composite coding sequence.

[0091] To ensure an equal chance of each potential combinatorial protein variant in the library, each DNA element comprising a unique set of mutations is preferably present in the library at an equimolar ratio.

[0092] B. Generation of Combinatorial Protein Mutant Libraries

[0093] Once a library of storage vectors containing the first, second, and so on up to the nth and (n+1)th DNA elements is constructed, DNA fragments containing DNA elements encoding protein segments or modules are first released by enzymatic digestion of the storage vector, for example, by cutting the vector at two sites using a first Type IIS restriction endonuclease (e.g., BsaI). Digestion of the storage vector releases DNA fragments, each containing a DNA element encoding a protein segment (including a mutation) and its uniquely assigned barcode, sandwiched between two Type IIS restriction enzyme (e.g., BbsI) recognition sites. The two ends of the DNA fragments have overhangs generated by cutting with the first Type IIS restriction enzyme.

[0094] At the same time, the DNA vector (so-called target vector for its purpose) intended to carry and express the final composite DNA element encoding the complete protein variant is an expression vector that contains all necessary genetic elements for expressing the DNA coding sequence. As described in the previous section, an essential element for transcription is a promoter, which is operably connected to the coding sequence to guide the transcription of the sequence. Generally, the promoter is a heterologous promoter to the coding sequence.

[0095] In order to receive the DNA fragments generated by the storage vector library, the target vector is also linearized by digestion with a type IIS restriction enzyme at a site at a suitable distance downstream of the promoter to allow insertion / ligation of the DNA fragment, and the DNA element (which encodes the protein segment) is placed within the DNA fragment and transcribed under the control of the promoter. Typically, the type IIS restriction enzyme used to linearize the target vector is different from the enzyme used to release the DNA fragment from the storage vector. However, it preferably produces overhangs of the same size and matching to allow the DNA fragment to be ligated into the target vector.

[0096] As shown in Figure 5b, when a library of storage vectors containing all kinds of first DNA elements encoding all kinds of first protein segments is digested by a first IIS type restriction enzyme, a library of DNA fragments containing all kinds of first DNA elements and their corresponding barcodes is released from its storage vector. This library of these first DNA fragments (preferably in an equimolar ratio for each sequence species) is then ligated into a linearized target vector, resulting in a 1-dimensional library. Each member of the resulting 1-dimensional library will contain a functional expression cassette in which a promoter is operably linked to the first DNA element and is capable of directing the expression of the first or most N-terminal protein segment encoded by the first DNA element.

[0097] Subsequently, the 1-dimensional library is digested again with a type IIS restriction enzyme, which cuts each member of the library twice between the first DNA element and its barcode, generating two overhangs at each cut site.

[0098] At the same time, a library of DNA fragments containing all kinds of second DNA elements and their corresponding barcodes is released from its storage vector by digesting the library of storage vectors containing all kinds of second DNA elements encoding all kinds of second protein segments with a first IIS type restriction enzyme. This library of second DNA fragments is then ligated (preferably in an equimolar ratio for each sequence species) to a linearized 1-dimensional expression vector between the first DNA element and its corresponding barcode, resulting in a library of new 2-dimensional expression vectors. Each member of the resulting 2-dimensional library will contain a functional expression cassette in which a promoter is operably linked to the first DNA element fused to the second DNA element and is capable of directing the expression of the fused first and second protein segments encoded by the fusion of the first DNA element and the second DNA element. In order to eliminate any extraneous amino acid residues or "scar" sequences at the fusion point between the first and second protein segments, the two cleavage sites located between the first DNA element and its barcode must be carefully designed to ensure that (1) there is a perfect match (in both sequence and size / orientation of the overhangs) between the overhangs at both ends of the linearized 1-dimensional vector and the overhangs at both ends of the second DNA fragment released from the library of the storage vector containing all species of the second DNA element; and (2) after their ligation, the overhang sequence matched between the tail or 3' end of the first DNA element and the head or 5' end of the second DNA element encodes the amino acid sequence segment found in the wild-type target protein at the same position. In other words, the design of the cleavage sites ensures seamless ligation of the two adjacent protein segments.

[0099] Upon completion of ligating the library of second DNA fragments released from the library of the second storage vector into the linearized 1-dimensional expression vector library, a library of 2-dimensional composite expression vectors is now constructed. Repeating the cycle of steps outlined in the previous two paragraphs, the third DNA fragment, and so on, can continue to be incorporated into the composite expression vector to obtain a library of final composite expression vectors containing a complete array of DNA coding sequences encoding full-length protein variants containing all possible mutation combinations, each variant coding sequence followed by a composite barcode sequence, which will have all barcodes corresponding to its unique assignment to the DNA element, but in the reverse order of the DNA element fusion.

[0100] C. Functional Screening of Protein Variants Since the final library of target vectors is an expression vector, each expression vector has a promoter operably linked to a composite DNA coding sequence containing all n+1 DNA elements to encode full-length protein variants containing a specific set of mutations, these protein variants can be easily expressed, screened and selected for any specific desired functional characteristics in an appropriate reporter system. For example, a virus-based target vector can be used to transfect host cells and directly express variants of the target protein in a suitable cellular environment for functional analysis.

[0101] Figure 2a An example illustrating how SpCas9 variants can be screened for their functionality: a cell line stably expressing red fluorescent protein (RFP) and a gRNA targeting the RFP gene sequence is transfected with a lentiviral vector containing the coding sequence of the SpCas9 variant to indicate the on-target activity of each variant, and another cell line stably expressing RFP and gRNA containing synonymous mutations is transfected to indicate the off-target activity of the variant. Since the CombiSEAL platform is designed to potentially generate useful variants of any protein, different functional screening assays can be designed depending on the specific functionality of the target protein. Once a clone that meets the desired functional properties (such as on-target and off-target activity characteristics in the case of Cas9 protein) is found, the composite barcode is sequenced to enable immediate identification of specific mutations in a specific variant.

[0102] iii. Optimized CAS9 enzyme

[0103] Using the newly improved CombiSEAL combinatorial gene modification system, the inventors identified a series of SpCas9 mutants and characterized their functional characteristics. Among the mutants studied, a specific variant called Opti-SpCas9 has been found to have highly desirable functional characteristics: it has enhanced gene editing specificity without sacrificing efficacy and a wide range of testing. Given its functional attributes, this improved Cas9 enzyme is a highly valuable tool in CRISPR genome editing protocols.

[0104] The wild-type SpCas9 protein has the amino acid sequence shown in SEQ ID NO: 1, and its corresponding DNA coding sequence is shown in SEQ ID NO: 2. Previous studies on the endonuclease provided insights into the structure of the protein, including regions and amino acid residues that interact with DNA. During their research to develop the CombiSEAL platform, the inventors demonstrated that mutations (particularly substitutions) introduced at certain residues of the amino acid sequence of SpCas9 that were previously predicted to interact with target and non-target DNA chains had a direct effect on the performance of the endonuclease. Specifically, it was found that substitutions at residues such as R661, Q695, K848, Q926, K1003, and K1060 would change the on-target / off-target editing activity of the enzyme. The variant Opti-SpCas9 is a double mutant of the wild-type SpCas9: residue 661 in SEQ ID NO: 1 is substituted with alanine and residue 1003 is substituted with histidine. Its amino acid sequence is shown in SEQ ID NO: 3. These substitutions are responsible for the improved on-target editing efficiency and reduced off-target activity of the modified endonucleases, highly desirable phenotypes.

[0105] The inventors also identified a triple mutant of R661A, K1003H and Q926A, which further reduced off-target editing from Opti-SpCas9 by about 80%, while its on-target activity was also significantly reduced. This triple mutant may be valuable in cases where it is particularly important to avoid off-target cutting. In addition, a second mutant called OptiHF-SpCas9 has been produced, which has 5 point mutations Q695A, K848A, E923M, T924V and Q926A (see variant 46 in Table 2). The amino acid sequences of Opti-SpCas9 and OptiHF-SpCas9 are shown in SEQ ID NO:3 and SEQ ID NO:13, respectively. Table 2 provides a compilation of the SpCas9 variants analyzed in this study, detailing the point mutations contained therein and their on-target and off-target cutting characteristics.

[0106] The SpCas9 variants disclosed herein are valuable tools in the genetic manipulation of living cell genomes. In order to use these variants for targeted DNA cutting by the CRISPR system, an expression vector for the expression of a guide variant (e.g., Opti-SpCas9) and an expression vector encoding an sgRNA of an appropriate sequence (for guiding the SpCas9 variant to a preselected target site in the cell genome to cut genomic DNA at the target site) are generally introduced into living cells. In some embodiments, the expression vector is a viral vector, such as a retroviral vector, especially a lentiviral vector. Although the expression vector encoding the SpCas9 variant and the expression vector encoding the sgRNA are generally two separate vectors, in some cases, a single expression vector contains both the coding sequences of the SpCas9 variant and the sgRNA, and the two coding sequences are operably linked to the same promoter or two separate promoters. Since the promoter is generally heterologous to the coding sequence, it is further contemplated to use a promoter suitable for a particular type of recipient cell. Example

[0107] The following examples are provided by way of illustration only and not limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that can be changed or modified to produce essentially the same or similar results.

[0108] Example 1: CombiSEAL is a high-throughput platform for seamlessly assembling barcoded combinatorial gene units, thereby providing a novel method for protein optimization such as screening SpCas9 variants. It is difficult to predict the combined effects of multiple mutations on protein function. Therefore, the ability to functionally evaluate a large number of protein sequence variants is actually useful for protein engineering. A high-throughput platform is proposed herein that enables scalable assembly and parallel characterization of barcoded protein variants with combinatorial modifications. The platform CombiSEAL is illustrated by systematically characterizing a library of 948 combinatorial mutants of the widely used Streptococcus pyogenes Cas9 (SpCas9) nuclease to optimize its genome editing activity in human cells. The ease of combining and evaluating the editing activity of SpCas9 variants on multiple targets and off-target sites accelerates the identification of optimized variants and promotes the study of mutation epistasis. Opti-SpCas9 was successfully identified, which has enhanced editing specificity without sacrificing efficacy and a wide range of targeting. This platform can be widely used for protein engineering through overall combinatorial modification.

[0109] introduce

[0110] Protein engineering has proven to be an important strategy for generating enzymes, antibodies, and genome-editing proteins with new or enhanced properties. 1-7Combinatorial optimization of protein sequences relies on strategies for creating and screening large numbers of variants, but current approaches are limited in their ability to systematically and efficiently create and test multiple modifications in a high-throughput manner. 8-11 Conventional site-directed mutagenesis based on structural and biochemical knowledge facilitates the generation of functionally relevant mutants, but screening combinatorial mutants using this one-by-one approach lacks throughput and scalability. Combinatorial mutants can be prepared in a pooled form using gene synthesis techniques, but typically 1-10 errors are made per kilobase synthesized. 12,13 , and is extremely expensive if the mutations to be introduced are scattered across different regions of the protein. Methods such as combinatorial DNA assembly 14,15 and restructuring and reorganization 16 Combinatorial mutants are created by fusing multiple mutant sequences together to assemble the entire protein sequence, but subsequent genotyping and characterization of the mutations requires selection of clonal isolates or long-read sequencing, both of which are not suitable for tracking a large number of mutants. Mutagenesis via error-prone polymerase chain reaction and mutator strains for directed evolution enables positive selection of desired mutant variants, but suffers from selection bias toward a subset of amino acids due to the seldom occurrence of two or more specific nucleotide mutations in a codon. Even though a wide variety of protein variants can be obtained by sequence randomization, the very limited throughput for genotyping and analyzing selected hits one by one is a major obstacle to protein engineering. In addition, it may be useful to accelerate the combinatorial optimization process to clearly indicate the exact mutation that confers the desired phenotype from the remaining passenger mutations.

[0111] Here, the inventors designed a new cloning method to combine seamless combinatorial DNA assembly with the use of ensemble combinatorial genetics (CombiGEM) 17-19The barcode connection strategy of the present invention is combined with the platform we call CombiSEAL, which is used for the combined assembly of barcoded combinatorial mutants, which can be easily tracked by high-throughput short-read sequencing (Figure 1). CombiSEAL works by modularizing protein sequences into combinatorial components, each of which contains a variant library labeled with a barcode, and the barcode specifies a predetermined mutation at a defined position. Type IIS restriction enzyme sites are used to flank the barcoded components to form overhangs derived from the digestion of the protein coding sequence, thereby achieving seamless connection after fusion with the aforementioned components. After iterative merging and cloning of the components, the unique barcodes are connected and attached to each protein coding sequence variant in the resulting library. This method is superior to other strategies because it avoids the need for long-read sequencing of the entire protein coding region covering multiple mutations, which provides a cost-effective way to quantitatively track each variant in the pool by high-throughput sequencing of short (e.g., ~50 base pairs) barcodes without selecting clonal isolates. In addition, the combined characterization of variants allows head-to-head comparisons under the same experimental conditions and facilitates the study of mutation epistasis. Unlike CombiGEM, which only allows the combinatorial assembly of discrete gene components, CombiSEAL does not leave fusion scar sequences to seamlessly connect continuous sequences (such as different segments of proteins). Therefore, this new platform has great potential for protein engineering.

[0112] result

[0113] High-throughput screening of SpCas9 combinatorial mutants. CombiSEAL was used to assemble SpCas9, a widely used clustered regularly interspaced short palindromic repeats (CRISPR) nuclease for genome engineering. 20-23 ) with the goal of identifying optimized variants with high editing specificity and activity. Previously, SpCas9 nucleases carrying specific mutation combinations (including eSpCas9(1.1) 3 、SpCas9-HF1 4 、HypaCas9 5 and evoCas9 6 ) were engineered to minimize off-target editing. However, these variants are incompatible with gRNAs that begin with a mismatched 5'-guanine (5'G). 3-6,24-27 , and therefore have fewer targetable sites. To date, a limited number of combinatorial mutants have been generated and tested (Table 1), so a more systematic exploration of other SpCas9 variants with better compatibility with gRNAs carrying an extra 5'G is warranted.

[0114] Using CombiSEAL, the SpCas9 sequence was modularized into four components, and barcoded inserts containing different random and specific mutations in the individual components were cloned into storage vectors ( Figure 1a ; Figure 7a, b; see Methods for details). The combinatorial barcoded library (having 4×2×17×7=952 SpCas9 variants, including wild-type (WT) SpCas9 and eSpCas9(1.1) sequences) was then combined and assembled in a lentiviral vector. The individual components in the library and the assembled constructs were sequenced to confirm the highly accurate assembly of the barcoded variants (see Methods for details). The inventors detected high coverage of the library in the plasmid pool stored in the E. coli pool (i.e., 951 of 952 variants) and the infected human cell pool (i.e., 948 of 952 variants). Figure 1b ), and highly reproducible performance between plasmids and infected cell pools and between biological replicates of infected cell pools ( Figure 7c ).

[0115] To search for robust and specific SpCas9 variants, a reporter system was established using monoclonal human cell lines to stably express red fluorescent protein (RFP) and gRNA targeting the RFP gene sequence (hereafter referred to as RFPsg5-ON and RFPsg8-ON; Figure 2a ). Compared to previous screening using primarily 20-nucleotide gRNAs beginning with 5'G 3-6 Differently, a gRNA carrying an additional 5'G in the reporter system is used to find compatible SpCas9 variants that do not sacrifice targeting range. The cells were then infected with the SpCas9 variant library and sorted into bins based on the level of RFP fluorescence at 14 days post-infection. The loss of RFP fluorescence reflects the cleavage and insertion-deletion-mediated destruction of the DNA at the target site, so cells containing active SpCas9 variants are enriched in sorting bins with low RFP levels. Using Illumina HiSeq to track the barcoded SpCas9 variants, it was found that the variant subpopulation was enriched >1.5 times in the sorting bin containing ~5% of the cell population with the lowest level of RFP (i.e., bin A) when compared to the unsorted population. Figure 2b ; Figure 8 ). WT SpCas9 is one of those enriched in both the reporter systems RFPsg5-ON and RFPsg8-ON, while eSpCas9 (1.1) is enriched in RFPsg8-ON. In order to facilitate the parallel characterization of the on-target and off-target activities of SpCas9 variants, cell lines containing synonymous mutations at RFP were further generated so that the sites of targeted mismatches showed off-target activities of SpCas9 variants (i.e., RFPsg5-OFF5-2 and RFPsg8-OFF5; Figure 2a)。WT SpCas9, rather than eSpCas9(1.1), was enriched for both RFPsg5 - OFF5 - 2 and RFPsg8 - OFF5( Figure 2b ; Figure 8 )。

[0116] Based on the enrichment of SpCas9 variants in the sorting bin relative to the unsorted population, their on - target and off - target activities were ranked and plotted, and it was found that most mutants impaired both the on - target and off - target activities of SpCas9( Figure 3a )。Variants with optimized activity were defined as those with an enrichment ratio of at least 90% of WT for both RFPsg5 - ON and RFPsg8 - ON, while having an enrichment ratio of less than 60% of WT for both RFPsg5 - OFF5 - 2 and RFPsg8 - OFF5. One variant (hereinafter referred to as Opti - SpCas9) met these criteria and was selected for further characterization (Table 2). Based on an enrichment ratio of at least >50% of WT for both RFPsg5 - ON and RFPsg8 - ON, and an enrichment ratio of <90% of WT for both RFPsg5 - OFF5 - 2 and RFPsg8 - OFF5, a high - fidelity variant, named OptiHF - SpCas9, was also identified (Table 2). The efficiency and specificity of Opti - SpCas9 and OptiHF - SpCas9 were verified by separate validation assays to measure their on - target and off - target activities. Using multiple cell lines (each cell line expressing gRNAs targeting matching or mismatched RFP sites), it was confirmed that when compared to WT, Opti - SpCas9 exhibited comparable on - target activity (i.e., 94.6%; averaged from 3 matching sites) and significantly reduced off - target activity (i.e., 1.7%; averaged from 3 mismatched sites), while OptiHF - SpCas9 showed reduced activity at both on - target (i.e., 63.6%; averaged from two matching sites) and off - target (i.e., 2.0%; averaged from two mismatched sites) sites( Figure 3b )。

[0117] Study the epistasis of SpCas9 editing efficiency. The systematic construction of protein variants by CombiSEAL enabled us to classify sets of amino acid substitutions as neutral, beneficial, or harmful and to explore their unpredictable epistatic interactions. Using the enrichment ratio as an indicator of SpCas9 editing activity( Fig. 9 ), heatmaps were constructed showing the on - target and off - target activities conferred by combinations of mutations and the epistatic interactions involved( Figure 4 ; Fig.10). It was revealed that the number and type of substitutions introduced at amino acid residues of SpCas9 that are expected to interact with target and non-target DNA strands (such as R661, Q695, K848, Q926, K1003, and K1060) determine the optimal balance between maximizing on-target efficiency and minimizing off-target activity. The activity-optimized variant Opti-SpCas9 differs from WT in having two substitution mutations (i.e., R661A and K1003H) at these DNA-contacting residues. Comparison between the three conserved basic residues (i.e., lysine, arginine, and histidine) introduced at the 1003rd amino acid position of SpCas9 showed that K1003H was a preferred substitution, which exhibited a positive epistatic interaction with the R661A mutation and conferred high editing efficiency to Opti-SpCas9 at the on-target site ( Figure 4 ). Adding SpCas9-HF1 to Opti-SpCas9 showed 4 The Q926A substitution, which confers higher specificity, slightly reduced its off-target effect (i.e., from 1.0% for Opti-SpCas9 to 0.2% for Opti-SpCas9+Q926A; averaged from three mismatched target sites) and significantly reduced its on-target activity by 21.6%, 62.4%, and 99.9% at the three matched sites tested ( Figure 3b Furthermore, we found that most SpCas9 variants with three or more mutations at these DNA-contacting residues produced fewer edits at both on-target and off-target sites ( Figure 4 These results are consistent with previous findings that excessive alanine substitutions at these DNA-contacting residues severely reduce the editing activity of SpCas9. 25 But interestingly, the HNH and RuvC nuclease domains responsible for SpCas9 28 In the case of additional substitutions introduced at residues that control conformational control, such as E923M+T924V and E923H+T924L mutations located at the linker region connecting the two domains, some SpCas9 variants carrying three or more mutations at DNA-contacting residues restored their on-target editing at the RFPsg5-ON site ( Figure 4 ). In addition to the Q695A, K848A, and Q926A substitutions, the high-fidelity variant OptiHF-SpCas9 also contained the E923M+T924V mutations and showed slightly higher on-target activity at the RFPsg8-ON site than the variant with only the triple mutations of Q695A, K848A, and Q926A ( Figure 4 These data support a model in which the DNA binding and cleavage activities of SpCas9 are functionally coupled to determine its editing specificity and efficiency. 5,29, and highlight the potential to program the editing properties of SpCas9 by modifying linker residues.

[0118] Characterization of optimized SpCas9 variants. In gRNA design and construction, a 5'G is often included or added to the beginning of the gRNA sequence to promote efficient transcription under the U6 promoter. WT SpCas9 is compatible with gRNAs with an additional 5'G that mismatches with the protospacer sequence. On the other hand, when using a gRNA with an additional 5'G (i.e., GN 20 ) or lack of an initial guanine (i.e., HN 19 ) with a 20-nucleotide gRNA, eSpCas9(1.1), SpCas9-HF1, HypaCas9, and evoCas9 lost their editing efficiency 4,6,24-26,30 . With N 20 -NGG compared to GN 19 -The availability of NGG sites, using gRNA with a 5'G matching the protospacer sequence can significantly reduce the number of editable sites in the human genome to ~1 / 4.3 ( Fig.11 The editing activity of Opti-SpCas9 was further characterized using gRNAs carrying an additional 5'G and based on assays of endogenous loci that we and others have previously studied. 3-5,18,31 , we found that Opti-SpCas9 exhibited on-target DNA cleavage activity comparable to WT (i.e., 95.1%), whereas eSpCas9(1.1) and HypaCas9 exhibited greatly reduced activities (i.e., 32.4% and 25.6%, respectively) ( Fig. 5a ; Fig.12 The reduced editing was not due to lower protein expression levels of the two SpCas9 variants ( Fig.13 These results confirmed our screening system in which gRNA with an additional 5'G was used (Figure 2; 3a) and based on independent validation experiments using a green fluorescent protein (GFP) disruption assay ( Figure 3b ; Fig.14 ) observed on-target activity for these variants. In addition, when using a 20-nucleotide gRNA beginning with a matching 5'G, Opti-SpCas9, eSpCas9(1.1), and HypaCas9 exhibited editing activities comparable to WT (i.e., 109.1%, 103.3%, and 106.8%, respectively) (Figure 5a). Opti-SpCas9 was further compared with OptiHF-SpCas9 and the recently characterized high-fidelity variant evoCas9. 6 and Sniper-Cas9 32Comparisons were made, and it was found that OptiHF-SpCas9, evoCas9, and Sniper-Cas9 produced less on-target editing than Opti-SpCas9 (i.e., 60.7%, 99.8%, and 51.7% less, respectively, when expressed with a gRNA carrying an additional 5'G, and 40.1%, 87.7%, and 63.9% less, respectively, when a gRNA starting with a matching 5'G at the 20-nucleotide gRNA sequence was used) ( Figure 5 b; Fig.12 ; 13). In summary, limiting the first base of the gRNA sequence to include a matching 5'G to 20 nucleotides for transcription under U6 (which limits the utility of other previously engineered SpCas9s with improved specificity) does not apply to Opti-SpCas9, which works compatibly with gRNAs carrying an additional 5'G. These findings highlight that engineered SpCas9s do not necessarily have to sacrifice targeting range for specificity.

[0119] We further examined the off-target activities of different SpCas9 variants. Eight potential off-target loci edited by WT SpCas9 using VEGFA site 3 and DNMT1 site 4 gRNAs were amplified. 3-5,31 , and genomic indels induced by WT SpCas9 were detected at four of those sites (i.e., VEGFA OFF1, VEGFA OFF2, VEGFA OFF3, and DNMT1 OFF1) in OVCAR8-ADR cells. When Opti-SpCas9, eSpCas9(1.1), and HypaCas9 were used instead of WT, off-target editing was detected only at the VEGFAOFF1 site ( Fig.15 Of the 4 variants, Opti-SpCas9 showed the greatest on-target:off-target activity at this site ( Fig.15 ). To compare the mismatch tolerance of different SpCas9 variants, gRNAs containing 1-4 base mismatches against the reporter gene target (i.e., the genomically integrated GFP gene sequence) were generated. These mismatched bases spanned different positions of the gRNA spacer sequence. The loss of GFP fluorescence was measured to reflect DNA cleavage and indel-mediated destruction of the target site. It was found that Opti-SpCas9 was largely intolerant to gRNAs with two or more mismatched bases, although relatively low activity levels were detected in 1 of the 8 sites carrying two base mismatches (i.e., 3.5% for Opti-SpCas9 versus 73.2% for WT) ( Fig.16 eSpCas9(1.1) and HypaCas9 were observed to make fewer edits at both on-target sites (i.e., >60% reduction) and off-target sites in our reporter system ( Fig.16). With similar levels of on-target activity between WT and Opti-SpCas9 (i.e., 97.6% of WT), Opti-SpCas9 showed higher specificity than WT, as indicated by significantly fewer off-target edits at 13 of 20 sites containing single-base mismatches, although a significant number of off-target edits were still detected ( Fig.16 Others have also reported editing activity at single-base mismatch sites using eSpCas9(1.1), SpCas9-HF1, HypaCas9, evoCas9, and Sniper-Cas9. 3,5,6,32 Nevertheless, most of the off-target sites predicted in silico in the genome contain two or more mismatches relative to the gRNA sequence. 33 , so tolerance to single-base mismatches should not limit the utility of SpCas9 for precise genome editing. GUIDE-Seq was further performed to look at the genome-wide cleavage activity brought about by Opti-SpCas9 and other engineered SpCas9 variants. These results show that Opti-SpCas9 produces significantly less off-target cleavage than WT, and OptiHF-SpCas9 shows an increased on-target:off-target ratio comparable to other reported high-fidelity variants such as eSpCas9(1.1), HypaCas9, evoCas9, and Sniper-Cas9 ( Figure 5c ; Table 3). Compared with eSpCas9 (1.1) and HypaCas9, Opti-SpCas9 showed better compatibility with the use of truncated gRNA ( Fig.17 ), which may provide a complementary strategy to improve the editing specificity of Opti-SpCas9 34 .

[0120] discuss

[0121] The inventors have established a simple yet very powerful platform, named CombiSEAL, to address the unmet need for rapid and simultaneous analysis of high-order combinatorial mutations in protein engineering. The strategy uses a combined assembly approach to bypass the cumbersome steps of establishing individual combinatorial mutants one by one, and utilizes a barcoding strategy to enable parallel experiments on a large number of protein variants and identify the best performers among them to facilitate protein engineering. In addition, the method can be applied to map epistatic relationships between mutations. Using the CombiSEAL approach, the inventors successfully identified Opti-SpCas9 and OptiHF-SpCas9, novel variants with excellent genome editing efficiency and specificity on a wide range of endogenous targets in human cells (Table 3). The CombiSEAL pipeline can be easily used to establish even more Cas9 variants to expand the range of variants with multifaceted or other properties, such as having a wider pre-spacer sequence adjacent motif flexibility. 7 and enhanced compatibility with ribonucleoprotein delivery 35 It is envisioned that CombiSEAL will accelerate the search for variants of CRISPR enzymes, including SaCas9 36 and Cpf1 37 ) and its derivatives (such as base editors 38-41 The versatility of this approach will also expand our scope to systematically engineer a wide range of proteins as well as other biomolecules and systems relevant to many biomedical and biotechnological applications, including synthetic DNA and genetic regulatory circuits.

[0122] method

[0123] Construction of DNA vector

[0124] The vector (table 4) used in this study was constructed using standard molecular cloning techniques, including PCR, restriction enzyme digestion, connection and Gibson assembly. Customized oligonucleotides were purchased from IntegratedDNA Technologies and Genewiz. The vector construct was transformed into the Escherichia coli strain DH5α, and the carbenicillin / ampicillin of 50 μg / ml was used to separate the bacterium colony comprising the construct. PlasmidMini (Takara) or Midi (Qiagen) test kits were used to extract and purify DNA. The sequence of the vector construct was verified by Sanger sequencing.

[0125] To create lentiviral expression vectors encoding eSpCas9 (1.1), HypaCas9 or SpCas9-HF1 and Zeocin as a selection marker, SpCas9 sequences were amplified / mutated from pAWp30 (Addgene #73857), eSpCas9 (1.1) (Addgene #71814) and VP12 (Addgene #72247) by PCR using Phusion DNA polymerase (New England Biolabs) and cloned into the pFUGW lentiviral vector backbone using Gibson Assembly Master Mix (New England Biolabs). Lentivirus expression vectors encoding evoCas9, Sniper-Cas9 and xCas9 (3.7) were created by amplifying their SpCas9 sequences from Addgene constructs #107550, #113912 and #1803380, respectively, and cloning into the pFUGW vector backbone. To construct storage vectors containing U6 promoter-driven expression of gRNA targeting specific genes, the expression vectors were constructed as previously described. 18 Oligonucleotide pairs with gRNA target sequences were synthesized using T4 DNA ligase (New England Biolabs), annealed, and cloned into BbsI-digested pAWp28 vector (Addgene

[0126] #73850). In order to find SpCas9 variants that can work compatibly with gRNAs carrying an additional 5'G at the beginning of the 20 nucleotide spacer sequence to facilitate transcription under the U6 promoter, in addition to Figures 5 and Fig.14 In addition to some of the ones used in , gRNAs containing additional 5'G were used in this study. The gRNA spacer sequences are listed in Table 5. To construct a lentiviral vector for U6-driven gRNA expression, the U6-gRNA expression cassette was prepared from a storage vector digested with BglII and MfeI enzymes (ThermoFisher Scientific) and inserted into the pAWp12 (Addgene#72732) vector backbone using a ligation method through compatible sticky ends generated by digesting the vector with BamHI and EcoRI enzymes (ThermoFisher Scientific). To express gRNA with dual RFP and GFP fluorescent protein reporters, the U6-driven gRNA expression cassette was inserted into the lentiviral vector backbone pAWp9 (Addgene#73851) instead of pAWp12 using the same strategy described above.

[0127] Creation of barcoded DNA components of SpCas9

[0128] Guided by the prior knowledge available when we began this study, the inventors focused on creating libraries of combinatorial mutants at amino acid residues predicted to be involved in the gRNA-directed genomic loci (including at SpCas9-HF1, 4 and eSpCas9(1.1) 3 contact with target and non-target DNA strands, or control the conformational dynamics of the HNH and RuvC nuclease domains of SpCas9 for DNA cleavage 28 . Eight amino acid residues were selected and modified to contain specified or randomly generated substitution mutations ( Figure 1a ). Basic residues were mutated to alanine to evaluate the role of those charged residues. In addition to the alanine substitution at K1003 previously introduced into eSpCas9 (1.1), this residue was also mutated to other positively charged residues (i.e., arginine and histidine) to minimize its effect on protein stability. It is speculated that the specific combination of these mutations on SpCas9 can maximize its on-target editing efficiency and enhance compatibility with gRNA while minimizing undesirable off-target activity.

[0129] The SpCas9 sequence was modularized into 4 components (i.e., P1, P2, P3, and P4) to create combinatorial mutants, and 4 inserts were created for P1, 2 inserts for P2, 17 inserts for P3, and 7 inserts for P4. Each insert was amplified and mutated by PCR from pAWp30 (Addgene #73857) or eSpCas9 (1.1) (Addgene #71814) using Phusion (New England Biolabs) or Kapa HiFi (Kapa Biosystems) DNA polymerase. To generate site-directed mutations at amino acids 923, 924, and 926 of SpCas9, the 3 initial codon sequences were replaced with the degenerate codon NNS in the PCR primers. After cloning into a storage vector (pAWp61 or pAWp62), an 8-base pair barcode unique to each DNA insert was added. The restriction enzyme site BsaI was added to the flank of the end (and the BbsI site and primer binding site were introduced between the insert and the barcode of pAWp61 and pAWp62, respectively, for barcode sequencing). Therefore, each pAWp61 and pAWp62 storage vector herein is configured as "BsaI-insert-BbsI-BbsI-barcode-BsaI" and "BsaI-insert-primer-binding site-barcode-BsaI", respectively. Sanger sequencing was performed to confirm the sequence identity of the individual inserts and their barcodes. In the case where the engineered target sequence contains BsaI or BbsI sites, other IIS type restriction enzyme sites can be used instead of BsaI and BbsI, or synonymous mutations can be introduced into the protein coding sequence to remove restriction sites while encoding the same amino acid residues.

[0130] Creation of SpCas9 barcoded combinatorial mutation libraries

[0131] Storage vectors containing inserts for each component of SpCas9 were mixed in equimolar ratios. The merged inserts were produced by a single-pot digestion reaction of the mixed storage vectors with BsaI. The target vector (pAWp60) was digested with BbsI. The digested P1 insert and vector were ligated to create a merged P1 library in the target vector. The P1 library was digested again with BbsI and ligated with the digested P2 insert to assemble the library with a two-way combination (P1×P2). Sequential rounds of ligation reactions were performed to produce three-way (P1×P2×P3) and four-way (P1×P2×P3×P4) combinatorial libraries. After the merge assembly step, the protein coding components of the inserts were seamlessly connected and positioned to one end of the vector construct, and their corresponding barcodes were connected to the other end. A four-way (4 × 2 × 17 × 7) combinatorial library of 952 SpCas9 variants was constructed, each carrying 1-8 mutations (in addition to WT) at the following amino acid residues predicted to interact with the target and non-target DNA strands of the gRNA-directed genomic locus 3,4 , or changes in the conformational dynamics of the nuclease domain of SpCas9 28 ( Figure 1a ). The complexity of the combination can be expanded by introducing additional barcoded components, and scaled up to simultaneously study tens of thousands or even more combined modifications. Sanger sequencing analysis was performed, and most of the assembled barcoded combined mutation constructs were verified to carry expected mutations in two-way (i.e., 20 / 20 colonies), three-way (i.e., 14 / 15 colonies), and four-way (i.e., 8 / 8 colonies) libraries. Except for a three-way combined mutation construct carrying an unexpected base substitution, no other random mutations were detected in other constructs. The final library was subcloned into a pFUGW lentiviral vector to express SpCas9 variants together with the selection marker Zeocin under the EFS promoter. Sanger sequencing of the full-length sequence of the barcoded SpCas9 variants assembled in the lentiviral vector (7 of 7 colonies sampled from the library) confirmed that only expected mutations were present without random mutations.

[0132] Generation of SpCas9 variants for individual validation

[0133] Lentiviral vectors encoding individual SpCas9 variants (including Opti-SpCas9) were constructed using the same strategy used to generate the combinatorial mutant library described above, except that the assembly was performed one by one with single inserts and vectors.

[0134] Human cell culture

[0135] HEK293T cells were obtained from the American Type Culture Collection (ATCC). OVCAR8-ADR cells were a gift from T. Ochiya (Japanese National Cancer Center Research Institute, Japan) 42 .

[0136] The identity of OVCAR8-ADR cells has been confirmed by cell line validation testing (Genetica DNA Laboratories). The monoclonal stable OVCAR8-ADR cell line was generated by transducing cells with lentivirus encoding RFP and GFP genes expressed from UBC and CMV promoters, respectively, and a tandem U6 promoter-driven expression cassette of gRNA targeting the RFP site. RFPsg5-ON, RFPsg8-ON, and RFP-sg6-ON systems contain target sites on RFP that fully match the gRNA spacer, while RFPsg5-OFF5-2, RFPsg8-OFF5, and RFPsg5-OFF5 systems contain target sites on RFP that carry synonymous mutations and mismatch with the gRNA spacer (Table 6). HEK293T cells were cultured in DMEM supplemented with 10% heat-inactivated FBS and 1x antibiotic-antimycotic (Life Technologies) at 37°C and 5% CO2. OVCAR8-ADR cells were cultured in RPMI supplemented with 10% heat-inactivated FBS and 1× antibiotic-antimycotic (Life Technologies) at 37° C. and 5% CO 2 .

[0137] Lentivirus production and transduction

[0138] Lentivirus was produced in 6-well plates with 2.5 × 10 5 HEK293T cells. Cells were transfected for 15 minutes with 0.5 μg of lentiviral vector, 1 μg of pCMV-dR8.2-dvpr vector, and 0.5 μg of pCMV-VSV-G vector mixed in 100 μl of OptiMEM medium (Life Technologies) using FuGENE HD transfection reagent (Promega). One day after transfection, the medium was replaced with fresh medium. Viral supernatants were then collected every 24 hours between 48 and 96 hours after transfection, combined and filtered through a 0.45 μm polyethersulfone membrane. For transduction with a single vector construct, 500 μl of filtered viral supernatant was used to infect 2.5 × 105 cells overnight. To transduce the combined library into human cells (i.e., OVCAR8-ADR), the production of lentivirus was scaled up using the same experimental conditions. To ensure that the high-coverage library had adequate representation for most combinations, a starting cell population containing cells that were ~300 times the size of the library to be tested was infected. The lentivirus was titrated to a multiplicity of infection of ~0.3, resulting in an infection efficiency of ~30% in the presence of 8 μg / ml polybrene, allowing the SpCas9 variant library to be delivered at low copy number.

[0139] Cell sorting

[0140] Cell sorting was performed on a BD Influx cell sorter (BD Biosciences). Droplet delay was determined using BD Accudrop beads. Cells were filtered through a 70 μm nylon mesh filter and then sorted using a 1.0 Drop Pure sorting mode through a 100 μm nozzle. Cells were gated to obtain GFP positive signals and sorted into 3 boxes (i.e., A, B, and C) based on the fluorescence level of RFP, so that about 5% of the cells in the population were collected into each box containing cells with lower RFP levels. The percentage of cells in the population to be sorted into each box can be adjusted to balance the performance of a single combination in the sorted population and the trade-off between the sensitivity of variant enrichment between the detection boxes. About 200,000 to 300,000 cells were collected for each sorting box in each sample.

[0141] Sample preparation for barcode sequencing

[0142] For the combinatorial mutant vector library, plasmid DNA was extracted from E. coli transformed with the vector library using the PlasmidMini kit (Qiagen). For the human cell pool infected with the combinatorial mutant library, genomic DNA from cells collected from various experimental conditions was extracted using the DNeasyBlood&Tissue Kit (Qiagen). DNA concentration was measured by Quant-iTPicoGreen dsDNA Assay Kit (Life Technologies). PCR amplification of 393 base pair fragments was performed using KapaHiFi HotstartReady-mix (Kapa Biosystems), each fragment containing a unique barcode representing a single combinatorial mutant, an Illumina anchor sequence, and an 8 base pair index barcode for multiple sequencing. The forward and reverse primers used were 5′-AATGATACGGCGACCACCGAGATCTACACGGAACCGCAACGGTATTC-3′ and 5′

[0143] -CAAGCAGAAGACGGCATACGAGAT NNNNNNNN GGTTGCGTCAGCAAACA CAG-3′, NNNNNNNN represents the specific index barcode assigned to each experimental sample. To avoid PCR bias, which could skew the population distribution, PCR conditions were optimized to ensure that amplification occurred during the exponential phase. PCR amplicons were purified with two rounds of size selection using AgencourtAMPure XP beads (Beckman Coulter Genomics) at ratios of 1:0.5 and 1:0.95 prior to real-time PCR quantification using Kapa SYBR FastqPCR Master Mix (KapaBiosystems) with the StepOnePlus Real Time PCR System (AppliedBiosystems). The forward and reverse primers used for quantitative PCR were 5′-AATGATACGGCGACCACCGA-3′ and 5′-CAAGCAGAAGACGGCATACGA-3′, respectively. The quantified samples were then combined at the desired ratio for multiplex analysis, evaluated on an Agilent 2100 Bioanalyzer using a high-sensitivity DNA chip (Agilent), and quantified using primers (5′

[0144] The cells were run on an Illumina HiSeq using a primer containing the primers 5′-GTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACC-3′ and index barcode primer (5′-GTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACC-3′).

[0145] Barcode sequencing data analysis

[0146] Barcode reads for each combination mutant were processed from the sequencing data. For each sample classified by the index barcode, the barcode reads representing each combination were normalized to one million reads. The analysis was performed with two biological replicates. The frequency of each combination mutant between the sorted bin A and the unsorted population was measured and its enrichment ratio (E) relative to the rest of the population was calculated. Bin A was selected because the enrichment of variants in this bin was most obvious ( Figure 2b ). The formula used is as follows:

[0147]

[0148] Where N 箱 represents the frequency of combined mutants in the sorted bins, and N 未分选的 Represents the frequency of combined mutants in the unsorted bins.

[0149] The average score of the log-transformed duplicates (i.e., log2(E)) comparing sorted bin A to the unsorted population was used as a measure of target editing activity. Only barcodes giving more than 300 absolute reads in the unsorted population were analyzed to improve data reliability. The correlation between the log2(E) scores determined from the pooled screen and the individual validation data was improved by increasing the cell representation fold for each combination in the pooled screen to reduce experimental noise 43 , which improved the correlation between the log2(E) scores determined from the pooled screen and the individual validation data ( Fig. 9 ). Variants with optimized activity (i.e., Opti-SpCas9 identified in this study) were defined as those with the following log2(E) (for bin A relative to the unsorted population): log2(E) of at least >90% of WT for both RFPsg5-ON and RFPsg8-ON, and log2(E) <60% of WT for both RFPsg5-OFF5-2 and RFPsg8-OFF5. OptiHF-SpCas9 was identified as a high-fidelity variant based on an enrichment ratio of at least >50% of WT for both RFPsg5-ON and RFPsg8-ON and an enrichment ratio <90% of WT for both RFPsg5-OFF5-2 and RFPsg8-OFF5. The complete list is shown in Table 2.

[0150] To determine epistasis, we applied a scoring system similar to that previously described for protein fitness and calculated an epistasis (ε) score for each combination in ,45 . The ε score was determined as: observed fitness - expected fitness, where according to the additive model, the expected fitness of the combination [X,Y] is (log2(E Figure 4 )) + log2(E [X] ). Generally, combinations showing better-than-expected fitness were defined as positive epistasis, while combinations with worse-than-expected fitness were defined as negative epistasis. In this work, the log2(E) values of lethal or nearly lethal combination mutants were set equal to those of the SpCas9 variant with 8 mutations (i.e., R661A + [Y] Q695A + K848A + E923M + T924V + Q926A + K1003A + R1060A) for comparison, and our individual validation data confirmed minimal activity in disrupting the target RFP sequence (

[0151] ). The upper limit of the expected fitness was the log2(E) value of the lethal or nearly lethal combination mutants to minimize false epistasis values caused by meaningless predicted fitness. In future work, it may be beneficial to include nuclease-dead mutants of SpCas9 as lethal mutants in the pooled screen for comparison. Figure 3b )

[0152] Fluorescent protein disruption assay

[0153] Fluorescent protein disruption assays were performed to assess DNA cleavage and indel-mediated disruption at fluorescent protein (i.e., GFP or RFP) target sites caused by SpCas9 and gRNA expression, which resulted in loss of cellular fluorescence. Cells containing integrated GFP or RFP reporter genes as well as SpCas9 and gRNA were washed and resuspended with 1x PBS supplemented with 2% heat-inactivated FBS and assayed with an LSR Fortessa analyzer (Becton Dickinson). Cells were gated based on forward and side scatter. At least 1x 10 4 cells.

[0154] Immunoblot analysis

[0155] Cells were dissolved in 2x RIPA buffer supplemented with protease inhibitors (GoldBiotechnology#GB-108-2). Lysates were collected by scraping the culture plate on ice and then centrifuged at 15000rpm for 15 minutes at 4°C. The supernatant was quantified using Bradford assay (BioRad). The protein was denatured at 99°C for 5 minutes and then subjected to gel electrophoresis on a 10% polyacrylamide gel (Bio-Rad). The protein was transferred to a polyvinylidene fluoride membrane at 110V and 4°C for 2 hours. The primary antibodies used were: anti-Cas9 (7A9-3A3) (1: 2,000, Cell Signaling#14697) and anti-β-actin (1: 10,000, Sigma#A2228). The secondary antibody used was HRP-linked anti-mouse IgG (1: 20,000, Cell Signaling#7076). The membrane was developed with WesternBright ECL HRP substrate (Advansta #K-12045-D20).

[0156] T7 Endonuclease I Assay

[0157] T7 endonuclease I assay was performed to assess DNA mismatch cleavage at genomic loci targeted by gRNA. Genomic DNA was extracted from cell cultures using QuickExtract DNA extraction solution (Epicentre) or DNeasy Blood & Tissue Kit (Qiagen). Amplicons containing the targeted loci were generated by PCR using the primers and PCR conditions listed in Table 7 and then purified using Agencourt AMPure XP beads (Beckman Coulter Genomics). Approximately 400 ng of PCR amplicons were denatured, self-annealed, and incubated with 4 units of T7 endonuclease I (New England Biolabs) at 37 ° C for ~40 minutes. The reaction products were separated using 2% agarose gel electrophoresis. Quantification was based on relative band intensities measured using ImageJ. As previously described 46 , through the formula 100×(1-(1-(b+c) / (a+b+c)) 1 / 2 ) to estimate the indel percentage, where a is the cumulative intensity of the uncut PCR product, and b and c are the cumulative intensities of each cleavage product.

[0158] GUIDE-Seq detection of genome-wide off-target

[0159] Using the GUIDE-Seq method 47 Capturing genome-wide off-targets. For each GUIDE-Seq sample, 1.5 million OVCAR8-ADR cells infected with SpCas9 variants and gRNA were electroporated with 1000 pmol of freshly annealed GUIDE-seq end-protected dsODN using 100 μl Neon tips (ThermoFisher Scientific) according to the manufacturer’s protocol. The dsODN oligonucleotide sequences used were: 5′

[0160] -PG*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T-3′ and 5′

[0161] -PA*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C-3′, where P represents 5′ phosphorylation and * represents a thiophosphate bond. 72 hours after electroporation, genomic DNA was extracted using the DNeasy Blood and Tissue kit (Qiagen). Genomic DNA concentration was quantified by the Qubit fluorometer dsDNA HS assay (ThermoFisher Scientific), and 400ng was used for library construction according to the GUIDE-Seq protocol with minor modifications. In brief, DNA was enzymatically fragmented by the KAPA Frag Kit (KAPA Biosystems), followed by two rounds of semi-nested PCR enrichment of adapter ligation and dsODN integration sequences. In order to unify the Illumina sequencing workflow to obtain dual-index data using a single-index sequencing workflow on various Illumina platforms, the semi-functional adapter was redesigned to place the sample index (Index 2) at the beginning of Read 1, followed by a unique molecular index (Table 8). The final sequencing libraries were quantified by KAPA Library Quantification Kits for Illumina and sequenced on the Illumina Next Seq 500 System. Data demultiplexing of Index 1 was performed by bcl2fq v2.19, followed by Index 2 demultiplexing and formatting with custom scripts for analysis using GUIDE-Seq software. 48 .

[0162] All patents, patent applications, and other publications cited in this application (including GenBank Accession Numbers or equivalent sequence identification numbers) are incorporated by reference in their entirety for all purposes.

[0163]

[0164] Table 2 This file contains the enrichment scores determined for SpCas9 variants based on the combined representation.

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193] Table 5

[0194] This file contains a list of gRNA pre-spacer sequences used in this study

[0195]

[0196]

[0197] (*) Lower case letters indicate additional 5' guanines that do not match. Upper case letters indicate additional 5' guanines that match. "-" indicates no additional 5' guanines.

[0198] Table 6

[0199] This file contains a list of reporter cell lines used in this study

[0200] Table 7

[0201] This file contains a list of primers and PCR conditions used for the T7E1 assay.

[0202]

[0203] Table 8

[0204] This file contains the adapter and primer sequences for GUIDE-Seq

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216] References

[0217] 1 Bornscheuer, U.T. et al. Engineering the third wave of biocatalysis. Nature 485, 185 - 194, doi:10.1038 / nature11117 (2012).

[0218] 2 Weinreich, D.M., Delaney, N.F., Depristo, M.A. & Hartl, D.L. Darwinian evolution can follow only very few mutational paths to fitter proteins. Science 312, 111 - 114, doi:10.1126 / science.1123539 (2006).

[0219] 3 Slaymaker, I.M. et al. Rationally engineered Cas9 nucleases with improved specificity. Science 351, 84 - 88, doi:10.1126 / science.aad5227 (2016).

[0220] 4 Kleinstiver, B.P. et al. High - fidelity CRISPR - Cas9 nucleases with no detectable genome - wide off - target effects. Nature 529, 490 - 495, doi:10.1038 / nature16526 (2016).

[0221] 5 Chen, J.S. et al. Enhanced proofreading governs CRISPR - Cas9 targeting accuracy. Nature 550, 407 - 410, doi:10.1038 / nature24268 (2017).

[0222] 6 Casini, A. et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat Biotechnol, doi:10.1038 / nbt.4066 (2018).

[0223] 7 Hu, J.H. et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature, doi:10.1038 / nature26155 (2018).

[0224] 8 Packer, M.S. & Liu, D.R. Methods for the directed evolution of proteins. Nat Rev Genet 16, 379 - 394, doi:10.1038 / nrg3927 (2015).

[0225] 9 Romero, P.A. & Arnold, F.H. Exploring protein fitness landscapes by directed evolution. Nat Rev Mol Cell Biol 10, 866 - 876, doi:10.1038 / nrm2805 (2009).

[0226] 10 Gasperini, M., Starita, L. & Shendure, J. The power of multiplexed functional analysis of genetic variants. Nat Protoc 11, 1782 - 1787, doi:10.1038 / nprot.2016.135 (2016).

[0227] 11 Fowler, D.M. & Fields, S. Deep mutational scanning: a new style of protein science. Nat Methods 11, 801 - 807, doi:10.1038 / nmeth.3027 (2014).

[0228] 12 Ma, S., Saaem, I. & Tian, J. Error correction in gene synthesis technology. Trends Biotechnol 30, 147 - 154, doi:10.1016 / j.tibtech.2011.10.002 (2012).

[0229] 13 Kosuri, S. & Church, G. M. Large-scale de novo DNA synthesis: technologies and applications. Nat Methods 11, 499-507, doi:10.1038 / nmeth.2918(2014).

[0230] 14 Engler, C., Kandzia, R. & Marillonnet, S. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3, e3647, doi:10.1371 / journal.pone.0003647(2008).

[0231] 15 Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343-345, doi:10.1038 / nmeth.1318(2009).

[0232] 16 Trudeau, D. L, Smith, M. A. & Arnold, F. H. Innovation by homologous recombination. Curr Opin Chem Biol 17, 902-909, doi:10.1016 / j.cbpa.2013.10.007(2013).

[0233] 17 Wong, A. S., Choi, G. C., Cheng, A. A., Purcell, O. & Lu, T. K. Massively parallel high-order combinatorial genetics in human cells. Nat Biotechnol 33, 952-961, doi:10.1038 / nbt.3326(2015).

[0234] 18 Wong, A.S. et al. Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM. Proc Natl Acad Sci U S A 113, 2544-2549, doi:10.1073 / pnas.1517883113 (2016).

[0235] 19 Cheng, A.A., Ding, H. & Lu, T.K. Enhanced killing of antibiotic-resistant bacteria enabled by massively parallel combinatorial genetics. Proc Natl Acad Sci U S A 111, 12462-12467, doi:10.1073 / pnas.1400093111 (2014).

[0236] 20 Doudna, J.A. & Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096, doi:10.1126 / science.1258096 (2014).

[0237] 21 Hsu, P.D., Lander, E.S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278, doi:10.1016 / j.cell.2014.05.010 (2014).

[0238] 22 Mali, P., Esvelt, K.M. & Church, G.M. Cas9 as a versatile tool for engineering biology. Nat Methods 10, 957-963, doi:10.1038 / nmeth.2649 (2013).

[0239] 23 Barrangou, R. & Horvath, P. A decade of discovery: CRISPR functions and applications. Nat Microbiol 2, 17092, doi:10.1038 / nmicrobiol.2017.92 (2017).

[0240] 24 Kim, S., Bae, T., Hwang, J. & Kim, J.S. Rescue of high-specificity Cas9 variants using sgRNAs with matched 5′ nucleotides. Genome Biol 18, 218, doi:10.1186 / s13059-017-1355-3 (2017).

[0241] 25 Kulcsar, P.I. et al. Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol 18, 190, doi:10.1186 / s13059-017-1318-8 (2017).

[0242] 26 Zhang, D. et al. Perfectly matched 20-nucleotide guide RNA sequences enable robust genome editing using high-fidelity SpCas9 nueleases. Genome Biol 18, 191, doi:10.1186 / s13059-017-1325-9 (2017).

[0243] 27 Kato-Inui, T., Takahashi, G., Hsu, S. & Miyaoka, Y. Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair. Nucleic Acids Res 46, 4677-4688, doi:10.1093 / nar / gky264(2018).

[0244] 28 Sternberg, S.H., LaFrance, B., Kaplan, M. & Doudna, J.A. Conformational control of DNA target cleavage by CRISPR-Cas9. Nature 527, 110-113, doi:10.1038 / nature15544(2015).

[0245] 29 Singh, D. et al. Mechanisms of improved specificity of engineered Cas9s revealed by single-molecule FRET analysis. Nat Struct Mol Biol 25, 347-354, doi:10.1038 / s41594-018-0051-7(2018).

[0246] 30 Kato-Inui, T., Takahashi, G., Hsu, S. & Miyaoka, Y. Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair. Nucleic Acids Res, doi:10.1093 / nar / gky264(2018).

[0247] 31 Fu, Y. et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nuclcases in human cells. Nat Biotechnol 31, 822-826, doi:10.1038 / nbt.2623(2013).

[0248] 32 Lee, J.K. et al. Directed evolution of CRISPR-Cas9 to increase its specificity. Nat Commun 9, 3048, doi:10.1038 / s41467-018-05477-x(2018).

[0249] 33 Haeussler, M. et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol 17, 148, doi:10.1186 / s13059-016-1012-2(2016).

[0250] 34 Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M. & Joung, J.K. Improving CRISPR-Cas nuclease specificity using tmncated guide RNAs. Nat Biotechnol 32, 279-284, doi:10.1038 / nbt.2808(2014).

[0251] 35 Vakulskas, C.A. et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nat Med 24, 1216-1224, doi:10.1038 / s41591-018-0137-0(2018).

[0252] 36 Ran, FA in vivo genome editing using Staphylococcus aureus Cas9.Nature 520, 186-191, doi:10.1038 / nature14299(2015).

[0253] Cell 163,759-771,doi:10.1016 / j.cell.2015.09.038(2015) 37 Zetsche, B. Cpf1 is a single RNA-guided endonuclecase of a class2 CRISPR-Cas system.

[0254] 38 Komor,AC,Kim,YB,Packer,MS,Zuris,JA&Liu,DRProgrammable editing of a target base in genomic DNA without double-stranded DNAcleavage.Nature 533,420–424,doi:10.1038 / nature17946(2016).

[0255] 39 Nishida,K.IndividualTargeted nucleotide editing using hybrid prokaryoticand vertebrate adaptive immune systems.Science 353,doi:10.1126 / science.aaf8729(2016).

[0256] 40 Gaudelli,NMProgrammable base editing of A*T to G*C ingenomic DNA without DNA cleavage.Nature 551,464-471,doi:10.1038 / nature24644(2017).

[0257] 41 Li,X.NatBiotechnol 36,324–327,doi:10.1038 / nbt.4102(2018).

[0258] 42 Honma, K. et al. RPN2 gene confers docetaxel resistance in breast cancer. Nat Med 14, 939 - 948, doi:10.1038 / nm.1858(2008).

[0259] 43 Kampmann, M., Bassik, M.C. & Weissman, J.S. Functional genomics platform for pooled screening and generation of mammalian genetic interaction maps. Nat Protoc 9, 1825 - 1847, doi:10.1038 / nprot.2014.103(2014).

[0260] 44 Olson, C.A., Wu, N.C. & Sun, R. A comprehensive biophysical description of pairwise epistasis throughout an entire protein domain. Curr Biol 24, 2643 - 2651, doi:10.1016 / j.cub.2014.09.072(2014).

[0261] 45 Aakre, C.D. et al. Evolving new protein - protein interaction specificity through promiscuous intermediates. Cell 163, 594 - 606, doi:10.1016 / j.cell.2015.09.055(2015).

[0262] 46 Guschin, D.Y. et al. A rapid and general assay for monitoring endogenous gene modification. Methods Mol Biol 649, 247 - 256, doi:10.1007 / 978 - 1 - 60761 - 753 - 2_15(2010).

[0263] 47 Tsai, S.Q. et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol 33, 187-197, doi:10.1038 / nbt.3117 (2015).

[0264] 48 Tsai, S.Q., Topkar, V.V., Joung, J.K. & Aryee, M.J. Open-source guide seq software for analysis of GUIDE-seq data. Nat Biotechnol 34, 483, doi:10.1038 / nbt.3534 (2016).

Claims

1. A method for producing a combinatorial gene construct, comprising: (a) cleaving a first DNA vector with a first Type IIS restriction enzyme to release a first DNA fragment, the first DNA fragment comprising a first DNA strand, first and second recognition sites for a second Type IIS restriction enzyme, and a first barcode flanked by first and second ends generated by the first Type IIS restriction enzyme, wherein the first DNA vector comprises, from 5′ to 3′: The first recognition site of the first type IIS restriction enzyme, DNA elements, the first and second recognition sites of a second type IIS restriction enzyme, a barcode uniquely assigned to the DNA element; and a second recognition site for a first type IIS restriction enzyme; (b) cutting the initial expression vector containing the promoter with a second Type IIS restriction enzyme to linearize the initial expression vector near the 3' end of the promoter and generate two ends compatible with the first and second ends of the DNA fragment of (a); (c) annealing and ligating the first DNA fragment of (a) into the linearized expression vector of (b) to form a unidirectional composite expression vector, wherein the first DNA fragment and the first barcode are operably linked to the 3' end of the promoter; (d) cleaving the second DNA vector with the first Type IIS restriction enzyme to release a second DNA fragment, the second DNA fragment comprising a second DNA segment, first and second recognition sites for the second Type IIS restriction enzyme, and a second barcode flanked by first and second ends generated by the first Type IIS restriction enzyme, wherein the second DNA vector comprises, from 5′ to 3′: The first recognition site of the first type IIS restriction enzyme, DNA elements, the first and second recognition sites of a second type IIS restriction enzyme, a barcode uniquely assigned to the DNA element; and a second recognition site for a first type IIS restriction enzyme; (e) cleaving the composite expression vector of (c) with a second Type IIS restriction enzyme to linearize the composite expression vector between the first DNA element and the first barcode and generate two ends compatible with the first and second ends of the DNA fragment of (d); (f) annealing and ligating the second DNA fragment of (d) into the linearized composite expression vector of (e) between the first DNA element and the first barcode to form a bidirectional composite expression vector, wherein the first DNA fragment, the second DNA fragment, the second barcode and the first barcode are operably linked to the 3' end of the promoter in this order, wherein the first and second DNA elements encode the first and second segments of the preselected protein immediately adjacent to each other starting from their N-termini, and wherein the first and second DNA segments are linked to each other in said bidirectional composite expression vector without any foreign nucleotide sequence resulting in any amino acid residue not found in the preselected protein, and wherein each of the first and second DNA elements comprises one or more mutations.

2. The method of claim 1, wherein steps (d)-(f) are repeated up to the nth time to incorporate the nth DNA fragment comprising the nth DNA element, the first and second recognition sites of the second type IIS restriction enzyme, and the nth barcode into the n-way composite expression vector, the nth DNA element encoding the nth or second to last segment of the preselected protein starting from its C-terminus, further comprising the steps of: (x) providing a final DNA vector comprising the (n+1)th DNA element, a primer binding site, and the (n+1)th barcode between the first and second recognition sites of the first Type IIS restriction enzyme; (y) cutting the final DNA vector with a first Type IIS restriction enzyme to release a final DNA fragment, the final DNA fragment comprising, from 5′ to 3′: the (n+1)th DNA element, a primer binding site, and the (n+1)th barcode flanked by the first and second ends generated by the first Type IIS restriction enzyme; (z) annealing and ligating the final DNA fragment into the n-dimensional composite expression vector generated after steps (d)-(f) are repeated for the nth time and linearized by the second type IIS restriction enzyme to form a final composite expression vector, wherein the first, second, and so on up to the nth and (n+1)th DNA elements encode the first, second, and so on up to the nth and last segments of a preselected protein immediately adjacent to each other starting from their N-termini, and wherein the first, second, and so on up to the nth and last DNA fragments are linked to each other in the final composite expression vector without any foreign nucleotide sequence resulting in any amino acid residue not found in the preselected protein, and wherein each DNA element comprises one or more mutations.

3. The method of claim 1 or 2, wherein the first Type IIS restriction enzyme and the second Type IIS restriction enzyme produce compatible ends after cleaving the DNA molecule.

4. The method of claim 1 or 2, wherein the first Type IIS restriction enzyme is BsaI and the second Type IIS restriction enzyme is BbsI.

Images