Methods and compositions for preparing polynucleotides

Abstract

Provided herein are methods, compositions, and kits for forming amplification products. In various embodiments provided herein, a transposome comprising a transposase is used to form tagged polynucleotides for use in downstream amplification and polynucleotide processing steps.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application Serial No. 62 / 663,967, filed on April 27, 2018, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy was created on April 23, 2019, is named 53081-702_601_SL.txt, and is 1,176 bytes in size. Background Art

[0005] For example, in the generation of sequencing libraries, transposase-mediated fragmentation and tagmentation of polynucleotides can be used in the preparation of polynucleotides. The advantages provided by tagmentation are sample preparation and workflow simplification, wherein the polynucleotides to be sequenced can be fragmented and tagged in a single reaction. These generated polynucleotides can be further amplified and / or sequence-specifically selected before sequencing. The sequence information of polynucleotides can be used to identify sequence variants for diagnosis, treatment, forensic identification, and many other applications.

[0006] Simple and rapid sample preparation can be used to analyze polynucleotide samples. Polynucleotide samples can be processed in parallel or in batches, for example, in a high-throughput multiplexing manner. However, existing methods for preparing nucleic acid samples are often plagued by many disadvantages. These include low yields and the need for large amounts of starting material. Summary of the invention

[0007] In view of the above, there is a need for improved methods for processing polynucleotides. The methods, compositions, reaction mixtures and kits provided herein meet this need and also provide additional advantages.

[0008] In one aspect, the present disclosure provides a method for characterizing polynucleotides in a sample. The method includes (a) contacting double-stranded polynucleotides in the sample with a first group of transposome complexes, the first group comprising transposome complexes having a first transposon sequence to produce a first plurality of overhanging end fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhanging end fragments to an extension reaction to produce a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to produce copies of the first plurality of blunt-end fragments or fragments thereof; (d) contacting the first plurality of blunt-end fragments or fragments thereof with a second group of transposome complexes, the second group comprising transposome complexes having a second transposon sequence to produce a second plurality of overhanging end fragments comprising the second transposon sequence at the 5' end; (e) subjecting the second plurality of overhanging end fragments to an additional extension reaction to produce a second plurality of blunt-end fragments; and (f) generating sequence reads from the second plurality of blunt-end fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotides in the sample. In some embodiments, the first transposon sequence and the second transposon sequence are not identical. In some embodiments, the second group further comprises a transposome complex having a first transposon sequence. In some embodiments, the second group further comprises a transposome complex having a third transposon sequence.

[0009] In one aspect, the present disclosure provides a method for characterizing polynucleotides in a sample, comprising: (a) contacting double-stranded polynucleotides in the sample with a first group of transposome complexes, each of which comprises a first transposon sequence, to generate a first plurality of overhang fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhang fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to generate copies of the first plurality of blunt-end fragments or fragments thereof; (d) contacting the first plurality of blunt-end fragments or fragments thereof with a second group of transposome complexes, each of which comprises a second transposon sequence; Sequences are prepared to generate a second plurality of overhang fragments comprising the second transposon sequence at the 5' end, wherein the first group of transposome complexes and the second group of transposome complexes differ in that: (i) the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes; and / or (ii) one group of transposome complexes used in step (a) or (d) is a homodimeric transposome, while the other group of transposome complexes used is a heterodimeric transposome; (e) subjecting the second plurality of overhang fragments to an additional extension reaction to generate a second plurality of blunt-end fragments; and (f) generating sequence reads from the second plurality of blunt-end fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotides in the sample. In some embodiments, the first group of transposome complexes and the second group of transposome complexes differ in that the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes. In some embodiments, the first set of transposome complexes and the second set of transposome complexes differ in that one set of transposome complexes used in step (a) or (d) are homodimeric transposomes and the other set of transposome complexes used are heterodimeric transposomes.

[0010] In some embodiments, step (d) comprises contacting the first plurality of blunt-ended fragments or fragments thereof with at least two additional sets of transposome complexes, wherein each of the additional sets of transposome complexes comprises a homodimeric transposome, and wherein the transposon sequence of each set is unique.

[0011] In some embodiments, the double-stranded polynucleotide comprises genomic DNA. In some embodiments, the genomic DNA is from a single cell. In some embodiments, the double-stranded polynucleotide comprises a chromosome. In some embodiments, the double-stranded polynucleotide is from a single cell.

[0012] In some embodiments, characterizing the double-stranded polynucleotides produces haplotype information. In some embodiments, characterizing the double-stranded polynucleotides comprises identifying structural variations in the polynucleotides, wherein the structural variations are copy number variations (CNVs), insertions, deletions, translocations, retrotransposons, inversions, rearrangements, repeat expansions, or duplications.

[0013] In some embodiments, the double-stranded polynucleotide is at least about 1 megabase (Mb) in length.

[0014] In some embodiments, the first plurality of blunt-ended fragments includes fragments that are at least about 500 bases in length.

[0015] In some embodiments, the second plurality of blunt-ended fragments includes fragments that are at least about 100 bases in length.

[0016] In some embodiments, each single-stranded polynucleotide of the first plurality of blunt-ended fragments forms a stem-loop structure. In some embodiments, the stem-loop structure comprises a stem having a length of at least 10 base pairs. In some embodiments, the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C.

[0017] In some embodiments, the method further comprises attaching sequencing adapters to the second plurality of blunt-ended fragments to produce derivatives thereof.

[0018] In some embodiments, each transposome complex of the first and / or second group comprises a transposase selected from the group consisting of Tn transposase, MuA transposase, and Vibhar transposase. In some embodiments, the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10.

[0019] In one aspect, the present disclosure provides a method for identifying low-frequency alleles. The method comprises: (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhanging end fragments comprising the transposon sequence at the 5' end; (b) subjecting the plurality of overhanging end fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a reverse complementary sequence of the first barcode sequence at the 3' end and comprising the second barcode sequence (X2) at the 5' end; (e) generating sequence reads from the second plurality of barcoded polynucleotides or derivatives thereof to generate a plurality of sequence reads; and (f) identifying the low-frequency allele in the double-stranded polynucleotide when the low-frequency allele appears in the sequence reads of both the sense strand and the antisense strand of the double-stranded polynucleotide, wherein (i) the sequence reads comprising (a) the sense strand sequence X2 and X1' or (b) the antisense strand sequence X1 and the reverse complementary sequence (X2') of X2 from the 5' end to the 3' end are identified as being derived from the sense strand of the double-stranded polynucleotide, and (ii) the sequence reads comprising (a) the sense strand sequence X1 and X2' or (b) the antisense strand sequence X2 and X1' from the 5' end to the 3' end are identified as being derived from the antisense strand of the double-stranded polynucleotide.

[0020] In one aspect, the present disclosure provides a method for identifying sequence variants. The method comprises: (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhanging end fragments comprising the transposon sequence at the 5' end; (b) subjecting the plurality of overhanging end fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a reverse complementary sequence comprising the second barcode sequence (X2) at the 5' end and the first barcode sequence at the 3' end; (e) generating sequence reads from the second plurality of barcoded polynucleotides or derivatives thereof to generate a plurality of sequence reads; and (f) identifying sequence variants in the double-stranded polynucleotide compared to a reference sequence when sequence variants appear in sequence reads of both the sense strand and the antisense strand of the double-stranded polynucleotide, wherein (i) sequence reads comprising (a) sense strand sequence X2 and X1' or (b) antisense strand sequence X1 and reverse complement sequence (X2') of X2 from the 5' end to the 3' end are identified as being derived from the sense strand of the double-stranded polynucleotide, and (ii) sequence reads comprising (a) sense strand sequence X1 and X2' or (b) antisense strand sequence X2 and X1' from the 5' end to the 3' end are identified as being derived from the antisense strand of the double-stranded polynucleotide.

[0021] In some embodiments, the double-stranded polynucleotide comprises genomic DNA. In some embodiments, the genomic DNA is from a single cell. In some embodiments, the double-stranded polynucleotide comprises a chromosome. In some embodiments, the double-stranded polynucleotide comprises cell-free DNA.

[0022] In some embodiments, the double-stranded polynucleotide is at least 1 megabase (Mb) in length.

[0023] In some embodiments, the plurality of blunt-ended fragments includes fragments that are at least 100 bases in length.

[0024] In some embodiments of the methods herein, the method further comprises attaching sequencing adaptors to the second plurality of barcoded polynucleotides to produce derivatives thereof.

[0025] In some embodiments, each transposome complex comprises a transposase selected from the group consisting of a Tn transposase, a MuA transposase, and a Vibhar transposase. In some embodiments, the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10.

[0026] In some embodiments, the allele frequency of a low frequency allele in a population is less than 5%.

[0027] In some embodiments, low frequency alleles are detected with an accuracy of at least 85%.

[0028] In some embodiments, sequence variants represent less than 5% of the double-stranded polynucleotides in a nucleic acid sample.

[0029] In some embodiments, sequence variants are detected with an accuracy of at least 85%.

[0030] In some embodiments, the nucleic acid sample comprises cell-free polynucleotides.

[0031] In some embodiments, the nucleic acid sample is from a single cell.

[0032] In one aspect, the present disclosure provides a method for selectively sampling a subset of regions of a polynucleotide. The method comprises (a) contacting a double-stranded polynucleotide with a first set of transposome complexes to generate a first plurality of overhang fragments comprising a first transposon sequence or a second transposon sequence at the 5' end, wherein the first set of transposome complexes comprises a mixture of (i) a homodimeric transposase comprising the first transposon sequence and (ii) a homodimeric transposase comprising the second transposon sequence; (b) subjecting the first plurality of overhang fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) subjecting the first plurality of overhang fragments to a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to selectively generate a first plurality of blunt-end fragments comprising the first transposon sequence; (d) contacting the first plurality of blunt-ended fragments or fragments thereof comprising the first transposon sequence with a second set of transposome complexes to produce a second plurality of overhanging fragments, wherein the second set of transposome complexes comprises (i) a plurality of homodimeric transposases or (ii) a plurality of heterodimeric transposases; (e) subjecting the second plurality of overhanging fragments to an additional extension reaction to produce a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof, thereby selectively sampling a subset of regions of the double-stranded polynucleotide. In some embodiments, the second set of transposome complexes comprises a plurality of homodimeric transposases. In some embodiments, the second set of transposome complexes comprises a plurality of heterodimeric transposases.

[0033] In some embodiments, in the mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence, (i) and (ii) are present in a molar ratio of about 1:9.

[0034] In some embodiments, in the mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence, (i) and (ii) are present in a molar ratio that is not equal to 1:1.

[0035] In some embodiments, the mixture of (a) further comprises (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence. In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (i) is less than the molar concentration of (ii) and (iii). In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (ii) is less than the molar concentration of (i) and (iii).

[0036] In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (iii) is less than the molar concentrations of (i) and (ii).

[0037] In some embodiments, the first plurality of overhang fragments comprises (i) fragments comprising a first transposon sequence, (ii) fragments comprising a second transposon sequence, and (iii) fragments comprising both the first transposon sequence and the second transposon sequence, and the molar concentration of (i) is less than the molar concentration of (ii) and (iii).

[0038] In some embodiments, the double-stranded polynucleotide comprises genomic DNA. In some embodiments, the genomic DNA is from a single cell. In some embodiments, the double-stranded polynucleotide comprises a chromosome. In some embodiments, the double-stranded polynucleotide is from a single cell.

[0039] In some embodiments, the double-stranded polynucleotide is at least 1 megabase (Mb) in length.

[0040] In some embodiments, the first plurality of blunt-ended fragments includes fragments that are at least 500 bases in length.

[0041] In some embodiments, the second plurality of blunt-ended fragments includes fragments that are at least 100 bases in length.

[0042] In some embodiments, the single-stranded polynucleotides of the first plurality of blunt-ended fragments comprising (i) a first transposon sequence at the 5' end and a reverse complement of the first transposon sequence at the 3' end, or (ii) a second transposon sequence at the 5' end and a reverse complement of the second transposon sequence at the 3' end form a stem-loop structure. In some embodiments, the stem-loop structure comprises a stem having a length of at least 10 base pairs. In some embodiments, the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C.

[0043] In some embodiments of the various methods herein, the method further comprises attaching sequencing adaptors to the second plurality of blunt-ended fragments to produce derivatives.

[0044] In some embodiments, each transposome complex of the first and / or second group comprises a transposase selected from the group consisting of Tn transposase, MuA transposase, and Vibhar transposase. In some embodiments, the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10.

[0045] In one aspect, the present disclosure provides a composition for implementing any of the various embodiments provided herein. In some embodiments, the composition comprises a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence. In some embodiments, (i) and (ii) are present in a molar ratio of about 1:9. In some embodiments, (i) and (ii) are present in a molar ratio not equal to 1:1.

[0046] In some embodiments, the composition further comprises (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence. In some embodiments, the molar concentration of (i) is less than the molar concentration of (ii) and (iii). In some embodiments, the molar concentration of (ii) is less than the molar concentration of (i) and (iii). In some embodiments, the molar concentration of (iii) is less than the molar concentration of (i) and (ii).

[0047] In one aspect, the reaction mixture comprises (a) (i) a mixture of a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence; and (b) a double-stranded polynucleotide comprising genomic DNA. In some embodiments, the reaction mixture further comprises (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence.

[0048] In some embodiments, the genomic DNA is from a single cell. In some embodiments, the genomic DNA is a single chromosome.

[0049] In one aspect, the present disclosure provides a kit for performing any of the various embodiments provided herein. In some embodiments, the kit comprises: (a) a first set of transposome complexes, each of which comprises a first transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second set of transposome complexes, each of which comprises a second transposon sequence; and (d) instructions for performing any of the methods provided herein, wherein the first set of transposome complexes and the second set of transposome complexes differ in that: (i) the transposon sequences contained therein are different between the first set of transposome complexes and the second set of transposome complexes; and / or (ii) one set of transposome complexes used is a homodimeric transposome, while the other set of transposome complexes used is a heterodimeric transposome.

[0050] In some embodiments, the kit comprises: (a) transposome complexes, each transposome complex comprising a transposon sequence; (b) a first primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1); (c) a second primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2); and (d) instructions for performing any of the methods provided herein.

[0051] In some embodiments, the kit comprises: (a) a first set of transposome complexes comprising: (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and optionally (iii) a heterodimeric transposase comprising the first transposon sequence and the second transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second set of transposome complexes comprising: (i) a plurality of homodimeric transposases, or (ii) a plurality of heterodimeric transposases; and instructions for performing any of the methods provided herein.

[0052] Incorporation by reference

[0053] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The novel features of the present invention are particularly set forth in the appended claims. The features and advantages of the present invention will be better understood by reference to the following detailed description of illustrative embodiments and the accompanying drawings (also referred to herein as "figures"), in which:

[0055] Figure 1Non-limiting example methods of characterizing polynucleotides are shown.

[0056] Figure 2A Non-limiting example methods of characterizing polynucleotides are shown.

[0057] Figure 2B Non-limiting example methods of characterizing polynucleotides are shown.

[0058] Figure 3 Non-limiting example methods of characterizing polynucleotides are shown.

[0059] Figure 4 Non-limiting example methods for identifying the sense and antisense strands of a double-stranded polynucleotide are shown.

[0060] Figure 5 Non-limiting example methods for selectively sampling subsets of regions of a polynucleotide are shown.

[0061] Figure 6 Non-limiting example methods for selectively sampling subsets of regions of a polynucleotide are shown. DETAILED DESCRIPTION

[0062] Unless otherwise indicated, the practice of some methods disclosed herein employs conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA within the technical scope of the art. See, for example, Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th edition (2012); these series Current Protocols in Molecular Biology (FM Ausubel et al.); the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor (1995)), Harlow and Lane (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th edition (RI Freshney (2010)).

[0063] The terms "about" and "approximately" mean within an acceptable error range for a particular value, as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, in accordance with the practice in the art, "about" can mean within 1 or more than 1 standard deviation. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude of a value, preferably within 5 times, more preferably within 2 times. Where specific values ​​are described in the application and claims, the term "about" should be assumed to mean within an acceptable error range for that specific value unless otherwise stated.

[0064] The terms "polynucleotide", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, i.e., deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci defined according to linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure, if present, may be imparted before or after polymer assembly. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, for example by conjugation with a labeling component.

[0065] As used herein, the term "chain" refers to a nucleic acid composed of nucleotides covalently linked together by a covalent bond, such as a phosphodiester bond. In cells, DNA is usually present in a double-stranded form, and therefore has two complementary nucleic acid chains, which are referred to herein as "upper" and "lower" chains. In some cases, the complementary chains of a chromosome region may be referred to as "plus" and "minus" chains, "first" and "second" chains, "coding" and "non-coding" chains, "Watson" and "Crick" chains, or "sense" and "antisense" chains. Designating a chain as an upper or lower chain is arbitrary and does not imply any specific orientation, function or structure.

[0066] Polynucleotides may have a 5' end and a 3' end, referring to the end-to-end chemical orientation of a single strand of a polynucleotide or nucleic acid. In a single strand of a linear DNA or RNA, the chemical convention of naming carbon atoms on a nucleotide sugar ring means that there is usually a 5' end that usually includes a phosphate group attached to the 5' carbon and a 3' end that is usually not modified from a ribose-OH substituent (hydroxyl). In some cases, a polynucleotide may have an -OH substituent or hydroxyl at the 5' end, and may have a -P group or a phosphate group at the 3' end. The phosphate group attached to the 5' end allows two nucleotides to connect, such as a 5'-phosphate covalently bound to the 3'-hydroxyl of another nucleotide, forming a phosphodiester bond. Removing the 5'-phosphate can inhibit or prevent connection. The 3'-hydroxyl is also important because it is joined to the 5'-phosphate in the connection.

[0067] As used herein, the term "tag" refers to a nucleic acid molecule that provides a means for identifying a polynucleotide to which it is attached. For example, a tag may include a polynucleotide sequence that allows identification, recognition, and / or molecular or biochemical manipulation of a target polynucleotide to which it is attached (e.g., by providing a site for annealing to an oligonucleotide, which is, for example, a primer for extension by a DNA polymerase, or an oligonucleotide for capture or for a ligation reaction). The process of attaching a tag to a polynucleotide molecule is sometimes referred to herein as "tag", and a polynucleotide that has undergone tagging or includes a tag is referred to as "tagged" (e.g., "tagged polynucleotide" or "tagged fragment"). For example, a tagged polynucleotide fragment (e.g., a tagged fragment) may include a transposon with a transposon sequence as a tag.

[0068] As used herein, the term "sequence variant" refers to any sequence variation relative to one or more reference sequences. Typically, for a given individual population of a known reference sequence, sequence variants occur at a lower frequency than the reference sequence. In some cases, the reference sequence is a single known reference sequence, such as a single individual's genomic sequence. In some cases, the reference sequence is a consensus sequence formed by comparing multiple known sequences, such as a multiple individual's genomic sequence used as a reference population, or multiple sequencing reads from the polynucleotides of the same individual. In some cases, sequence variants occur at a low frequency in a population (also referred to as "rare" sequence variants). For example, sequence variants can occur at a frequency of about or less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001% or less. In some cases, sequence variants occur at a frequency of about or less than about 1%. In some cases, sequence variants occur at a frequency of about or less than about 0.1%. Sequence variants can be any variant relative to a reference sequence. Sequence variants can be composed of changes, insertions or deletions of a single nucleotide or multiple nucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides). In the case where a sequence variant comprises two or more nucleotide differences, different nucleotides can be continuous or discontinuous with each other. Non-limiting examples of sequence variant types include single nucleotide polymorphisms (SNPs), insertion and / or deletion polymorphisms (INDELs), copy number variations (CNVs), short tandem repeats (STRs), simple repeats (SSRs), variable number tandem repeats (VNTRs), amplified fragment length polymorphisms (AFLPs), insertion polymorphisms based on retrotransposons, sequence-specific amplified polymorphisms, and epigenetic marker differences (e.g., methylation differences) that can be detected as sequence variants. In some embodiments, sequence variants can refer to chromosome rearrangements, including but not limited to translocations or fusion genes.

[0069] As used herein, the term "allele" refers to any one or more alternative forms of a gene at a specific locus, all of which can be relevant to a trait or feature at a specific locus. In the diploid cells of an organism, the allele of a given gene can be located at a specific position or locus (multiple loci) on a chromosome. The sequences at these different variant sites between different alleles can be referred to as "variants," "polymorphisms," or "mutations."

[0070] When referring to alleles or sequences, the term "wild type" generally refers to the allele or sequence encoding the most common phenotype in a particular natural population. In some cases, the wild-type allele can refer to the allele with the highest frequency of occurrence in a population. In some cases, the wild-type allele or sequence refers to an allele or sequence associated with a normal state relative to an abnormal state (e.g., a disease state).

[0071] When mentioning allele or sequence, the term "mutant" or "variant" generally refers to an allele or sequence that is not encoded in the most common phenotype in a specific natural population. In some cases, mutant alleles can refer to alleles that exist with lower frequency in a colony relative to wild-type alleles. In some cases, mutant alleles or sequences can refer to alleles or sequences that are mutated from wild-type sequences to mutant sequences that present a phenotype relevant to a disease state. Mutant alleles and sequences can only differ by one base from wild-type alleles and sequences, but can also differ by as many as multiple bases. When mentioning a gene, the term mutant generally refers to one or more sequence mutations in a gene, including point mutations, single nucleotide polymorphisms (SNPs), insertions, deletions, displacements, transpositions, translocations, copy number variations, another genetic mutation, replacements or sequence variations.

[0072] As used herein, the term "allele frequency", or "frequency" when referring to alleles, generally refers to the relative frequency of alleles (such as variants of genes) in a sample, such as expressed as a fraction or percentage. In some cases, allele frequency can refer to the relative frequency of alleles (such as variants of genes) in a sample such as a cell-free nucleic acid sample or a genomic DNA sample. In some cases, allele frequency can refer to the relative frequency of alleles (such as variants of genes) in a sample. In one example, a genetic locus may include allele A or allele B. If allele A and allele B are present in a nucleic acid sample with similar concentrations, the allele frequency of the two alleles can be about 50%. If for each copy of allele A, a nucleic acid sample includes 9 copies of allele B, the allele frequency of A can be about 10%, and the allele frequency of B can be about 90%.

[0073] As used herein, the term "haplotype" refers to a combination of alleles at multiple loci, which are transmitted together on the same chromosome. A haplotype can refer to as few as two loci or entire chromosomes, depending on the number of recombination events occurring between a given locus group. A haplotype can also refer to a group of statistically related single nucleotide polymorphisms (SNPs) on a single chromatid. The term "haplotype data", also referred to as "phased data" or "ordered genetic data", refers to the data from a single chromosome in a diploid or polyploid genome, that is, the maternal or paternal copy of the separation of chromosomes in a diploid genome. As used herein, "phasing" refers to the action of determining the haploid genetic data of an individual of a given unordered diploid (or polyploid) genetic data. For a group of alleles found on a chromosome, it can refer to the action of determining which of the two genes on the allele is associated with each of two homologous chromosomes in an individual. The term "phased data" refers to the genetic data wherein haplotypes have been determined.

[0074] As used herein, the terms "hybridization" and "annealing" are generally reactions wherein one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding between the bases of the nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may include two chains forming a duplex structure, three or more chains forming a multi-chain complex, a self-hybridizing chain, or any combination thereof. Hybridization reactions may constitute a step in a broader process, such as the initiation of PCR or the enzymatic cleavage of polynucleotides by ribozymes. A first sequence that can be stabilized by hydrogen bonding with the bases in the nucleotide residues of the second sequence is referred to as "hybridizable" with the second sequence. In this case, the second sequence may also be said to be hybridizable with the first sequence.

[0075] As used herein, the terms "complementary", "complementary sequence" and "complementarity" generally refer to a sequence that is completely complementary and hybridizable to a given sequence. In some cases, if the base sequence of a given nucleic acid on a given region is able to complementarily bind to the base sequence of its binding partner, such as to form AT, AU, GC and GU base pairs, the sequence that hybridizes with the given nucleic acid is referred to as the "complementary sequence" or "reverse complementary sequence" of the given molecule. Typically, a first sequence that can hybridize with a second sequence can hybridize specifically or selectively with the second sequence, so that during the hybridization reaction, hybridization with the second sequence or a group of second sequences (e.g., more thermodynamically stable under a given set of conditions, such as stringent conditions commonly used in the art) takes precedence over hybridization with non-target sequences. Typically, hybridizable sequences share a degree of sequence complementarity over all or a portion of their respective lengths, for example, 25%-100% complementarity, including at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence complementarity. Sequence identity (e.g., for the purpose of assessing percent complementarity) can be measured by any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see, e.g., the EMBOSS Needle aligner at www.ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.html, optionally with default settings), the BLAST algorithm (see, e.g., the BLAST alignment tool available at blast.ncbi.nlm.nih.gov / Blast.cgi, optionally with default settings), or the Smith-Waterman algorithm (e.g., see, e.g., the EMBOSS Water aligner at www.ebi.ac.uk / Tools / psa / emboss_water / nucleotide.html, optionally with default settings). Optimal alignment can be assessed using any suitable parameters of the selected algorithm, including the default parameters.

[0076] As used herein, the term "overhang fragment" refers to a double-stranded polynucleotide having unpaired nucleotides at one or both ends of the polynucleotide, such as a fragment of a longer double-stranded polynucleotide. In the absence of an overhang, a double-stranded polynucleotide can be referred to as having a "blunt end."

[0077] As used herein, the terms "stem-loop product" and "stem-loop structure" generally refer to the secondary structure of a polynucleotide in which intramolecular hybridization occurs between parts of a polynucleotide. When two regions of a single polynucleotide chain hybridize to form a double-stranded portion (which may be referred to as a "stem") and an unpaired single-stranded loop (which may be referred to as a loop), a stem-loop may be formed. The stem may be any variable length base pair, and the base pairing along the stem may be interrupted internally by the gap of one or more unpaired bases on one or both parts of the stem. The loop may be any variable length of non-paired bases. In some cases, the length of the loop is at least 3 bases. In some cases, the two regions forming the "stem" are fully complementary. In some cases, the two regions forming the "stem" are partially complementary. In some cases, a single polynucleotide may include a stem-loop structure. In some cases, a single polynucleotide may include more than one stem-loop structure. The stem portion of the stem-loop structure can terminate as a double-stranded segment having no overhang, a single-stranded segment comprising a 5' overhang, a single-stranded segment comprising a 3' overhang, or a single-stranded portion extending from both the 5' and 3' ends. The stem-loop structure may also be referred to as a "hairpin" or "hairpin structure".

[0078] As used herein, the term "adapter" generally refers to a nucleic acid that can be attached to another polynucleotide. For example, an adaptor can refer to a single-stranded polynucleotide (e.g., a cell-free polynucleotide, a fragment of a cell-free polynucleotide, a genomic DNA, or a fragment of a genomic DNA) that can be attached to a single-stranded polynucleotide. In some cases, an adaptor can refer to a double-stranded nucleic acid (e.g., a cell-free polynucleotide, a fragment of a cell-free polynucleotide, a genomic DNA, or a fragment of a genomic DNA) that can be attached to another double-stranded nucleic acid. An adaptor can be attached to the 5' end or 3' end of a polynucleotide. In some cases, an adaptor can be attached to both ends of a polynucleotide, i.e., an adaptor is attached to each end.

[0079] As used herein, the term "primer" generally refers to a natural or synthetic oligonucleotide that can serve as a starting point for nucleic acid synthesis after forming a duplex with a polynucleotide template and can extend from its 3' end along the template to form an extended duplex. The sequence of the nucleotides added during the extension reaction can be determined by the sequence of the template polynucleotide. Typically, primers are extended by DNA polymerase. The length of the primer is typically compatible with its use in the synthesis of primer extension products, and the length is typically in the range of 8 to 100 nucleotides, such as 10 to 75, 15 to 60, 15 to 40, 18 to 30, 20 to 40, 21 to 50, 22 to 45, 25 to 40, etc., more typically in the range of 18-40, 20-35, 21-30 nucleotides, and any length between the ranges. Typical primers can be in the range of 10-50 nucleotides in length, e.g., 15-45, 18-40, 20-30, 21-25, etc., and any length between said ranges. In some embodiments, primers are typically no more than about 10, 12, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, or 70 nucleotides in length.

[0080] Primers are usually single-stranded to maximize amplification efficiency, but can alternatively be double-stranded. If the primer is double-stranded, it can be treated to separate its chains before being used to prepare primer extension products (or simply extension products). The denaturation step can be carried out by heating, but can alternatively also be carried out using alkali and subsequent neutralization. Therefore, a "primer" is complementary to a polynucleotide template and forms a complex by hydrogen bonding or hybridization with the template to provide a primer / template complex for initiating synthesis by a polymerase, and the primer / template complex is extended by adding a covalently bonded base complementary to the template at its 3' end during DNA synthesis.

[0081] As used herein, the term "extension product" generally refers to a reaction product in which a nucleotide primer is extended by the covalent addition of nucleotides. In some cases, nucleotide incorporation can be guided by a template. In some cases, nucleotide incorporation can occur without a template (e.g., "template independence"). In some cases, the extension product is an amplification product, such as an amplification product from PCR amplification, rolling circle amplification (RCA) or isothermal amplification.

[0082] As used herein, the terms "amplification" and "amplified" generally refer to any process by which one or more copies are made from a target polynucleotide or a portion thereof. Various methods of amplifying polynucleotides (e.g., DNA and / or RNA) can be used, some examples of which are described herein. In a multiphase amplification process, amplification can be linear, exponential, or can include a linear phase and an exponential phase. Amplification methods can involve temperature changes, such as a thermal denaturation step, or can be an isothermal process that does not require thermal denaturation. In some cases, a pair of primers are used to amplify by PCR. Subsequent analysis can be performed on the amplified product, including but not limited to melting curve analysis, nucleotide sequencing, single-stranded conformational polymorphism determination, allele-specific oligonucleotide hybridization, Southern blot analysis, and restriction endonuclease digestion.

[0083] With respect to polynucleotides or polynucleotide complexes, including but not limited to tagging products and extension products, the terms "isolated" and "isolation" generally refer to the preparation of a substance (e.g., a polynucleotide, a polynucleotide complex, a tagging product thereof, and an extension product) that is free of at least some other components, which may also be present in the place where the substance or similar substance is naturally present or originally obtained (e.g., a biological sample, a sample reaction volume, such as a tagging reaction volume, an extension reaction volume, etc.). For example, the isolated substance can be prepared from a source mixture using purification techniques, thereby enriching it. Enrichment can be measured based on absolute amount or by concentration (e.g., by weight per volume of solution, number of molecules per volume of solution), or any other appropriate measure.

[0084] In various aspects, the present disclosure provides methods, reaction mixtures, kits and systems for characterizing and analyzing polynucleotides. The polynucleotides can be part of a polynucleotide sample. The polynucleotides can be isolated polynucleotides. The subject methods, reaction mixtures, kits and systems can be used to prepare polynucleotides, such as but not limited to cell-free DNA and genomic DNA.

[0085] Provided herein is a method for characterizing polynucleotides in a sample. In one aspect, the method for characterizing polynucleotides in a sample comprises (a) contacting a double-stranded polynucleotide in a sample with a first group of transposome complexes, the first group comprising transposome complexes having a first transposon sequence to produce a first plurality of overhanging end fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhanging end fragments to an extension reaction to produce a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to produce a first plurality of blunt-end fragments or copies of a fragment thereof; (d) contacting the first plurality of blunt-end fragments or fragments thereof with a second group of transposome complexes, the second group comprising transposome complexes having a second transposon sequence to produce a second plurality of overhanging end fragments comprising the second transposon sequence at the 5' end; (e) subjecting the second plurality of overhanging end fragments to an additional extension reaction to produce a second plurality of blunt-end fragments; and (f) generating sequence reads from the second plurality of blunt-end fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotide in the sample. In some embodiments, the first transposon sequence and the second transposon sequence are not identical. In some embodiments, the second set of transposome complexes further comprises a transposome complex having a first transposon sequence. In some embodiments, the second set of transposome complexes further comprises a transposome complex having a third transposon sequence, a fourth transposon sequence, a fifth transposon sequence, and so on.

[0086] In one aspect, a method for characterizing a polynucleotide in a sample comprises (a) contacting a double-stranded polynucleotide in a sample with a first group of transposome complexes, wherein the individual transposome complexes of the first group comprise a first transposon sequence, to produce a first plurality of overhanging end fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhanging end fragments to an extension reaction to produce a first plurality of blunt-ended fragments; (c) subjecting the first plurality of blunt-ended fragments to a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to produce copies of the first plurality of blunt-ended fragments or fragments thereof; (d) contacting the first plurality of blunt-ended fragments or fragments thereof with a second group of transposome complexes, wherein the individual transposome complexes of the second group comprise a second transposon sequence; sequences to generate a second plurality of overhang fragments comprising a second transposon sequence at the 5' end, wherein the first group of transposome complexes differ from the second group of transposome complexes in that: (i) the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes; and / or (ii) one group of transposome complexes used in step (a) or (d) is a homodimeric transposome and the other group of transposome complexes used is a heterodimeric transposome; (e) subjecting the second plurality of overhang fragments to an additional extension reaction to generate a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof to characterize double-stranded polynucleotides in the sample.

[0087] By contacting the double-stranded polynucleotide with a first set of transposome complexes via a transposition or tagging process, a first plurality of overhang fragments comprising a first transposon sequence at the 5' end can be formed. An individual transposome complex can include a transposase that is complexed or bound to a first transposon sequence. A transposon sequence can include a transposon element, which can also be referred to as a transposase element. A transposase refers to an enzyme that is capable of complexing with at least one transposon sequence and catalyzing the insertion or transposition of a transposon into a polynucleotide sequence to produce a modified or "tagged" polynucleotide. Typically, a transposase can catalyze the insertion or transposition of a transposon sequence into a polynucleotide by a cut and paste mechanism or a replicative transposition mechanism.

[0088] Transposases suitable for use in the subject methods can be of prokaryotic or eukaryotic origin. Exemplary transposases include, but are not limited to, integrase, HERMES, and HIV integrase. Non-limiting examples of transposases that can be used in the embodiments herein include Tn transposases (e.g., Tn3, Tn5, Tn7, Tn10, Tn552, Tn903), MuA transposase, Vibhar transposase (e.g., from Vibrio harveyi), harveyi)), Ac-Ds, Ascot-1, Bs1, Cin4, Copia, En / Spm, F element, hobo, Hsmar1, Hsmar2, IN(HIV), IS1, IS2, IS3, IS4, IS5, IS6, IS10, IS21, IS30, IS50, IS51, IS150, IS256, IS407, IS427, IS630, IS903, IS911, IS982, IS1031, ISL2, L1, Mariner, P element, Tam3, Tc1, Tc3, Tel, THE-1, Tn / O, TnA, Toll, Tol2, Tn10, Ty1, any prokaryotic transposase, or any transposase related to and / or derived from those provided herein. In some embodiments, the subject methods utilize Tn transposase, MuA transposase, or Vibhar transposase. In some cases, the transposase used in the subject methods is a Tn transposase, such as a Tn transposase selected from Tn3, Tn5, Tn7, and Tn10. In some cases, the transposome comprises a dimer of monomers, each monomer comprising a transposase and a transposon sequence. The transposome dimer can be a homodimer or a heterodimer. The transposon sequence of the homodimer can be the same transposon sequence. The transposon sequence of the heterodimer can be a different transposon sequence. In some cases, the transposition reaction can be promoted and / or triggered by adding one or more cations. The cation can be a divalent cation, such as Ca. 2+ Mg 2+ and Mn 2+ .

[0089] The transposon sequence can include nucleic acid, such as single-stranded and / or double-stranded nucleic acid. The transposon sequence can be a double-stranded polynucleotide, such as completely double-stranded or partially double-stranded, such as having a single-stranded overhang, having a bubble, having a ring, etc. The transposon sequence generally includes a transposon element or a transposase element. A transposon element or a transposase element can refer to a nucleic acid molecule or a part thereof comprising a nucleotide sequence that forms a transpososome with a transposase or an integrase. In some embodiments, the transposon element can form a functional complex (such as a transpososome) with a transposase in a transposition reaction. The non-limiting example of a transposon element includes a 19-bp outer end ("OE") transposon end, an inner end ("IE") transposon end or a "chimeric end" ("ME") transposon end (such as, recognized by a wild-type or mutant Tn5 transposase), or the R1 and R2 transposon ends recognized by a MuA transposase. In some embodiments, the transposon element or transposase element of the transposon sequence used in the embodiments herein is a ME transposon end. The transposon element may comprise any nucleic acid or nucleic acid analog suitable for forming a functional complex with a transposase or integrase. For example, the transposon element may comprise DNA, RNA, modified bases, non-natural bases, modified backbones, or may comprise gaps in one or both chains.

[0090] In the process of transposition or labeling, a chain of a double-stranded transposon sequence can be covalently linked to a chain (e.g., "transferred chain") of a double-stranded polynucleotide. In some cases, the transferred chain is covalently linked to the 5' end of a chain of a double-stranded polynucleotide. The other chain of the transposon sequence can be referred to as a "non-transferred chain". The non-transferred chain may not be connected to a chain of a double-stranded polynucleotide. In the case where the target polynucleotide for labeling is a double-stranded polynucleotide, the upper chain of the double-stranded polynucleotide can be connected to the transposon sequence via labeling by a first transposase, and the lower chain of the same double-stranded polynucleotide can be connected to another transposon sequence at its 5' end by another transposase via labeling. The upper chain of the double-stranded polynucleotide is connected to the transposon sequence at its 5' end, and the lower chain of the double-stranded polynucleotide is connected to the transposon sequence at its corresponding 5' end to produce an overhang fragment.

[0091] In some cases, the transpososome breaks the double-stranded polynucleotide into fragments while covalently transferring the transposon sequence to the first strand of the polynucleotide fragment. In the case where the transposase catalyzes the insertion or transposition of the transposon sequence into the target polynucleotide by a cutting and pasting mechanism, the target polynucleotide can be fragmented into shorter polynucleotides (e.g., fragments).

[0092] In some cases, the transposition reaction can include fragmentation before labeling the polynucleotide with a transposon sequence. In some cases, fragmentation and labeling can occur simultaneously or substantially simultaneously. In some cases, the transposase cuts the polynucleotide to produce a staggered cut that generates an overhang. The length of the overhang can be 1 base pair (bp), 2bp, 3bp, 4bp, 5bp, 6bp, 7bp, 8bp, 9bp, 10bp or longer. For example, Tn5 can cut the polynucleotide to produce an overhang of 9bp at the 5' end of the double-stranded sequence. In some cases, the transposase cuts the polynucleotide to produce a blunt-ended cut.

[0093] After labeling, the transfer strand of the transposon sequence can keep hybridizing with the non-transfer strand. In some embodiments, a gap is formed between the non-transfer strand and a strand of the double-stranded target polynucleotide. In some embodiments, the gap is filled by a polymerase and / or a ligase. In some embodiments, the non-transfer strand of the transposon sequence does not keep hybridizing with the transfer strand. In some embodiments, for example, due to thermal denaturation, the non-transfer strand of the transposon sequence dissociates from the transfer strand. In some embodiments, for example, by the action of a strand displacement polymerase, the non-transfer strand of the transposon sequence is displaced from the transfer strand. In some embodiments, before the extension reaction, the non-transfer strand is separated from the transfer strand. In some embodiments, a polymerase and / or a ligase do not fill the gap.

[0094] The transposon sequence can be inserted by a transposase at a random or substantially random site in a double-stranded polynucleotide. The double-stranded polynucleotide can have any of a variety of lengths. The size of the resulting overhang fragment can be any of a variety of lengths and can depend on the length of the starting polynucleotide. In some cases, the size of the first plurality of overhang fragments can depend on the concentration of the transposase during tagmentation.

[0095] In some embodiments, the length of the double-stranded polynucleotide is at least about 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 60 kb, 70 kb, 80 kb, 90 kb, 100 kb, 200 kb, 300 kb, 400 kb, 500 kb, 600 kb, 700 kb, 80 ...0 kb, 1000 kb, 2000 kb, 3000 kb, 4000 kb, 5000 kb, 6000 kb, 7000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 8000 kb, 00kb, 900kb, 1 megabase (Mb), 2Mb, 3Mb, 4Mb, 5Mb, 6Mb, 7Mb, 8Mb, 9Mb, 10Mb, 20Mb, 30Mb, 40Mb, 50M b, 60Mb, 70Mb, 80Mb, 90Mb, 100Mb, 200Mb, 300Mb, 400Mb, 500Mb, 600Mb, 700Mb, 800Mb or 900Mb. In some embodiments, the length of the double-stranded polynucleotide is about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 60 kb, 70 kb, 80 kb, 90 kb, 100 kb, 200 kb, 300 kb, 400 kb, 500 kb, 600 kb, 700 kb, 80 0kb, 900kb, 1Mb, 2Mb, 3Mb, 4Mb, 5Mb, 6Mb, 7Mb, 8Mb, 9Mb, 10Mb, 20Mb, 30Mb, 40Mb, 50Mb, 6 0Mb, 70Mb, 80Mb, 90Mb, 100Mb, 200Mb, 300Mb, 400Mb, 500Mb, 600Mb, 700Mb, 800Mb or 900Mb. In some embodiments, the length of the double-stranded polynucleotide is at most about 900 Mb, 800 Mb, 700 Mb, 600 Mb, 500 Mb, 400 Mb, 300 Mb, 200 Mb, 100 Mb, 90 Mb, 80 Mb, 70 Mb, 60 Mb, 50 Mb, 40 Mb, 30 Mb, 20 Mb, 10 Mb, 9 Mb, 8 Mb, 7 Mb, 6 Mb, 5 Mb, 4 Mb, 3 Mb, 2Mb, 1Mb, 900kb, 800kb, 700kb, 600kb, 500kb, 400kb, 300kb, 200kb, 100kb, 90kb, 80k b, 70kb, 60kb, 50kb, 40kb, 30kb, 20kb, 10kb, 9kb, 8kb, 7kb, 6kb, 5kb, 4kb, 3kb, 2kb or 1kb.

[0096] In some embodiments, the first plurality of overhang segments comprises at least about 50 bases, 75 bases, 100 bases, 125 bases, 150 bases, 175 bases, 200 bases, 225 bases, 250 bases, 275 bases, 300 bases, 325 bases, 350 bases, 375 bases, 400 bases, 425 bases, 450 bases, 475 bases, 500 bases, 525 bases, 550 bases, 575 bases, 600 bases, 625 bases, 650 bases, 660 bases, 675 bases, 700 bases, 715 bases, 725 bases, 730 bases, 740 bases, 750 bases, 760 bases, 775 bases, 780 bases, 790 bases, 800 bases, 810 bases, 820 bases, 830 bases, 840 bases, 850 bases, 860 bases kb, 2kb, 3kb, 4kb, 5kb, 6kb, 7kb, 8kb, 9kb, 10kb, 20kb, 30kb, 40kb, 50kb, 60kb, 70kb, 80kb, 90kb or 100kb fragments. In some embodiments, the first plurality of overhang segments comprises about 50 bases, 75 bases, 100 bases, 125 bases, 150 bases, 175 bases, 200 bases, 225 bases, 250 bases, 275 bases, 300 bases, 325 bases, 350 bases, 375 bases, 400 bases, 425 bases, 450 bases, 475 bases, 500 bases, 525 bases, 550 bases, 575 bases, 600 bases, 625 bases in length. , 650 bases, 675 bases, 700 bases, 725 bases, 750 bases, 775 bases, 800 bases, 825 bases, 850 bases, 875 bases, 900 bases, 925 bases, 950 bases, 975 bases, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 60 kb, 70 kb, 80 kb, 90 kb or 100 kb fragments.In some embodiments, the first plurality of overhang segments comprises a length of up to about 100 kb, 90 kb, 80 kb, 70 kb, 60 kb, 50 kb, 40 kb, 30 kb, 20 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 975 bases, 950 bases, 925 bases, 900 bases, 875 bases, 850 bases, 825 bases, 800 bases, 775 bases, 750 bases, 725 bases, or fragments of 700 bases, 675 bases, 650 bases, 625 bases, 600 bases, 575 bases, 550 bases, 525 bases, 500 bases, 475 bases, 450 bases, 425 bases, 400 bases, 375 bases, 350 bases, 325 bases, 300 bases, 275 bases, 250 bases, 225 bases, 200 bases, 175 bases, 150 bases, 125 bases, 100 bases, 75 bases, or 50 bases.

[0097] In some embodiments, the transposon sequence can include sequences other than the transposon element. In some embodiments, the additional sequence can be inserted into the target polynucleotide by the transposition reaction. The additional sequence can include a primer binding site, such as a sequencing primer site and / or an amplification primer site. The additional sequence can also include a cleavage site, an anchor site, a reporter gene label, and a barcode. The primer binding site can include a sequence for sequencing a primer annealed to a nucleic acid in a sequencing reaction or other extension reactions. Such additional sequences can also be used for downstream polynucleotide manipulation steps.

[0098] In some cases, after transposition, before the next step of the reaction, the transposase can be removed or inactivated. The transposase can be removed by any of a variety of suitable methods, including purification or inactivation, such as by denaturation or enzyme treatment. The removal of the transposase can be used to minimize the inhibition of downstream reactions, such as extension reactions or amplification reactions that can use the tagged fragments as templates. In some cases, chemical treatment can be used to remove the transposase. For example, the chemical treatment can include treating the tagged fragments with a detergent solution, such as an SDS solution. In some cases, the tagged fragments are not treated to remove the transposase.

[0099] The first plurality of overhang fragments may be subjected to an extension reaction to produce a first plurality of blunt-ended fragments. The extension reaction may be used to fill the overhang to produce a blunt end. In the extension reaction, one strand of the overhang fragment may be used as a primer, and the other strand may be used as a template. The extension reaction may involve the use of a polymerase. The polymerase may be a strand displacement polymerase capable of displacing a non-transferred strand.

[0100] The overhang fragment may have a first transposon sequence at the 5' end of the upper strand and a first transposon sequence at the 5' end of the lower strand. After extension to fill the overhang, each upper strand and lower strand may include the first transposon sequence at the 5' end and the reverse complementary sequence of the first transposon sequence at the 3' end. Due to sequence complementarity, the 5' end of each upper strand or lower strand may base pair with its own 3' end, thereby forming a stem-loop or hairpin structure.

[0101] A primer-directed extension reaction can be performed to produce copies of the first plurality of blunt-ended fragments or fragments thereof. Primer extension can be performed with a primer comprising a first transposon sequence or a portion thereof. The primer can have a segment at the 5' end and a segment at the 3' end. In some cases, the primer can have an additional segment inserted between the 5' end and the 3' end or flanking the 5' end and / or the 3' end. The segment at the 3' end can exhibit sequence complementarity with the blunt-ended fragment. The segment at the 5' end can also exhibit sequence complementarity with the blunt-ended fragment. The segment at the 3' end can exhibit sequence complementarity with the transposon sequence or a fragment thereof. The segment at the 5' end can also exhibit sequence complementarity with the transposon sequence or a fragment thereof. The segment at the 3' end may not exhibit sequence complementarity with the transposon sequence, but instead exhibit sequence complementarity with the polynucleotide sequence. The segment at the 5' end may also not exhibit sequence complementarity with the transposon sequence, but instead exhibit sequence complementarity with the polynucleotide sequence. The segment at the 5' end may not exhibit sequence complementarity with any part of the blunt-ended fragment, and may contain additional sequence that is appended to the sequence of the blunt-ended fragment when a copy is generated.

[0102] In some cases, the primer comprises a first transposon sequence or a portion thereof. The use of a primer comprising a first transposon sequence or a portion thereof allows the generation of a copy of any blunt-end fragment comprising the first transposon sequence. In some cases, a copy of each blunt-end fragment is generated. In some cases, a copy of most of the blunt-end fragments is generated. In some cases, a copy of most of the blunt-end fragments is generated. In some embodiments, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the copies of the blunt-end fragments are generated during the extension directed by the primer. In some cases, this process can be referred to as single primer amplification. In some cases, regardless of the polynucleotide sequence between the transposon sequences, a copy of the blunt-end fragment is generated. In some cases, the use of a primer comprising the first transposon sequence can allow the unbiased amplification of the blunt-end fragments.

[0103] In some cases, the segment of the primer at the 3' end may include a gene-specific sequence. For example, in the case of a primer extension product containing a specific gene sequence required for downstream analysis, the primer may include a segment that can act as a gene-specific primer (e.g., with a gene-specific sequence) at the 3' end. The gene-specific sequence of the primer may hybridize with a gene-specific tag fragment and initiate primer extension. The extension reaction may select and enrich the target sequence in some cases from a plurality of blunt-end fragments. In some cases, primers with gene-specific sequences corresponding to a plurality of genes may be used in combination to select and enrich a plurality of gene-specific blunt-end fragments in some cases. For example, in order to produce an extension product corresponding to a tag fragment of two gene sequences (e.g., gene 1 and gene 2), half of the primers may have a 3' segment whose sequence is specific to gene 1, and half of the primers may have a 3' segment whose sequence is specific to gene 2. Also for example, to generate extension products of tagged fragments corresponding to three gene sequences (e.g., gene 1, gene 2, and gene 3), one-third of the primers can have a 3' segment with a sequence specific to gene 1, one-third of the primers can have a 3' segment with a sequence specific to gene 2, and one-third of the primers can have a 3' segment with a sequence specific to gene 3. The ratio of primers in the mixture can be optimized and / or adjusted as needed.

[0104] In some cases, gene-specific sequences can include sequences of targeted cancer-specific genes or sequences relevant to cancer. In some cases, multiple primers are used, and each primer has specificity to a target gene. In some cases, the primer of the subject method comprises a mixture of gene-specific primers, and the mixture is for example used for multiple processing. In some cases, the mixture of gene-specific primers targets at least 5 genes (for example, at least 10 genes, 15 genes, 20 genes, 25 genes, 50 genes, 100 genes, 200 genes, 300 genes, 400 genes, 500 genes, 600 genes, 700 genes, 800 genes, 900 genes or 1,000 genes).

[0105] In some embodiments, the segment of the extension primer at the 5' end may lack sequence complementarity with the tagging fragment. In some embodiments, the 5' end of the extension primer comprises a sequence that can be used for downstream sample processing steps. For example, the segment of the extension primer at the 5' end may comprise one or more amplification primer annealing sequences or their complements; one or more sequencing primer annealing sequences or their complements; one or more barcode sequences; one or more common sequences shared between multiple different primers; one or more restriction enzyme recognition sites; one or more probe binding sites or sequencing adapters (e.g., for attachment to a sequencing platform, such as a flow cell for massively parallel sequencing); one or more random or near-random sequences (e.g., one or more nucleotides randomly selected from a set of two or more different nucleotides at one or more positions, wherein each of the different nucleotides selected at one or more positions is represented in a primer pool comprising a random sequence); and combinations thereof.

[0106] The first plurality of blunt-end fragments or fragments thereof may be contacted with a second group of transposome complexes to produce a second plurality of overhang fragments that may include a second transposon sequence at the 5' end. Each transposome complex of the second group may include a second transposon sequence. In some embodiments, the second group of transposome complexes is a mixture of homodimeric transposome complexes and further includes a transposome complex having a first transposon sequence. In some embodiments, the mixture further includes a transposome complex having a third transposon sequence, a fourth transposon sequence, a fifth transposon sequence, and the like, as desired. In some embodiments, the second group of transposome complexes includes heterodimeric transposome complexes, each of which includes a first transposon sequence and a second transposon sequence. By using a mixture of homodimeric transposome complexes having different transposon sequences or a heterodimeric transposome complex having at least two transposon sequences, each of the resulting plurality of second overhang fragments may have a first transposon sequence, a second transposon sequence, a third transposon sequence, a fourth transposon sequence, and the like at the 5' end. The second plurality of overhang fragments may comprise a plurality of fragments having different transposon ends.In some embodiments, the second set of transposome complexes comprises homodimeric transposome complexes having a transposon sequence different from the first transposon sequence.

[0107] The size of the resulting overhang fragments can be any of a variety of lengths and can depend on the length of the first plurality of blunt-ended fragments. In some cases, the size of the second plurality of overhang fragments can depend on the concentration of the transposase during tagmentation.

[0108] In some embodiments, the second plurality of overhang segments comprises at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 75 bases, 100 bases, 125 bases, 150 bases, 175 bases, 200 bases, 225 bases, 250 bases, 275 bases, 300 bases, 325 bases, 350 bases, 375 bases, 400 bases, 425 bases, 5 450 bases, 475 bases, 500 bases, 525 bases, 550 bases, 575 bases, 600 bases, 625 bases, 650 bases, 675 bases, 700 bases, 725 bases, 750 bases, 775 bases, 800 bases, 825 bases, 850 bases, 875 bases, 900 bases, 925 bases, 950 bases, 975 bases or a fragment of 1 kb. In some embodiments, the first plurality of overhang segments comprises about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 75 bases, 100 bases, 125 bases, 150 bases, 175 bases, 200 bases, 225 bases, 250 bases, 275 bases, 300 bases, 325 bases, 350 bases, 375 bases, 400 bases, 425 bases, 4 A fragment of 50 bases, 475 bases, 500 bases, 525 bases, 550 bases, 575 bases, 600 bases, 625 bases, 650 bases, 675 bases, 700 bases, 725 bases, 750 bases, 775 bases, 800 bases, 825 bases, 850 bases, 875 bases, 900 bases, 925 bases, 950 bases, 975 bases or 1 kb. In some embodiments, the first plurality of overhang segments comprises a length of up to about 1 kb, 975 bases, 950 bases, 925 bases, 900 bases, 875 bases, 850 bases, 825 bases, 800 bases, 775 bases, 750 bases, 725 bases, 700 bases, 675 bases, 650 bases, 625 bases, 600 bases, 575 bases, 550 bases, 525 bases, bases, 500 bases, 475 bases, 450 bases, 425 bases, 400 bases, 375 bases, 350 bases, 325 bases, 300 bases, 275 bases, 250 bases, 225 bases, 200 bases, 175 bases, 150 bases, 125 bases, 100 bases, 75 bases, 50 bases, 40 bases, 30 bases, 20 bases, or 10 bases.

[0109] The second plurality of overhang fragments can be subjected to additional extension reactions to produce the second plurality of blunt-ended fragments. Additional extension reactions can be used to fill the overhangs to produce blunt ends. In additional extension reactions, one chain of the overhang fragments can serve as a primer, and the other chain serves as a template. The extension reaction can involve the use of a polymerase. The polymerase can be a strand displacement polymerase that can displace a non-transferred strand.

[0110] The second plurality of blunt-ended fragments or derivatives thereof can be sequenced to generate sequence reads to characterize the double-stranded polynucleotides in the sample. In some embodiments, the second plurality of blunt-ended fragments are further processed for nucleic acid in preparation for sequencing analysis. In some embodiments, a sequencing primer binding sequence (e.g., read 1 or read 2), a unique molecular identifier or barcode sequence (e.g., i5, i7), and / or a flow cell binding sequence (e.g., P5, P7) is attached or appended to the 5' end and / or 3' end of the fragment, for example, by ligation, amplification, or a combination thereof.

[0111] exist Figure 1 An example is shown in FIG. Figure 1As shown, a homodimeric transposome comprising a first transposon sequence X1-ME can be used in a first transposition or tagging reaction to produce a first overhang fragment. The transfer chain of the double-stranded transposon sequence is covalently linked to one chain (e.g., the upper chain) of a double-stranded target polynucleotide at, for example, the 5' end of the chain, while the non-transferred chain of the transposon is not connected to the target polynucleotide. The transfer chain can also be connected to the other chain (e.g., the lower chain) of the double-stranded target polynucleotide at, for example, the 5' end of the polynucleotide. The first overhang fragment can be subjected to an extension reaction to produce a first blunt-end fragment. After extension to fill the overhang, each chain of the blunt-end fragment can include the first transposon sequence (e.g., X1-ME) at the 5' end and the reverse complementary sequence (e.g., X1'-ME') of the first transposon sequence at the 3' end (e.g., copied during extension). In some cases, due to the sequence complementarity of the transposon sequences at the 5' end and the 3' end, the first blunt-end fragment forms a stem-loop or hairpin structure. Next, a primer-directed extension reaction can be performed with a primer comprising a first transposon sequence or a portion thereof to produce a copy of a first plurality of blunt-end fragments or fragments thereof. The use of a primer comprising a first transposon sequence or a portion thereof allows the production of a copy of any blunt-end fragment comprising the first transposon sequence. Then, the first blunt-end fragment or fragment thereof can be contacted with a second group of transposome complexes comprising a mixture of X1-ME homodimer transposome complexes and X2-ME homodimer transposome complexes to produce a second overhang fragment comprising a second transposon sequence at the 5' end and / or comprising the first transposon sequence at the 5' end. The second overhang fragment can comprise the reverse complement of the first transposon sequence at the 3' end. Some second overhang fragments can comprise the first transposon sequence at the 5' end and the reverse complement of the second transposon sequence at the 3' end. In some embodiments, X1 and X2 are not the same sequence.

[0112] In some embodiments, the first set of transposome complexes and the second set of transposome complexes differ in that (i) the transposon sequences contained therein are different between the first set of transposome complexes and the second set of transposome complexes. In some cases, the first set of transposome complexes and the second set of transposome complexes comprise homodimeric transposome complexes. Figure 2A An example is shown in FIG. Figure 2AAs shown, a homodimeric transposome comprising a first transposon sequence X1-ME can be used for a first transposition or tagging reaction to produce a first overhang fragment. The transfer chain of the double-stranded transposon sequence is covalently linked to one chain (e.g., the upper chain) of a double-stranded target polynucleotide at, for example, the 5' end of the chain, while the non-transferred chain of the transposon is not connected to the target polynucleotide. The transfer chain can also be connected to the other chain (e.g., the lower chain) of the double-stranded target polynucleotide at, for example, the 5' end of the polynucleotide. The first overhang fragment can be subjected to an extension reaction to produce a first blunt-end fragment. After extension to fill the overhang, each chain of the blunt-end fragment can include the first transposon sequence (e.g., X1-ME) at the 5' end and the reverse complementary sequence (e.g., X1'-ME') of the first transposon sequence at the 3' end (e.g., copied during extension). In some cases, due to the sequence complementarity of the transposon sequences at the 5' end and the 3' end, the first blunt-end fragment forms a stem-loop or hairpin structure. Next, a primer-directed extension reaction can be performed with a primer comprising the first transposon sequence or a portion thereof to produce a copy of a first plurality of blunt-end fragments or fragments thereof. The use of a primer comprising the first transposon sequence or a portion thereof allows the production of a copy of any blunt-end fragment comprising the first transposon sequence. Then, the first blunt-end fragment or fragment thereof can be contacted with a second group of homodimeric transposomes comprising the second transposon sequence X2-ME to produce a second overhang fragment comprising the second transposon sequence at the 5' end. The second overhang fragment can comprise the reverse complementary sequence of the first transposon sequence at the 3' end. Some second overhang fragments can comprise the first transposon sequence at the 5' end and the reverse complementary sequence of the second transposon sequence at the 3' end. In some embodiments, X1 and X2 are not identical sequences.

[0113] In some embodiments, the first group of transposome complexes comprises homodimeric transposomes and the second group of transposome complexes comprises heterodimeric transposomes. Figure 2B An example is shown in FIG. Figure 2BAs shown, a homodimeric transposome comprising a first transposon sequence X1-ME can be used for a first transposition or tagging reaction to produce a first overhang fragment. The transfer chain of the double-stranded transposon sequence is covalently linked to one chain (e.g., the upper chain) of a double-stranded target polynucleotide at, for example, the 5' end of the chain, while the non-transferred chain of the transposon is not connected to the target polynucleotide. The transfer chain can also be connected to the other chain (e.g., the lower chain) of the double-stranded target polynucleotide at, for example, the 5' end of the polynucleotide. The first overhang fragment can be subjected to an extension reaction to produce a first blunt-end fragment. After extension to fill the overhang, each chain of the blunt-end fragment can include the first transposon sequence (e.g., X1-ME) at the 5' end and the reverse complementary sequence (e.g., X1'-ME') of the first transposon sequence at the 3' end (e.g., copied during extension). In some cases, due to the sequence complementarity of the transposon sequences at the 5' end and the 3' end, the first blunt-end fragment forms a stem-loop or hairpin structure. Next, a primer-directed extension reaction can be performed with a primer comprising a first transposon sequence or a portion thereof to produce a copy of a first plurality of blunt-end fragments or fragments thereof. The use of a primer comprising a first transposon sequence or a portion thereof allows the production of a copy of any blunt-end fragment comprising a first transposon sequence. Then, the first blunt-end fragment or fragment thereof can be contacted with a second group of transposomes comprising heterodimeric transposomes to produce a second overhanging end fragment comprising a second transposon sequence (e.g., X2-ME) at the 5' end. Each complex of the heterodimeric transposome may comprise X1-ME and X2-ME transposome sequences. The second overhanging end fragment may comprise the reverse complementary sequence of the first transposon sequence (e.g., X1'-ME') at the 3' end. Some second overhanging end fragments may comprise the first transposon sequence (e.g., X1-ME) at the 5' end and the reverse complementary sequence of the second transposon sequence (e.g., X2'-ME') at the 3' end. In some embodiments, X1 and X2 are not the same sequence.

[0114] In some embodiments, in step (d), the second set of transposome complexes further comprises transposome complexes having at least a third transposon sequence. Figure 3 An example is shown in FIG. Figure 3As shown, a homodimeric transposome comprising a first transposon sequence X1-ME can be used in a first transposition or tagging reaction to produce a first overhang fragment. The transfer chain of the double-stranded transposon sequence is covalently linked to one chain (e.g., the upper chain) of a double-stranded target polynucleotide at, for example, the 5' end of the chain, while the non-transferred chain of the transposon is not connected to the target polynucleotide. The transfer chain can also be connected to the other chain (e.g., the lower chain) of the double-stranded target polynucleotide at, for example, the 5' end of the polynucleotide. The first overhang fragment can be subjected to an extension reaction to produce a first blunt-end fragment. After extension to fill the overhang, each chain of the blunt-end fragment can include the first transposon sequence (e.g., X1-ME) at the 5' end and the reverse complementary sequence (e.g., X1'-ME') of the first transposon sequence at the 3' end (e.g., copied during extension). In some cases, due to the sequence complementarity of the transposon sequences at the 5' and 3' ends, the first blunt-end fragment forms a stem-loop or hairpin structure. Next, a primer directed extension reaction can be performed with a primer comprising the first transposon sequence or a portion thereof to produce copies of the first plurality of blunt-end fragments or fragments thereof. The use of a primer comprising the first transposon sequence or a portion thereof allows the production of copies of any blunt-end fragment comprising the first transposon sequence. The first blunt-end fragment or fragment thereof can then be contacted with at least two additional sets of transposome complexes, such as X2-ME transposomes, X3-ME transposomes ... Xn-ME transposomes. The second overhang fragment can comprise a second transposon sequence (e.g., X2-ME, X3-ME ... Xn-ME) at the 5' end. The second overhang fragment can comprise a reverse complementary sequence of the first transposon sequence (e.g., X1'-ME') at the 3' end. Some second overhang fragments can comprise a first transposon sequence (e.g., X1-ME) at the 5' end and a reverse complementary sequence of the second transposon sequence at the 3' end.

[0115] In some embodiments, characterizing the double-stranded polynucleotides can generate haplotype information. In some cases, the haplotype information includes haplotype phasing. In some embodiments, determining haplotype phasing includes determining whether the polynucleotide is derived from a paternal chromosome or a maternal chromosome. Characterizing the double-stranded polynucleotides can include haplotype construction or genetic phasing. The methods disclosed herein can be used to construct a diploid reference genome.

[0116] In some embodiments, the subject method can be used to identify one or more heterozygous sites in a plurality of read pairs. The directional data of allelic variants can be determined by identifying the read pairs comprising a pair of heterozygous sites. In some embodiments, the present disclosure provides a method for haplotype phasing, which includes generating a plurality of read pairs from a single DNA molecule, and using read pairs to assemble a plurality of overlapping groups of DNA molecules. In some embodiments, haplotype phasing is performed with an accuracy greater than 70%, 75%, 80%, 85%, 90% or 95%. In some embodiments, read pairs spanning a distance greater than 0.5 kilobases (kb), 1kb, 2kb, 3kb, 4kb, 5kb, 10kb, 15kb, 20kb, 30kb, 40kb or 50kb on a single DNA molecule. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the read pairs span a distance greater than 0.5 kilobases (kb), 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb on a single DNA molecule. In some embodiments, at least 1% of the read pairs span a distance greater than 0.5 kilobases (kb), 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb on a single DNA molecule, and haplotype phased with an accuracy greater than 70%.

[0117] In some embodiments, characterizing double-stranded polynucleotides includes identifying structural variations in polynucleotides. Structural variations can be variations in, for example, chromosome structure. Structural variations identified in polynucleotides can include deletions, repetitions, copy number variations, insertions, inversions, and translocations. Structural variations can affect polynucleotides of any length. Structural variations can be characterized by loss of genetic material, gain of genetic material, translocations, gene fusions, and combinations thereof. In some cases, structural variants are selected from insertions, deletions, repetitions, transgenics, translocations, and gene fusions. Other examples of structural variants include copy number variations (CNVs), short tandem repeats (STRs), simple repeats (SSRs), variable number tandem repeats (VNTRs), amplified fragment length polymorphisms (AFLPs), insertion polymorphisms based on retrotransposons, and sequence-specific amplified polymorphisms.

[0118] The present disclosure provides a method for identifying an allele, such as a low-frequency allele. In one aspect, the method for identifying a low-frequency allele comprises (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhanging end fragments comprising a transposon sequence at the 5' end; (b) subjecting the plurality of overhanging end fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising a transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising a transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a second barcode sequence (X2) at the 5' end and the first barcode sequence (X2) at the 3' end. (e) generating sequence reads from the second plurality of barcoded polynucleotides or derivatives thereof; and (f) identifying low-frequency alleles in the double-stranded polynucleotide when the low-frequency alleles appear in the sequence reads of the sense strand and the antisense strand of the double-stranded polynucleotide, wherein (i) the sequence reads comprising (a) the sense strand sequence X2 and X1', or (b) the reverse complement sequence (X2') of the antisense strand sequence X1 and X2 from the 5' end to the 3' end are identified as being derived from the sense strand of the double-stranded polynucleotide, and (ii) the sequence reads comprising (a) the sense strand sequence X1 and X2', or (b) the antisense strand sequence X2 and X1' from the 5' end to the 3' end are identified as being derived from the antisense strand of the double-stranded polynucleotide.

[0119] The challenge of the allele in the detection nucleic acid sample can include the error caused by order-checking, amplification and other nucleic acid processing technologies.For the allele that is present in the nucleic acid sample with low allele frequency, such error may be particularly challenging.For example, allele can be present in the nucleic acid sample with less than about 50%, 45%, 40%, 35%, 30%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.1%, 0.01% or less allele frequency.The allele that exists with low frequency in the nucleic acid sample can be considered as " rare " allele.

[0120] In the embodiments herein, when an allele appears in a sequence read of both the sense strand and the antisense strand of a double-stranded polynucleotide, a low-frequency allele in a double-stranded polynucleotide present in a nucleic acid sample can be identified. Sequence reads of the sense strand and the antisense strand derived from a double-stranded polynucleotide can be identified by a combination of barcode sequences. Sequence reads containing (a) sense strand sequences X2 and X1', or (b) antisense strand sequences X1 and X2' from the 5' end to the 3' end can be identified as sense strands derived from double-stranded polynucleotides. Sequence reads containing (a) sense strand sequences X1 and X2', or (b) antisense strand sequences X2 and X1' from the 5' end to the 3' end can be identified as antisense strands derived from double-stranded polynucleotides.

[0121] Figure 4 An example is shown. Figure 4As shown, contacting a double-stranded polynucleotide with a transposome complex produces an overhang fragment that contains a transposon sequence (e.g., ME) at the 5' end. In this example, the sense strand contains a forward polynucleotide sequence (forward sequence) and the antisense strand contains a reverse polynucleotide sequence (reverse sequence). Both the sense strand and the antisense strand contain a transposon sequence at their respective 5' ends. The overhang fragment is subjected to an extension reaction to produce a blunt-end fragment. The sense strand contains a transposon sequence (e.g., ME) at the 5' end and a reverse complementary sequence (e.g., ME') of the transposon sequence at the 3' end. The antisense strand contains ME at the 5' end and ME' at the 3' end. Next, a first plurality of barcoded polynucleotides containing a first barcode sequence X1 can be generated by performing a primer-directed extension reaction with a primer containing a transposon sequence ME or a portion thereof and a first barcode sequence X1. The transposon sequence ME of the primer can hybridize with ME' of the antisense strand and ME' of the sense strand to generate barcoded polynucleotides of both the sense strand and the antisense strand by primer extension. The barcoded polynucleotide of the antisense strand can include X1, ME, a forward sequence, and ME' from the 5' end to the 3' end. The copy of the sense strand can include X1, ME, a reverse sequence, and ME' from the 5' end to the 3' end. Next, a second plurality of barcoded polynucleotides comprising a second barcode sequence X2 can be generated by performing a primer-directed extension reaction with a primer comprising the transposon sequence ME or a portion thereof and the second barcode sequence X2. The transposon sequence ME of the primer can hybridize with ME' of the first plurality of barcoded polynucleotides to generate a second plurality of barcoded polynucleotides. The transposon sequence ME of the primer can hybridize with the ME' of the X1 barcoded polynucleotide of the antisense strand and the ME' of the X1 barcoded polynucleotide of the sense strand to generate the X1 / X2 barcoded polynucleotides of both the sense strand and the antisense strand by primer extension. The second plurality of barcoded polynucleotides can include the sequence barcode sequence X2 at the 5' end and the reverse complementary sequence X1' of the first barcode sequence at the 3' end. The barcoded polynucleotide of the antisense strand can include (i) X1, ME, forward sequence, ME' and X2', or (ii) X2, ME, reverse sequence, ME' and X1' from the 5' end to the 3' end. The barcoded polynucleotide of the sense strand can include (i) X2, ME, forward sequence, ME' and X1', or (ii) X1, ME, reverse sequence, ME' and X2' from the 5' end to the 3' end.

[0122] The subject methods can detect low frequency alleles with an accuracy of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the low frequency allele is present in a nucleic acid sample at an allele frequency of less than about 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.1%, 0.01% or less.

[0123] The present disclosure provides a method for identifying sequence variants. In one aspect, the method for identifying sequence variants comprises (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhanging end fragments comprising a transposon sequence at the 5' end; (b) subjecting the plurality of overhanging end fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising a transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising a transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a second barcode sequence (X2) at the 5' end and the first barcode sequence (X2) at the 3' end. (e) generating sequence reads from the second plurality of barcoded polynucleotides or derivatives thereof; and (f) identifying sequence variants in the double-stranded polynucleotide compared to the reference sequence when sequence variants appear in sequence reads of both the sense strand and the antisense strand of the double-stranded polynucleotide, wherein (i) sequence reads comprising the reverse complement sequence (X2') of (a) the sense strand sequence X2 and X1', or (b) the antisense strand sequence X1 and X2 from the 5' end to the 3' end are identified as being derived from the sense strand of the double-stranded polynucleotide, and (ii) sequence reads comprising the reverse complement sequence (a) the sense strand sequence X1 and X2', or (b) the antisense strand sequence X2 and X1' from the 5' end to the 3' end are identified as being derived from the antisense strand of the double-stranded polynucleotide.

[0124] The challenges of detecting sequence variants in nucleic acid samples can include errors caused by sequencing, amplification, and other nucleic acid processing techniques. Since sequence variants caused by amplification or sequencing errors are less likely to be repeated (e.g., position and type) on both strands of a double-stranded polynucleotide, identifying sequence variants in sequence reads of both the sense and antisense strands of a double-stranded polynucleotide can reduce the background of erroneous sequence variants.

[0125] The subject method can be used to detect sequence variants that occur at a frequency of about or less than about 50%, 45%, 40%, 35%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001% or less. In some cases, the sequence variant is a rare sequence variant. In some cases, the sequence variants occur at a frequency of about or less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01%. The subject methods can detect sequence variants (e.g., rare sequence variants) with an accuracy of at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0126] The present disclosure provides a method for selectively sampling a subset of regions of a polynucleotide. In one aspect, the method for selectively sampling a subset of regions of a polynucleotide comprises (a) contacting a double-stranded polynucleotide with a first set of transposome complexes to generate a first plurality of overhang fragments comprising a first transposon sequence or a second transposon sequence at the 5' end, wherein the first set of transposome complexes comprises a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence; (b) subjecting the first plurality of overhang fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof, to selectively produce copies of a first plurality of blunt-end fragments or a subset of fragments thereof comprising a first transposon sequence; (d) contacting the first plurality of blunt-end fragments or fragments thereof comprising the first transposon sequence with a second set of transposome complexes to produce a second plurality of overhanging fragments, wherein the second set of transposome complexes comprises (i) a plurality of homodimeric transposases or (ii) a plurality of heterodimeric transposases; (e) subjecting the second plurality of overhanging fragments to an additional extension reaction to produce a second plurality of blunt-end fragments; and (f) generating sequence reads from the second plurality of blunt-end fragments or derivatives thereof, thereby selectively sampling a subset of regions of the double-stranded polynucleotide. In some embodiments, the first set of transposome complexes comprises a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence.

[0127] Contacting the double-stranded polynucleotide with a first set of transposome complexes can generate a first plurality of overhang fragments having different transposon ends, the first set of transposome complexes comprising: (i) a homodimeric transposase comprising a first transposon sequence (X1 homodimer) and (ii) a homodimeric transposase comprising a second transposon sequence (X2 homodimer); or (i) a homodimeric transposase comprising a first transposon sequence (X1 homodimer), (ii) a homodimeric transposase comprising a second transposon sequence (X2 homodimer) and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence (X1 / X2 heterodimer). Some of the plurality of overhang fragments can comprise the first transposon sequence (e.g., X1 / X1) at the 5' end of both the top strand and the bottom strand. Some of the plurality of overhang fragments may comprise a first transposon at the 5' end of one of the top strand or the bottom strand and a second transposon sequence (e.g., X1 / X2) at the 5' end of the other strand. Some of the plurality of overhang fragments may comprise a second transposon sequence (e.g., X2 / X2) at the 5' end of both the top strand and the bottom strand.

[0128] The relative proportions of X1 / X1, X1 / X2 and X2 / X2 fragments can depend on the relative proportions of X1 homodimers and X2 homodimers, and optional X1 / X2 heterodimers (if present). The relative proportions of X1 / X1, X1 / X2 and X2 / X2 fragments can depend on the relative proportions of X1 transposon sequences and X2 transposon sequences in the mixture. In some cases, X1 homodimers and X2 homodimers are assembled separately, and then the homodimers are mixed together to produce a mixture. In some cases, X1 transposon sequences and X2 transposon sequences are mixed together and then assembled into a transposome complex, so that the resulting mixture of transposome complexes contains X1 homodimers, X2 homodimers and X1 / X2 heterodimers.

[0129] In some cases, the relative molar ratio of X1 transposon to X2 transposon in the mixture is about 1:19, 2:18, 3:17, 4:16, 5:15, 6:14, 7:13, 8:12, 9:11, 10:10, 11:9, 12:8, 13:7, 14:6, 15:5, 16:4, 17:3, 18:2, or 19: 1. In some cases, the relative molar ratio of X1 transposon to X2 transposon in the mixture is about 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9:1. In some cases, the relative molar ratio of X1 transposon to X2 transposon in the mixture is at least about 1:19, 2:18, 3:17, 4:16, 5:15, 6:14, 7:13, 8:12, 9:11, 10:10, 11:9, 12:8, 13:7, 14:6, 15:5, 16:4, 17:3, 18:2, or 19: 1. In some cases, the relative molar ratio of X1 transposon to X2 transposon in the mixture is at least about 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9:1.

[0130] The relative molar ratios of the X1 / X1 fragments, the X1 / X2 fragments, and the X2 / X2 fragments in the first plurality of overhang fragments can be about 1:81:18, or about 4:64:32, or about 9:49:42, or about 16:36:48, or about 25:25:50. In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (i) is less than the molar concentrations of (ii) and (iii). In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (ii) is less than the molar concentration of (i) and (iii). In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (iii) is less than the molar concentration of (i) and (ii). In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a transposase homodimer comprising a second transposon sequence, the molar concentration of (i) is less than the molar concentration of (ii). In some embodiments, in a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a transposase homodimer comprising a second transposon sequence, the molar concentration of (ii) is less than the molar concentration of (i).

[0131] Although exemplary ratios are provided herein, the subject methods are not limited to any particular ratios disclosed herein, and can be adjusted to produce different ratios of X1 / X1, X1 / X2, and X2 / X2 fragments.

[0132] Figure 5 and Figure 6An example is shown. In this example, a transposon containing X1 and a transposon containing X2 are present in a mixture at a ratio of about 10:90 (e.g., 1:9). Contacting a double-stranded polynucleotide with a transposome complex produces a first plurality of overhang fragments that contain X1 or X2 at the 5' end. The first plurality of overhang fragments may have different transposon ends. When using an X1:X2 transposon at a ratio of about 1:9, about 1% of the first plurality of overhang fragments may contain a first transposon sequence (e.g., X1 / X1) at the 5' end of both the upper and lower chains, about 18% of the first plurality of overhang fragments may contain a first transposon at the 5' end of one of the upper or lower chains, and a second transposon sequence (e.g., X1 / X2) at the 5' end of the other chain, and about 81% of the first plurality of overhang fragments may contain a second transposon sequence (e.g., X2 / X2) at the 5' end of both the upper and lower chains.

[0133] Next, the first plurality of overhanging end fragments may be subjected to an extension reaction to generate a first plurality of blunt-end fragments. Figure 5 As shown, due to sequence complementarity, the single-stranded polynucleotides of the first plurality of blunt-end fragments comprising X1 at the 5' end and the reverse complementary sequence of X1 (e.g., X1') at the 3' end can form a stem-loop structure. Similarly, due to sequence complementarity, the single-stranded polynucleotides of the first plurality of blunt-end fragments comprising X2 at the 5' end and the reverse complementary sequence of X2 (e.g., X2') at the 3' end can also form a stem-loop structure.

[0134] Primer-directed extension can be performed with a primer comprising the first transposon sequence X1 or a portion thereof to selectively generate copies of a subset of blunt-ended fragments comprising X1. Primer-directed extension using a primer comprising the first transposon sequence X1 or a portion thereof can allow for selective sampling of a subset of polynucleotide regions. In some cases, linear polynucleotides (e.g., comprising an X1 transposon sequence and an X2 transposon sequence) can be removed from the stem-loop product prior to the extension reaction.

[0135] The blunt-ended fragments can then be contacted with a second set of transposome complexes to produce a second plurality of overhanging fragments. The second set of transposome complexes can comprise a plurality of homodimeric transposases, such as Figure 5 as shown, or multiple heterodimeric transposases, e.g. Figure 6 As shown. Then, the second plurality of overhanging end fragments can be subjected to additional extension reactions to produce a second plurality of blunt-ended fragments. The second plurality of blunt-ended fragments can be subjected to additional nucleic acid processing, such as adapter attachment and / or amplification by polymerase chain reaction (PCR). The second plurality of blunt-ended fragments or derivatives thereof can be sequenced to generate sequence reads, thereby selectively sampling a regional subset of double-stranded polynucleotides.

[0136] The present disclosure provides compositions for performing the subject methods. In some aspects, the present disclosure provides compositions resulting from performing any one or more steps of the subject methods.

[0137] In one aspect, the present disclosure provides a composition comprising (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a mixture of a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence. In some cases, the relative ratio of the X1 transposon sequence to the X2 transposon sequence in the composition is about 1:19, 2:18, 3:17, 4:16, 5:15, 6:14, 7:13, 8:12, 9:11, 10:10, 11:9, 12:8, 13:7, 14:6, 15:5, 16:4, 13:7, 12:8, or 19:1. In some cases, the relative ratio of X1 transposon sequences to X2 transposon sequences in the composition is about 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9: 1. In some cases, the relative ratio of X1 transposon sequences to X2 transposon sequences in the composition is at least about 1:19, 2:18, 3:17, 4:16, 5:15, 6:14, 7:13, 8:12, 9:11, 10:10, 11:9, 12:8, 13:7, 14:6, 15:5, 16:4, 13:7, 12:8, or 19: 1. In some cases, the relative ratio of X1 transposon sequences to X2 transposon sequences in the composition is at least about 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9:1. In some embodiments, in the composition of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (i) is less than the molar concentration of (ii) and (iii). In some embodiments, in the composition of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (ii) is less than the molar concentration of (i) and (iii). In some embodiments, in the composition of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a transposase homodimer comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (iii) is less than the molar concentrations of (i) and (ii).

[0138] The present disclosure also provides a reaction mixture for performing any of the subject methods. The reaction mixture for performing the subject method may include one or more elements disclosed herein relating to any of the various aspects or in any combination. On the one hand, the present disclosure provides a reaction mixture comprising a double-stranded polynucleotide and at least one transposome complex. In some embodiments, the reaction mixture may include an overhang fragment and at least one enzyme (e.g., a polymerase) for performing an extension reaction. In some embodiments, the reaction mixture may include one or more primers for performing a primer-directed extension reaction. In some embodiments, the reaction mixture may include one or more barcoded primers for performing a primer-directed extension reaction.

[0139] In one aspect, the present disclosure provides a reaction mixture comprising (a) (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and optionally (iii) a mixture of a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence; and (b) a double-stranded polynucleotide. In some embodiments, the double-stranded polynucleotide comprises genomic DNA. The genomic DNA may comprise a single chromosome or a fragment thereof. In some cases, the genomic DNA is from a single cell.

[0140] The present disclosure also provides kits for performing any of the subject methods. The kit may include one or more elements disclosed herein relating to any of the various aspects or in any combination. The kit may include a transposase, such as a Tn transposase. The kit may include a transposon sequence. The kit may include at least one enzyme for performing an extension reaction. The kit may include at least one primer for performing a primer-directed extension reaction. The kit may include at least one barcoded primer for performing a primer-directed extension reaction.

[0141] In some embodiments, the kit may include (a) a first set of transposome complexes, each transposome complex of the first set comprising a first transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second set of transposome complexes, each transposome complex of the second set comprising a second transposon sequence; and (d) instructions for characterizing a polynucleotide sample, for example, according to the subject methods. The first set of transposome complexes and the second set of transposome complexes may differ in that: (i) the transposon sequences contained therein are different between the first set of transposome complexes and the second set of transposome complexes; and / or (ii) one set of transposome complexes is a homodimeric transposome, while the other set of transposome complexes is a heterodimeric transposome.

[0142] In some embodiments, the kit may include (a) transposome complexes, each transposome complex comprising a transposon sequence; (b) a first primer comprising a transposon sequence or a portion thereof and a first barcode sequence (X1); (c) a second primer comprising a transposon sequence or a portion thereof and a second barcode sequence (X2); and (d) instructions for identifying low-frequency alleles or sequence variants in a polynucleotide, e.g., according to the subject methods.

[0143] In some embodiments, the kit can include (a) a first set of transposome complexes comprising: (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and optionally (iii) a heterodimeric transposase comprising the first transposon sequence and the second transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second set of transposome complexes comprising (i) a plurality of homodimeric transposases or (ii) a plurality of heterodimeric transposases; and (d) instructions for selectively sampling a subset of regions of a polynucleotide, e.g., according to the subject methods.

[0144] The contents of the kit may be contained in any suitable container. Each component may be packaged in a different container, or, where cross-reactivity and shelf life permit, a combination of components may be provided in a container. Non-limiting examples of containers include wells, plates, tubes, chambers, flow cells, or chips.

[0145] The contents of the kit can be used immediately to perform the methods described herein. In some cases, the contents of the kit are combined with other reagents in the kit or reagents provided by the user before use in the methods described herein. For example, a concentrated composition can be diluted before use, or a lyophilized composition can be reconstituted before use.

[0146] The kit may provide a buffer, non-limiting examples of which include sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof. The kit may include a control sample, such as purified DNA used as a positive control or quantitative standard.

[0147] In some embodiments, the kit further comprises an adapter oligonucleotide. The adapter oligonucleotide can be single-stranded or double-stranded. The adapter can be attached to the 5' end or 3' end of the polynucleotide. In some cases, the adapter oligonucleotide comprises a barcode sequence, an amplification primer binding sequence, a sequencing primer binding sequence, or a combination thereof.

[0148] The transposase provided in the kit can be any transposase described herein, including but not limited to integrase, HERMES or HIV integrase. The transposase can be Tn transposase (e.g., Tn3, Tn5, Tn7, Tn10, Tn552, Tn903), MuA transposase, Vibhar transposase (e.g., from Vibrio harveyi), Ac-Ds, Ascot-1, Bs1, Cin4, Copia, En / Spm, F element, hobo, Hsmar1, Hsmar2, IN (HIV), IS1, IS2, IS3, IS4, IS5, IS6, IS10, IS21, IS3 0, IS50, IS51, IS150, IS256, IS407, IS427, IS630, IS903, IS911, IS982, IS1031, ISL2, L1, Mariner, P element, Tam3, Tc1, Tc3, Tel, THE-1, Tn / O, TnA, Toll, Tol2, Tn10, Ty1, any prokaryotic transposase or any transposase related to and / or derived from the above listed transposases. In some embodiments, the transposase provided in the kit is a Tn transposase, a MuA transposase, or a Vibhar transposase. In some cases, the transposase provided in the kit is a Tn transposase selected from Tn3, Tn5, Tn7, and Tn10. In some cases, the transpososome comprises a dimer of monomers, each monomer comprising a transposase and a transposon sequence. The transposome dimer can be a homodimer or a heterodimer. In some cases, the kit includes one or more cations to promote and / or trigger the transposition reaction. The cation can be a divalent cation, such as Ca 2+ Mg 2+ and Mn 2+ .

[0149] The transposon sequence provided in the test kit can be connected to a polynucleotide. The transposon sequence provided in the test kit can be a single-stranded, double-stranded or partially double-stranded polynucleotide sequence. In some cases, the transposon sequence can be a double-stranded sequence or a partially double-stranded sequence. The transposon sequence provided in the test kit can include any nucleic acid or nucleic acid analog that is suitable for forming a functional complex with a transposase. The transposon sequence can include DNA, RNA, modified bases, non-natural bases, modified backbones, or can include gaps in one or both chains.

[0150] The hot start polymerase provided in the kit can be used for extension reaction and / or amplification reaction.The hot start polymerase, such as a high-fidelity PCR polymerase, can be activated by incubating at elevated temperature for a sufficient length of time (e.g., 95 degrees for 1 minute).

[0151] In some cases, the kit may include an SDS solution for inactivating the transposase. For example, the kit may include an SDS solution having 0.1%, 0.2% or more SDS.

[0152] In one aspect, the present disclosure provides a system for performing the methods disclosed herein. The system may include: (a) a computer configured to receive a user request to characterize a polynucleotide, identify a low-frequency allele, identify a sequence variant, or selectively sample a subset of a polynucleotide region; (b) one or more processors configured to execute a command for a tagging reaction and one or more extension reactions (including primer-directed extension reactions) of a polynucleotide or a portion thereof in response to a user request; and / or (c) a sequencing system capable of generating sequence reads. In some embodiments, the computer includes one or more processors. The processor may be associated with one or more controllers, computing units, and / or other units of a computer system, or may be implanted in firmware as needed. If implemented in software, the routine may be stored in any computer-readable memory, such as RAM, ROM, flash memory, disk, laser disk, or other storage medium. Similarly, the software may be delivered to a computing device by any known delivery method, including, for example, by a communication channel such as a telephone line, the Internet, a wireless connection, or by a transmittable medium such as a computer-readable disk or a flash drive. Each step can be implemented as multiple blocks, operations, tools, modules or technologies, which can be implemented in hardware, firmware, software or any combination thereof. When implemented in hardware, some or all of the blocks, operations, technologies, etc. can be implemented, for example, with custom integrated circuits (ICs), application specific integrated circuits (ASICs), field programmable logic arrays (FPGAs) or programmable logic arrays (PLAs). In some embodiments, a computer is configured to receive a client request to design a primer for amplifying a specified target sequence (which can also be provided by a client). The computer can receive a client request directly (for example, by input devices such as keyboards, mice or touch screens operated by a client or a user who enters a client request) or indirectly (for example, by wired or wireless connections, including through the Internet).

[0153] In some embodiments, the system includes a report generator, which sends a report to a recipient, wherein the report includes information about the polynucleotides in the sample. For example, the report can include haplotype information or identification of structural variations in polynucleotides. The report can include information about low-frequency alleles or sequence variants. The report can include information about a subgroup of a polynucleotide region that is selectively sampled. The report generator can automatically send a report in response to a client request. Alternatively, the report generator can send a report in response to an instruction from an operator. Any appropriate communication medium can be used to send the report to a recipient at a local or remote location. For example, the communication medium can be a network connection, a wireless connection, or an Internet connection. The report can be sent through such a network or connection (or any other suitable means for sending information, including but not limited to mailing a physical report, such as a printout) for the recipient to receive and / or view. The recipient can be, but is not limited to, a client or an electronic system (e.g., one or more computers and / or one or more servers). In some embodiments, the report generator sends the report to the recipient's device, such as a personal computer, a phone, a tablet computer, or other devices. The report can be viewed online, saved on the recipient's device, or printed.

[0154] In one aspect, the present disclosure provides a computer-readable medium including code, which, when executed by one or more processors, implements a method according to any method disclosed herein. Computer-readable media can take many forms, including but not limited to tangible storage media, carrier media, or physical transmission media. Non-volatile storage media include, for example, optical or magnetic disks, such as any storage device in any computer, etc., such as can be used to implement extension reactions and / or amplification reactions, etc. Volatile storage media include dynamic memory, such as the main memory of a computer. Tangible transmission media include coaxial cables; copper wires and optical fibers, including wires that constitute a bus within a computer system. Carrier transmission media can take the form of electrical or electromagnetic signals or sound or light waves, such as those generated during radio frequency (RF) and infrared (IR) data communications. Thus, common forms of computer-readable media include, for example, a floppy disk, a flexible disk, a hard disk, a magnetic tape, any other magnetic medium, a CD-ROM, a DVD or DVD-ROM, any other optical medium, a punched card tape, any other physical storage medium with a pattern of holes, a RAM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cassette, a carrier wave that transmits data or instructions, a cable or link that transmits such a carrier wave, or any other medium from which a computer can read programming code and / or data. Many of these forms of computer-readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.

[0155] In various embodiments of various aspects herein, the transpososome comprises a transposase complexed with a transposon sequence. The transposase can be any naturally occurring transposase or engineered (e.g., a mutant or mutant transposase). As previously described, a transposase refers to an enzyme that is capable of complexing with at least one transposon sequence and catalyzing the insertion or transposition of a transposon sequence into a target polynucleotide. The transposase can be of prokaryotic or eukaryotic origin.

[0156] Exemplary transposases include, but are not limited to, integrase, HERMES, and HIV integrase. Non-limiting examples of transposases include Tn transposases (e.g., Tn3, Tn5, Tn7, Tn10, Tn552, Tn903), MuA transposase, Vibhar transposase (e.g., from Vibrio harveyi), Ac-Ds, Ascot-1, Bs1, Cin4, Copia, En / Spm, F element, hobo, Hsmar1, Hsmar2, IN (HIV), IS1, IS2, IS3, IS4, IS5, IS6, IS10, IS21 , IS30, IS50, IS51, IS150, IS256, IS407, IS427, IS630, IS903, IS911, IS982, IS1031, ISL2, L1, Mariner, P element, Tam3, Tc1, Tc3, Tel, THE-1, Tn / O, TnA, Toll, Tol2, Tn10, Ty1, or any transposase related to or derived from those disclosed herein. In various embodiments of various aspects herein, the transposase of the transpososome is a Tn transposase, a MuA transposase, or a Vibhar transposase. In some cases, the transposase is a Tn transposase, such as a transposase selected from Tn3, Tn5, Tn7, and Tn10. In some embodiments, the transposase is Tn5 or a variant thereof. In some cases, the transposome comprises a dimer of monomers comprising a transposase and a transposon sequence. The transposome dimer can be a homodimer or a heterodimer. In some cases, the transposition reaction can be promoted and / or triggered by adding one or more cations. The cation can be a divalent cation, such as Ca. 2+ Mg 2+ and Mn 2+ .

[0157] In some cases, the transposase is an engineered transposase. Relative to the parent transposase from which it is derived, the engineered transposase may have different properties. In some cases, the transposase is a highly active transposase. In some cases, the engineered transposase is capable of binding to a polynucleotide comprising a modified nucleotide or nucleotide analog. For example, the transposase of the present disclosure may be an engineered transposase that binds to any polynucleotide sequence in an unbiased manner. In some cases, the transposase of the present disclosure is an engineered transposase or a mutant transposase comprising a peptide fragment having at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% amino acid sequence identity with the corresponding peptide fragment of the parent transposase. The length of the peptide fragment can be at least about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 400, or about 500 amino acids. Compared to the parent transposase, the engineered transposase or mutant transposase of the present disclosure may have increased transposition activity. In some cases, the engineered transposase or mutant transposase has an activity that is at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% higher than the parent transposase. Compared to the parent transposase, the engineered transposase or mutant transposase of the present disclosure may have reduced transposition activity. In some cases, the engineered transposase or mutant transposase has at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% less activity than the parent transposase.

[0158] In various embodiments of various aspects of this paper, the transposon sequence can be DNA, RNA or reverse transcription RNA (e.g., cDNA). The transposon element of the transposon sequence can be recognized by a transposase, and can be referred to as a recognition sequence. The recognition sequence can include the entire transposon sequence or any part thereof. In some cases, the two ends or a single end of a transposon sequence can be recognized by a transposase. For example, the Tn5 transposase can recognize the 19bp sequence at either end of a transposon sequence.

[0159] In some cases, the transposon sequence can be connected to a polynucleotide in a sequence-dependent manner. For example, the transposons Passport, Himar1, Hsmar1, Frog Prince and Sleeping Beauty can preferentially connect to a polynucleotide sequence that is rich in "TA". Similarly, the transposons PiggyBac and PiggyBat can preferentially connect to a polynucleotide sequence that is rich in "TTAA". In some cases, the transposon sequence can be connected to a polynucleotide sequence in a sequence-independent manner or substantially in a sequence-independent manner. For example, the transposon Tol2 and TcBuster can be connected to any 8bp long polynucleotide sequence. The transposon can be substantially methylated, partially methylated, hemimethylated or substantially unmethylated.

[0160] Any of a variety of polynucleotides can be characterized by the method of the present disclosure. In some embodiments, the polynucleotide characterized is a cell-free polynucleotide. In some embodiments, the cell-free polynucleotide is a cell-free DNA (cfDNA) or a cell-free RNA (cfRNA). For example, the cell-free polynucleotide can be a circulating tumor DNA, a circulating tumor RNA, a circulating fetal DNA or a circulating fetal RNA. In some embodiments, the polynucleotide characterized can be a genomic polynucleotide. In some cases, the genomic polynucleotide can include a mixture of genomic DNA, genomic RNA or genomic DNA and genomic RNA. In some cases, the genomic polynucleotide can show high integrity, such as a high molecular weight polynucleotide. In some cases, the genomic polynucleotide can be further bound to a protein, such as a histone. In some cases, the genomic polynucleotide can be fragmented. In some cases, the polynucleotide can be methylated, such as 5-methylcytosine (e.g., partially or completely). In some cases, the polynucleotide can be unmethylated. In some cases, the genomic polynucleotide includes a chromosome. The chromosome can be any chromosome of a eukaryotic cell or a prokaryotic cell.

[0161] Polynucleotides can be from polynucleotide samples. In some cases, polynucleotides can be obtained from complete cells or tissues. Polynucleotides can be from single cells. In some cases, polynucleotides can be obtained from body fluids, such as blood, saliva, urine, amniotic fluid, plasma, mucus, cerebrospinal fluid, tears, synovial fluid, lymphatic fluid, lacteal duct (lactal duct) fluid and semen, etc. In some embodiments, polynucleotides are separated from fresh tissues. In other cases, polynucleotide samples can be separated from frozen tissues. In some other cases, polynucleotide samples can be separated from fixed tissues, such as formalin-fixed paraffin-embedded (FFPE) tissues. Other examples of polynucleotide sample sources include, but are not limited to, cells, blood cells, bacteria, viruses, mitochondria, chloroplasts, protein DNA complexes assembled in vitro and neutrophil extracellular captures from tissue dissociation. In some cases, polynucleotides can be obtained from cell cultures, such as cell lines. Polynucleotides can be fragmented to produce fragments suitable for downstream determination.

[0162] Cell-free polynucleotides include polynucleotides derived from cells but not directly obtained from a cell source (e.g., a tissue sample). Non-limiting examples of sources from which cell-free polynucleotides can be produced are normal cells and tissues, abnormal cells and tissues (e.g., diseased cells or tissues, such as cancer cells or tissues), fetal cells and tissues, and pathogens. Cell-free polynucleotides present in non-cellular sources can be produced by cell death (e.g., apoptosis or necrosis) or cell shedding. Sequence analysis of cell-free polynucleotides can be used to characterize cells or cell populations from which cell-free polynucleotides are derived, such as tumor cells (e.g., in cancer detection), fetal cells (e.g., in prenatal diagnosis), cells from transplanted tissues (e.g., early detection of transplantation failure), or pathogens (e.g., bacteria or viruses).

[0163] Embodiments of the present disclosure can use any polynucleotide.Polynucleotide can be obtained from a subject, such as any animal or living organism.Non-limiting examples of subjects are mammals, such as humans, non-human primates, rodents such as mice and rats, dogs, cats, pigs, sheep, rabbits, etc.In some embodiments, the subject is healthy, and the polynucleotides obtained from the subject may not include sequence variants associated with a disease or illness.In some embodiments, the subject is suspected of having a disease or illness, and the polynucleotides obtained from the subject may include sequence variants associated with the disease or illness.In some embodiments, the subject is pregnant, and the polynucleotides obtained from the subject include fetal polynucleotides.

[0164] Cell-free polynucleotides can be obtained from a variety of non-cellular sources. Non-limiting examples of non-cellular sources from which cell-free polynucleotides can be obtained are serum, plasma, blood, sweat, saliva, urine, feces, semen, mucosal excretions, cerebrospinal fluid, amniotic fluid, and lymph fluid. There are a variety of methods for collecting non-cellular source samples from which cell-free polynucleotides can be obtained. In some embodiments, the non-cellular source sample from which cell-free polynucleotides can be obtained is from a subject. In some embodiments, the sample is obtained by venipuncture. In some embodiments, the sample is obtained by aspiration.

[0165] There are a variety of methods and commercial kits available for obtaining cell-free polynucleotides, such as cell-free DNA or RNA, from a sample. Examples of methods and kits for extracting and isolating cell-free polynucleotides, including cell-free DNA, are phenol / chloroform extraction, phenol / chloroform / isoamyl alcohol (PCI)-glycogen extraction, NaI (sodium iodide) extraction, guanidine resin extraction, QIAmp DNA Blood Midi Kit with carrier RNA, ChargeSwitch Serum Kit, ZR Serum DNA Kit, QiagenQubit TM dsDNA HS Assay Kit, Agilent TM DNA 1000 Kit, TruSeq TM Sequencing library preparation and Puregene DNA purification system blood kit.

[0166] Cell-free polynucleotides, including cell-free DNA and RNA, can be extracted and separated from body fluids by a distribution step, in which the cell-free polynucleotides are separated from cells and other non-soluble components of the body fluids. Examples of distribution techniques are centrifugation and filtration. In some embodiments, cells are not first distributed with cell-free polynucleotides, but lysed. In some embodiments, the genomic DNA of intact cells is distributed by selective precipitation. Cell-free polynucleotides including DNA can remain soluble and can be separated from insoluble genomic DNA and extracted. According to certain procedures, after adding buffers and other washing steps specific to different kits, DNA can be precipitated using isopropanol precipitation. Further purification steps, such as silica-based columns, can be used to remove contaminants or salts. General procedures can be optimized for specific applications. For example, a large amount of non-specific carrier polynucleotides can be added throughout the reaction to optimize certain aspects of the procedure, such as yield.

[0167] In some embodiments of any of the various aspects disclosed herein, the polynucleotide or target polynucleotide includes genomic DNA. In some embodiments, the polynucleotide or target polynucleotide is derived from genomic DNA. Genomic DNA can be obtained from cells or tissue samples using various methods and commercially available kits (e.g., Qiagen DNeasy tissue kit). Genomic DNA can be obtained from samples and purified using any extraction, separation, and purification methods previously described elsewhere herein. Other non-limiting examples of extraction techniques include: (1) organic extraction followed by ethanol precipitation, such as using phenol / chloroform organic reagents (Ausubel et al., 1993), with or without an automatic nucleic acid extractor (e.g., a 341 DNA extractor available from Applied Biosystems (Foster City, Calif)); (2) stationary phase adsorption (U.S. Pat. No. 5,234,809; Walsh et al., 1991); and (3) salt-induced nucleic acid precipitation methods (Miller et al., (1988), such precipitation methods are often referred to as "salting out" methods). Another example of nucleic acid separation and / or purification includes the use of magnetic particles that can bind specifically or non-specifically to nucleic acids, then using a magnet to separate beads, and washing and eluting nucleic acids from beads (e.g., see U.S. Patent No. 5,705,628). For example, solid phase reversible immobilization (SPRI) beads (AgencourtAMPure XP) can be used to separate and purify nucleic acids. In some embodiments, an enzyme digestion step can be performed before the above-mentioned separation method to help eliminate unwanted proteins from the sample, for example, digested with proteinase K or other similar proteases. If necessary, ribonuclease inhibitors can be added to the lysis buffer. For some cells or sample types, it may be necessary to add a protein denaturation / digestion step to the protocol. Purification methods can be performed to separate DNA, RNA, or both. When both DNA and RNA are separated together during or after the extraction procedure, other steps can be used to purify one or both are purified separately. Subfractions of extracted nucleic acids can also be produced, for example, purified by size, sequence, or other physical or chemical characteristics. In addition to the initial nucleic acid separation step, nucleic acid purification can also be performed after any step of the disclosed method, for example to remove excess or unwanted reagents, reactants or products. A variety of methods can be used, such as by absorbance (e.g., absorbance at 260nm, 280nm light and its ratio) and detection labels (e.g., fluorescent dyes and intercalators, such as SYBR green, SYBR blue, DAPI, propidium iodide, Hoechst staining, SYBR gold, ethidium bromide) to determine the amount and / or purity of nucleic acids in a sample.

[0168] In some embodiments, the polynucleotide or target polynucleotide comprises fragmented cell-free DNA or fragmented genomic DNA. In some cases, fragmentation occurs due to previous sample processing steps such as formalin fixation, paraffin embedding or freezing. In some cases, the polynucleotide is fragmented to produce shorter fragments.

[0169] There are a variety of methods that can be used to fragment polynucleotides, including but not limited to chemical methods, enzymatic methods, and mechanical methods such as sonication, shearing, and contact with restriction enzymes. In some embodiments, the length of the cell-free DNA fragments is approximately uniform. In some embodiments, the length of the cell-free DNA fragments is not approximately uniform. In some embodiments, the average length of the cell-free DNA fragments is about 50 nucleotides to about 1000 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 50 nucleotides to about 500 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 50 nucleotides to about 250 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 50 nucleotides to about 200 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 50 nucleotides to about 100 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 40 nucleotides to about 1000 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 40 nucleotides to about 500 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 40 nucleotides to about 250 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 40 nucleotides to about 200 nucleotides. In some embodiments, the average length of the cell-free DNA fragments is about 40 nucleotides to about 100 nucleotides.

[0170] In some embodiments, genomic DNA is fragmented into polynucleotides of shorter length. In some embodiments, the length of genomic DNA fragments is approximately uniform. In some embodiments, the length of genomic DNA fragments is not approximately uniform. In some embodiments, the average length of genomic DNA fragments is about 50 nucleotides to about 100 nucleotides. In some embodiments, the average length of genomic DNA fragments is about 50 nucleotides to 250 nucleotides. In some embodiments, the average length of genomic DNA fragments is about 50 nucleotides to 500 nucleotides. In some embodiments, the average length of genomic DNA fragments is about 50 nucleotides to 750 nucleotides. In some embodiments, the average length of genomic DNA fragments is about 100 nucleotides to 1000 nucleotides.

[0171] In some cases, polynucleotides can be obtained from intact cells or tissues. In some cases, polynucleotides can be obtained from body fluids, such as blood, saliva, urine, amniotic fluid, plasma, mucus, cerebrospinal fluid, tears, synovial fluid, lymphatic fluid, lacteal fluid and semen etc. In some embodiments, polynucleotides are separated from fresh tissues. In other cases, polynucleotide samples can be separated from frozen tissues. In some other cases, polynucleotide samples can be isolated from fixed tissues. Other examples of polynucleotide sample sources include but are not limited to cells dissociated from tissues, blood cells, cells obtained from formalin-fixed paraffin-embedded (FFPE) tissues, bacteria, viruses, mitochondria, chloroplasts, protein DNA complexes assembled in vitro and neutrophil extracellular captures. In some cases, polynucleotides can be obtained from cell cultures, such as cell lines.

[0172] Some embodiments of the present disclosure include primer extension and amplification reactions, such as producing extension products and amplification extension products. Primer extension reactions may involve temperature changes (thermal cycling) or constant temperature (isothermal). In some embodiments, primer extension reactions include polymerase chain reaction (PCR). PCR involves cycling through multiple stages of denaturation, primer pairs and opposite strand annealing, and primer extension for exponentially increasing the number of copies of a target sequence, at least some of which typically occur at different reaction temperatures. Non-limiting examples of PCR amplification techniques are quantitative PCR (qPCR or real-time PCR), reverse transcription PCR (RT-PCR), digital PCR (dPCR or dePCR), target-specific PCR, and quantitative reverse transcription PCR (qRT-PCR). Examples of polymerases that can be used for PCR are thermostable polymerases, including but not limited to Thermus thermophilus HB8; Thermus oshimai mutant; Thermus scotoductus; Thermus thermophilus 1B21; Thermus thermophilus GK24; Thermus aquaticus polymerase ( FS or Taq(G46D;F667Y), Taq(G46D;F667Y;E6811), and Taq(G46D;F667Y;T664N;R660G); Pyrococcus furiosus polymerase; Thermococcus gorgonarius polymerase; Pyrococcus species GB-D polymerase; Thermococcus species (strain 9°N-7) polymerase; Bacillus stearothermophilus polymerase; Tsp polymerase; ThermalAce TMPolymerase (Invitrogen); Thermus flavus polymerase; Thermus litoralis polymerase; Thermus Z05 polymerase; Delta Z05 polymerase (e.g., Delta Z05 Gold DNA polymerase); and mutants, variants, and derivatives thereof. Other examples of polymerases that can be used for PCR are non-thermostable polymerases, including, but not limited to, DNA polymerase I; DNA polymerase I mutants, including, but not limited to, Klenow fragment and Klenow fragment (3'-5' exo-); T4 DNA polymerase; mutant T4 DNA polymerase; T7 DNA polymerase; mutant T7 DNA polymerase; phi29 DNA polymerase; and mutant phi29 DNA polymerase.

[0173] In some embodiments, the primer extension and amplification reaction comprises an isothermal reaction. Non-limiting examples of isothermal amplification techniques are ligase chain reaction (LCR); transcription-mediated amplification (TMA); nucleic acid sequence-based amplification (NASBA); signal-mediated RNA amplification technology (SMART); strand displacement amplification (SDA); thermophilic SDA; rolling circle amplification (RCA); loop-mediated DNA isothermal amplification (LAMP); helicase-dependent amplification (HDA); single primer isothermal amplification (SPIA); and circular helicase-dependent amplification (cHDA).

[0174] In various embodiments of various aspects of this paper, hot start polymerase is used for extension and / or amplification. The term "hot start" generally refers to a means of limiting the availability of essential reaction components (e.g., polymerase) when the reaction mixture is maintained at a first temperature (usually a lower temperature) until a second temperature (usually a higher temperature) is reached to allow the essential components to participate in the reaction. Hot start reactions generally involve incubation at a first (e.g., lower) temperature, and then rise to a second (e.g., higher) temperature that allows the desired reaction to be performed. Activation of the hot start reaction can be achieved by incubating the reaction mixture at a temperature equal to or higher than the primer hybridization (annealing) temperature. Primer binding specificity can be ensured using a temperature equal to or higher than the primer hybridization temperature. The incubation time required to restore enzyme activity depends on the temperature and pH value of the reaction mixture and the stability of the enzyme. A wide range of incubation conditions can be used; the optimal conditions for each reaction can be determined empirically. The solution can be optionally heated to a first temperature and maintained at a first temperature for a first time period suitable for hot start activation of nucleic acid polymerase.

[0175] Non-limiting examples of hot start mechanisms include, but are not limited to, antibodies or antibody combinations that block nucleic acid polymerase activity at lower temperatures and dissociate from the polymerase at elevated temperatures; affibodies or affibodies, sometimes referred to as antibody mimetics; oligonucleotides that block nucleic acid polymerase activity at lower temperatures and dissociate from the polymerase at elevated temperatures; reversible chemical modifications to nucleic acid polymerases that cause the activity of nucleic acid polymerases to be blocked at lower temperatures and that are reversed or dissociated at elevated temperatures; amino acid mutations of nucleic acid polymerases that provide reduced activity at lower temperatures; Nucleic acid polymerase fusion proteins; ligands that inhibit nucleic acid polymerase in a temperature-dependent manner; single-stranded binding proteins that sequester primers at low temperatures; thermostable pyrophosphatases that hydrolyze inorganic pyrophosphates at elevated temperatures; thermolabile blockers, such as polymerase blocking proteins; primer competing sequences; modified primer constructs; modified primers that improve hybridization selectivity; primers with 3' modifications that can be removed by 3'-5' exonuclease activity; primers with modified nucleobases that can be removed by ultraviolet irradiation; primer modifications that can be removed by thermal deprotection; or modifications of dNTPs with thermolabile modifying groups. Agents that act as hot start mechanisms, such as, but not limited to, antibodies, oligonucleotides, affibodies, chemical modifications, etc., can be referred to as "hot start inhibitors".

[0176] In some embodiments, the hot start composition comprises an antibody specific for a polymerase. In some embodiments, the hot start composition comprises an antibody specific for a polymerase, which binds to the polymerase. In some embodiments, the hot start composition comprises an inhibitor specific for a polymerase, which binds to the polymerase. In some embodiments, the inhibitor comprises an affibody. In some embodiments, the inhibitor comprises an oligonucleotide. In some embodiments, the inhibitor comprises a chemical modification. Many hot start polymerases are available from various commercial sources, such as Applied Biosystems; Bio-Rad; eEnzyme LLC; Eppendorf North America; Finnzymes Oy; Gene Choice, Inc.; Invitrogen; Jena Bioscience GmbH; MTDSCI; Minerva Biolabs GmbH; New England Biolabs; Novagen; Promega; QIAGEN; Roche Applied Science; Sigma-Aldrich; Stratagene; Takara Minis Bio; USB Corp.; Yorkshire Bioscience Ltd, etc.

[0177] In some embodiments of any of the various aspects of the present disclosure, a primer may comprise one or more parts. For example, a primer may comprise one or more amplification primer annealing sequences or their complements; one or more sequencing primer annealing sequences or their complements; one or more barcode sequences; one or more common sequences shared between multiple different primers; one or more restriction enzyme recognition sites; one or more probe binding sites or sequencing adapters (e.g., for attachment to a sequencing platform, such as a flow cell for massively parallel sequencing); one or more random or near-random sequences (e.g., one or more nucleotides randomly selected from a set of two or more different nucleotides at one or more positions, wherein each of the different nucleotides selected at one or more positions is represented in a primer pool comprising a random sequence); and combinations thereof.

[0178] Non-limiting examples of next generation sequencing methods are single molecule real-time sequencing, ion semiconductor sequencing, pyrophosphate sequencing, synthetic sequencing, ligation sequencing, and chain termination. The sequencing adapter for flow cell attachment can include any suitable sequence compatible with the next generation sequencing system, such as 454 sequencing, Ion Torrent Proton or PGM, and Illumina X10. Non-limiting examples of sequencing adapters for next generation sequencing methods include P5 and P7 adapters suitable for Illumina sequencing systems; TruSeq universal adapters; and TruSeq index adapters. In some embodiments, sequencing adapters can be used to enrich polynucleotides comprising adapter sequences, such as by amplification, such as polymerase chain reaction (PCR). The sequencing adapter may also include a barcode sequence and / or a sample index sequence.

[0179] In some embodiments, the primer comprises a barcode sequence. A barcode sequence refers to a known nucleic acid sequence that allows identification of certain features of a polynucleotide associated with a barcode. The length of each barcode may be in the range of 5 nucleotides to 35 nucleotides, 6 nucleotides to 30 nucleotides, or 8 nucleotides to 20 nucleotides. In some embodiments, the length of the barcode is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, the length of the barcode is less than 6 nucleotides. In some embodiments, the length of the barcode associated with some target polynucleotides may be different from the length of the barcode associated with other target polynucleotides. The melting temperature of a barcode within a group may be within ±10°C of each other, within ±5°C of each other, or within ±2°C of each other. A barcode may be a member of a minimum cross-hybridization group. For example, the nucleotide sequence of each member of the group may be sufficiently different from the nucleotide sequence of each other member of the group so that under moderate or stringent hybridization conditions, no member may form a stable duplex with the complementary sequence of any other member. The nucleotide sequence of each member of the minimal cross-hybridization set can differ from the nucleotide sequence of each other member by at least two nucleotides. Some barcoding technologies are described in Winzeler et al. (1999) Science 285:901; Brenner (2000) Genome Biol. 1:1 Kumar et al. (2001) Nature Rev. 2:302; Giaever et al. (2004) Proc. Natl. Acad. Sci. USA 101:793; Eason et al. (2004) Proc. Natl. Acad. Sci. USA 101:11046; and Brenner (2004) Genome Biol. 5:240, each of which is incorporated herein by reference in its entirety.

[0180] The amplification products (also referred to as amplicons) produced according to the methods herein can be analyzed by sequencing. A variety of sequencing methods can be used for sequencing of amplification products. In some embodiments, a high-throughput sequencing method is used. Non-limiting examples of sequencing methods that can be used include sequencing systems manufactured by Illumina (sequencing systems such as and ), sequencing systems manufactured by Life Technologies (Ion etc.), Roche's 454 Life Sciences system, Pacific Biosciences system, etc. In some embodiments, sequencing includes using and The system is used to generate a read of about or greater than about 50, 75, 100, 125, 150, 175, 200, 250, 300 nucleotides or longer in length. In some embodiments, sequencing includes a sequencing-by-synthesis process, wherein each nucleotide is iteratively identified when each nucleotide is added to the growing primer extension product. Pyrophosphate sequencing is an example of a sequencing-by-synthesis process, which identifies the incorporation of nucleotides by determining the presence of a sequencing reaction byproduct, i.e., pyrophosphate, in the resulting synthetic mixture. In particular, the primer / template / polymerase complex is contacted with a single type of nucleotide. If the nucleotide is incorporated, the polymerization reaction cleaves the nucleoside triphosphate between the α-phosphate and β-phosphate of the triphosphate chain, thereby releasing pyrophosphate. The presence of the released pyrophosphate is then identified using a chemiluminescent enzyme reporter system, which converts pyrophosphate to ATP with AMP, and then uses luciferase to measure ATP to generate a measurable light signal. In the case of detecting light, the base is then incorporated, and in the case of not detecting light, the base is not incorporated. After appropriate washing steps, each base is contacted with the complex in cycles to sequentially identify subsequent bases in the template sequence. See, e.g., U.S. Pat. No. 6,210,891.

[0181] In some embodiments, the amplified product is sequenced to obtain haplotype information. Haplotype information can include haplotype phasing. In some embodiments, determining haplotype phasing includes determining whether the polynucleotide is derived from a paternal chromosome or a maternal chromosome. In some embodiments, haplotype information can include haplotype construction or genetic phasing. Methods disclosed herein can be used to construct a diploid reference genome.

[0182] In some embodiments, the amplified product is sequenced to detect sequence variants, such as inversions, deletions, duplications, translocations, and rare somatic mutations, relative to a reference sequence or in the context of no mutation. In some embodiments, sequence variants are associated with a disease (e.g., cancer). In some embodiments, sequence variants are unrelated to a disease. Typically, sequence variants with statistical, biological, and / or functional evidence related to a disease or propensity are referred to as "causal genetic variants." A single causal genetic variation may be associated with more than one disease or propensity. In some cases, causal genetic variants may be associated with Mendelian genetic traits, non-Mendelian genetic traits, or both. Causal genetic variants may be expressed as variations in polynucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more sequence differences (e.g., between polynucleotides comprising causal genetic variants and polynucleotides without causal genetic variants at the same relative genomic position). Non-limiting examples of causal genetic variant types include single nucleotide polymorphisms (SNPs), deletion / insertion polymorphisms (DIPs), copy number variations (CNVs), short tandem repeats (STRs), restriction fragment length polymorphisms (RFLPs), simple repetitive sequences (SSRs), variable number tandem repeats (VNTRs), randomly amplified polymorphic DNA (RAPDs), amplified fragment length polymorphisms (AFLPs), inter-retrotransposon amplified polymorphisms (IRAPs), long and short interspersed elements (LINE / SINEs), long tandem repeats (LTRs), mobile elements, retrotransposon microsatellite amplified polymorphisms, insertion polymorphisms based on retrotransposons, sequence-specific amplified polymorphisms, and heritable epigenetic modifications (e.g., DNA methylation). Causal genetic variants can also be a group of closely related causal genetic variants. Some causal genetic variants can be used as sequence variations in RNA polynucleotides to exert influence. At this level, some causal genetic variants are also indicated by the presence or absence of RNA polynucleotide species. Similarly, some causal genetic variants can cause sequence variations in protein polypeptides. Many causal genetic variants have been reported. An example of a causal genetic variant that is a SNP is the Hb S variant of hemoglobin, which causes sickle cell anemia. An example of a causal genetic variant that is a DIP is the delta 508 mutation of the CFTR gene, which causes cystic fibrosis. An example of a causal genetic variant that is a CNV is trisomy 21, which causes Down syndrome. An example of a causal genetic variant that is a STR is a tandem repeat sequence, which causes Huntington's disease. Other non-limiting examples of causal genetic variants are described in WO2014015084. Other non-limiting examples of methods for identifying rare sequence variants are described in WO2015089333.

[0183] In some embodiments of any one of the various aspects of the present disclosure, the amplified product is purified before sequencing. The amplified product can be purified by various methods. The amplified product can be purified to remove excess or unwanted reagents, reactants or products. The amplified product can also be purified by size, sequence or other physical or chemical properties. In some embodiments, the amplicon can be subjected to size exclusion chromatography. In some embodiments, the amplified product can be subjected to fragment excision and gel filtration from the gel (e.g., to enrich for fragments greater than about 300, 400, 500 or more nucleotides in length); and SPRI magnetic beads (Agencourt AMPure XP) size selection is performed by fine-tuning the binding buffer concentration. For example, the use of 0.6x binding buffer during mixing with DNA fragments can be used to preferentially bind DNA fragments greater than about 500 base pairs (bp).

[0184] The embodiments of the present disclosure provided herein can be used to identify multiple sequence variants associated with one or more cancers. Suitable target sequences with oncological significance found to be useful in the methods disclosed herein include, but are not limited to, changes in TP53 genes, ALK genes, KRAS genes, PIK3CA genes, BRAF genes, EGFR genes, and KIT genes. The target sequence that can be specifically amplified and / or specifically analyzed for sequence variants can be all or part of a cancer-related gene. In some embodiments, one or more sequence variants are identified in the TP53 gene. TP53 is one of the most common mutant genes in human cancers, for example, TP53 mutations are found in 45% of ovarian cancers, 43% of colorectal cancers, and 42% of upper respiratory tract cancers (see, for example, M. Olivier, et al. TP53 Mutations in Human Cancers: Origins, Consequences, and Clinical Use. Cold Spring Harb Perspect Biol. January 2010; 2 (1)). Characterizing TP53 mutation status can contribute to clinical diagnosis, provide prognostic value, and affect the treatment of cancer patients. For example, TP53 mutations can be used as a predictor of poor prognosis in patients with CNS tumors derived from glial cells, and a predictor of rapid disease progression in patients with chronic lymphocytic leukemia (see, e.g., McLendon RE, et al. Cancer. 2005 Oct 15; 1 04 (8): 1693-9; Dicker F, et al. Leukemia. 2009 Jan; 23 (1): 117-24). Sequence variations can occur anywhere within the gene. Therefore, all or part of the TP53 gene can be evaluated herein. That is, as described elsewhere herein, when a target-specific component (e.g., using a target-specific primer), multiple TP53-specific sequences can be used, for example, for amplifying and detecting fragments across the gene, rather than only one or more selected subsequences (e.g., mutation "hotspots") that can be used for a selected target. Alternatively, target-specific primers can be designed that hybridize upstream or downstream of one or more selected subsequences (such as nucleotides or regions of nucleotides associated with increased mutation rates in a class of subjects, also encompassed by the term "hotspot").

[0185] Other non-limiting examples of cancer-associated genes (all or a portion of which can be analyzed for sequence variants according to the methods described herein) include, but are not limited to, PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch 1; Notch 2; Notch 3; Notch 4; AKT; AKT2; AKT3; HIF; HIFla; HIF3a; Met; HRG; Bcl2; PPARα; PPARγ; WT1 (Wilms tumor); FGF receptor family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (androgen receptor); TSG101; IGF; IGF receptor; Igfl (4 variants); Igf2 (3 variants); Igf1 receptor; Igf2 receptor; Bax; Bcl2; caspase family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras and Ape.

[0186] Examples of cancers that may be associated with the selected gene sequences include, but are not limited to, acanthoma, acinar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, terminal duct carcinoma, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, mature acute myeloblastic leukemia, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, adamantoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adrenal cortical carcinoma, adult T-cell leukemia, aggressive NK-cell leukemia, AIDS-related cancer, AIDS-related lymphoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anal carcinoma, anaplastic large cell lymphoma, anaplastic thyroid cancer , angioimmunoblastic T-cell lymphoma, angiomyolipoma, angiosarcoma, appendix cancer, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, basaloid carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, biliary tract cancer, bladder cancer, germ cell tumor, bone cancer, osteoma, brain stem glioma, brain tumor, breast cancer, Brenner tumor, bronchial tumor, bronchioalveolar carcinoma, brown tumor, Burkitt lymphoma, cancer of unknown primary site, carcinoid tumor, carcinoma, carcinoma in situ, penile cancer, cancer of unknown primary site, carcinosarcoma, Castleman disease, embryonal tumor of the central nervous system, cerebellar astrocytoma, brain astrocytoma, cervical cancer, bile duct cancer, enchondroma, chondrosarcoma, chordoma, choriocarcinoma, choroid plexus Papilloma, chronic lymphocytic leukemia, chronic monocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, chronic neutrophilic leukemia, clear cell tumor, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, Degos disease, dermatofibrosarcoma protuberans, dermoid cyst, desmoplastic small round cell tumor, diffuse large B-cell lymphoma, dysembryoplastic neuroepithelioma, embryonal carcinoma, endodermal sinus tumor, endometrial cancer, endometrial uterine cancer, endometrioid tumor, enteropathy-associated T-cell lymphoma, ependymoma, ependymoma, epithelioid sarcoma, erythroleukemia, esophageal cancer, nasal glioma, Ewing family tumors, Ewing family sarcoma, Ewing sarcoma, extracranial Germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, extramammary Paget's disease, fallopian tube cancer, fetus in fetus, fibroma, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, gallbladder cancer, gallbladder cancer, ganglioglioma, ganglioneuroma, gastric cancer, gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gastrointestinal stromal tumor, germ cell tumor, germ cell tumor, gestational choriocarcinoma, gestational trophoblastic tumor, giant cell tumor of bone, glioblastoma multiforme, glioma, glioma of the brain, angioneuroma, glucagonoma, gonadal blastoma, granulosa cell tumor, hairy cell leukemia, hairy cell leukemia, head and neck cancer, head and neck cancer, heart cancer, hemangioblastoma, hemangiopericytoma, hemangioendothelioma,Hematological malignancies, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, hereditary breast-ovarian cancer syndrome, Hodgkin's lymphoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell carcinoma, islet cell tumor, juvenile myelomonocytic leukemia, Kaposi's sarcoma, Kaposi's sarcoma, renal cancer, hilar bile duct tumor, ovarian Krugenberg tumor, laryngeal cancer, laryngeal cancer, malignant lentigo melanoma, leukemia, leukemia, lip and oral cancer, liposarcoma, lung cancer, luteoma, lymphangioma, lymphangiosarcoma, lymphoepithelioma, lymphoid leukemia, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, malignant fibrous histiocytoma of bone, malignant glioma, Malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rhabdoid tumor, malignant salamander tumor, MALT lymphoma, mantle cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid carcinoma, medulloblastoma, medulloblastoma, medullary epithelioma, melanoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, mesothelioma, primary occult metastatic squamous neck cancer, metastatic urothelial carcinoma, mixed tumor of the Mullerian type, monocytic leukemia, oral cancer, mucinous tumor, multiple endocrine neoplasia syndrome, multiple myeloma, multiple myeloma, mycosis fungoides, mycosis fungoides, myelodysplastic disease, myelodysplastic syndrome, myeloid leukemia, myeloid sarcoma, myeloproliferative disease disease, myxoma, nasal cancer, nasopharyngeal cancer, nasopharyngeal cancer, neoplasm, schwannoma, neuroblastoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-Hodgkin lymphoma, non-Hodgkin lymphoma, non-melanoma skin cancer, non-small cell lung cancer, eye tumor, oligoastrocytoma, oligodendroglioma, eosinophilic adenoma, optic nerve sheath meningioma, oral cancer, oral cancer, oropharyngeal cancer, osteosarcoma, osteosarcoma, ovarian cancer, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, breast Paget's disease, superior pulmonary sulcus tumor, pancreatic cancer, pancreatic cancer, papillary thyroid cancer, papillomatosis, paraganglioma, paranasal sinus cancer, parathyroid cancer, penile cancer, perivascular epithelioid cell tumor, pharyngeal Laryngeal cancer, pheochromocytoma, moderately differentiated pineal parenchymal tumor, pinealoblastoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasmacytoma, pleuropulmonary blastoma, polyembryoma, precursor T-lymphoblastic lymphoma, primary central nervous system lymphoma, primary effusion lymphoma, primary hepatocellular carcinoma, primary liver cancer, primary peritoneal cancer, primitive neuroectodermal tumor, prostate cancer, pseudomyxoma peritonei, rectal cancer, renal cell carcinoma, respiratory cancer involving the NUT gene on chromosome 15, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, Richter's transformation, sacrococcygeal teratoma, salivary gland cancer, sarcoma, Schwannoma neurothecoma, sebaceous gland carcinoma, secondary tumors, seminoma, serous tumors,Sertoli-Leydig cell tumor of the ovary tumor), sex cord-stromal tumor, Sezary syndrome, signet ring cell carcinoma, skin cancer, small blue round cell tumor, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestinal cancer, soft tissue sarcoma, somatostatinoma, sooty warts, spinal cord tumor, spinal tumor, splenic marginal zone lymphoma, squamous cell carcinoma, gastric cancer, superficial spreading melanoma, supratentorial primitive neuroectodermal tumor, surface epithelial-stromal tumor, synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphocytic leukemia, T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, teratoma, advanced lymphoma, testicular cancer, thecoma, laryngeal cancer, thymic cancer, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, transitional cell carcinoma, urachal carcinoma, urethral cancer, genitourinary tumors, uterine sarcoma, uveal melanoma, vaginal cancer, Verner Morrison syndrome, verrucous carcinoma, optic pathway glioma, vulvar carcinoma, Waldenstrom macroglobulinemia, Warthin tumor, Wilms tumor, and combinations thereof.

[0187] Example

[0188] The following examples are given to illustrate various embodiments of the present disclosure and are not meant to limit the present disclosure in any way. The examples and methods described herein are exemplary and are not intended to limit the scope of the present disclosure.

[0189] Example 1: X1 and X2 homodimeric transposome complexes

[0190] To generate a transposome complex containing X1-ME, equimolar DNA oligonucleotides transposon X1-ME: GTAGGTGTGAGTGATGGTTGAGGTAGT-AGATGTGTATAAGAGACAG (SEQ ID NO: 1) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooling to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form a transposome complex (Tn5-X1-ME).

[0191] To generate a transposome complex containing X2-ME, equimolar DNA oligonucleotides transposon X2-ME: GTGAGTGATGGTTGAGGTAGTGTGGAG-AGATGTGTATAAGAGACAG (SEQ ID NO: 3) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooling to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form a transposome complex (Tn5-X2-ME).

[0192] 10pg of genomic DNA was incubated with the transposome complex Tn5-X1-ME at 55°C for 15 minutes in the presence of 5mM MgCl2. 1uL of 2mg / ml protease was then added to the reaction. The reaction was then incubated at 50°C for 10 minutes and then at 72°C for 15 minutes.

[0193] In single primer preamplification, the fragmented double-stranded DNA was incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs and 0.5uM of the following primer in a 20uL reaction: GTAGGTGTGAGTGATGGTTGAGGTAGTAGATGTGTATAAGAGACAG (SEQ ID NO: 1). The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 16 cycles of 98°C for 15 seconds and 72°C for 3 minutes and 30 seconds.

[0194] For the second labeling, the preamplification product was then incubated with the transposome complex Tn5-X2-ME in the presence of MgCl2 at 55°C for 10 minutes. The second labeling product was then purified by DNA Clean&Concentrator-5 (Zymo Research). The fragmented double-stranded DNA was then incubated in a 20uL reaction with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs, and 0.5uM index primer mixture. The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 8 cycles of 98°C for 15 seconds, 63°C for 30 seconds, and 72°C for 3 minutes and 30 seconds.

[0195] The resulting amplification products were purified to serve as libraries for sequencing on an Illumina HiSeq X or NovaSeq sequencer for paired-end reads.

[0196] Example 2: X1 and X2 homodimers and heterodimers transposome complexes

[0197] To generate the X1-ME transposome complex, equimolar DNA oligonucleotides transposon X1-ME: GTAGGTGTGAGTGATGGTTGAGGTAGT-AGATGTGTATAAGAGACAG (SEQ ID NO: 1) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooled to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form a transposome complex (Tn5-X1-ME).

[0198] To generate the X2-ME transposome complex, equimolar DNA oligonucleotides transposon X2-ME: GTGAGTGATGGTTGAGGTAGTGTGGAG-AGATGTGTATAAGAGACAG (SEQ ID NO: 3) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooling to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form a transposome complex (Tn5-X2-ME).

[0199] In the presence of 5mM MgCl2, 10pg of genomic DNA was incubated with the transposome complex Tn5-X1-ME at 55°C for 15 minutes. 1uL of 2mg / ml protease was then added to the reaction. The reaction was then incubated at 50°C for 10 minutes and then at 72°C for 15 minutes.

[0200] In single primer preamplification, the fragmented double-stranded DNA was incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTP, 0.5μM of the following primer in a 20uL reaction: GTAGGTGTGAGTGATGGTTGAGGTAGTAGATGTGTATAAGAGACAG (SEQ ID NO: 1). The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 16 cycles of 98°C for 15 seconds and 72°C for 3 minutes and 30 seconds.

[0201] For the second tagging, the preamplification product was then incubated with the transposome complexes Tn5-X1-ME and Tn5-X2-ME at 55°C for 10 minutes in the presence of MgCl2. The second tagging product was then purified by DNA Clean&Concentrator-5 (ZymoResearch). The fragmented double-stranded DNA was incubated in a 20uL reaction with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs, and 0.5uM index primer mixture. The reaction was performed under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 8 cycles of 98°C for 15 seconds, 63°C for 30 seconds, and 72°C for 3 minutes and 30 seconds.

[0202] The resulting amplification products were purified to serve as libraries for sequencing on an Illumina HiSeq X or NovaSeq sequencer for paired-end reads.

[0203] Example 3: Generation of identifiable sense and antisense strands

[0204] To generate the transposome complex, equimolar DNA oligonucleotides transposon ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 4) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95°C for 1 minute and then cooling to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form the transposome complex Tn5-ME.

[0205] 10 pg of genomic DNA was incubated with the transposome complex Tn5-ME in the presence of 5 mM MgCl2 at 55°C for 15 minutes. 1 uL of 2 mg / ml protease was added to the reaction, followed by incubation at 50°C for 10 minutes and then at 72°C for 15 minutes.

[0206] In the first primer extension, the fragmented double-stranded DNA was incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs and 0.5uM of the following primer X1-ME in a 20uL reaction: GTAGGTGTGAGTGATGGTTGAGGTAGTAGATGTGTATAAGAGACAG (SEQ ID NO: 1). The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, and then 72°C for 3 minutes and 30 seconds. Exonuclease I was then added to the reaction to digest excess X1-ME oligonucleotide. The reaction was incubated at 80°C for 15 minutes.

[0207] For the second primer extension, the previous product was incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs and 0.5uM of the following primer X2-ME in a 20uL reaction: GTGAGTGATGGTTGAGGTAGTGTGGAG-AGATGTGTATAAGAGACAG (SEQ ID NO: 3). The reaction was performed under the following conditions: 98°C for 2 minutes, then 72°C for 3 minutes and 30 seconds. Exonuclease I was then added to the reaction to digest excess X2-ME oligonucleotide, followed by incubation at 80°C for 15 minutes.

[0208] For PCR indexing, primer extension products were incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs and 0.5uM index primer mixture in a 30uL reaction. The reaction was performed under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 8 cycles of 98°C for 15 seconds, 63°C for 30 seconds and 72°C for 3 minutes and 30 seconds.

[0209] The resulting amplification products were purified to serve as libraries for sequencing on an Illumina HiSeq X or NovaSeq sequencer for paired-end reads.

[0210] Example 4: Tagging with asymmetric mixtures of transposome complexes

[0211] To generate the transposome complex, equimolar DNA oligonucleotides transposon X1-ME: GTAGGTGTGAGTGATGGTTGAGGTAGT-AGATGTGTATAAGAGACAG (SEQ ID NO: 1) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooled to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form the transposome complex Tn5-X1-ME.

[0212] To generate the transposome complex, equimolar DNA oligonucleotides transposon X2-ME: GTGAGTGATGGTTGAGGTAGTGTGGAG-AGATGTGTATAAGAGACAG (SEQ ID NO: 3) and ME': (5phos)-CTGTCTCTTATACACATCT (SEQ ID NO: 2) were annealed in the presence of 1×STE (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) by incubation at 95° C. for 1 minute and then cooling to room temperature. The double-stranded transposon was then incubated with Tn5 transposase at a molar ratio of 1.2:1 at room temperature for 30 minutes to form the transposome complex Tn5-X2-ME. The transposome complexes Tn5-X1-ME and Tn5-X2-ME were mixed at a molar ratio of 1:9 to form a mixture of asymmetric transposome complexes.

[0213] In the presence of 5 mM MgCl2, 10 pg of genomic DNA was incubated with the asymmetric transposome complex Tn5-X1-ME:Tn5-X2-ME at 55°C for 15 minutes. 1 uL of 2 mg / ml protease was then added to the reaction, followed by incubation at 50°C for 10 minutes and then at 72°C for 15 minutes.

[0214] In single primer preamplification, the fragmented double-stranded DNA was incubated with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs and 0.5uM of the following primer in a 20uL reaction: GTAGGTGTGAGTGATGGTTGAGGTAGTAGATGTGTATAAGAGACAG (SEQ ID NO: 1). The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 16 cycles of 98°C for 15 seconds and 72°C for 3 minutes and 30 seconds.

[0215] For the second tagging, the preamplification product was then incubated with the transposome complexes Tn5-X1-ME and Tn5-X2-ME at 55°C for 10 minutes in the presence of MgCl2. The second tagging product was then purified by DNA Clean&Concentrator-5 (ZymoResearch). The fragmented double-stranded DNA was incubated in a 20uL reaction with 1×Q5 reaction buffer, 0.02U / uL Q5 hot start high-fidelity DNA polymerase (New England BioLabs Inc), 200uM dNTPs, and 0.5uM index primer mixture. The reaction was carried out under the following conditions: 72°C for 3 minutes; 98°C for 2 minutes, followed by 8 cycles of 98°C for 15 seconds, 63°C for 30 seconds, and 72°C for 3 minutes and 30 seconds.

[0216] The resulting amplification products were purified to serve as libraries for sequencing on an Illumina HiSeq X or NovaSeq sequencer for paired-end reads.

[0217] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Without departing from the present invention, those skilled in the art will now expect many variations, changes and replacements. It should be understood that various alternatives of the embodiments of the present invention described herein can be used to implement the present invention. It is intended that the appended claims define the scope of the present invention, and thus encompass methods and structures and equivalents thereof within the scope of these claims.

[0218] Exemplary embodiments

[0219] In an exemplary embodiment: 1. A method for characterizing a polynucleotide in a sample, comprising: (a) contacting a double-stranded polynucleotide in a sample with a first group of transposome complexes, the first group comprising transposome complexes having a first transposon sequence, to produce a first plurality of overhanging end fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhanging end fragments to an extension reaction to produce a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to produce copies of the first plurality of blunt-end fragments or fragments thereof; (d) contacting the first plurality of blunt-end fragments or fragments thereof with a second group of transposome complexes, the second group comprising transposome complexes having a second transposon sequence, to produce a second plurality of overhanging end fragments comprising the second transposon sequence at the 5' end; (e) subjecting the second plurality of overhanging end fragments to an additional extension reaction to produce a second plurality of blunt-end fragments; and (f) generating sequence reads from the second plurality of blunt-end fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotide in the sample. 2. The method according to embodiment 1, wherein the first transposon sequence and the second transposon sequence are not the same. 3. The method according to embodiment 1, wherein the second group further comprises a transposome complex having the first transposon sequence. 4. The method according to embodiment 1, wherein the second group further comprises a transposome complex having a third transposon sequence. 5. A method for characterizing polynucleotides in a sample, comprising: (a) contacting a double-stranded polynucleotide in a sample with a first group of transposome complexes, each of which comprises a first transposon sequence, to produce a first plurality of overhanging end fragments comprising the first transposon sequence at the 5' end; (b) subjecting the first plurality of overhanging end fragments to an extension reaction to produce a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to produce copies of the first plurality of blunt-end fragments or fragments thereof; (d) contacting the first plurality of blunt-end fragments or fragments thereof with a second group of transposome complexes, each of which comprises a second transposon sequence, to produce a second plurality of overhang fragments comprising the second transposon sequence at the 5' end, wherein the first group of transposome complexes and the second group of transposome complexes differ in that: (i) the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes; and / or (ii) one group of transposome complexes used in step (a) or (d) is a homodimeric transposome and the other group of transposome complexes used is a heterodimeric transposome; (e) subjecting the second plurality of overhang fragments to an additional extension reaction to generate a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotides in the sample.6. The method according to embodiment 5, wherein the first group of transposome complexes and the second group of transposome complexes differ in that the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes. 7. The method according to embodiment 5, wherein the first group of transposome complexes and the second group of transposome complexes differ in that one group of transposome complexes used in step (a) or (d) is a homodimeric transposome, and the other group of transposome complexes used is a heterodimeric transposome. 8. The method according to embodiment 5, wherein step (d) comprises contacting the first plurality of blunt-ended fragments or fragments thereof with at least two additional groups of transposome complexes, wherein each group of the additional groups of transposome complexes comprises a homodimeric transposome, and wherein the transposon sequences of each group are unique. 9. The method according to any one of embodiments 1 to 8, wherein the double-stranded polynucleotide comprises genomic DNA. 10. The method according to embodiment 9, wherein the genomic DNA is from a single cell. 11. The method according to any of the preceding embodiments, wherein the double-stranded polynucleotide comprises a chromosome. 12. The method according to any of the preceding embodiments, wherein the double-stranded polynucleotide is from a single cell. 13. The method according to any of the preceding embodiments, wherein characterizing the double-stranded polynucleotide produces haplotype information. 14. The method according to any of the preceding embodiments, wherein characterizing the double-stranded polynucleotide comprises identifying a structural variation in the polynucleotide, wherein the structural variation is a copy number variation (CNV), an insertion, a deletion, a translocation, a retrotransposon, an inversion, a rearrangement, a repeat expansion, or a duplication. 15. The method according to any of the preceding embodiments, wherein the double-stranded polynucleotide is at least about 1 megabase (Mb) in length. 16. The method according to any of the preceding embodiments, wherein the first plurality of blunt-ended fragments comprises fragments of at least about 500 bases in length. 17. The method according to any of the preceding embodiments, wherein the second plurality of blunt-ended fragments comprises fragments of at least about 100 bases in length. 18. The method according to any of the preceding embodiments, wherein each single-stranded polynucleotide of the first plurality of blunt-ended fragments forms a stem-loop structure. 19. The method according to embodiment 18, wherein the stem-loop structure comprises a stem of at least 10 base pairs in length. 20. The method according to embodiment 18, wherein the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C. 21. The method according to any of the preceding embodiments, further comprising attaching a sequencing adaptor to the second plurality of blunt-ended fragments to produce the derivatives thereof. 22. The method according to any of the preceding embodiments, wherein each transposome complex of the first group and / or the second group comprises a transposase selected from the group consisting of Tn transposase, MuA transposase, and Vibhar transposase.23. The method according to embodiment 22, wherein the transposase is a Tn transposase selected from Tn3, Tn5, Tn7 and Tn10. 24. A method for identifying a low frequency allele, comprising: (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhanging end fragments comprising the transposon sequence at the 5' end; (b) subjecting the plurality of overhanging end fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a first plurality of barcoded polynucleotides comprising the second barcode sequence (X2) at the 5' end and the first barcode sequence at the 3' end; (e) generating sequence reads from the second plurality of barcoded polynucleotides or derivatives thereof to generate a plurality of sequence reads; and (f) identifying the low-frequency allele in the double-stranded polynucleotide when the low-frequency allele appears in the sequence reads of both the sense strand and the antisense strand of the double-stranded polynucleotide, wherein (i) the sequence reads comprising (a) the sense strand sequence X2 and X1' or (b) the reverse complement sequence (X2') of the antisense strand sequence X1 and X2 from the 5' end to the 3' end are identified as being derived from the sense strand of the double-stranded polynucleotide, and (ii) the sequence reads comprising (a) the sense strand sequence X1 and X2' or (b) the antisense strand sequence X2 and X1' from the 5' end to the 3' end are identified as being derived from the antisense strand of the double-stranded polynucleotide.25. A method for identifying sequence variants, comprising: (a) contacting a double-stranded polynucleotide with a transposome complex, each transposome complex comprising a transposon sequence, to generate a plurality of overhang fragments comprising the transposon sequence at the 5' end; (b) subjecting the plurality of overhang fragments to an extension reaction to generate a plurality of blunt-end fragments; (c) performing a first primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1) to generate a first plurality of barcoded polynucleotides comprising the first barcode sequence (X1) at the 5' end; (d) performing a second primer-directed extension reaction with a primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2) to generate a reverse sequence comprising the second barcode sequence (X2) at the 5' end and the first barcode sequence at the 3' end; 26. The method of embodiment 24 or 25, wherein the double-stranded polynucleotide comprises genomic DNA. 27. The method of embodiment 26, wherein the genomic DNA is from a single cell. 28. The method of any one of embodiments 24 or 25, wherein the double-stranded polynucleotide comprises cell-free DNA. 29. The method of any one of embodiments 24 to 28, wherein the double-stranded polynucleotide is at least 1 megabase (Mb) in length. 30. The method of any one of embodiments 24 to 29, wherein the plurality of blunt-ended fragments comprises fragments of at least 100 bases in length. 31. The method of any one of embodiments 24 to 30, further comprising attaching a sequencing adapter to the second plurality of barcoded polynucleotides to produce the derivatives thereof. 32. The method of any one of embodiments 24 to 31, wherein each transposome complex comprises a transposase selected from the group consisting of a Tn transposase, a MuA transposase, and a Vibhar transposase. 33. The method of embodiment 32, wherein the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10. 34. The method of embodiment 24, wherein the allele frequency of the low-frequency allele in the population is less than 5%.35. The method of embodiment 24, wherein the low frequency allele is detected with an accuracy of at least 85%. 36. The method of embodiment 25, wherein the sequence variant represents less than 5% of the double-stranded polynucleotides in the nucleic acid sample. 37. The method of embodiment 25, wherein the sequence variant is detected with an accuracy of at least 85%. 38. The method of embodiment 36, wherein the nucleic acid sample comprises cell-free polynucleotides. 39. The method of embodiment 36, wherein the nucleic acid sample is from a single cell. 40. A method for selectively sampling a subset of regions of a polynucleotide, comprising: (a) contacting a double-stranded polynucleotide with a first set of transposome complexes to generate a first plurality of overhang fragments comprising a first transposon sequence or a second transposon sequence at the 5' end, wherein the first set of transposome complexes comprises a mixture of (i) a homodimeric transposase comprising the first transposon sequence and (ii) a homodimeric transposase comprising the second transposon sequence; (b) subjecting the first plurality of overhang fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction with a primer comprising the first transposon sequence or a portion thereof to select (d) contacting the first plurality of blunt-ended fragments or fragments thereof comprising the first transposon sequence with a second set of transposome complexes to produce a second plurality of overhanging fragments, wherein the second set of transposome complexes comprises (i) a plurality of homodimeric transposases or (ii) a plurality of heterodimeric transposases; (e) subjecting the second plurality of overhanging fragments to an additional extension reaction to produce a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof, thereby selectively sampling a subset of regions of the double-stranded polynucleotide. 41. The method according to embodiment 40, wherein the second set of transposome complexes comprises a plurality of homodimeric transposases. 42. The method according to embodiment 40, wherein the second set of transposome complexes comprises a plurality of heterodimeric transposases. 43. The method of any one of embodiments 40 to 42, wherein in the mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence, (i) and (ii) are present in a molar ratio of about 1:9. 44. The method of any one of embodiments 40 to 43, wherein in the mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence, (i) and (ii) are present in a molar ratio not equal to 1:1. 45. The method of any one of embodiments 40 to 44, wherein the mixture of (a) further comprises (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence.46. ​​The method of embodiment 45, wherein in the mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (i) is less than the molar concentration of (ii) and (iii). 47. The method of embodiment 45, wherein in the mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (ii) is less than the molar concentration of (i) and (iii). 48. The method of embodiment 45, wherein in the mixture of (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence, the molar concentration of (iii) is less than the molar concentration of (i) and (ii). 49. The method of any one of embodiments 40 to 48, wherein the first plurality of overhang fragments comprises (i) fragments comprising a first transposon sequence, (ii) fragments comprising a second transposon sequence, and (iii) fragments comprising both a first transposon sequence and a second transposon sequence, wherein the molar concentration of (i) is less than the molar concentration of (ii) and (iii). 50. The method of any one of embodiments 40 to 49, wherein the double-stranded polynucleotide comprises genomic DNA. 51. The method of embodiment 50, wherein the genomic DNA is from a single cell. 52. The method of any one of embodiments 40 to 51, wherein the double-stranded polynucleotide comprises a chromosome. 53. The method according to any one of embodiments 40 to 52, wherein the double-stranded polynucleotide is from a single cell. 54. The method according to any one of embodiments 40 to 53, wherein the double-stranded polynucleotide is at least 1 megabase (Mb) in length. 55. The method according to any one of embodiments 40 to 54, wherein the first plurality of blunt-ended fragments comprises fragments of at least 500 bases in length. 56. The method according to any one of embodiments 40 to 55, wherein the second plurality of blunt-ended fragments comprises fragments of at least 100 bases in length. 57. The method according to any one of embodiments 40 to 56, wherein the single-stranded polynucleotides of the first plurality of blunt-ended fragments comprising (i) the first transposon sequence at the 5' end and the reverse complement of the first transposon sequence at the 3' end, or (ii) the second transposon sequence at the 5' end and the reverse complement of the second transposon sequence at the 3' end form a stem-loop structure. 58. The method according to embodiment 57, wherein the stem-loop structure comprises a stem of at least 10 base pairs in length.59. The method of embodiment 57, wherein the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C. 60. The method of any one of embodiments 40 to 59, further comprising attaching a sequencing adapter to the second plurality of blunt-ended fragments to produce the derivative. 61. The method of any one of embodiments 40 to 60, wherein each transposome complex of the first group and / or the second group comprises a transposase selected from Tn transposase, MuA transposase, and Vibhar transposase. 62. The method of embodiment 61, wherein the transposase is a Tn transposase selected from Tn3, Tn5, Tn7, and Tn10. 63. A composition comprising a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence. 64. The composition of embodiment 63, wherein (i) and (ii) are present in a molar ratio of about 1:9. 65. The composition of embodiment 63, wherein (i) and (ii) are present in a molar ratio that is not equal to 1:1. 66. The composition of embodiment 63, further comprising (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence. 67. The composition of embodiment 66, wherein the molar concentration of (i) is less than the molar concentration of (ii) and (iii). 68. The composition of embodiment 63, wherein the molar concentration of (ii) is less than the molar concentration of (i) and (iii). 69. The composition of embodiment 63, wherein the molar concentration of (iii) is less than the molar concentration of (i) and (ii). 70. A reaction mixture comprising: (a) a mixture of (i) a homodimeric transposase comprising a first transposon sequence and (ii) a homodimeric transposase comprising a second transposon sequence; and (b) a double-stranded polynucleotide comprising genomic DNA. 71. The reaction mixture of embodiment 70, further comprising (iii) a heterodimeric transposase comprising a first transposon sequence and a second transposon sequence. 72. The reaction mixture of embodiment 70, wherein the genomic DNA is from a single cell. 73. The reaction mixture of embodiment 70, wherein the genomic DNA is a single chromosome.74. A kit comprising: (a) a first group of transposome complexes, each of which comprises a first transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second group of transposome complexes, each of which comprises a second transposon sequence; and (d) instructions for implementing the method according to embodiment 1 or embodiment 5, wherein the first group of transposome complexes and the second group of transposome complexes differ in that: (i) the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes; and / or (ii) one group of transposome complexes used in step (a) or (d) of the method according to embodiment 1 is a homodimeric transposome, while the other group of transposome complexes used is a heterodimeric transposome. 75. A kit comprising: (a) transposome complexes, each transposome complex comprising a transposon sequence; (b) a first primer comprising the transposon sequence or a portion thereof and a first barcode sequence (X1); (c) a second primer comprising the transposon sequence or a portion thereof and a second barcode sequence (X2); and (d) instructions for implementing the method according to embodiment 24 or 25. 76. A kit comprising: (a) a first set of transposome complexes comprising (i) a homodimeric transposase comprising a first transposon sequence, (ii) a homodimeric transposase comprising a second transposon sequence, and optionally (iii) a heterodimeric transposase comprising the first transposon sequence and the second transposon sequence; (b) a primer comprising the first transposon sequence or a portion thereof; (c) a second set of transposome complexes comprising (i) a plurality of homodimeric transposases, or (ii) a plurality of heterodimeric transposases; and (d) instructions for implementing the method according to embodiment 40. Sequence Listing <110> Sina Biotech (Beijing) Co., Ltd. <120> Methods and compositions for preparing polynucleotides <130> 53081-702.601 <140> <141> <150> 62 / 663,967 <151> 2018-04-27 <160> 4 <170> PatentIn Version 3.5 <210> 1 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic Primers <400> 1 gtaggtgtga gtgatggttg aggtagtaga tgtgtataag agacag 46 <210> 2 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic Oligonucleotides <400> 2 ctgtctctta tacacatct 19 <210> 3 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic Primers <400> 3 gtgagtgatg gttgaggtag tgtggagaga tgtgtataag agacag 46 <210> 4 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic Oligonucleotides <400> 4 agatgtgtat aagagacag 19

Claims

1. A method for characterizing polynucleotides in a sample, comprising: (a) contacting double-stranded polynucleotides in a sample with a first group of transposome complexes, the first group comprising transposome complexes having a first transposon sequence, to generate a first plurality of overhang fragments comprising the first transposon sequence at the 5′ end; the first group of transposome complexes are homodimeric transposomes, the transposon sequences of the homodimers are identical transposon sequences, and the transposon sequences comprise transposon elements and additional sequences; (b) subjecting the first plurality of overhang-end fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction using a primer comprising the first transposon sequence or a portion thereof to generate copies of the first plurality of blunt-ended fragments or fragments thereof; (d) contacting the first plurality of blunt-ended fragments or fragments thereof with a second set of transposome complexes, the second set comprising transposome complexes having a second transposon sequence, to generate a second plurality of overhanging fragments comprising the second transposon sequence at the 5′ end; (e) subjecting the second plurality of overhanging end fragments to an additional extension reaction to generate a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotides in the sample; The double-stranded polynucleotide is derived from a single cell; The first transposon sequence and the second transposon sequence are not identical. 2 . The method of claim 1 , wherein the second group further comprises a transposome complex having the first transposon sequence.

3. The method of claim 1, wherein the second group further comprises a transposome complex having a third transposon sequence.

4. The method of claim 2, wherein the second group further comprises a transposome complex having a third transposon sequence.

5. A method for characterizing polynucleotides in a sample, comprising: (a) contacting double-stranded polynucleotides in a sample with a first group of transposome complexes, each of which comprises a first transposon sequence, to generate a first plurality of overhang fragments comprising the first transposon sequence at the 5′ end; (b) subjecting the first plurality of overhang-end fragments to an extension reaction to generate a first plurality of blunt-end fragments; (c) performing a primer-directed extension reaction using a primer comprising the first transposon sequence or a portion thereof to generate copies of the first plurality of blunt-ended fragments or fragments thereof; (d) contacting the first plurality of blunt-ended fragments or fragments thereof with a second set of transposome complexes, each of which comprises a second transposon sequence, to generate a second plurality of overhanging fragments comprising the second transposon sequence at the 5′ end, wherein the first set of transposome complexes and the second set of transposome complexes differ in that: (i) the transposon sequences contained therein are different between the first group of transposome complexes and the second group of transposome complexes; and / or (ii) the group of transposome complexes used in step (a) are homodimeric transposomes, and the group of transposome complexes used in step (d) are heterodimeric transposomes, the transposon sequences of the homodimers are the same transposon sequences, and the transposon sequences of the heterodimers are different transposon sequences, the transposon sequences comprising transposon elements and additional sequences, wherein the transposon sequences comprised therein are different between the first group of transposome complexes and the second group of transposome complexes; (e) subjecting the second plurality of overhanging end fragments to an additional extension reaction to generate a second plurality of blunt-ended fragments; and (f) generating sequence reads from the second plurality of blunt-ended fragments or derivatives thereof, thereby characterizing the double-stranded polynucleotides in the sample; The double-stranded polynucleotide is derived from a single cell.

6. The method of claim 5, wherein step (d) comprises contacting the first plurality of blunt-ended fragments or fragments thereof with at least two additional groups of transposome complexes, wherein each of the two additional groups of transposome complexes comprises a homodimeric transposome, and wherein the transposon sequences of the respective groups are unique.

7. The method according to any one of claims 1 to 6, wherein the double-stranded polynucleotide comprises genomic DNA.

8. The method of claim 7, wherein the genomic DNA is from a single cell.

9. The method of claim 1, wherein the double-stranded polynucleotide comprises a chromosome.

10. The method of claim 5, wherein the double-stranded polynucleotide comprises a chromosome.

11. The method of claim 1, wherein characterizing the double-stranded polynucleotide produces haplotype information.

12. The method of claim 5, wherein characterizing the double-stranded polynucleotide produces haplotype information.

13. The method of claim 1, wherein characterizing the double-stranded polynucleotide comprises identifying a structural variation in the polynucleotide, wherein the structural variation is a copy number variation (CNV), an insertion, a deletion, a translocation, a retrotransposon, an inversion, a rearrangement, a repeat expansion, or a duplication.

14. The method of claim 5, wherein characterizing the double-stranded polynucleotide comprises identifying a structural variation in the polynucleotide, wherein the structural variation is a copy number variation (CNV), an insertion, a deletion, a translocation, a retrotransposon, an inversion, a rearrangement, a repeat expansion, or a duplication.

15. The method of claim 1, wherein the double-stranded polynucleotide is at least 1 megabase (Mb) in length.

16. The method of claim 5, wherein the double-stranded polynucleotide is at least 1 megabase (Mb) in length.

17. The method of claim 1, wherein the first plurality of blunt-ended fragments comprises fragments of at least 500 bases in length.

18. The method of claim 5, wherein the first plurality of blunt-ended fragments comprises fragments of at least 500 bases in length.

19. The method of claim 1, wherein the second plurality of blunt-ended fragments comprises fragments of at least 100 bases in length.

20. The method of claim 5, wherein the second plurality of blunt-ended fragments comprises fragments of at least 100 bases in length.

21. The method of claim 1, wherein each single-stranded polynucleotide of the first plurality of blunt-ended fragments forms a stem-loop structure.

22. The method of claim 5, wherein each single-stranded polynucleotide of the first plurality of blunt-ended fragments forms a stem-loop structure.

23. The method of claim 21, wherein the stem-loop structure comprises a stem that is at least 10 base pairs in length.

24. The method of claim 22, wherein the stem-loop structure comprises a stem that is at least 10 base pairs in length.

25. The method of claim 21, wherein the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C.

26. The method of claim 22, wherein the stem of the stem-loop structure has a melting temperature (Tm) of at least 50°C.

27. The method of claim 1, further comprising attaching sequencing adapters to the second plurality of blunt-ended fragments to produce the derivatives thereof.

28. The method of claim 5, further comprising attaching sequencing adaptors to the second plurality of blunt-ended fragments to generate the derivatives thereof.

29. The method of claim 1, wherein each transposome complex of the first group and / or the second group comprises a transposase selected from the group consisting of Tn transposase, MuA transposase and Vibhar transposase.

30. The method of claim 5, wherein each transposome complex of the first group and / or the second group comprises a transposase selected from the group consisting of Tn transposase, MuA transposase and Vibhar transposase.

31. The method of claim 29, wherein the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10.

32. The method of claim 30, wherein the transposase is a Tn transposase selected from the group consisting of Tn3, Tn5, Tn7, and Tn10.

Images