Primer set, probe, microfluidic chip, detection method and system for detecting HLA-B*58:01 allele

Abstract

The present invention discloses a primer set, a probe, a microfluidic chip, a detection method and a system for detecting HLA-B*58:01 alleles. The primer set includes three pairs of specific primers, wherein the sequences of the first forward primer, the second forward primer and the third forward primer are respectively shown in SEQ ID NO.1 to SEQ ID NO.3, and the sequence of the reverse primer is shown in SEQ ID NO.4. The sequence of the probe is shown in SEQ ID NO.5. The microfluidic chip of the present invention can automatically complete the extraction and purification of genomic DNA and isothermal nucleic acid amplification detection from the sample to be detected under the control of a peripheral miniaturized portable system, without the need for thermal cycling reaction, and without the need for amplification in a PCR instrument. It has the advantages of high sensitivity, strong specificity, simple reaction procedure, short detection time, etc. This method introduces RPA reaction internal control for clinical detection requirements to ensure the authenticity and accuracy of the detection reaction.

Description

Technical Field

[0001] The present invention relates to a method for detecting an HLA-B*58:01 allele, and in particular to a primer set, a probe, a kit and a detection method for detecting an HLA-B*58:01 allele, as well as a microfluidic chip, a portable control device and an HLA-B*58:01 allele detection system, belonging to the technical field of gene detection. Background Art

[0002] Allopurinol is an effective first-line drug for the treatment of hyperuricemia and gout. It is inexpensive and has a good uric acid-lowering effect. In addition, many studies have shown that allopurinol can also resist oxidative stress and improve endothelial cell function. It has a protective effect on multiple systemic organs and is the best choice for patients with renal insufficiency or ineffective uric acid excretion treatment. It is irreplaceable. Allopurinol has the risk of causing hypersensitivity reactions. Studies have confirmed that severe hypersensitivity reactions associated with allopurinol are closely related to HLA-B*58:01. The positive rate of Asian people is significantly higher than that of white people, so the risk of hypersensitivity reactions is greater. Hung et al. (PNAS, 102(11)4134-4139(2015)) found that the SNP sites strongly associated with severe drug eruption were all located on the MHC gene, concentrated in the HLA-A, B, C and DRB1 loci, especially the HLA-B*58:01 allele. HLA-B*58:01 is present in 100% of patients who experience severe skin adverse reactions after taking allopurinol, while the carrier rate is only 15% and 20% in patients who do not experience skin adverse reactions (tolerant population) and normal control groups. Testing for HLA-B*58:01 alleles before taking allopurinol is important for guiding safe clinical medication to determine whether one belongs to the relevant high-risk population. Therefore, in 2008, Taiwan, my country, has implemented gene testing for patients who are preparing to use allopurinol, and patients with positive results are prohibited from using allopurinol. In 2012, the American College of Rheumatology (ACR) recommended that Asian people should undergo HLA-B*58:01 testing before using allopurinol. In 2013, the Chinese Medical Association Endocrine Society's "Chinese Expert Consensus on the Treatment of Hyperuricemia and Gout" also recommended HLA-B*58:01 testing.

[0003] The "gold standard" for HLA-B*58:01 identification is the base sequence sequencing analysis method HLA-SBT published by the International Histocompatibility Working Group (IHWG), which directly obtains nucleic acid sequences through sequencing to identify polymorphisms. However, due to the high polymorphism and complexity of the HLA system, as well as factors such as primer design, the sequencing results will have overlapping peaks, and the interpretation is relatively complicated. In addition, HLA-SBT requires the use of expensive sequencers, and the preparation of sequencing samples has high requirements for operators, making this method difficult to carry out routinely in hospitals. Another method is to use sequence-specific primer PCR (PCR-SSP) for HLA allele type screening. For example, the SSP HLA kit of Olerup Company in Switzerland uses more than 20 pairs of primers for amplification and then uses agarose gel electrophoresis to separate and identify genotypes. It is time-consuming, easy to contaminate, and extremely cumbersome to operate. Moreover, the kit is designed for European and American populations, and some HLA alleles common in European and American populations do not appear in the Chinese population. Therefore, this type of kit is not suitable for clinical application in domestic hospitals. To address the clinical need for rapid detection of HLA-B*58:01 in the Chinese population, Taiwan's Shiji and Suzhou Kuangyuan have each developed a fluorescent quantitative PCR-based test kit that has been certified by CFDA.

[0004] But in general, the existing technology for detecting HLA-B*58:01 allele still has shortcomings such as expensive instruments and equipment, strict requirements on laboratory environment and high requirements on operator skills, long cycle and low efficiency.

[0005] Microfluidics refers to the integration of basic functional units such as sample pretreatment, chemical and biological reactions, separation and detection in the research fields of chemistry and biology into a chip or device of a few square centimeters or smaller through micro / nano processing technology. It can complete a series of complex tasks such as sample preparation, biochemical reactions, result detection and analysis, which can only be completed in conventional chemical or biological laboratories with large instruments and equipment. Therefore, it is also called Lab on a Chip. Microfluidics technology is used to integrate sample processing, genomic nucleic acid extraction and nucleic acid amplification in the HLA-B*58:01 detection process on a microfluidic chip, realizing fully automatic analysis from "sample to result".

[0006] Recombinase Polymerase Amplification (RPA) is a constant temperature nucleic acid amplification technology developed by TwistDxInc, a British company. It is considered to be a nucleic acid detection technology that can replace PCR. RPA technology mainly relies on three enzymes: recombinase that can bind to single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA binding protein (SSB) and strand displacement DNA polymerase. The mixture of three enzymes in the RPA reaction system is also active at room temperature. Its optimal amplification temperature is between 37℃-42℃, and no thermal denaturation is required. Compared with PCR, it does not require cycling between two or three temperatures and corresponding temperature control equipment. It can be carried out between 37℃-42℃ or even at room temperature. Combining microfluidics and RPA technology can greatly reduce the requirements of HLA-B*58:01 detection projects on instruments and equipment, laboratory environment and operator skills, realize portable rapid detection, and make it possible to carry out this detection project in outpatient clinics or even patients' homes. Summary of the invention

[0007] The main purpose of the present invention is to provide a primer set, a probe and a kit for detecting the HLA-B*58:01 allele in view of the above situation, so as to overcome the shortcomings of the prior art.

[0008] Another main purpose of the present invention is to provide a microfluidic chip.

[0009] Another main object of the present invention is to provide a method for detecting the HLA-B*58:01 allele, a portable control device and an HLA-B*58:01 allele detection system.

[0010] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes:

[0011] The embodiment of the present invention provides a primer set for detecting the HLA-B*58:01 allele, comprising:

[0012] a first primer pair comprising a first forward primer and a reverse primer;

[0013] a second primer pair comprising a second forward primer and a reverse primer;

[0014] a third primer pair comprising a third forward primer and a reverse primer;

[0015] The sequences of the first forward primer, the second forward primer and the third forward primer are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively, and the sequence of the reverse primer is shown as SEQ ID NO.4.

[0016] The embodiment of the present invention further provides a probe for detecting the HLA-B*58:01 allele, and its sequence is shown in SEQ ID NO.5.

[0017] The embodiment of the present invention further provides a kit for detecting HLA-B*58:01 allele, which includes: at least one primer set and at least one probe, wherein one primer set is the aforementioned primer set, and one probe set is the aforementioned probe.

[0018] The embodiment of the present invention further provides a microfluidic chip, which includes a cover layer, a substrate layer and a control layer arranged in sequence along a set direction;

[0019] The substrate layer includes a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a microchannel at least for connecting the chambers, and a control valve disposed between the chambers, wherein the nucleic acid extraction chamber is at least used to extract nucleic acid from a sample to be detected, the mixing chamber is at least used to store an RPA freeze-dried reagent and mix the RPA freeze-dried reagent with the extracted nucleic acid, and the reaction chamber is at least used to store a primer set and a probe for detecting the HLA-B*58:01 allele and perform an isothermal amplification reaction with the RPA freeze-dried reagent in the mixing chamber and the extracted nucleic acid;

[0020] The control layer includes a first control unit, a second control unit and a third control unit. The first control unit is arranged above the nucleic acid extraction chamber, at least for providing pressure to drive the liquid to flow between the chambers. The second control unit is arranged above the control valve, at least for closing or opening the control valve. The third control unit is arranged above the outlet connected to the reaction chamber, at least for discharging the liquid in the reaction chamber.

[0021] The embodiment of the present invention further provides a portable control device for use with the aforementioned microfluidic chip, which includes a liquid and flow path control unit, a thermal management and temperature control unit, and a fluorescence excitation and collection unit;

[0022] Wherein, the liquid and flow path control unit comprises:

[0023] A liquid driving component, which is at least used to squeeze the dome pressure chamber of the microfluidic chip to drive the flow of liquid;

[0024] A control valve control assembly, which is used at least to squeeze the second control unit to close or open the control valve;

[0025] The thermal management and temperature control unit comprises:

[0026] A first heating component, which is used at least to heat and make the nucleic acid extraction chamber reach a temperature required for nucleic acid elution;

[0027] A second heating component, which is used at least to heat and make the reaction chamber reach the temperature required for the RPA reaction;

[0028] The fluorescence excitation and acquisition unit comprises a fluorescence excitation component and a fluorescence image acquisition component.

[0029] The embodiment of the present invention also provides a detection system for HLA-B*58:01 allele, which comprises:

[0030] The aforementioned kit for detecting the HLA-B*58:01 allele;

[0031] RPA reaction system;

[0032] The aforementioned microfluidic chip; and,

[0033] The aforementioned portable control device.

[0034] The embodiments of the present invention also provide the use of the aforementioned primer set, probe, and kit for detecting the HLA-B*58:01 allele in preparing a product for detecting the HLA-B*58:01 allele.

[0035] Furthermore, the method for detecting HLA-B*58:01 allele using the product is mainly implemented based on the aforementioned HLA-B*58:01 allele detection system, and the detection method comprises:

[0036] The sample to be tested is placed in the nucleic acid extraction chamber of the microfluidic chip, the RPA freeze-dried reagent is placed in the mixing chamber, and the kit for detecting the HLA-B*58:01 allele is placed in the reaction chamber;

[0037] Using a first heating component of a portable control device to heat the nucleic acid extraction chamber, and eluting the sample to be detected to obtain extracted nucleic acid;

[0038] The liquid driving component of the portable control device is used to squeeze the dome pressure chamber of the microfluidic chip, and the first control valve is opened at the same time, so as to drive the nucleic acid into the mixing chamber and mix with the RPA freeze-dried reagent;

[0039] The liquid driving component continues to squeeze the dome pressure chamber of the microfluidic chip, and at the same time, the second control valve is opened, so as to drive the nucleic acid and the RPA freeze-dried reagent into the reaction chamber and mix with the primer set and the probe for detecting the HLA-B*58:01 allele;

[0040] The second heating component of the portable control device is used for heating to increase the temperature in the reaction chamber for RPA reaction, and

[0041] The RPA reaction products were detected using the fluorescence excitation and acquisition unit of a portable control device.

[0042] Compared with the prior art, the advantages of the present invention include:

[0043] 1) The present invention provides an integrated HLA-B*58:01 allele detection method, primers and fluorescent probes, microfluidic chips, portable detection devices and detection systems based on microfluidic technology to achieve real-time fluorescence detection of recombinase polymerase amplification. This method introduces RPA reaction internal control to ensure the authenticity and accuracy of the detection reaction in accordance with the requirements of clinical detection;

[0044] 2) The present invention extracts and purifies genomic DNA from samples such as blood samples, throat swabs or saliva, and then performs isothermal nucleic acid amplification. It does not require thermal cycling reactions and does not need to be amplified in a PCR instrument. It has the advantages of high sensitivity, strong specificity, simple reaction procedures, and short detection time. In addition, the detection process of the present invention is fast and low in cost, and has wide promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0046] Figure 1 It is a schematic diagram of primers and probes for detecting HLA-B*58:01 allele in a typical embodiment of the present invention.

[0047] Figure 2 It is a schematic diagram of the structure of a microfluidic chip in a typical implementation scheme of the present invention.

[0048] Figure 3 It is a schematic diagram of the structure of a microfluidic chip and a portable control device in a typical implementation scheme of the present invention.

[0049] Figure 4a-4e It is a schematic diagram of the steps of a method for detecting the HLA-B*58:01 allele in a typical embodiment of the present invention.

[0050] Figure 5a-Figure 5b It is a schematic diagram of the detection results of the HLA-B*58:01 allele in a typical embodiment of the present invention.

[0051] Explanation of the reference numerals: 100 - cover layer, 200 - substrate layer, 201 - nucleic acid extraction chamber, 202 - mixing chamber, 203 - reaction chamber, 204 - microchannel, 205 - first control valve, 206 - second control valve, 300 - control layer, 301 - dome, 302 - porous membrane, 303 - soft material membrane, 304 - porous membrane, 401 - first linear motor, 402 - second linear motor, 403 - third linear motor, 404 - infrared LED heating component, 405 - heating and temperature control component, 406a - LED light source, 406b - excitation filter, 407a - CCD component, 407b - emission filter. DETAILED DESCRIPTION

[0052] In view of the shortcomings and defects of the existing technology for detecting HLA-B*5801 alleles, such as expensive instruments and equipment, strict requirements on laboratory environment and high requirements on operator skills, long cycle and low efficiency, the inventors of this case have proposed the technical solution of the present invention after long-term research and extensive practice, and established an integrated HLA-B*58:01 allele detection method, primers and fluorescent probes, microfluidic chips and portable detection devices and detection systems based on microfluidic technology to realize real-time fluorescence detection of recombinase polymerase amplification (RPA). This method introduces RPA reaction internal control to ensure the authenticity and accuracy of the detection reaction in response to the requirements of clinical testing.

[0053] The technical solution, its implementation process and principle will be further explained as follows.

[0054] The technical solution of the present invention will be explained in more detail below. However, it should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0055] One aspect of an embodiment of the present invention provides a primer set for detecting an HLA-B*58:01 allele, comprising:

[0056] a first primer pair comprising a first forward primer and a reverse primer;

[0057] a second primer pair comprising a second forward primer and a reverse primer;

[0058] a third primer pair comprising a third forward primer and a reverse primer;

[0059] The sequences of the first forward primer, the second forward primer and the third forward primer are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively, and the sequence of the reverse primer is shown as SEQ ID NO.4.

[0060] According to the HLA-B*58:01 allele sequence (Genbank Sequence ID: KU319333.1), the present invention designs sequence-specific primers and fluorescent probes (such as ) for detecting human HLA-B*58:01 allele in the concentrated area of ​​HLA-B polymorphic sites. Figure 1 The sequence is as follows:

[0061] Furthermore, the specific sequence SEQ ID NO.1 of the first forward primer (ie, forward primer 1: B*58:01-FP1) is expressed as: ATAGAGCAGGAGGGGCCGGAGTATTGGGACG.

[0062] Furthermore, the specific sequence of the second forward primer (ie, forward primer 2: B*58:01-FP2) is represented by SEQ ID NO.2: CCGCGCAGACTTACCGAGAGAACCTGCCGAT. An amplification blocking mutation is introduced at the fourth position of the 3' end of the sequence, replacing g with c, to improve amplification specificity.

[0063] Furthermore, the specific sequence SEQ ID NO.3 of the third forward primer (i.e., forward primer 3:B*58:01-FP3) is expressed as: CCCGAGTCTCCGTGTCCGAGATCCGCCT.

[0064] T was introduced to replace G at the thirteenth position at the 5' end of the sequence to destroy the influence of the primer secondary structure on amplification. This design took advantage of the good compatibility of the RPA system with mismatches at the 5' end and the middle part of the sequence.

[0065] Furthermore, the specific sequence of the reverse primer (ie, B*58:01-RP) SEQ ID NO.4 is represented as: CCCAGGT CGCAGCCATACATCCTCTGGATGA.

[0066] Another aspect of the embodiments of the present invention further provides a probe for detecting the HLA-B*58:01 allele, the sequence of which is shown in SEQ ID NO.5.

[0067] Furthermore, the specific sequence of the probe (ie, B*58:01-Probe) SEQ ID NO.5 is represented by: CCGGCGAGAGCCCCAGGCGCGTTTACCCGG[FAM-dT]T[THF]CA[BHQ-dT]TTTCAGTTGAGGCC[3'-C3], that is Figure 1 'CCGGCGAGAGCCCCAGGCGCGTTTACCCGGTTTCATTTTCAGTTG AGGCC' shown in .

[0068] Among them, FAM-dT is base dT labeled with fluorescein, BHQ-dT is base dT labeled with a fluorescence quencher group, THF is tetrahydrofuran. After being cut by exonuclease III, the fluorescent group and the quencher group are separated to achieve fluorescence quantification. C3 is a 3'-end blocking group that can prevent the fluorescent probe from being extended.

[0069] In the present invention, the Rpa primer is longer than the PCR primer sequence. At the same time, the RPA amplification system is insensitive to the mismatched bases at the 5' end and the middle of the primer, but has better specificity for the mismatch near the 3' end of the primer. Amplification blocking mutations can also be introduced into the primer sequence to further improve the specificity, so the primers can be better designed according to needs.

[0070] Furthermore, the present invention realizes gene detection in a fully closed reaction system in a fully automatic manner, and the low-temperature reaction can avoid laboratory contamination caused by aerosols, without the need for a professional molecular biology laboratory and professionally trained personnel.

[0071] Another aspect of an embodiment of the present invention further provides a kit for detecting the HLA-B*58:01 allele, comprising: at least one primer set and at least one probe, wherein one primer set is the aforementioned primer set, and one probe set is the aforementioned probe.

[0072] In some preferred embodiments, the kit further comprises an internal reference primer pair and an internal reference probe, the internal reference primer pair comprising an internal reference forward primer and an internal reference reverse primer, the sequences of the internal reference forward primer and the internal reference reverse primer are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively, and the sequence of the internal reference probe is shown in SEQ ID NO.8.

[0073] Furthermore, the present invention designs a pair of internal reference primers and a fluorescent probe according to the GAPDH gene sequence:

[0074] Specifically, the specific sequence of the internal reference forward primer (ie, GAPDH-FP) SEQ ID NO.6 is represented by: CCGGGAAACTGTGGCGTGATGGCCGCGG.

[0075] Specifically, the specific sequence of the internal reference reverse primer (ie, GAPDH-RP) SEQ ID NO.7 is represented by: GGTGGAGGAGTGGGTGTCGCTGTTGAAGTC.

[0076] Specifically, the specific sequence of the internal reference probe (ie, GAPDH-probe) SEQ ID NO.8 is represented by: AGCTGAACGGGAAGCTCACTGGCATGGCCT[FAM-dT]C[THF]G[BHQ-dT]GTCCCCACTGCCAAC[3'-C3], that is, AGCTGAACGGGAAGCTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAAC.

[0077] Among them, FAM-dT is the base dT labeled with fluorescein, BHQ-dT is the base dT labeled with a fluorescence quencher group, THF is tetrahydrofuran, after being cut by exonuclease III, the fluorescent group and the quencher group are separated to achieve fluorescence quantification, and C3 is the 3' end blocking group, which can prevent the fluorescent probe from being extended.

[0078] Another aspect of the embodiments of the present invention further provides a microfluidic chip, which includes a cover layer, a substrate layer and a control layer arranged in sequence along a set direction;

[0079] The substrate layer includes a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a microchannel at least for connecting the chambers, and a control valve disposed between the chambers, wherein the nucleic acid extraction chamber is at least used to extract nucleic acid from a sample to be detected, the mixing chamber is at least used to store an RPA freeze-dried reagent and mix the RPA freeze-dried reagent with the extracted nucleic acid, and the reaction chamber is at least used to store a primer set and a probe for detecting the HLA-B*58:01 allele and perform an isothermal amplification reaction with the RPA freeze-dried reagent in the mixing chamber and the extracted nucleic acid;

[0080] The control layer includes a first control unit, a second control unit and a third control unit. The first control unit is arranged above the nucleic acid extraction chamber, at least for providing pressure to drive the liquid to flow between the chambers. The second control unit is arranged above the control valve, at least for closing or opening the control valve. The third control unit is arranged above the outlet connected to the reaction chamber, at least for discharging the liquid in the reaction chamber.

[0081] In some embodiments, the first control unit includes a porous membrane and a dome disposed on the surface of the porous membrane, and at least a dome pressure chamber for driving liquid to flow between the chambers is formed between the dome and the porous membrane.

[0082] In some embodiments, the material of the dome includes soft materials such as silicone, TPE or TPU that can deform under pressure to drive liquid, but is not limited thereto.

[0083] Furthermore, the porous membrane is a breathable and water-impermeable membrane, and the material of the porous membrane includes polytetrafluoroethylene (PTFE) and other materials, but is not limited thereto.

[0084] In some embodiments, the second control unit is disposed on a control valve seat of the substrate layer.

[0085] Furthermore, the second control unit includes a soft material membrane, which can at least be stretched and deformed under pressure, so as to control the state of the control valve. The second control unit is made of soft material, which can include silicone membrane, latex membrane, and also includes thermoplastic material films such as polycarbonate (PC) with certain ductility, which can be stretched and deformed under pressure.

[0086] Furthermore, the third control unit includes a porous membrane, and the porous membrane is a breathable and water-impermeable membrane. The material of the porous membrane includes polytetrafluoroethylene PTFE and other materials, but is not limited thereto.

[0087] Furthermore, the cover layer is attached or bonded to the substrate layer, thereby forming a nucleic acid extraction chamber, a mixing chamber, a reaction chamber and a microchannel.

[0088] Furthermore, the thickness of the substrate layer is 0.3-10 mm.

[0089] Furthermore, the thickness of the cover layer is 0.01-0.5 mm.

[0090] In some embodiments, a first control valve is disposed between the nucleic acid extraction chamber and the mixing chamber, and a second control valve is disposed between the mixing chamber and the reaction chamber.

[0091] In summary, the present invention proposes a microfluidic chip that can extract and elute nucleic acids from FTA samples and perform RPA isothermal amplification, and its characteristics include three micro-reaction chambers, namely a nucleic acid extraction chamber, a mixing chamber and an RPA reaction chamber. The nucleic acid extraction chamber is used to receive FTA cards that have collected samples such as blood, throat swabs or saliva and elute nucleic acids by heating; the mixing chamber stores RPA freeze-dried reagents and mixes with the eluted nucleic acids; the RPA reaction chamber stores freeze-dried sequence-specific primers and probes and performs isothermal amplification reactions.

[0092] The FTA card uses the patented FTA technology of Whatman (now part of GE Healthcare) to collect and capture DNA in a simple one-step process. The FTA card contains unique chemicals that can lyse cells, denature proteins and effectively protect nucleic acids from nucleases, oxidants and ultraviolet damage. The captured nucleic acids can be used in various downstream applications, making the operation and processing of nucleic acids simple.

[0093] Another aspect of the embodiments of the present invention further provides a portable control device, which cooperates with the microfluidic chip to complete the detection of the HLA-B*58:01 allele, and the portable control device is controlled by a single-chip microcomputer, and includes a liquid and flow control unit, a thermal management and temperature control unit, and a fluorescence excitation and collection unit;

[0094] Wherein, the liquid and flow path control unit comprises:

[0095] A liquid driving component, which is at least used to squeeze the dome pressure chamber of the microfluidic chip to drive the flow of liquid;

[0096] A control valve control assembly, which is used at least to squeeze the second control unit to close or open the control valve;

[0097] The thermal management and temperature control unit comprises:

[0098] A first heating component, which is used at least to heat and make the nucleic acid extraction chamber reach a temperature required for nucleic acid elution;

[0099] A second heating component, which is used at least to heat and make the reaction chamber reach the temperature required for the RPA reaction;

[0100] The fluorescence excitation and acquisition unit comprises a fluorescence excitation component and a fluorescence image acquisition component.

[0101] Furthermore, the liquid drive assembly and the control valve control assembly include linear motors.

[0102] Furthermore, the liquid and flow control unit includes three linear motors: the first linear motor drives the sequential flow of liquid between the mixing chamber and the reaction chamber by squeezing the dome pressure chamber on the microfluidic chip; the second linear motor controls the microvalve (i.e., the first control valve) between the sample extraction chamber and the mixing chamber, which closes the microvalve by squeezing the soft material membrane above the microvalve seat by moving downward, or opens the microvalve by moving upward to separate from the soft material membrane; the third linear motor controls the microvalve (i.e., the second control valve) between the mixing chamber and the RPA reaction chamber, which closes the microvalve by squeezing the soft material membrane above the microvalve seat by moving downward, or opens the microvalve by moving upward to separate from the soft material membrane.

[0103] Furthermore, the first heating component includes an infrared LED heating component.

[0104] Furthermore, the thermal management and temperature control unit includes two parts: the first part is to heat the liquid in the nucleic acid extraction chamber through an infrared LED heating component below the nucleic acid extraction chamber to provide the temperature required for nucleic acid elution, and the temperature range is 80°C-98°C; the second part is a heating and temperature unit below the RPA reaction chamber, which provides the optimal reaction temperature of 37°C-42°C for the RPA reaction.

[0105] In some preferred embodiments, the fluorescence excitation component includes an LED light source and an excitation filter, and the LED light source is arranged above the excitation filter.

[0106] In some preferred embodiments, the fluorescent image acquisition component includes a CCD component and an emission filter, and the CCD component is arranged above the emission filter.

[0107] Furthermore, the liquid and flow path control unit, the heat management and temperature control unit and the fluorescence excitation and collection unit are all controlled by a control center, and the control center includes a single chip microcomputer.

[0108] Furthermore, the LED light source, excitation filter and emission filter are selected according to the wavelength of the dye used by the fluorescent probe.

[0109] Another aspect of the embodiments of the present invention further provides a detection system for HLA-B*58:01 allele, comprising:

[0110] The aforementioned kit for detecting the HLA-B*58:01 allele;

[0111] RPA reaction system;

[0112] The aforementioned microfluidic chip; and

[0113] The aforementioned portable control device.

[0114] In the present invention, the RPA reaction system, microfluidic chip and portable control device constitute a complete integrated HLA-B*58:01 allele detection system. After adding the sample, the detection is completed by one-button full-automatic operation. After the FTA sample is added, the dome pressure chamber is covered to form a fully enclosed microfluidic chip reactor, and the amplification product is enclosed in the microfluidic chip, which will not cause laboratory contamination.

[0115] Another aspect of the embodiments of the present invention further provides the use of the aforementioned primer set, probe, and kit for detecting the HLA-B*58:01 allele in the preparation of a product for detecting the HLA-B*58:01 allele.

[0116] Furthermore, the method for detecting HLA-B*58:01 allele using the product is mainly implemented based on the aforementioned HLA-B*58:01 allele detection system, and the detection method comprises:

[0117] The sample to be tested is placed in the nucleic acid extraction chamber of the microfluidic chip, the RPA freeze-dried reagent is placed in the mixing chamber, and the kit for detecting the HLA-B*58:01 allele is placed in the reaction chamber;

[0118] Using a first heating component of a portable control device to heat the nucleic acid extraction chamber, and eluting the sample to be detected to obtain extracted nucleic acid;

[0119] The liquid driving component of the portable control device is used to squeeze the dome pressure chamber of the microfluidic chip, and the first control valve is opened at the same time, so as to drive the nucleic acid into the mixing chamber and mix with the RPA freeze-dried reagent;

[0120] The liquid driving component continues to squeeze the dome pressure chamber of the microfluidic chip, and at the same time, the second control valve is opened, so as to drive the nucleic acid and the RPA freeze-dried reagent into the reaction chamber and mix with the primer set and the probe for detecting the HLA-B*58:01 allele;

[0121] The second heating component of the portable control device is used for heating to increase the temperature in the reaction chamber for RPA reaction, and

[0122] The RPA reaction products were detected using the fluorescence excitation and acquisition unit of a portable control device.

[0123] Furthermore, the samples to be tested include samples such as throat swabs, blood or saliva collected by FTA cards, but are not limited thereto.

[0124] Furthermore, the elution temperature is 80-98°C, and the RPA reaction temperature is 37-42°C.

[0125] Furthermore, the detection method includes: real-time monitoring and collecting the light intensity of the RPA reaction product, and analyzing the result through an amplification curve of the fluorescence intensity changing with time.

[0126] Furthermore, the collection time is 15 to 40 minutes.

[0127] The detection method of the HLA-B*58:01 allele of the present invention comprises: after collecting a throat swab or a blood sample with an FTA card, adding a microfluidic chip, fully automatically completing the extraction and elution of the genomic DNA of the sample to be tested, using three pairs of specific primers, a pair of internal reference primers and corresponding fluorescent probes, placing in a 37°C-42°C environment for isothermal amplification, real-time monitoring and collecting fluorescence intensity, and analyzing the results through an amplification curve of fluorescence intensity changing over time. After genomic DNA is extracted and purified from samples such as blood samples, throat swabs or saliva, isothermal nucleic acid amplification is performed, and no thermal cycle reaction is required, and amplification in a PCR instrument is not required. It has the advantages of high sensitivity, strong specificity, simple reaction procedure, short detection time, etc. The present invention is fast, low-cost, and has wide promotion value.

[0128] The following will describe the technical solutions in the embodiments of the present invention in detail in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0129] See also Figure 2 As shown, a microfluidic chip provided in a specific embodiment of the present invention can perform nucleic acid extraction and elution from FTA samples and RPA isothermal amplification, and its structure is mainly divided into three layers: a cover layer 100, a substrate layer 200 and a control layer 300.

[0130] Among them, the middle layer is the substrate layer 200, which includes three micro-reaction chambers (i.e., nucleic acid extraction chamber 201, mixing chamber 202 and reaction chamber 203), microchannels 204 connecting each micro-reaction chamber, and valve seats of control valves (i.e., first control valve 205, second control valve 206), and the thickness of the substrate layer is generally 0.3mm to 10mm. The nucleic acid extraction chamber 201 is used to receive FTA cards with samples such as blood, throat swabs or saliva collected and heat to elute nucleic acids; the mixing chamber 202 stores RPA freeze-dried reagents and mixes with the eluted nucleic acids; the RPA reaction chamber stores freeze-dried sequence-specific primers and probes and performs isothermal amplification reactions.

[0131] After the cover layer 100 of the microfluidic chip is attached or bonded to the substrate layer 200, a closed micro reaction chamber and micro channel are formed. The thickness of the cover layer is generally 0.01 mm to 0.5 mm.

[0132] The control layer 300 includes three parts: the first control unit is at least used to provide pressure for driving the liquid to flow between the chambers, which includes a porous membrane 302 and a dome 301 arranged on the surface of the porous membrane 302. At least a dome pressure chamber for driving the liquid to flow between the chambers is formed between the dome 301 and the porous membrane 302, which can be deformed under pressure to drive the liquid. The dome 301 can be made of soft materials such as silicone, TPE and TPU, and the porous membrane 302 is a breathable and water-tight membrane made of materials such as PTFE; the second control unit is at least used to close or open the first control valve 205 and the second control valve 206, which can be a soft material membrane 303, which covers the valve seat of the substrate layer 200 of the microfluidic chip, and can be stretched and deformed under pressure to close the first control valve 205 and the second control valve 206; the third control unit is a breathable and water-tight porous membrane 304, such as a membrane made of PTFE material, which can discharge the liquid originally occupying the reaction chamber during the filling process of the reaction chamber 203.

[0133] See also Figure 3 As shown, a portable control device provided in a specific embodiment of the present invention cooperates with a microfluidic chip to complete the detection of the HLA-B*58:01 allele. The portable control device is controlled by a single-chip microcomputer, and its main functional units include: a liquid and flow control unit, a thermal management and temperature control unit, and a fluorescence excitation and collection unit.

[0134] The liquid and flow path control unit includes three linear motors, namely, the first linear motor 401 drives the liquid to flow sequentially between the mixing chamber 202 and the reaction chamber 203 by squeezing the dome pressure chamber on the microfluidic chip; the second linear motor 402 controls the microvalve (i.e., the first control valve 205 and the second control valve 206) between the nucleic acid extraction chamber 201 and the mixing chamber 202, and closes the microvalve by squeezing the soft material membrane 303 above the control microvalve seat by moving downward, or opens the microvalve by moving upward to separate from the soft material membrane 303; the third linear motor 403 controls the microvalve between the mixing chamber 202 and the RPA reaction chamber 203, and closes the microvalve by squeezing the soft material membrane 303 above the control microvalve seat by moving downward, or opens the microvalve by moving upward to separate from the soft material membrane 303.

[0135] The thermal management and temperature control unit includes two parts: the first heating component is to heat the liquid in the nucleic acid extraction chamber through the infrared LED heating component 404 below the nucleic acid extraction chamber 201, providing the temperature required for nucleic acid elution, and the temperature range is 80°C-98°C; the second heating component is the heating and temperature control component 405 below the RPA reaction chamber, providing the optimal reaction temperature of 37°C-42°C for the RPA reaction.

[0136] The fluorescence excitation and collection includes a fluorescence excitation component and a fluorescence image collection component. The fluorescence excitation component includes a fluorescence excitation component part composed of an LED light source 406a and an excitation filter 406b; the fluorescence image collection component includes a fluorescence image collection part composed of an emission filter 407b and a CCD component 407a. The LED light source, the excitation filter and the emission filter are selected according to the dye wavelength used by the fluorescent probe.

[0137] A method for detecting the HLA-B*58:01 allele provided in a specific embodiment of the present invention comprises:

[0138] (a) placing the FTA membrane to be detected into the nucleic acid extraction chamber 201 of the microfluidic chip;

[0139] (b) turning on the first heating component, namely the infrared LED heating component 404, to heat and elute the genomic nucleic acid;

[0140] (c) The first linear motor 401 squeezes the dome pressure chamber, and at the same time the first control valve 205 opens, so that the liquid in the nucleic acid extraction chamber 201 fills the mixing chamber 202, and the liquid dissolves the freeze-dried RPA reagent;

[0141] (d) The first linear motor 401 continues to squeeze the dome pressure chamber, and at the same time the second control valve 206 opens, and the freeze-dried primers, probes and magnesium acetate are mixed with the RPA reaction solution;

[0142] (e) The second control valve 206 is closed, and the second heating component, namely the heating and temperature control component 405, is heated to control the RPA reaction temperature in the reaction chamber 203 to be 37-42° C., and finally the RPA reaction product is detected by the fluorescence excitation and collection unit.

[0143] Example 1 Throat swab sample collection

[0144] Oral cells of patients were collected using a pharyngeal swab sample collection card (FTA Buccal Collection Kit, P / N: WB120239, GE Healthcare). The specific method was as follows: (a) Patients could not eat for 30 minutes before sampling; (b) Patient information was filled in on the collection card; (c) After rinsing the mouth with clean water, first place the sampling stick under the tongue, dip it in saliva, and then wipe one side of the sampling stick on the left side of the mouth for 30 seconds, and wipe the other side of the sampling stick on the right side of the mouth for 30 seconds; (d) Press the flat surface of the sponge head into the sample area of ​​the collection card to allow the sample to be fully absorbed; then turn the sponge head over and place it on the sample area of ​​the collection card and press repeatedly; (e) Leave the collection card at room temperature for 1 hour until it is completely dry.

[0145] Example 2 Fingertip blood sample collection

[0146] Use a blood sample collection card (FTA blood sample collection kit, P / N: WB120238, GE Healthcare) to collect blood from the patient's fingertips. The specific method is as follows: (a) Fill in the patient information on the collection card; (b) Disinfect the blood collection site with medical alcohol; (c) Insert the tip of the medical blood collection needle into the blood collection site, squeeze the blood collection site to make blood flow out to form blood drops; (d) The blood naturally seeps into the sample area of ​​the collection card. Be careful not to let the sample area directly contact the blood; (e) Use a dry cotton ball to gently press the blood collection site to stop bleeding; (f) Leave the collection card to dry at room temperature.

[0147] Example 3 Microfluidic Chip Fabrication

[0148] The microfluidic chip substrate layer containing micro-reaction chambers, microchannels and control valve seats is manufactured by double-sided hot molding or injection molding. The substrate layer is made of PMMA and has a thickness of 4 mm. The diameter of the nucleic acid extraction chamber is 6 mm, the depth is 4 mm (perforated), and the volume is 113 μL; the diameter of the mixing chamber is 6 mm, the depth is 1.8 mm, and the volume is 50 μL; the RPA reaction chamber is 4 microcavities with a diameter of 4.6 mm, a depth of 0.6 mm, and a volume of 10 μL. The valve seat has a diameter of 6 mm, a depth of 0.1 mm, and a maximum dead volume of 2.8 μL. The width of the microchannel is 0.5 mm and the depth is 0.1 mm.

[0149] The cover layer of the microfluidic chip is an optical film coated with a pressure-sensitive adhesive. Before applying pressure to seal the microchannel and reaction chamber, sequence-specific primers, fluorescent probes and magnesium acetate are first added to the RPA reaction chamber and heated to dryness; then The exo lyophilized reagent (which can be dissolved in water to form a 50 μL reaction system) is added to the mixing chamber; finally, it is sealed with a pressure-sensitive optical film.

[0150] The soft membrane used for microvalve opening and closing control is a PDMS membrane with a thickness of 0.2 mm. It is pasted on the microfluidic chip substrate layer with double-sided pressure-sensitive adhesive. The double-sided pressure-sensitive adhesive area corresponding to the microvalve seat is removed with a knife. The dome pressure chamber is injection molded with a TPE material with a hardness of 50 after heating, and the bottom is pasted with a PTFE porous membrane with a double-sided pressure-sensitive adhesive. The PTFE porous membrane is pasted with a double-sided pressure-sensitive adhesive at the outlet of the reaction chamber.

[0151] Example 4 HLA-B*58:01 allele detection process

[0152] The detection process of HLA-B*58:01 allele in this embodiment is as follows Figure 4a-4e As shown in (a), a small piece of FTA membrane with a diameter of about 3 mm is taken and placed in the nucleic acid extraction chamber of the microfluidic chip, and about 100 μL of sterile water (such as Figure 4a); (b) turn on the 850nm infrared laser tube to heat for 15 minutes to elute the genomic nucleic acid (such as Figure 4b ); (c) The first linear motor squeezes the soft material cap, i.e., the dome pressure chamber, and at the same time, the first control valve opens, and about 50 μL of liquid fills the mixing chamber, and the liquid dissolves the freeze-dried RPA reagent (such as Figure 4c ); (d) the first linear motor continues to squeeze the dome pressure chamber, and at the same time the second control valve is opened, and the freeze-dried primers, probes and magnesium acetate are mixed with the RPA reaction solution (such as Figure 4d ); (e) the second control valve is closed, the reaction temperature is controlled at 37-42°C, and the fluorescence is collected for 15-40 minutes (such as Figure 4e ), wherein this step is fluorescence collection at 510nm and excitation at 470nm. Only step (a) requires manual operation, which takes 2 minutes, and the following steps are automatically completed within 1 hour under the control of the single-chip microcomputer.

[0153] Example 5 HLA-B*58:01 allele detection results

[0154] Saliva samples were collected from 10 gout patients according to the method of Example 1. According to the detection process of Example 4, the detection results showed that there was 1 HLA-B*58:01 positive patient. The fluorescence intensity changed with time as shown in Figure 5a As shown, another patient was selected and the test results were as follows Figure 5b As shown. After PCR cloning sequencing and sequence comparison, the two patients were HLA-B*58:01 / HLA-B*52:01 heterozygotes and HLA-B*51:01 homozygotes, respectively. The above results show that the detection results obtained according to the embodiment of the present invention are consistent with the sequencing results.

[0155] In summary, through the above technical scheme, the present invention extracts and purifies genomic DNA from the sample to be tested, and then performs isothermal nucleic acid amplification, which does not require thermal cycling reaction and does not need to be amplified in a PCR instrument. It has the advantages of high sensitivity, strong specificity, simple reaction procedure, and short detection time. This method introduces RPA reaction internal control to meet the requirements of clinical testing to ensure the authenticity and accuracy of the detection reaction; and the detection process is fast and low-cost.

[0156] The various aspects, embodiments, features and examples of the present invention should be considered as illustrative in all aspects and are not intended to limit the present invention, the scope of the present invention is defined only by the claims. Other embodiments, modifications and uses will be apparent to those skilled in the art without departing from the spirit and scope of the claimed invention.

[0157] The use of headings and sections in this disclosure is not meant to limit the disclosure; each section may apply to any aspect, embodiment, or feature of the disclosure.

[0158] Throughout this disclosure, where a composition is described as having, containing, or including particular components, or where a process is described as having, containing, or including particular process steps, it is contemplated that the compositions taught by the present invention also consist essentially of or consist of the recited components, and that the processes taught by the present invention also consist essentially of or consist of the recited process steps.

[0159] It should be understood that the order of the various steps or the order in which a particular action is performed is not very important, as long as the teachings of the present invention remain operable. In addition, two or more steps or actions may be performed simultaneously.

[0160] In addition, the inventors of this case also referred to the aforementioned embodiments and conducted experiments with other raw materials, process operations, and process conditions described in this specification, and obtained relatively ideal results.

[0161] Although the present invention has been described with reference to illustrative embodiments, it will be appreciated by those skilled in the art that various other changes, omissions and / or additions may be made and that elements of the described embodiments may be substituted with substantial equivalents without departing from the spirit and scope of the present invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the present invention without departing from the scope of the present invention. Therefore, it is not intended herein to limit the present invention to the specific disclosed embodiments for carrying out the present invention, but rather it is intended that the present invention will include all embodiments within the scope of the appended claims. Sequence Listing <110> Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences <120> Primer set, probe, microfluidic chip, detection method and system for detecting HLA-B*58:01 allele <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 31 <212> DNA <213> Artificial sequence (artificial sequence) <400> 1 atagagcagg aggggccgga gtattgggac g 31 <210> 2 <211> 31 <212> DNA <213> Artificial sequence (artificial sequence) <400> 2 ccgcgcagac ttaccgagag aacctgccga t 31 <210> 3 <211> 28 <212> DNA <213> Artificial sequence (artificial sequence) <400> 3 cccgagtctc cgtgtccgag atccgcct 28 <210> 4 <211> 31 <212> DNA <213> Artificial sequence (artificial sequence) <400> 4 cccaggtcgc agccatacat cctctggatg a 31 <210> 5 <211> 50 <212> DNA <213> Artificial sequence (artificial sequence) <400> 5 ccggcgagag ccccaggcgc gtttacccgg tttcattttc agttgaggcc 50 <210> 6 <211> 28 <212> DNA <213> Artificial sequence (artificial sequence) <400> 6 ccgggaaact gtggcgtgat ggccgcgg 28 <210> 7 <211> 30 <212> DNA <213> Artificial sequence (artificial sequence) <400> 7 ggtggaggag tgggtgtcgc tgttgaagtc 30 <210> 8 <211> 50 <212> DNA <213> Artificial sequence (artificial sequence) <400> 8 agctgaacgg gaagctcact ggcatggcct tctgtgtccc cactgccaac 50

Claims

1. A microfluidic chip, characterized in that It includes a cover layer, a base layer and a control layer which are sequentially arranged along a set direction; The substrate layer includes a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a microchannel at least for connecting the chambers, and a control valve disposed between the chambers, wherein the nucleic acid extraction chamber is at least used to extract nucleic acid from a sample to be detected, the mixing chamber is at least used to store an RPA freeze-dried reagent and mix the RPA freeze-dried reagent with the extracted nucleic acid, and the reaction chamber is at least used to store a primer set and a probe for detecting the HLA-B*58:01 allele and perform an isothermal amplification reaction with the RPA freeze-dried reagent in the mixing chamber and the extracted nucleic acid; The cover layer and the substrate layer are bonded or bonded to form a nucleic acid extraction chamber, a mixing chamber, a reaction chamber and a microchannel; a first control valve is provided between the nucleic acid extraction chamber and the mixing chamber, and a second control valve is provided between the mixing chamber and the reaction chamber; The control layer includes a first control unit, a second control unit and a third control unit. The first control unit is arranged above the nucleic acid extraction chamber, at least for providing pressure to drive the liquid to flow between the chambers. The first control unit includes a porous membrane and a dome arranged on the surface of the porous membrane. At least a dome pressure chamber for driving the liquid to flow between the chambers is formed between the dome and the porous membrane; the second control unit is arranged above the control valve, at least for closing or opening the control valve, the second control unit is covered on the control valve seat of the substrate layer, the second control unit is a soft material membrane, at least capable of stretching and deforming under pressure, so as to control the state of the control valve; the material of the second control unit is selected from silicone membrane, latex membrane or polycarbonate; the third control unit is arranged above the outlet connected to the reaction chamber, at least for discharging the liquid in the reaction chamber, the third control unit is a porous membrane, the porous membrane is a breathable and water-impermeable membrane, and the material of the porous membrane is polytetrafluoroethylene.

2. The microfluidic chip according to claim 1, characterized in that: The material of the dome is selected from silicone, TPE or TPU.

3. The microfluidic chip according to claim 1, characterized in that: The thickness of the substrate layer is 0.3-10 mm.

4. The microfluidic chip according to claim 1, characterized in that: The thickness of the cover sheet layer is 0.01-0.5 mm.

5. A portable control device, used in conjunction with the microfluidic chip according to any one of claims 1 to 4, characterized in that It includes a liquid and flow control unit, a thermal management and temperature control unit, and a fluorescence excitation and collection unit; Wherein, the liquid and flow path control unit comprises: A liquid driving component, which is at least used to squeeze the dome pressure chamber of the microfluidic chip to drive the flow of liquid; A control valve control assembly, which is used at least to squeeze the second control unit to close or open the control valve; The thermal management and temperature control unit comprises: The first heating component is an infrared LED heating component, which is used at least to heat and make the nucleic acid extraction chamber reach the temperature required for nucleic acid elution; A second heating component, which is used at least to heat and make the reaction chamber reach the temperature required for the RPA reaction; The fluorescence excitation and acquisition unit includes a fluorescence excitation component and a fluorescence image acquisition component. The fluorescence excitation component includes an LED light source and an excitation filter. The LED light source is arranged above the excitation filter. The fluorescence image acquisition component includes a CCD component and an emission filter. The CCD component is arranged above the emission filter.

6. The portable control device according to claim 5, characterized in that: The liquid drive component and the control valve control component are linear motors.

7. The portable control device according to claim 5, characterized in that: The liquid and flow path control unit, the heat management and temperature control unit and the fluorescence excitation and collection unit are all controlled by a control center.

8. The portable control device according to claim 7, characterized in that: The control center is a single chip microcomputer.

9. A detection system for HLA-B*58:01 allele, characterized in that include: A kit for detecting HLA-B*58:01 alleles, comprising at least one primer set and at least one probe, wherein one primer set is a primer set for detecting HLA-B*58:01 alleles, comprising: a first primer pair comprising a first forward primer and a reverse primer; a second primer pair comprising a second forward primer and a reverse primer; a third primer pair comprising a third forward primer and a reverse primer; Wherein, the sequences of the first forward primer, the second forward primer, and the third forward primer are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the sequence of the reverse primer is shown as SEQ ID NO.4; A probe set is a probe for detecting HLA-B*58:01 allele, and the sequence of the probe is shown in SEQ ID NO.5; RPA reaction system; The microfluidic chip according to any one of claims 1 to 4; and The portable control device according to any one of claims 5 to 8.

10. Use of the HLA-B*58:01 allele detection system according to claim 9 in preparing a product for detecting the HLA-B*58:01 allele, wherein the method for detecting the HLA-B*58:01 allele using the product comprises: The sample to be tested is placed in the nucleic acid extraction chamber of the microfluidic chip, the RPA freeze-dried reagent is placed in the mixing chamber, and the kit for detecting the HLA-B*58:01 allele is placed in the reaction chamber; Using a first heating component of a portable control device to heat the nucleic acid extraction chamber, and eluting the sample to be detected to obtain extracted nucleic acid; The liquid driving component of the portable control device is used to squeeze the dome pressure chamber of the microfluidic chip, and the first control valve is opened at the same time, so as to drive the nucleic acid into the mixing chamber and mix with the RPA freeze-dried reagent; The liquid driving component continues to squeeze the dome pressure chamber of the microfluidic chip, and at the same time, the second control valve is opened, so as to drive the nucleic acid and the RPA freeze-dried reagent into the reaction chamber and mix with the primer set and the probe for detecting the HLA-B*58:01 allele; The second heating component of the portable control device is used for heating to increase the temperature in the reaction chamber for RPA reaction, and The RPA reaction products were detected using the fluorescence excitation and acquisition unit of a portable control device.

11. The use according to claim 10, characterized in that: The sample to be tested is selected from a throat swab, blood or saliva sample collected by an FTA card.

12. The use according to claim 10, characterized in that: The elution temperature is 80-98°C.

13. The use according to claim 10, characterized in that: The temperature of the RPA reaction is 37-42°C.

14. The use according to claim 10, characterized in that The detection method comprises: real-time monitoring and collecting the light intensity of the RPA reaction product, and analyzing the result through an amplification curve of the fluorescence intensity changing with time.

15. The use according to claim 14, characterized in that: The collection time is 15 to 40 minutes.

Images