Enzyme-free and amplification-free sequencing

Abstract

The present invention relates to sequencing probes, methods, kits and apparatuses, which provide enzyme-free, amplification-free and library-free nucleic acid sequencing with long read lengths and low error rates. The sequence probe used comprises a target binding domain and a barcode domain; wherein the target binding domain comprises at least four nucleotides and is capable of binding to a target nucleic acid; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least a first attachment region, the first attachment region comprises a nucleic acid sequence capable of being bound by a first complementary nucleic acid molecule, and wherein the nucleic acid sequence of the first attachment region determines the position and identity of the first nucleotide of the target nucleic acid bound by the first nucleotide of the target binding domain.

Description

[0001] This application is a divisional application of the following application: Application date: November 19, 2015; Application number: 201580073880.8 (PCT / US2015 / 061615); Invention name: Same as above.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 082,883, filed on November 21, 2014. The contents of the above patent application are incorporated herein by reference in their entirety.

[0004] Sequence Listing

[0005] This application contains a sequence listing that has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy, generated on November 19, 2015, is named NATE-025_ST25.txt and is 20,860 bytes in size. Background of the Invention

[0006] There are currently various methods for nucleic acid sequencing, i.e. methods for determining the precise order of nucleotides within a nucleic acid molecule. Current methods require enzymatic amplification of nucleic acids (e.g., PCR and / or by cloning). Further enzymatic polymerization is required to produce a detectable signal by a light detection device. Such amplification and polymerization steps are expensive and / or time-consuming. Therefore, there is a need in the art for a method for nucleic acid sequencing without amplification and enzymes. The present invention addresses these needs. SUMMARY OF THE INVENTION

[0007] The present invention provides sequencing probes, methods, kits and devices that provide enzyme-free, amplification-free and library-free nucleic acid sequencing with long read lengths and low error rates. In addition, the methods, kits and devices have rapid sample-to-answer capabilities. These features are particularly useful for sequencing in clinical settings.

[0008] Provided herein is a sequencing probe comprising a target binding domain and a barcode domain. The target binding domain and the barcode domain may be operably connected, such as covalently linked. The sequencing probe optionally comprises a spacer between the target binding domain and the barcode domain. The spacer may be any polymer with suitable mechanical properties, such as (1 to 100 nucleotides, such as 2 to 50 nucleotides) single-stranded or double-stranded DNA spacers. Non-limiting examples of double-stranded DNA spacers include SEQ ID NO: 25 to SEQ ID NO: 29 covered sequences.

[0009] The target binding domain comprises at least four nucleotides (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12 or more) and is capable of binding to a target nucleic acid (e.g., DNA, RNA, and PNA). The barcode domain comprises a synthetic backbone, and the barcode domain has at least a first position comprising one or more attachment regions. The barcode domain can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more positions; each position has one or more (e.g., one to fifty) attachment regions; each attachment region comprises at least one (i.e., one to fifty, such as ten to thirty copies of a nucleic acid sequence) capable of reversibly binding to a complementary nucleic acid molecule (RNA or DNA). Certain positions in the barcode domain may have more attachment regions than other positions; optionally, each position in the barcode domain has the same number of attachment regions. The nucleic acid sequence of the first attachment region determines the position and identity of the first nucleotide in the target nucleic acid bound by the first nucleotide of the target binding domain, while the nucleic acid sequence of the second attachment region determines the position and identity of the second nucleotide in the target nucleic acid bound by the second nucleotide of the target binding domain. Similarly, the nucleic acid sequence of the sixth attachment region determines the position and identity of the sixth nucleotide in the target nucleic acid bound by the sixth nucleotide of the target binding domain. In an embodiment, the synthetic backbone comprises a polysaccharide, a polynucleotide (e.g., single-stranded or double-stranded DNA or RNA), a peptide, a peptide nucleic acid, or a polypeptide. The number of nucleotides in the target binding domain is equal to or greater than the number of positions in the barcode domain (e.g., 1, 2, 3, 4 or more). Each attachment region in a specific position of the barcode domain may include a copy of the same nucleic acid sequence and / or multiple copies of the same nucleic acid sequence. However, the attachment region will include a different nucleic acid sequence from the attachment region at a different position of the barcode domain, even when both attachment regions identify the same type of nucleotides (e.g., adenine, thymine, cytosine, guanine, uracil, and analogs thereof). The attachment region can be connected to the monomer of modification, such as the nucleotide of modification, in the synthesis backbone, thereby producing branch relative to the backbone. The attachment region can be a part of the polynucleotide sequence of the synthesis backbone. One or more attachment regions can be adjacent to at least one side joint single-stranded polynucleotide, that is, the attachment region can be operably connected to 5' side joint single-stranded polynucleotide and / or 3' side joint single-stranded polynucleotide. The attachment region with or without one or two side joint single-stranded polynucleotides can be hybridized with the hybrid nucleic acid molecule lacking a detectable marker. The hybrid nucleic acid molecule lacking a detectable marker can be between about 4 and about 20 nucleotides in length, such as 12 nucleotides or longer.

[0010] The attachment region may be bound by a complementary nucleic acid comprising a detectable label. Each complementary nucleic acid may comprise a detectable label.

[0011] Alternatively, the attachment region can be combined by a complementary nucleic acid as a part of the report complex (including detectable markers). Complementary nucleic acids (including detectable markers or report complexes) can be between about 4 and about 20 nucleotides in length, such as about 8, 10, 12 and 14 nucleotides or more. In the report complex, complementary nucleic acids are connected (directly or indirectly) to primary nucleic acid molecules. Complementary nucleic acids can be indirectly connected to primary nucleic acid molecules via single-stranded or double-stranded nucleic acid joints (for example, polynucleotides comprising 1 to 100 nucleotides). Primary nucleic acids and one or more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) secondary nucleic acid hybridization. Each secondary nucleic acid and one or more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) tertiary nucleic acid hybridization; Tertiary nucleic acids include one or more detectable markers. One or each secondary nucleic acid may include a region ("extra handle") that is not hybridized to the primary nucleic acid molecule and is not hybridized to the tertiary nucleic acid molecule; the region may be four or more (e.g., about 6 to about 40, such as about 8, 10, 12, and 14) nucleotides in length. The region that is not hybridized to the primary nucleic acid molecule and is not hybridized to the tertiary nucleic acid molecule may include a nucleotide sequence of a complementary nucleic acid molecule connected to the primary nucleic acid molecule. The region may be located at the end of the second nucleic acid that is hybridized to the primary nucleic acid at the distal end thereof. By having an "extra handle" containing a nucleotide sequence of a complementary nucleic acid, the probability and speed of the reporter complex binding to the sequencing probe are greatly increased. In any embodiment or aspect of the present invention, when the reporter complex includes an "extra handle", the reporter complex may hybridize to the sequencing probe via the complementary nucleic acid of the reporter complex or via the "extra handle". Thus, for example, the phrase "binding to the first attachment region... the first complementary nucleic acid molecule of the first reporter complex" will be understood according to its clear meaning, and is also understood to mean "binding to the first attachment region... the "extra handle" of the first reporter complex.

[0012] In an embodiment, the terms "barcode domain" and "synthetic backbone" are synonymous.

[0013] Provided herein is a method for sequencing nucleic acids using a sequencing probe of the present invention. The method comprises the following steps: (1) hybridizing at least one sequencing probe of the present invention with a target nucleic acid fixed to a substrate (e.g., at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more positions); (2) binding a first complementary nucleic acid molecule (RNA or DNA) having a detectable marker (e.g., a fluorescent marker) or a first complementary nucleic acid molecule of a first reporter complex comprising a detectable marker (e.g., a fluorescent marker) to a first attachment region; (3) detecting the detectable marker, and (4) identifying the position and identity of the first nucleotide in the fixed target nucleic acid. Optionally, the fixed target nucleic acid is extended before being bound by the probe. The method further comprises the following steps: (5) contacting the first attachment region (with or without one or two flanking single-stranded polynucleotides) with a first hybrid nucleic acid molecule lacking a detectable marker, such that a first complementary nucleic acid molecule having a detectable marker or a first complementary nucleic acid molecule of a first reporter complex comprising a detectable marker is not bound and the first hybrid nucleic acid lacking a detectable marker is bound to at least the first attachment region; (6) binding a second complementary nucleic acid molecule having a detectable marker or a complementary nucleic acid molecule of a second reporter complex comprising a detectable marker to a second attachment region; (7) detecting the detectable marker; and (8) identifying the position and identity of a second nucleotide in the fixed target nucleic acid. Steps (5) to (8) are repeated until each nucleotide in the fixed target nucleic acid corresponding to the target binding domain has been identified. Steps (5) and (6) may occur simultaneously or sequentially. Each (e.g., first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth or higher) complementary nucleic acid molecule (having a detectable marker or a portion of a reporter complex) has the same nucleic acid sequence as its corresponding (i.e., first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth or higher) hybrid nucleic acid molecule lacking a detectable marker. The target nucleic acid is fixed to the matrix by binding the first position and / or second position of the target nucleic acid with the first and / or second capture probe; each capture probe comprises an affinity tag that selectively binds to the matrix. The first and / or second position may be at or near the end of the target nucleic acid. The matrix may be any solid support known in the art, such as a coated glass slide and a microfluidic device (e.g., coated with streptavidin). Other positions located at the distal end of the end of the target nucleic acid may be selectively bound to the matrix. The nucleic acid may be elongated by applying a force sufficient to extend the target nucleic acid (e.g., gravity, fluid dynamics, electromagnetic force, flow stretching, receding meniscus technique, and combinations thereof).

[0014] Provided herein is a method for sequencing nucleic acids using a probe population of the present invention or a plurality of probe populations of the present invention. The method comprises the following steps: (1) hybridizing a first population of sequencing probes (of the present invention) to a target nucleic acid fixed to a substrate (wherein each sequencing probe in the first population is dehybridized with the fixed target nucleic acid under approximately the same conditions (e.g., level of chaotropic agent, temperature, salt concentration, pH, and fluid dynamics); (2) binding a plurality of first complementary nucleic acid molecules, each having a detectable label, or a plurality of first complementary nucleic acid molecules, each of which contains a plurality of first reporter complexes having a detectable label, to a first attachment region in each sequencing probe in the first population; (3) detecting the detectable label; (4) identifying the position and identity of a plurality of first nucleotides in the fixed target nucleic acid hybridized by the sequencing probes in the first population; (5) Each first attachment region of each sequencing probe of the first population is contacted with a plurality of first hybrid nucleic acid molecules lacking a detectable label, so that the first complementary nucleic acid molecules having a detectable label or a reporter complex are not bound, and the first hybrid nucleic acid molecules lacking a detectable label are bound to each first attachment region; (6) a plurality of second complementary nucleic acid molecules, each having a detectable label, or a plurality of second complementary nucleic acid molecules, each of which contains a plurality of second reporter complexes with a detectable label, are bound to the second attachment region in each sequencing probe in the first population; (7) the detectable label is detected; and (8) the position and identity of a plurality of second nucleotides in the fixed target nucleic acid hybridized by the sequencing probe in the first population are identified. In step (9), steps (5) to (8) are repeated until each nucleotide in the fixed target nucleic acid corresponding to the target binding domain of each sequencing probe in the first population has been identified. Steps (5) and (6) may occur simultaneously or sequentially. Thus, for the region of the fixed target nucleic acid to which the target binding domain of the sequencing probe in the first population of sequencing probes is hybridized, the linear order of the nucleotides is identified.

[0015] In an embodiment, when probes from multiple populations (i.e., more than one population) are used, the method further comprises the following steps: (10) dehybridizing each sequencing probe of the first population from the nucleic acid; (11) removing each dehybridized sequencing probe of the first population; (12) hybridizing at least a second population of sequencing probes of the present invention, wherein each sequencing probe in the second population is dehybridized with the fixed target nucleic acid under approximately the same conditions and is dehybridized with the fixed target nucleic acid under different conditions from the sequencing probes in the first population; (13) allowing a plurality of first complementary nucleic acid molecules, each having a detectable label, or a plurality of first complementary nucleic acid molecules, each complex comprising a plurality of first reporter complexes having a detectable label, to bind to the first attachment region in each sequencing probe in the second population; (14) detecting the detectable label; (15) identifying the position and identity of a plurality of first nucleotides in the fixed target nucleic acid hybridized by the sequencing probes in the second population; (16) allowing Each first attachment region of each sequencing probe of the second population is contacted with a plurality of first hybrid nucleic acid molecules lacking a detectable label, so that no first complementary nucleic acid molecules (having a detectable label or from a reporter complex) are bound, and the first hybrid nucleic acid molecules lacking a detectable label are bound to each first attachment region; (17) a plurality of second complementary nucleic acid molecules, each having a detectable label, or a plurality of second complementary nucleic acid molecules, each complex comprising a plurality of second reporter complexes having a detectable label, are bound to the second attachment region in each sequencing probe in the second population; (18) the detectable label is detected; (19) the position and identity of a plurality of second nucleotides in the immobilized target nucleic acid hybridized by the sequencing probe in the second population are identified; and (20) steps (16) to (19) are repeated until the linear order of nucleotides has been identified for the region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe in the second population of sequencing probes. Steps (16) and (17) may occur simultaneously or sequentially.

[0016] Each sequencing probe in the second population can be dehybridized from the immobilized target nucleic acid under conditions that are different from the average conditions under which the sequencing probes in the first population dehybridize from the target nucleic acid (e.g., higher temperature, higher level of chaotropic agent, higher salt concentration, higher flow rate, and different pH).

[0017] In some embodiments, the probe of the present invention is used as the probe of the present invention.But, when using more than two probe colonies, the probes in the two continuous colonies can be dehybridized under different conditions, and the probes in the non-continuous colonies can be dehybridized under similar conditions.As an example, the probes in the first colony and the third colony can be dehybridized under similar conditions.In an embodiment, the continuous probe colony is dehybridized under more and more stringent conditions (such as higher chaotropic agent level, salt concentration and temperature).For microfluidic device, using temperature as an example, the first probe colony can keep hybridization at a first temperature, but dehybridize at a second temperature higher than the first temperature.The second probe colony can keep hybridization at a second temperature, but dehybridize at a third temperature higher than the second temperature.In this example, the temperature of the solution (comprising the reagent required for the method) of the target nucleic acid flowing through the initial probe colony is lower than the solution of the target nucleic acid flowing through the subsequent probe colony.

[0018] In some embodiments, after using probe colony, probe colony is dehybridized from target nucleic acid, and new aliquots of identical probe colony are used.For example, after the first probe colony is hybridized, detected and dehybridized, the subsequent aliquots of the first probe colony are hybridized.Alternatively, as an example, the first probe colony can be dehybridized and replaced with the second probe colony; Once the second colony has been detected and dehybridized, the subsequent aliquots of the first probe colony are hybridized with target nucleic acid.Therefore, the probe in the subsequent colony can be hybridized with the region of the target nucleic acid previously sequenced (so as to obtain the sequence information repeated and / or verified) or the probe in the subsequent colony can be hybridized with the region of the target nucleic acid not previously sequenced (so as to obtain new sequence information).Therefore, when the previous reading value is unsatisfactory (due to any reason) and / or improves the accuracy of the comparison caused by sequencing reading, the probe colony can be divided into equal parts again.

[0019] Probes that hybridize and dehybridize under similar conditions may have similar lengths of their target binding domains, GC content, or frequencies of repeated bases, and combinations thereof. The relationship between the Tm and length of an oligonucleotide is taught, for example, by Sugimoto et al., Biochemistry , 34, 11211-6.

[0020] When more than two probe populations are used, the steps described for the first and second populations of sequencing probes are repeated with additional probe populations (e.g., 10 to 100 to 1000 populations). The number of probe populations used will depend on a variety of factors, including but not limited to the size of the target nucleic acid, the number of unique probes in each population, the degree of overlap between sequencing probes required, and enrichment of probes to the target region.

[0021] The probe population can contain additional sequencing probes for specific regions of interest in the target nucleic acid, such as regions containing mutations (e.g., point mutations) or SNP alleles. The probe population can contain fewer sequencing probes for specific regions of less interest in the target nucleic acid.

[0022] The sequencing probe population can be compartmentalized into discrete smaller sets of sequencing probes. Compartmentalization can be based on the predicted melting temperature of the target binding domain in the sequencing probe and / or the sequence motif of the target binding domain in the sequencing probe. Compartmentalization can be based on empirically derived rules. Using different reaction conditions, for example, based on temperature, salt concentration and / or buffer content, different sequencing probe sets can react with the target nucleic acid. Compartmentalization can be performed to cover a target nucleic acid with uniform coverage. Compartmentalization can be performed to cover a target nucleic acid with a known coverage profile.

[0023] The length of the target binding domain in a population of sequencing probes can be shortened to increase the coverage of the probes in a specific region of the target nucleic acid. The length of the target binding domain in a population of sequencing probes can be increased to reduce the coverage of the probes in a specific region of the target nucleic acid, for example, above the resolution limit of the sequencing apparatus.

[0024] Alternatively or additionally, the concentration of sequencing probes in the population can be increased to increase the coverage of the probes in a specific region of the target nucleic acid. The concentration of sequencing probes can be reduced to reduce the coverage of the probes in a specific region of the target nucleic acid, for example above the resolution limit of the sequencing device.

[0025] The method for sequencing nucleic acids also includes assembling each identified linear order of nucleotides in each region of the fixed target nucleic acid, thereby identifying the step of the sequence of the fixed target nucleic acid. The step of assembling uses a non-transitory computer-readable storage medium with an executable program stored thereon, which instructs a microprocessor to arrange each identified linear order of nucleotides, thereby obtaining the sequence of the nucleic acid. Assembly can occur in "real time", i.e., while collecting data from the sequencing probe, rather than after all data have been collected.

[0026] The target nucleic acid, ie the target nucleic acid for sequencing, can be between about 4 and 1,000,000 nucleotides in length. The target can include an entire, complete chromosome or a length thereof that is greater than 1,000,000 nucleotides in length.

[0027] Provided herein are apparatus for carrying out the methods of the invention.

[0028] Provided herein are kits comprising sequencing probes of the invention and for performing the methods of the invention. In an embodiment, the kit comprises a substrate capable of fixing nucleic acids via capture probes, a plurality of sequencing probes of the invention, at least one capture probe, at least one complementary nucleic acid molecule having a detectable label, at least one complementary nucleic acid molecule lacking a detectable label, and instructions for use. In an embodiment, the kit comprises about or at least 4096 unique sequencing probes. 4096 is the minimum number of unique probes necessary to include each possible hexamer combination (i.e., for probes with six attachment regions in the barcode domain). Here, "4096" is achieved because there are four nucleotide options for six positions: 4 6 For a probe set with four attachment regions in the barcode domain, only 256 (i.e., 4 4 For a probe set with 8 nucleotides in its target binding domain, 4 8 For a probe set with 10 nucleotides in its target binding domain, 4 10 species (i.e., 1,048,576) unique probes.

[0029] In an embodiment, the kit comprises about or at least twenty-four different complementary nucleic acid molecules with detectable labels, and about or at least twenty-four different hybrid nucleic acid molecules lacking detectable labels. As a non-limiting example, the complementary nucleic acid can be combined with an attachment region having a sequence of one of SEQ ID NOs: 1 to 24. Additional exemplary sequences that can be included in the barcode domain are listed in SEQ ID NOs: 42 to SEQ ID NOs: 81. In practice, the nucleotide sequence is not limited; preferably, it lacks substantial homology (e.g., 50% to 99.9%) with a known nucleotide sequence; this helps to avoid undesired hybridization of complementary nucleic acids and target nucleic acids.

[0030] Any of the above aspects and embodiments may be combined with any other aspect or embodiment.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. In the specification, the singular also includes the plural, unless the context clearly states otherwise; as an example, the terms "a", "an" and "the" are understood to be singular or plural, and the term "or" is understood to be inclusive. By way of example, "an element" means one or more elements. Throughout the specification, the word "comprising" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of the elements, integers or steps or groups of elements, integers or steps, but does not exclude any other elements, integers or steps or groups of elements, integers or steps. About can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05% or 0.01% of the values ​​shown. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about".

[0032] Although methods and materials similar or equivalent to those described herein may also be used to implement or test the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not recognized as prior art to the claimed invention. In the event of a conflict, this specification, including definitions, will prevail. In addition, materials, methods and examples are illustrative only and are not intended to be limiting. Other features and advantages of the present invention will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication in color drawing will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

[0034] The above and further features will be more clearly understood from the detailed description when taken in conjunction with the accompanying drawings.

[0035] Figures 1 to 5 A schematic diagram showing exemplary sequencing probes of the invention.

[0036] FIG. 6A to FIG. 6D is a schematic diagram showing variants of the sequencing probe of the present invention.

[0037] Figure 7 Schematic diagrams showing the target binding domain of a sequencing probe of the invention; the domain comprises zero, two or four nucleotides having universal bases.

[0038] FIG. 8A to FIG. 8EThe steps of the sequencing method of the present invention are described.

[0039] Fig.9A The initial steps of the sequencing method of the present invention are shown.

[0040] Fig. 9B Schematic diagram showing a reporter complex comprising a detectable label.

[0041] Fig. 9C Multiple reporter complexes, each comprising a detectable label, are shown.

[0042] Figures 9D to 9G show Fig.9A A further step of the sequencing method started in .

[0043] Fig.10 show Fig.9D and Fig.9E An alternative description of the steps shown in , and exemplary data obtained thereby. The fragment of the sequencing probe shown has the sequence of SEQ ID NO: 82.

[0044] Fig.11 illustrate Fig.10 A variation of the method shown in . The fragment of the sequencing probe shown also has the sequence of SEQ ID NO:82.

[0045] Fig.12 The method of the present invention is described.

[0046] Fig.13 The steps required in the sequencing method of the present invention are compared with the steps required for other sequencing methods.

[0047] Fig.14 and Fig.15 Examples of performance measures that can be obtained by the present invention are given.

[0048] Fig.16 The sequencing rates, read counts, and clinical utility of the present invention and various other sequencing methods / apparatuses were compared.

[0049] Fig.17 This shows the low original error rate of the sequencing method of the present invention. The template sequence shown has the sequence of SEQ ID NO: 83.

[0050] Fig.18 The sequencing data obtainable from the present invention are compared with other sequencing methods.

[0051] Fig.19 The single base specificity of the sequencing method of the present invention is demonstrated. The template and probe sequences shown (from top to bottom) have sequences of SEQ ID NO: 84 to SEQ ID NO: 88.

[0052] Fig. 20A Various designs of reporter complexes of the invention are shown.

[0053] Fig. 20B Display from Fig. 20A Fluorescence counts obtained for the reporter complex shown in .

[0054] Fig. 20C Exemplary formulations for constructing reporter complexes of the invention are shown.

[0055] Fig.21A Design of the reporter complex containing an "extra handle" is shown.

[0056] Fig.21B Fluorescence counts obtained from reporter complexes with an “extra handle” are shown.

[0057] Fig.22A and Fig. 22B Hybridization kinetics of two exemplary designs of reporter complexes of the invention are shown.

[0058] Fig.23 Display and Figure 8 to Fig.12 The methods shown are schematic diagrams of the sequencing probes of the present invention used in different methods.

[0059] Fig.24 A schematic diagram showing a consumable sequencing card that can be used in the present invention.

[0060] Fig.25 Mismatch detection of 10-mers is shown as described in Example 3. The nucleotides shown (from top to bottom) have the sequence of SEQ ID NO: 89 to SEQ ID NO: 99.

[0061] Fig.26 The hybridization capacity is shown according to the size of the target binding domain as described in Example 3. The background is high due to the very high reporter concentration and no prior purification. The nucleotides shown (from top to bottom) have the sequence of SEQ ID NO: 100 to SEQ ID NO: 104.

[0062] Fig. 27 Comparison between single spots compared to full length reporter is shown. Results for single spots show 1000 times faster hybridization than full length barcodes (conditions 100 nM target, 30 min hybridization). DETAILED DESCRIPTION OF THE INVENTION

[0063] The present invention provides sequencing probes, methods, kits and devices that provide enzyme-free, amplification-free and library-free nucleic acid sequencing with long read lengths and low error rates.

[0064] Sequencing probes

[0065] The present invention relates to sequencing probes comprising a target binding domain and a barcode domain. Non-limiting examples of sequencing probes of the present invention are shown in Figure 1 To 6th.

[0066] Figure 1 A schematic diagram of a sequencing probe of the present invention is shown. This exemplary sequencing probe has a target binding domain of six nucleotides, each of which corresponds to a position in the barcode domain (which contains one or more attachment regions). Note the first attachment region; it corresponds to the nucleotide of the target nucleic acid bound by the first nucleotide in the target binding domain. Note the third position on the barcode domain. Note the fifth position, which contains two attachment regions. Each position on the barcode domain can have multiple attachment regions. For example, a position can have 1 to 50 attachment regions. Some positions in the barcode domain may have more attachment regions than other positions (as shown here, position 5 relative to positions 1 to 4 and 6); alternatively, each position in the barcode domain has the same number of attachment regions (see, e.g. Figure 2 , 3 , 5 and 6). Although not shown, each attachment region comprises at least one (i.e., one to fifty, such as ten to thirty) copies of a nucleic acid sequence capable of reversibly binding to a complementary nucleic acid molecule (RNA or DNA). Figure 1 In the present invention, the attachment region is essential for the linear polynucleotide molecules that make up the barcode domain.

[0067] Figure 2 A schematic diagram of a sequencing probe of the present invention is shown. The exemplary sequencing probe has a target binding domain of six nucleotides, each of which corresponds to an attachment region in the barcode domain. Note the first attachment region; it corresponds to the nucleotide of the target nucleic acid bound by the first nucleotide in the target binding domain. Circle the fourth position of the barcode domain, which contains a portion of the barcode domain and two fourth attachment regions. Note the two sixth attachment regions. Here, each position has two attachment regions; however, each position on the barcode domain can have one attachment region or multiple attachment regions, such as 2 to 50 attachment regions. Although not shown, each attachment region contains at least one (i.e., one to fifty, such as ten to thirty) copies of a nucleic acid sequence that is capable of reversibly binding to a complementary nucleic acid molecule (RNA or DNA). In Figure 2 In the invention, the barcode domain is a linear polynucleotide molecule connected to an attachment region; the attachment region is not essential to the polynucleotide molecule.

[0068] Figure 3 Another schematic diagram of a sequencing probe of the present invention is shown. This exemplary sequencing probe has a target binding domain of four nucleotides, wherein the four nucleotides correspond to four positions in the barcode domain. Each position shows an attachment region with three connections.

[0069] Figure 4 Another schematic diagram of a sequencing probe of the present invention is shown. This exemplary sequencing probe has a ten nucleotide target binding domain. However, only the first six nucleotides correspond to the six positions in the barcode domain. The seventh to tenth nucleotides (indicated by "n1 to n4") are added to increase the length of the target binding domain, thereby affecting the likelihood that the probe will hybridize and remain hybridized to the target nucleic acid. In an embodiment, the "n" nucleotide may precede the nucleotide corresponding to the position in the barcode domain. In an embodiment, the "n" nucleotide may follow the nucleotide corresponding to the position in the barcode domain. Figure 4 In the embodiment of the present invention, four "n" nucleotides are shown; however, the target binding domain may include more than four "n" nucleotides. The "n" nucleotides may have universal bases (e.g., inosine, 2'-deoxyinosine (inosine deoxyribonucleotide) derivatives, nitroindole, nitroindazole analogs, and hydrophobic aromatic non-hydrogen bonding groups) that can base pair with any of the four typical bases.

[0070] Another sequencing probe of the present invention is shown in Figure 5 Here, "n" nucleotides precede and follow the nucleotides corresponding to positions in the barcode domain. The exemplary sequencing probe shown has a ten-nucleotide target binding domain. However, only three to eight nucleotides in the target binding domain correspond to the six positions (first to sixth) in the barcode domain. The first, second, ninth, and tenth nucleotides (indicated by "n1 to n4") are added to increase the length of the target binding domain. Figure 5 In FIG. 4 , four "n" nucleotides are shown; however, the target binding domain may include more or less than four "n" nucleotides.

[0071] FIG. 6A to FIG. 6D show Figure 1 Variants of sequencing probes. Fig. 6A In the barcode domain, the linear order of nucleotides in the target binding domain and the linear order of the attachment region proceed from left to right (relative to the illustration). Figure 6B In the barcode domain, the linear order of nucleotides in the target binding domain and the linear order of the attachment region proceeds from right to left (relative to the illustration). Figure 6C In any probe of the invention, the linear order of nucleotides in the target binding domain is reversed relative to the linear order of the attachment region in the barcode domain. In any probe of the invention, the nucleotides in the target binding domain and the attachment region in the barcode domain lack a strict order as long as the probe is designed such that each nucleotide in the target binding domain corresponds to one or more attachment regions in the target binding domain; Fig.6D Any probe of the present invention (e.g., Figures 1 to 5 6 ) may have the order of nucleotides and attachment regions as shown in FIG. 6 .

[0072] The target binding domain has at least four nucleotides, such as at least 4, 5, 6, 7, 8, 9, 10, 11, 12 or more nucleotides. The target binding domain is preferably a polynucleotide. The target binding domain is capable of binding to a target nucleic acid.

[0073] The probe may include multiple copies of the target binding domain operably linked to a synthetic backbone.

[0074] Probes can be designed to control the probability of hybridization and / or dehybridization and the rate at which these occur. Generally, the lower the Tm of the probe, the faster and more likely the probe will hybridize with / from the target nucleic acid. Therefore, using a lower Tm probe will reduce the number of probes that bind to the target nucleic acid.

[0075] The length of the target binding domain partially affects the possibility of probe hybridization and maintaining hybridization with the target nucleic acid. Generally, the longer the target binding domain is (more number of nucleotides), the less likely the target nucleotide will have a complementary sequence. On the contrary, the shorter the target binding domain is, the greater the possibility of the target nucleotide having a complementary sequence. For example, the probability that a tetramer sequence will be located in a target nucleic acid is 1 / 256, while the probability that a hexamer sequence will be located in a target nucleic acid is 1 / 4096. Therefore, when compared with a set of longer probes, for a given nucleic acid segment, a set of shorter probes will likely bind at more positions.

[0076] Figure 7 A 10-mer target binding domain is shown. In some embodiments, the target binding domain includes four universal bases (identified as "U", "C", and "T") that base pair with any of the four canonical nucleotides (A, G, C, and T). b ”). In an embodiment, the target binding domain includes one to six (eg, 2 and 4) universal bases. The target binding domain may not include universal nucleotides. Figure 7 It is noted that a "complete" probe population with 6 specific nucleotides in the target binding domain would require 4096 unique probes, and a "complete" probe population with 10 specific nucleotides would require approximately -1 million unique probes.

[0077] In some cases, probes with shorter target binding domains are preferred to increase the read count in a given nucleic acid segment, thereby enriching the coverage of the target nucleic acid or a portion of the target nucleic acid, particularly a portion of particular interest, such as when detecting mutations or SNP alleles.

[0078] However, it is preferred to have a smaller number of probes combined with the target nucleic acid, because too many probes in the presence region can cause its detectable marker to overlap, thereby preventing the resolution of two adjacent probes. This is explained as follows. Considering that a nucleotide length is 0.34nm, and considering that the lateral (xy) spatial resolution of the sequencing device is about 200nm, the resolution limit of the sequencing device is about 588 base pairs (i.e., 1 nucleotide / 0.34nm x 200nm). In other words, when the two probes are within about 588 base pairs of each other, the above-mentioned sequencing device will not be able to distinguish the signals from the two probes hybridized with the target nucleic acid. Therefore, depending on the resolution of the sequencing device, the two probes will need to be separated by about 600bp before their detectable markers can be resolved as different "spots". Therefore, under the optimal spacing, the target nucleic acid of every 600bp should have a single probe. Various software methods (for example, using fluorescence intensity values ​​and wavelength-dependent ratios) can be used to monitor, limit and potentially deconvolute the number of probes hybridized in the resolvable region of the target nucleic acid and design the probe population accordingly. In addition, detectable labels that provide a more discrete signal (e.g., fluorescent labels) can be selected. In addition, methods in the literature (e.g., Small and Parthasarthy: “Superresolution localization methods.” Annu. Rev. Phys Chem ., 2014; 65:107-25) describe structured illumination and various super-resolution methods that reduce the resolution limit of sequencing microscopes by up to 10's of nanometers. The use of higher resolution sequencing devices allows the use of probes with shorter target binding domains.

[0079] As mentioned above, the Tm of the designed probe can affect the number of probes that hybridize with the target nucleic acid. Alternatively or additionally, the concentration of the sequencing probes in the population can be increased to increase the coverage of the probes in a specific region of the target nucleic acid. The concentration of the sequencing probes can be reduced to reduce the coverage of the probes in a specific region of the target nucleic acid, for example, above the resolution limit of the sequencing device.

[0080] The term "target nucleic acid" shall mean a nucleic acid molecule (DNA, RNA or PNA) whose sequence is to be determined by the probes, methods and apparatus of the present invention. In general, the terms "target nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleic acid", "nucleic acid fragment", "oligonucleotide" and "polynucleotide" are used interchangeably and are intended to include, but are not limited to, polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) that may have various lengths. Non-limiting examples of nucleic acids include genes, gene fragments, exons, introns, intergenic DNA (including but not limited to heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, small interfering RNA (siRNA), non-coding RNA (ncRNA), cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of a sequence, isolated RNA of a sequence, nucleic acid probes and primers.

[0081] The present method directly orders the nucleic acid molecules obtained from the sample (e.g., the sample from the organism), preferably without conversion (or amplification) steps. As an example, for RNA-based order-checking, the present method does not need to convert the RNA molecule into a DNA molecule (i.e., via the synthesis of cDNA) before the sequence can be obtained. Owing to the fact that amplification or conversion is not required, when the nucleic acid is in the sample or when it is obtained from the sample, the nucleic acid ordered in the present invention will retain any unique bases and / or epigenetic markers present in the nucleic acid. Such unique bases and / or epigenetic markers have been lost in order-checking methods known in the art.

[0082] Target nucleic acid can be obtained from any sample or source of nucleic acid, such as any cell, tissue or organism, in vitro, chemical synthesizer etc. Target nucleic acid can be obtained by any art-recognized method. In embodiments, nucleic acid is obtained from a blood sample of a clinical subject. Methods and reagents well known in the art can be used to extract, separate or purify nucleic acid from a source or sample.

[0083] The nucleic acid molecules comprising the target nucleic acid can be fragmented by any means known in the art. Preferably, the fragmentation is carried out by enzymatic or mechanical means. The mechanical means can be ultrasonic treatment or physical shearing. The enzymatic means can be carried out by digestion with a nuclease (e.g., deoxyribonuclease I (DNase I)) or one or more restriction endonucleases.

[0084] When the nucleic acid molecule comprising the target nucleic acid is an intact chromosome, steps should be taken to avoid fragmenting the chromosome.

[0085] The target nucleic acid may include natural or non-natural nucleotides, including modified nucleotides, as are well known in the art.

[0086] The probe of the invention may have a total length (including the target binding domain, the barcode domain, and any optional domains) of about 20 nanometers to about 50 nanometers. The backbone of the probe may be a polynucleotide molecule comprising about 120 nucleotides.

[0087] The barcode domain comprises a synthetic backbone. The synthetic backbone and the target binding domain are operably linked, e.g., covalently attached or attached via a linker. The synthetic backbone can include any material, e.g., a polysaccharide, a polynucleotide, a polymer, a plastic, a fiber, a peptide, a peptide nucleic acid, or a polypeptide. Preferably, the synthetic backbone is rigid. In an embodiment, the backbone comprises a "DNA origami" of six DNA double helices (see, e.g., Lin et al., "Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA." Nature Chemistry ; 2012Oct; 4(10): 832-9). Barcodes can be made from DNA origami tiles (Jungmann et al. , "Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT", Nature Methods, Vol. 11, No. 3, 2014).

[0088] The barcode domain comprises a plurality of positions, e.g., one, two, three, four, five, six, seven, eight, nine, ten or more positions. The number of positions may be less than, equal to, or greater than the number of nucleotides in the target binding domain. It is preferred to include additional nucleotides in the target binding domain compared to the number of positions in the backbone domain, e.g., one, two, three, four, five, six, seven, eight, nine, ten or more nucleotides. The length of the barcode domain is not limited as long as there is enough space for at least four positions as described above.

[0089] Each position in the barcode domain corresponds to a nucleotide in the target binding domain, and therefore to a nucleotide in the target nucleic acid. As an example, the first position in the barcode domain corresponds to the first nucleotide in the target binding domain, and the sixth position in the barcode domain corresponds to the sixth nucleotide in the target binding domain.

[0090] Each position in the barcode domain contains at least one attachment region, such as one to fifty or more attachment regions. Certain positions in the barcode domain may have more attachment regions than other positions (e.g., the first position may have three attachment regions, and the second position may have two attachment positions); alternatively, each position in the barcode domain has the same number of attachment regions. Each attachment region contains at least one (i.e., one to fifty, such as ten to thirty) copies of a nucleic acid sequence that can be reversibly bound by a complementary nucleic acid molecule (e.g., DNA or RNA). In an example, the nucleic acid sequence in the first attachment region determines the position and identity of the first nucleotide in the target nucleic acid bound by the first nucleotide of the target binding domain. Each attachment region can be connected to a modified monomer (e.g., a modified nucleotide) in a synthetic backbone so that the attachment region branches from the synthetic backbone. In an embodiment, the attachment region is essential for the polynucleotide backbone; that is, the backbone is a single polynucleotide, and the attachment region is part of a single polynucleotide sequence. In an embodiment, the terms "barcode domain" and "synthetic backbone" are synonymous.

[0091] The nucleic acid sequence in the attachment region determines the position and identity of the nucleotides in the target nucleic acid bound by the nucleotides of the target binding domain of the sequencing probe. In the probe, each attachment region will have a unique overall sequence. In fact, each position on the barcode domain can have an attachment region containing a nucleic acid sequence, and the nucleic acid sequence encodes one of the four nucleotides, that is, specific to one of adenine, thymine / uracil, cytosine and guanine. In addition, the attachment region of the first position (and, for example, encoding cytosine) will include a nucleic acid sequence different from the attachment region of the second position (and, for example, encoding cytosine). Therefore, for the nucleic acid sequence in the attachment region of the first position encoding thymine, there will be no binding of complementary nucleic acid molecules identifying adenine in the target nucleic acid corresponding to the first nucleotide of the target binding domain. In addition, for the attachment region of the second position, there will be no binding of complementary nucleic acid molecules identifying adenine in the target nucleic acid corresponding to the first nucleotide of the target binding domain.

[0092] Each position on the barcode domain can include one or more (up to fifty, preferably ten to thirty) attachment regions; thus, each attachment region can bind one or more (up to fifty, preferably ten to thirty) complementary nucleic acid molecules. As an example, Figure 1 The probe in has a fifth position comprising two attachment regions, and Figure 2The probe in has a second position with six attachment regions. In an embodiment, the nucleic acid sequences of the attachment regions of the positions are identical; therefore, the complementary nucleic acid molecules that bind to those attachment regions are identical. In an alternative embodiment, the nucleic acid sequences of the attachment regions of the positions are different; therefore, the complementary nucleic acid molecules that bind to those attachment regions are different, e.g., each comprising a different nucleic acid sequence and / or a detectable marker. Therefore, in an alternative embodiment, a combination of different nucleic acid molecules (e.g., detectable markers thereof) attached to the attachment regions provides a code for identifying nucleotides in a target nucleic acid.

[0093] For purposes of illustration only, Table 1 provides exemplary sequences for the accessory region of a sequencing probe having up to six positions in its barcode domain and a detectable label on the complementary nucleic acid to which it binds.

[0094] Table 1:

[0095] Nucleotide position in target binding domain / barcode domain Nucleotides Nucleic acid sequence in the attachment region (5' to 3') Detectable markers for complementary nucleic acids SEQ ID NO 1 A ATACATCTAG GFP 1 1 G GATCTACATA RFP 2 1 C TTAGGTAAAG CFP 3 1 U / T TCTTCATTAC YFP 4 2 A ATGAATCTAC GFP 5 2 G TCAATGTATG RFP 6 2 C AATTGAGTAC CFP 7 2 U / T ATGTTAATGG YFP 8 3 A AATTAGGATG GFP 9 3 G ATAATGGATC RFP 10 3 C TAATAAGGTG CFP 11 3 U / T TAGTTAGAGC YFP 12 4 A ATAGAGAAGG GFP 13 4 G TTGATGATAC RFP 14 4 C ATAGTGATTC CFP 15 4 U / T TATAACGATG YFP 16 5 A TTAAGTTTAG GFP 17 5 G ATACGTTATG RFP 18 5 C TGTACTATAG CFP 19 5 U / T TTAACAAGTG YFP 20 6 A AACTATGTAC GFP 21 6 G TAACTATGAC RFP 22 6 C ACTAATGTTC CFP 23 6 U / T TCATTGAATG YFP 24

[0096] As seen in Table 1, the nucleic acid sequence of the first attachment region can be one of SEQ ID NO: 1 to SEQ ID NO: 4, and the nucleic acid sequence of the second attachment region can be one of SEQ ID NO: 5 to SEQ ID NO: 8. When the first nucleotide in the target nucleic acid is adenine, the nucleic acid sequence of the first attachment region will have the sequence of SEQ ID NO: 1, and when the second nucleotide in the target nucleic acid is adenine, the nucleic acid sequence of the second attachment region will have the sequence of SEQ ID NO: 5.

[0097] In embodiments, the complementary nucleic acid molecule may be bound by a detectable label. In alternative embodiments, the complementary nucleic acid is bound to a reporter complex comprising a detectable label.

[0098] The nucleotide sequence of the complementary nucleic acid is not limited; preferably, it lacks substantial homology (eg, 50% to 99.9%) to a known nucleotide sequence; this helps avoid undesired hybridization of the complementary nucleic acid and the target nucleic acid.

[0099] Examples of reporter complexes that can be used in the present invention are shown in Fig. 9B In this example, a complementary nucleic acid is linked to a primary nucleic acid molecule, which in turn hybridizes to a plurality of secondary nucleic acid molecules, each of which in turn hybridizes to a plurality of tertiary nucleic acid molecules to which one or more detectable labels are attached.

[0100] In embodiments, the primary nucleic acid molecule may comprise about 90 nucleotides. The secondary nucleic acid molecule may comprise about 87 nucleotides. The tertiary nucleic acid molecule may comprise about 15 nucleotides.

[0101] Fig. 9C A population of exemplary reporter complexes is shown. Included in Fig. 9C In the upper left panel of are four complexes hybridized to the attachment region 1 of the probe. For each possible nucleotide that may be present at nucleotide position 1 of the target binding domain of the probe, there is a type of reporter complex. Here, while performing the sequence method of the present invention, if position 1 of the reporter domain of the probe is bound by a reporter complex with a "blue" detectable marker, the first nucleotide in the target binding domain is identified as adenine. Alternatively, if position 1 is bound by a reporter complex with a "green" detectable marker, the first nucleotide in the target binding domain is identified as thymine.

[0102] The reporter complex can have a variety of designs. For example, a primary nucleic acid molecule can hybridize with at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) secondary nucleic acid molecule. Each secondary nucleic acid molecule can hybridize with at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) tertiary nucleic acid molecule. Exemplary reporter complexes are shown in Fig. 20A . Here, a "4x3" reporter complex has one primary nucleic acid molecule (which is connected to a complementary nucleic acid molecule) hybridized to four secondary nucleic acid molecules, each of which is hybridized to three tri-nucleic acid molecules (each containing a detectable marker). In this figure, each complementary nucleic acid of the complex is 12 nucleotides ("12 bases") in length; however, the length of the complementary nucleic acid is not limited and can be less than 12 or more than 12 nucleotides. The lower right complex includes a spacer between its complementary nucleic acid and its primary nucleic acid molecule. The spacer is identified as being 20 to 40 nucleotides long; however, the length of the spacer is non-limiting and it can be shorter than 20 nucleotides or longer than 40 nucleotides.

[0103] Fig. 20B Display from Fig. 20A Variable average (fluorescence) counts obtained for the four exemplary reporter complexes shown in . Fig. 20B In , 10 pM of biotinylated target template was attached to the streptavidin-coated flow cell surface, and 10 nM of reporter complex was flowed onto the flow cell; after a 1-minute incubation, the flow cell was washed, imaged, and fluorescent features were counted.

[0104] In embodiments, the reporter complex is "pre-constructed." That is, each polynucleotide in the complex is hybridized prior to contacting the complex with the probe. Exemplary formulations for pre-constructing five exemplary reporter complexes are shown in Fig. 20C middle.

[0105] Fig.21AAn alternative reporter complex is shown, in which the secondary nucleic acid molecule has an "extra handle" that is not hybridized with the tertiary nucleic acid molecule and is at the distal end of the primary nucleic acid molecule. In the figure, each "extra handle" is 12 nucleotides long ("12-mer"); however, their length is not limited and can be less than 12 or more than 12 nucleotides. In an embodiment, the "extra handle" each comprises a nucleotide sequence of a complementary nucleic acid; therefore, when the reporter complex comprises an "extra handle", the reporter complex can hybridize with a sequencing probe via the complementary nucleic acid of the reporter complex or via the "extra handle". Therefore, the probability of the reporter complex binding to the sequencing probe increases. The "extra handle" design can also improve hybridization kinetics. Without being bound by theory, the "extra handle" substantially increases the effective concentration of the complementary nucleic acid of the reporter complex.

[0106] Fig.21B Display usage for Fig. 20B The described procedure obtains variable average (fluorescence) counts from five exemplary reporter complexes with "extra handles".

[0107] Fig.22A and 22B Hybridization kinetics and fluorescence intensity for two exemplary reporter complexes are shown. By approximately 5 minutes, total counts began to plateau, indicating that most of the added reporter complexes had found available targets.

[0108] Detectable moieties, markers or reporters can be bound to complementary nucleic acids or tertiary nucleic acid molecules in various ways (including directly or indirectly attaching detectable moieties, such as fluorescent moieties, colorimetric moieties, etc.). Those skilled in the art can refer to references for labeled nucleic acids. Examples of fluorescent moieties include but are not limited to yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, cyanine, dansyl chloride, phycocyanin, phycoerythrin, etc. Fluorescent labels and their attachment to nucleotides and / or oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, Second Edition (Stockton Press, New York, 1993); Eckstein, ed., Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Specific methods suitable for use in the present invention are disclosed in the following sample references: U.S. Pat. Nos. 4,757,141; 5,151,507; and 5,091,519. In one aspect, one or more fluorescent dyes are used as markers for the labeled target sequence, for example as disclosed by U.S. Pat. Nos. 5,188,934 (4,7-dichlorofluorescein dye); 5,366,860 (spectrally resolvable rhodamine dye); 5,847,162 (4,7-dichlororhodamine dye); 4,318,846 (ether-substituted fluorescein dye); 5,800,996 (energy transfer dye); Lee et al. 5,066,580 (xanthine dye); 5,688,648 (energy transfer dye); etc. Labeling can also be performed with quantum dots, as disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002 / 0045045; and 2003 / 0017264.As used herein, the term "fluorescent marker" includes a signal transduction moiety that transmits information through the fluorescence absorption and / or emission properties of one or more molecules. Such fluorescence properties include fluorescence intensity, fluorescence lifetime, emission spectral characteristics, energy transfer, etc.

[0109] Commercially available fluorescent nucleotide analogs that are readily incorporated into nucleotide and / or oligonucleotide sequences include, but are not limited to, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein-12-dUTP, tetramethylrhodamine-6-dUTP, TEXAS RED™-5-dUTP, CASCADE BLUE™-7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR-14-dUTP, RHODAMINE GREEN™-5-dUTP, OREGON GREENR™ 488-5-dUTP, TEXAS RED™- 12-dUTP, BODIPY TM 630 / 650- 14-dUTP, BODIPY TM 650 / 665- 14-dUTP, ALEXA FLUOR™ 488-5-dUTP, ALEXA FLUOR™ 532-5-dUTP, ALEXA FLUOR™ 568-5-dUTP, ALEXA FLUOR™ 594-5-dUTP, ALEXA FLUOR™ 546- 14-dUTP, Fluorescein- 12-UTP, Tetramethylrhodamine-6-UTP, TEXAS RED™-5-UTP, mCherry, CASCADE BLUE™-7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHODAMINEGREEN™-5-UTP, ALEXA FLUOR™ 488-5-UTP, LEXA FLUOR™ 546-14-UTP (Molecular Probes, Inc. Eugene, OR) etc. Alternatively, the above fluorophores and those mentioned herein can be added during oligonucleotide synthesis using, for example, phosphoroamidite or NHS chemistry. Protocols for custom synthesis of nucleotides with other fluorophores are known in the art (see, Henegariu et al. (2000) Nature Biotechnol. 18: 345). 2-aminopurine is a fluorescent base that can be directly incorporated into the oligonucleotide sequence during its synthesis. Nucleic acids can also be first stained with intercalating dyes such as DAPI, YOYO-1, ethidium bromide, cyanine dyes (e.g., SYBR Green) etc.

[0110] Other fluorophores that can be used for post-synthesis attachment include, but are not limited to, ALEXA FLUOR™ 350, ALEXA FLUOR™ 405, ALEXA FLUOR™ 430, ALEXA FLUOR™ 532, ALEXA FLUOR™ 546, ALEXA FLUOR™ 568, ALEXA FLUOR™ 594, ALEXA FLUOR™ 647, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY 530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, Lissamine Rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Tetramethylrhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ), etc. FRET tandem fluorophores can also be used, including but not limited to PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC-Cy7, PE-Alexa dyes (610, 647, 680), APC-Alexa dyes, etc.

[0111] Metallic silver or gold particles can be used to enhance the signal from fluorescently labeled nucleotide and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).

[0112] Other suitable labels for oligonucleotide sequences may include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phospho-amino acids (e.g., P-tyr, P-ser, P-thr), etc. In one embodiment, the following hapten / antibody pairs are used for detection, wherein each antibody is derivatized with a detectable label: biotin / α-biotin, digoxigenin / a-digoxigenin, dinitrophenol (DNP) / a-DNP, 5-carboxyfluorescein (FAM) / a-FAM.

[0113] Detectable markers described herein are spectrally resolvable. "Spectrally resolvable" with reference to multiple fluorescent markers refers to the fluorescent emission bands of markers being sufficiently different, i.e., not overlapping enough, and the molecular tags attached to the respective markers can be distinguished based on the fluorescence signals generated by the standard light detection system of the corresponding markers, and the standard light detection system, for example, uses a system of bandpass filters and photomultiplier tubes, such as U.S. Patent No. 4,230,558; 4,811,218; etc., or Wheeless et al., pp. 21-76, Flow Cytometry: Instrumentation and Data Analysis (Academic Press, New York, 1985) described in the system exemplified. In one aspect, spectrally resolvable organic dyes, such as fluorescein, rhodamine, etc., mean that the wavelength emission maximum is separated by at least 20nm, and on the other hand, separated by at least 40nm. In another aspect, spectrally resolvable chelated lanthanide compounds, quantum dots, etc. mean that the wavelength emission maximum is separated by at least 10nm, and in another aspect, separated by at least 15nm.

[0114] Sequencing methods

[0115] The present invention relates to a method for sequencing nucleic acids using the sequencing probe of the present invention. Examples of the method are shown in Figures 8 to 12.

[0116] The method comprises reversibly hybridizing at least one sequencing probe of the invention to a target nucleic acid immobilized to a substrate (eg, at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more positions).

[0117] The matrix can be any solid support known in the art, such as coated slides and microfluidic devices, which can fix the target nucleic acid. In certain embodiments, the matrix is ​​a surface, film, pearl, porous material, electrode or array. The target nucleic acid can be fixed on any matrix apparent to those skilled in the art.

[0118] In an embodiment, the target nucleic acid is bound by a capture probe comprising a domain complementary to a portion of the target nucleic acid. The portion may be a terminus of the target nucleic acid, or may not be towards the terminus.

[0119] Exemplary useful matrices include matrices comprising a binding moiety selected from ligands, antigens, carbohydrates, nucleic acids, receptors, lectins and antibodies. The capture probe comprises a binding moiety capable of binding to the binding moiety of the matrix. Exemplary useful matrices comprising reactive moieties include, but are not limited to, surfaces comprising epoxy, aldehyde, gold, hydrazide, sulfhydryl, NHS-ester, amine, thiol, carboxylate, maleimide, hydroxymethylphosphine, iminoester, isocyanate, hydroxyl, pentafluorophenyl ester, psoralen, pyridyl disulfide or vinyl sulfone, polyethylene glycol (PEG), hydrogel or a mixture thereof. Such surfaces can be obtained from commercial sources or prepared according to standard techniques. Exemplary useful matrices comprising reactive moieties include, but are not limited to, OptArray-DNA NHS groups (Accler8), Nexterion Slide AL (Schott) and Nexterion Slide E (Schott).

[0120] In embodiments, the binding moiety of the capture probe is biotin, and the matrix comprises avidin (e.g., streptavidin). Useful matrices comprising avidin are commercially available, including TB0200 (Accelr8), SAD6, SAD20, SAD100, SAD500, SAD2000 (Xantec), SuperAvidin (Array-It), streptavidin slides (catalog number #MPC 000, Xenopore), and STREPTAVIDINnslide (catalog number #439003, Greiner Bio-one).

[0121] In an embodiment, the binding moiety of the capture probe is avidin (e.g., streptavidin), and the matrix comprises biotin. Commercially available useful matrices comprising biotin include, but are not limited to, Optiarray-biotin (Accler8), BD6, BD20, BD100, BD500, and BD2000 (Xantec).

[0122] In an embodiment, the binding portion of the capture probe may comprise a reactive portion capable of binding to a substrate by photoactivation. The substrate may comprise a photoreactive portion, or the first portion of the nanoreporter may comprise a photoreactive portion. Some examples of photoreactive portions include aryl azides, such as N((2-pyridyldisulfide)ethyl)-4-azido salicylamide; fluorinated aryl azides, such as 4-azido-2,3,5,6-tetrafluorobenzoic acid; benzophenone-based reagents, such as the succinimidyl ester of 4-benzoylbenzoic acid; and 5-bromo-deoxyuridine.

[0123] In embodiments, the binding moieties of the capture probes may be immobilized to the substrate via other binding pairs that will be apparent to those skilled in the art.

[0124] After binding to the substrate, the nucleic acid can be elongated by applying a force sufficient to extend the target nucleic acid (e.g., gravity, fluid dynamics, electromagnetic forces "electrostretching," flow stretching, receding meniscus techniques, and combinations thereof).

[0125] The target nucleic acid can be combined by a second capture probe, which comprises a domain complementary to the second portion of the target nucleic acid. The portion can be the end of the target nucleic acid, or may not be towards the end. The combination of the second capture probe can occur after or during the extension of the target nucleic acid, or the second capture probe can be combined with the unextended target nucleic acid. The second capture probe can have a combination as described above.

[0126] The capture probe may comprise or be associated with a detectable label (ie, a fiducial).

[0127] Capture probe can separate target nucleic acid from sample.Here, capture probe is added to the sample comprising target nucleic acid.Capture probe binds target nucleic acid via the region of capture probe, the region of the capture probe is complementary to the region of target nucleic acid.When target nucleic acid contacts the matrix comprising the part of the binding portion of the capture probe, nucleic acid is fixed to the matrix.

[0128] In order to ensure that the user "captures" as many target nucleic acid molecules as possible from a highly fragmented sample, it is helpful to include multiple capture probes, each capture probe being complementary to different regions of the target nucleic acid. For example, there may be three capture probe sets, wherein the first set is complementary to the region near its 5' end of the target nucleic acid, the second set is complementary to the region in the middle of the target nucleic acid, and the third set is near its 3' end. This can be summarized as the "n regions of interest" for each target nucleic acid. In this example, each individual set of fragmented target nucleic acids is combined with a capture probe comprising or in combination with a biotin tag. 1 / n of the input sample (where n = the number of different regions in the target nucleic acid) is separated for each collection chamber. The capture probe binds to the target nucleic acid of interest. The target nucleic acid is then fixed to the avidin molecule attached to the matrix via the biotin of the capture probe. Optionally, the target nucleic acid is stretched, for example, via flow or electrostatic force. All n sets can be stretched and combined simultaneously, or in order to maximize the number of fully stretched molecules, set 1 (which captures up to 5' regions) can be stretched and combined first; then set 2 (which captures the middle of the target region) can be stretched and combined; finally, set 3 can be stretched and combined.

[0129] The number of different capture probes required is inversely proportional to the size of the target nucleic acid fragment. In other words, for highly fragmented target nucleic acids, more capture probes will be needed. For sample types with highly fragmented and degraded target nucleic acids (e.g., formalin-fixed paraffin-embedded tissues), it may be useful to include multiple capture probe sets. On the other hand, for samples with long target nucleic acid fragments, such as isolated nucleic acids obtained in vitro, a single capture probe at the 5' end may be sufficient.

[0130] The region of the target nucleic acid between two capture probes or after a capture probe and before the end of the target nucleic acid is referred to herein as a "gap". The gap is a portion of the target nucleic acid that can be used to bind to the sequencing probe of the present invention. The minimum gap is the target binding domain length (e.g., 4 to 10 nucleotides), and the maximum gap is a large portion of the entire chromosome.

[0131] The immobilized target nucleic acid is shown in Fig.12 Here, the two capture probes are identified as the "5' capture probe" and the "3' capture probe".

[0132] Fig. 8AThe schematic diagram of the sequencing probe combined with the target nucleic acid is shown. Here, the target nucleic acid has thymidine (T). The first complementary nucleic acid set comprising a detectable marker or a reporter complex is shown at the top, and each member of the set has different detectable markers (for example, thymidine is identified by green signal) and different nucleotide sequences. The first nucleotide in the target binding domain binds the T in the target nucleic acid. The first attachment region of the probe includes one or more nucleotide sequences, which indicate that the first nucleotide in the target binding domain of the probe binds thymidine. Therefore, only the complementary nucleic acid of thymidine binds the first position in the barcode domain. As shown, the first complementary nucleic acid encoding thymine comprising a detectable marker or the reporter complex comprising a detectable marker is combined with the attachment region of the first position in the barcode domain of the probe.

[0133] The number of sets of complementary nucleic acids or reporter complexes is the same as the number of positions in the barcode domain. Thus, for a barcode domain with six positions, six sets will be cycled over the probes.

[0134] Alternatively, the probe can be hybridized to a complementary nucleic acid or a reporter complex comprising a detectable label at its first position before contacting the target nucleic acid with the probe. Thus, when contacted with its target nucleic acid, the probe is capable of emitting a detectable signal from its first position, and it is not necessary to provide a first set of complementary nucleic acids or reporter complexes for the first position on the barcode domain.

[0135] Figure 8B continue Fig. 8A In the method shown in. Here, the first complementary nucleic acid (or reporter complex) of the thymidine bound to the attachment region of the first position of the barcode domain has been replaced by the first hybrid nucleic acid for thymidine and lacking a detectable marker. The first hybrid nucleic acid for thymidine and lacking a detectable marker replaces the previously bound complementary nucleic acid or previously bound reporter complex containing a detectable marker. Therefore, position 1 of the barcode domain no longer emits a detectable signal.

[0136] In an embodiment, a complementary nucleic acid or a reporter complex comprising a detectable marker can be removed from the attachment region, but is not replaced by a hybrid nucleic acid lacking a detectable marker. This can be performed, for example, by adding a chaotropic agent, increasing the temperature, changing the salt concentration, adjusting the pH and / or applying fluid dynamics. In these embodiments, less reagents (i.e., hybrid nucleic acids lacking a detectable marker) are required.

[0137] Figure 8CContinue to claim the method of the present invention. Here, the target nucleic acid has cytidine (C) and thymidine (T) before it. The second set of complementary nucleic acids or reporter complexes is shown at the top, and each member of the set has different detectable labels and different nucleotide sequences. In addition, the nucleotide sequence of the complementary nucleic acid of the first set or the complementary nucleic acid of the reporter complex is different from the nucleotide sequence of those of the second set. However, base-specific detectable markers are common to the set of complementary nucleic acids, such as thymidine identified by green signal. Here, the second nucleotide in the target binding domain binds to C in the target nucleic acid. The second attachment region of the probe has a nucleotide sequence that indicates that the second nucleotide in the target binding domain of the probe binds to cytidine. Therefore, only the complementary nucleic acid or reporter complex containing a detectable label from the second set and for cytidine binds to the second position of the barcode domain. As shown, the second complementary nucleic acid or reporter complex encoding cytidine binds at the second position of the barcode domain of the probe.

[0138] In an implementation scheme, Figure 8C The steps shown in Figure 8B Here, once ( Fig. 8A A first set of complementary nucleic acids or reporter complexes has been ( Figure 8B A second set of complementary nucleic acids or reporter complexes (e.g., Figure 8C Optionally, Figure 8C The steps shown in Figure 8B Here, with a second set of complementary nucleic acids or reporter complexes (such as Figure 8C ) and simultaneously providing a first hybrid nucleic acid lacking a detectable label (such as Figure 8B ).

[0139] Fig.8D continue Figure 8C Here, the first to fifth positions on the barcode domain are bound by complementary nucleic acids or reporter complexes comprising a detectable marker and have been replaced with hybrid nucleic acids lacking a detectable marker. The sixth position of the barcode domain is now bound by a complementary nucleic acid or reporter complex comprising a detectable marker, which identifies the sixth position in the target binding domain as being bound to guanine (G).

[0140] As mentioned above, a complementary nucleic acid or reporter complex comprising a detectable label can be removed from the attachment region but not replaced with a hybridized nucleic acid lacking the detectable label.

[0141] If desired, the rate of detectable label exchange can be accelerated by incorporating small single-stranded oligonucleotides that accelerate the rate of detectable label exchange (e.g., "Toe-Hold" Probes; see, e.g., Seeling et al. , “CatalyzedRelaxation of a Metastable DNA Fuel”; J. Am. Chem. Soc . 2006, 128(37), pp12211-12220).

[0142] The final position of the barcode field ( Fig.8D 6 position in the sequence probe); however, this may not be necessary when the sequencing probe is replaced with another sequencing probe. Fig.8D The sequencing probe can now be dehybridized and removed from the target nucleic acid and replaced by a second (overlapping or non-overlapping) sequencing probe that has not yet been bound by any complementary nucleic acid, such as Fig. 8E The second probe population may include Fig. 8E The probe in .

[0143] picture Figures 8A to 8E Same, Fig.9A and 9D 9G to 9G show the method steps of the present invention; however, Fig.9A and 9D 9G clearly show that the reporter complex (including the detectable label) is bound to the attachment region of the sequencing probe. Fig.9D and 9E The fluorescent signal emitted by the probe hybridized to the reporter complex is displayed. Fig.9D and 9E The target nucleic acid is shown to have a sequence of "TA".

[0144] Fig.10 Overview Fig.9D and 9E The steps shown in . The nucleotide sequence of an exemplary probe is shown at the top of the figure and the important domains of the probe are identified. The probe comprises an optional double-stranded DNA spacer between its target binding domain and its barcode domain. The barcode domain comprises, in sequence, a "Flanking 1" portion, an "AR-1" portion, an "AR-1 / Flanking 2" portion, an "AR-2" portion, and an "AR-2 / Flanking 3" portion. In step 1, "AR-1 detection" hybridizes with the "AR-1" and "AR-1 / Flanking 2" portions of the probe. "AR-1 detection" corresponds to a reporter complex encoding a first position thymidine or a complementary nucleic acid comprising a detectable marker. Therefore, step 1 corresponds to Fig.9DIn step 2, "Lack 1" hybridizes to the "Flanking 1" and "AR-1" portions of the probe. "Lack 1" corresponds to a hybridized nucleic acid lacking a detectable label specific for the first attachment region of the probe (e.g. Fig.9E By hybridizing at the "Flanking 1" position 5' of the reporter complex or complementary nucleic acid, the hybridizing nucleic acid more efficiently displaces the reporter complex / complementary nucleic acid from the probe. The "Flanking" portion is also referred to as the "Toe-Holds". In step 3, the "AR-2 Detection" hybridizes to the "AR-2" and "AR-2 / Flanking 3" portions of the probe. The "AR-2 Detection" corresponds to the reporter complex or complementary nucleic acid encoding the second position guanine that contains a detectable label. Therefore, step 3 corresponds to Fig.9E In this embodiment, a hybridizing nucleic acid lacking a detectable label and a complementary nucleic acid / reporter complex comprising a detectable label are provided sequentially.

[0145] Alternatively, a hybridizing nucleic acid lacking a detectable label and a complementary nucleic acid / reporter complex comprising a detectable label are provided simultaneously. This alternative embodiment is shown in Fig.11 In step 2, "Deficiency 1" (a hybridized nucleic acid lacking a detectable label) is provided together with "AR-2 Detection" (a reporter complex encoding a guanine at the second position). This alternative embodiment can be compared to Fig.10 The embodiment shown in is more efficient because it combines two steps into one.

[0146] Fig.12 The method of the present invention is described. Here, the target nucleic acid is captured and fixed at two positions, thereby producing a "gap" that the probe can bind. The first probe colony is hybridized to the target nucleic acid, and a detectable marker is detected. The initial step is repeated with the second probe colony, the third probe colony, to more than 100 probe colonies. The use of about 100 probe colonies provides about 5 times the coverage of each nucleotide in the target nucleic acid. Fig.12 An estimated rate of read time is provided based on the time required to detect a signal from one field of view (FOV).

[0147] The distribution of probes along the length of the target nucleic acid is critical to the resolution of the detectable signal. As discussed above, the resolution limit of two detectable labels is about 600 nucleotides. Preferably, each sequencing probe in the probe population will bind no closer than 600 nucleotides to each other. As discussed above, 600 nucleotides is the resolution limit of a typical sequencing device. In this case, the sequencing probe will provide a single read value; this Fig.12 The resolution limit point is shown on the far left.

[0148] Randomly, but depending in part on the length of the target binding domain, the Tm of the probe, and the concentration of the probe used, two different sequencing probes in the population may bind within 600 nucleotides of each other. In this case, unordered multiple reads will emanate from a single resolution limit; this Fig.12 The second resolution limit is shown in Figure 2.

[0149] Alternatively or additionally, the concentration of sequencing probes in the population can be reduced to reduce the coverage of the probes in a specific region of the target nucleic acid, for example above the resolution limit of the sequencing apparatus, thereby generating a single read from the resolution limit.

[0150] Fig.23 A schematic diagram of a sequencing probe different from that used in Figures 8 to 12 is shown. Here, each position on the barcode domain is bound by a complementary nucleic acid or a reporter complex comprising a detectable label. Therefore, in this example, six nucleotide sequences can be read without the need to replace the complementary nucleic acids in sequence. The use of this sequencing probe will reduce the time to obtain sequence information because many steps of the method are omitted. However, this probe will benefit from non-overlapping detectable labels, for example, fluorophores are excited by light of non-overlapping wavelengths or fluorophores emit light of non-overlapping wavelengths.

[0151] The method also includes assembling the linear order of each identified nucleotide in each region of the fixed target nucleic acid, thereby identifying the step of the sequence of the fixed target nucleic acid. The step of assembling uses a non-temporary computer-readable storage medium with an executable program stored thereon. The program instructs the microprocessor to arrange the linear order of each identified nucleotide in each region of the target nucleic acid, thereby obtaining the sequence of the nucleic acid. Assembling can occur in "real time", i.e., while collecting data from the sequencing probe, rather than after all data have been collected.

[0152] Any of the above aspects and embodiments may be combined with any other aspect or embodiment disclosed herein in the Summary and / or Detailed Description sections.

[0153] definition:

[0154] In certain exemplary embodiments, the terms "annealing" and "hybridization" as used herein are used interchangeably to indicate the formation of a stable duplex. In one aspect, a stable duplex refers to a duplex structure that is not destroyed by stringent washing under conditions such as: a temperature of about 5°C or above about 5°C below the Tm of the chains of the duplex and a low monovalent salt concentration, for example less than 0.2M, or less than 0.1M or a salt concentration known to those skilled in the art. The term "perfectly matched" when used with reference to a duplex refers to a polynucleotide and / or oligonucleotide chain constituting the duplex forming a double-stranded structure with each other, so that each nucleotide in each chain undergoes Watson-Crick base pairing with a nucleotide in the other chain. The term "duplex" includes, but is not limited to, pairing of nucleoside analogs such as deoxyinosine, nucleosides with 2-aminopurine bases, PNA, etc. that can be employed. A "mismatch" in a duplex between two oligonucleotides means that a pair of nucleotides in the duplex cannot undergo Watson-Crick bonding.

[0155] As used herein, the term "hybridization conditions" will typically include salt concentrations of less than about 1 M, more typically less than about 500 mM, and even more typically less than about 200 mM. The hybridization temperature can be as low as 5°C, but is typically greater than 22°C, more typically greater than about 30°C, and often exceeds about 37°C. Hybridization is typically performed under stringent conditions, such as conditions under which the probe will specifically hybridize to its target sequence. Stringent conditions are sequence dependent and are different in different situations. Longer fragments may require higher hybridization temperatures for specific hybridization. Since other factors may affect the stringency of hybridization, including the base composition and length of the complementary strands, the presence of organic solvents, and the degree of base mismatching, the combination of parameters is more important than the absolute measurement of any one alone.

[0156] Typically, stringent conditions are selected so that the Tm of a specific sequence is about 5°C lower than that of the specific sequence at a defined ionic strength and pH. Exemplary stringent conditions include a salt concentration of at least 0.01M to no more than 1M Na ion concentration (or other salts) at a temperature of pH 7.0 to 8.3 and at least 25°C. For example, 5X SSPE (750 mM NaCl, 50 mM sodium phosphate, 5mM EDTA, pH 7.4) and a temperature of 25-30°C are suitable for allele-specific probe hybridization. For stringent conditions, see, for example, Sambrook, Fritsche and Maniatis, "Molecular Cloning A Laboratory Manual, 2nd Ed." Cold Spring Harbor Press (1989) and Anderson Nucleic Acid Hybridization, 1st edition, BIOS Scientific Publishers Limited (1999). As used herein, the term "with ... specific hybridization" or "with ... specific hybridization" or similar terms refer to that a molecule is substantially combined, double-stranded or hybridized with one or more specific nucleotide sequences under stringent conditions.

[0157] The detectable label associated with a specific position of the probe can be "read" (e.g., its detected fluorescence) one or more times; "read" can be synonymous with the term "base call". Multiple reads improve accuracy. The target nucleic acid sequence is "read" when a continuous sequence segment of sequence information obtained from a single initial target molecule is detected; typically, this is generated via a multi-channel common (defined below). As used herein, the term "coverage" or "coverage depth" refers to the number of times a target region has been sequenced (via discrete read values) and aligned with a reference sequence. Read coverage is the total number of reads mapped to a specific reference target sequence; base coverage is the total number of base calls made at a specific genomic position.

[0158] As used herein, a "hybe and seq cycle" refers to all steps required to detect each attachment region on a particular probe or probe population. For example, for a probe capable of detecting six positions on a target nucleic acid, one "hybe and seq cycle" would include at least hybridizing the probe to the target nucleic acid, hybridizing a complementary nucleic acid / reporter complex to an attachment region at each of the six positions on the barcode domain of the probe, and detecting a detectable label associated with each of the six positions.

[0159] The term "k-mer probe" is synonymous with the probe of the present invention.

[0160] When comparing two or more sequences from discrete reads, overlapping portions can be combined to produce a single consensus sequence. At positions with identical bases in the overlapping portion (single column of the comparison), these bases become a common thing. Various rules can be used to produce a common thing at positions that are inconsistent between overlapping sequences. The most common base in the column is used as a common thing by a simple majority rule. "Multi-channel common thing" is the comparison of all discrete probe readings from a single target molecule. According to the total number of cycles of the probe colony / voting applied, each base position in a single target molecule can be queried with different redundancy or overlapping levels; Usually, redundancy increases the confidence level of base calls.

[0161] "Raw accuracy" is a measure of the inherent ability of the system to correctly identify bases. Raw accuracy depends on the sequencing technology. "Shared accuracy" is the ability of the system to correctly identify bases using additional readings and statistical power. "Specificity" refers to the percentage of reads that are mapped to the expected target for each run of total reads. "Uniformity" refers to the variability of sequence coverage of the target region; high uniformity is associated with low variability. This feature is usually reported as the fraction of the targeted region covered by ≥20% of the average coverage depth of all targeted regions. Random errors (i.e., inherent sequencing chemistry errors) can be easily corrected with "multiple passes" sequencing of the same target nucleic acid; given a sufficient number of passes, substantially "perfect consensus" or "error-free" sequencing can be achieved.

[0162] The method described herein can be implemented and / or recorded results using any device capable of implementing the method and / or recording the results. The example of the device that can be used includes but is not limited to electronic computing devices, including all types of computers. When the method described herein is implemented and / or recorded in a computer, any computer readable medium that can contain a computer program can contain a computer program that can be used to configure a computer to implement the steps of the method. The example of the computer readable medium that can be used includes but is not limited to disks, CD-ROMs, DVDs, ROMs, RAMs, non-transitory computer readable media, and other memories and computer storage devices. The computer program that can be used to configure a computer to implement the steps of the method, assembling sequence information, and / or recording the results can also be provided by an electronic network, for example, by the Internet, an intranet, or other networks.

[0163] "Consumable Sequencing Cards" Fig.24) can be incorporated into fluorescent imaging equipment known in the art. Any fluorescent microscope with many varying features can perform the sequencing read. For example: widefield lights, lasers, LEDs, multiphoton, confocal or total internal reflection illumination can be used for excitation and / or detection. On the emission detection channel of the fluorescence microscope, cameras (single or multiple) and / or photomultiplier tubes (single or multiple) with filter-based or grating-based spectral resolution (one or more spectrally resolved emission wavelengths) are possible. A standard computer can control the consumable sequencing card, the reagents flowing through the card, and the detection by the fluorescence microscope.

[0164] The sequencing data can be analyzed by any number of standard next generation sequencing assemblers (see, e.g., Wajid and Serpedin, “Review of general algorithmic features for genome assemblers for next generation sequencers”). Genomics, proteomics & bioinformatics, 10 (2), 58-73, 2012). Sequencing data acquired within a single diffraction-limited region of the microscope are “locally assembled” to generate a consensus sequence from multiple reads within the diffraction spot. Reads assembled from multiple diffraction spots are then mapped together to generate a contiguous sequence representing the entire set of targeted genes, or a de novo assembly of the whole genome.

[0165] Additional teachings relevant to the present invention are described in one or more of the following: US 8,148,512, US 7,473,767, US 7,919,237, US 7,941,279, US 8,415,102, US 8,492,094, US 8,519,115, US 2009 / 0220978, US 2009 / 0299640, US 2010 / 0015607, US 2010 / 0261026, US 2011 / 0086774, US 2011 / 0145176, US 2011 / 0201515, US 2011 / 0229888, US 2013 / 0004482, US 2013 / 0017971, US 2013 / 0178372, US 2013 / 0230851, US 2013 / 0337444, US 2013 / 0345161, US 2014 / 0005067, US 2014 / 0017688, US 2014 / 0037620, US 2014 / 0087959, US 2014 / 0154681, and US 2014 / 0162251, each of which is incorporated herein by reference in its entirety. Example

[0166] Example 1: The method of the present invention for sequencing a target nucleic acid is rapid

[0167] The following describes the timing of the steps in the method of the present invention and as shown in Figures 8 to 12.

[0168] The present invention requires minimal sample preparation. Fig.13 As shown in , nucleic acids in a sample can begin to be read after 2 hours or less or preparation time; this is significantly less time than required for Ion Torrent (AmpliSeq™) or Illumina (TruSight) sequencing, which require approximately 12 or 9 hours of preparation time, respectively.

[0169] Fig.14 The calculation of an exemplary run is shown in , and Fig.15 The calculation of the cycle time is shown in .

[0170] The binding of the probe population to the immobilized target nucleic acid takes about 60 seconds. The reaction can be accelerated by using multiple copies of the target binding domain on the synthetic backbone. Using a microfluidic controlled fluid exchange device, it takes about half a second to wash away the unbound probes.

[0171] It takes about 15 seconds to add the first set of complementary nucleic acids (comprising a detectable label) and bind them to the attachment region in the first position of the barcode domain.

[0172] Each field of view (FOV) is imaged for four different colors, each color representing a single base. A reference point placed on the 5' capture probe or the 3' capture probe (or both) can help read only those optical barcodes that are aligned between the two positions (consistent with the presence of the gap target nucleic acid). Reference points can also be added to each field of view to produce equal alignment of images after consecutive steps in the sequencing process. All four images can be obtained in a single FOV, and then the optical reading device can be moved to a new FOV, or all FOVs can be taken in one color and then re-imaged in a second color. A single FOV can be read in about half a second. It takes about half a second to move to the next FOV. Therefore, the time to read "n" FOVs is equal to "n" × 1 second).

[0173] The complementary nucleic acid with the detectable label is removed from the first position of the barcode domain by heating or washing with an excess of complementary nucleic acid lacking the detectable label. If desired, the rate of detectable label exchange can be accelerated by incorporating a small single-stranded oligonucleotide that accelerates the rate of detectable label exchange (e.g., a "Toe-Hold" probe; see, e.g., Seeling et al. , “Catalyzed Relaxation of a Metastable DNA Fuel”; J. Am. Chem. Soc . 2006, 128(37), pp 12211-12220). The FOV can be re-imaged to confirm that all complementary nucleic acids with detectable markers are removed before continuing to move. This takes about fifteen seconds. This step can be repeated until the background signal level is reached.

[0174] Repeat the above steps or for the remaining positions in the barcode domain of the probe.

[0175] The total time to read is equal to m(bases read) × (15 seconds + n FOV × 1 second + 15 seconds). For example, when the number of positions in the barcode field is 6 and 20 FOVs, the time to read is equal to 6 X (30 + 20 + 15) or 390 seconds.

[0176] The first population of probes was dehybridized. This took about sixty seconds.

[0177] Repeat the above steps for the second and subsequent probe populations. If the population of sequencing probes is organized by melting temperature (Tm), each probe population will need multiple hybridizations to ensure that each base is covered to the desired depth (this is driven by the error rate). In addition, by analyzing the hybridization readings during the run, each single gene that is well sequenced can be identified before the actual determination of the entire sequence. Therefore, the cycle can be repeated until the error frequency (or coverage) of a specific expectation is met.

[0178] Using the above timing, together with some gap nucleic acid binding density estimates, the throughput of the Nanostring (NSTG)-next generation sequencer of the present invention can be estimated.

[0179] The net throughput of the sequencer is given by:

[0180] Fractional base occupancy X <gap length> X number of gaps per FOV X number of bases per optical barcode / [60 seconds (probe hybridized to target nucleic acid) + 0.5 seconds (wash) + m: number of positions in the barcode domain X (15 seconds (bound complementary nucleic acid) + nfovsX1 + 15 seconds (unbound complementary nucleic acid)) + 60 seconds (probe dehybridized to target nucleic acid)].

[0181] Thus, in one example, the total "cycles" of a single gap nucleic acid (from Fig.10 ) together with the methods shown in :

[0182] 60 seconds (probe to target nucleic acid hybridization) + 0.5 seconds (wash) + m-base X (15 seconds (bound complementary nucleic acid) + nFOV X 1 + 15 seconds (unbound complementary nucleic acid)) + 60 seconds (probe to target nucleic acid dehybridization). Using m = 6, nFOV = 20, the resulting time = 60 + 0.5 + 390 + 60 = 510.5 seconds.

[0183] Assumptions: 1% occupancy of the gapped nucleic acid region, 4000 bases per gap, and 5000 gapped nucleic acid fragments per FOV, and m of 6 and nFOV of 20 (as described above) yield the following net flux:

[0184] 0.01 X 4000 X 5000 X 20 = 4,000,000 6-base reads every 510.5 seconds = 47,012.73 bases / second.

[0185] Therefore, in this example, the net flux measured continuously every 24 hours = 4.062 Gigabases (Gb) / day. An alternative estimate is up to 12 Gb per day. See Fig.12 .

[0186] like Fig.14 As shown in , the run time required for sequencing 100 different target nucleic acids ("100-plex") is about 4.6 hours; the run time required for sequencing 1000 different target nucleic acids ("1000-plex") is about 16 hours.

[0187] Fig.16 The sequencing rates, read counts, and clinical utility of the present invention and various other sequencing methods / apparatuses were compared.

[0188] Example 2: The method of the present invention has a low error rate

[0189] Fig.17 It is shown that when the end position is omitted, the present invention has an original error rate of about 2.1%.

[0190] For the claimed invention, the error rate associated with sequencing is related to the free energy difference between a perfectly matched (m+n)-mer and a single base mismatched (m-1+n)-mer. The sum of m+n is the number of nucleotides in the target binding domain, and m represents the number of positions in the barcode domain. The hybridization selectivity can be estimated using the equation (see, Owczarzy, R. (2005), Biophys. Chem., 117:207-215 and Integrated DNA Technologies website: at the World Wide Web ( www )idtdna.com / analyzer / Applications / Instructions / Default.aspxAnalyzerDefinitions=true#MismatchMeltTemp):

[0191]

[0192] Where K a is the binding equilibrium constant obtained from the predicted thermodynamic parameters,

[0193]

[0194] Theta represents the percentage of binding of exactly complementary sequences and single-base mismatched sequences that are expected to anneal to the target at a specified hybridization temperature. T is the hybridization temperature in Kelvins, H° (enthalpy) and S° (entropy) is the melting parameter calculated from the sequence and published nearest neighbor thermodynamic parameters, and R is the ideal gas constant (1.987 cal.K -1 mole -1), [strand 1 / 2] is the molar concentration of the oligonucleotide, and the constant of -273.15 converts the temperature from Kelvin to Celsius. DNA / DNA base pairs were obtained from the following publications (see, Allawi, H., SantaLucia, J. Biochemistry , 36, 10581), RNA / DNA base pairs (see, Sugimoto et al., Biochemistry , 34, 11211-6), RNA / RNA base pairs (see, Xia, T. et al., Biochemistry , 37, 14719).

[0195] As an example of an estimate of the approximate error rate expected from a NSTG sequencer, the following is given: For (m + n) equal to 8'mer. Consider the following 8-mer barcode and its single base mismatch.

[0196]

[0197] (Sequence region)

[0198]

[0199] (Sequencing of optical barcodes with perfect matches)

[0200]

[0201] (Optical barcode sequencing with single-base mismatch (GT) pairing).

[0202] Using an IDT calculator based on the above equation yields:

[0203] At 17.4°C (the Tm for a perfect match), (50% / 0.3%) would be the ratio of correct optical barcodes to incorrect barcodes that hybridized to the sequence at Tm, giving an estimated error rate of 0.6% for the sequence.

[0204] Very high GC content sequencing calculated:

[0205]

[0206] (Sequence region)

[0207]

[0208] (Sequencing of optical barcodes with perfect matches)

[0209]

[0210] (Optical barcode sequencing with single base mismatch (GA) mismatch pairs).

[0211] At 41.9°C (the Tm for a perfect match), (50% / 0.4%) would be the ratio of correct optical barcodes to incorrect barcodes that hybridized to the sequence at Tm, giving an estimated error rate of 0.8% for the sequence.

[0212] Examination of the number of 8-mer pairs yielded a distribution of error rates in the range of 0.2% to 1%. Although the above calculations differ from the conditions used, these calculations provide an indication that the methods of the present invention will have a relatively low intrinsic error rate when compared to other single molecule sequencing technologies (such as Pacific Biosciences and Oxford Nanopore technologies) where the error rate can be significant (>> 10%).

[0213] Fig.18 This indicates that the raw accuracy of the present invention is higher than other sequencing methods. Thus, the present invention provides a consensus sequence from a single target after fewer passes than required by other sequencing methods. In addition, after 30 or more passes, the present invention can obtain "completely consistent / error-free" sequencing (i.e., 99.9999% / Q60), while the PacBio sequencing method (for example) cannot achieve such consistency after 70 passes.

[0214] Example 3: The present invention has single base pair resolution capability

[0215] Fig.19 The present invention was shown to have single-base resolution and to have a low error rate (ranging from 0% to 1.5% depending on the specific nucleotide substitution).

[0216] Additional experiments were performed using target RNA hybridized to the barcode and immobilized to the surface of the cassette using normal NanoString gene expression binding technology (see e.g. , Geiss et al., “Direct multiplexed measurement of gene expression with color-coded probe pairs”; Nature Biotechnology , 26, 317- 325 (2008)). The ability of RNA targets to hybridize with barcodes of varying target binding domain lengths and with perfect matches (YGBYGR-2um optical barcode linked to a perfect 10-mer matching sequence) was measured. Fig.26 ). Longer lengths of the target binding domain resulted in higher counts. It also shows that a 10-mer target binding domain is sufficient to register sequences above background. Each of the matches for individual single base changes was synthesized with an alternative optical barcode. The ratio of counts for correct to incorrect optical barcodes ( Fig.24 and25 ).

[0217] Ability of 10-mer to detect SNPs with true sequence >15000 counts above background and incorrect sequence up to >400 counts above background. Expected error rate of 3% of true sequence in the presence of correct probe. Note that this data is (essentially) a worse case scenario. Only 10 base pair hybridization sequences were attached to a 6.6 kilobase optical barcode reporter (Gen2 type). No specific conditions were optimized. However, this data does show that the NanoString next generation sequencing method is able to resolve single base pairs of sequences.

[0218] The detailed materials and methods used in the above studies are as follows:

[0219] Hybridization Protocol Probe B plus Code Set

[0220] • Take 25ul element (194 code set)

[0221] • Add 5ul of Probe B + complementary sequence to target (100uM)

[0222] • Add 15ul Hyb buffer (14.56 X SSPE 0.18% Tween 20)

[0223] SSPE (150mM NaCl, NaH2PO4xH2O 10mM, Na2EDTA 10mM)

[0224] • Incubate on ice for 10 minutes

[0225] • Add 150ul G beads (40ul 10mg / ml G beads plus 110ul 5x SSPE 0.1% Tween 20)

[0226] • Incubate at room temperature for 10 minutes

[0227] • Wash three times with 0.1SSPE 0.1% Tween 20 using a magnetic collector

[0228] • Elute in 100ul 0.1x SSPE at 45°C for 10 minutes.

[0229] Target hybridization protocol (750 mM NaCl)

[0230] • Take 20ul of the above eluted sample

[0231] • Add 10ul hyb buffer

[0232] • Add 1ul target (100nM biotinylated RNA)

[0233] • Incubate on ice for 30 minutes

[0234] 15ul was taken and bound to a streptavidin slide for 20 minutes, the fluid was stretched with a G hook, and counted with an nCounter.

[0235] Material

[0236] Feature 194 Code Set

[0237] Oligonucleotides were purchased from IDT

[0238] SSPE (150mM NaCl, NaH2PO4xH2O 10mM, Na2EDTA 10mM)

[0239] Hyb buffer (14.56 X SSPE 0.18% Tween 20).

[0240] Table 2: 12-, 11-, .., 8-mer probe B sequences. (SEQ ID NO: 30 to SEQ ID NO: 34)

[0241]

[0242] Table 3: Target sequence (in bold; SEQ ID NO: 35)

[0243]

[0244] Table 4: 10-mer mismatched probe B sequences (in bold; SEQ ID NO: 36 to SEQ ID NO: 41)

[0245] Sequence Listing <110> NanoString Technologies, Inc. BEECHEM, Joseph KHAFIZOV, Rustem <120> Enzyme-free and amplification-free sequencing <130> NATE-025 / 001 <150> US 62 / 082,883 <151> 2014-11-21 <160> 104 <170> PatentIn version 3.5 <210> 1 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 1 atacatctag 10 <210> 2 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 2 gatctacata 10 <210> 3 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 3 ttaggtaaag 10 <210> 4 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 4 tcttcattac 10 <210> 5 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 5 atgaatctac 10 <210> 6 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 6 tcaatgtatg 10 <210> 7 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 7 aattgagtac 10 <210> 8 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 8 atgttaatgg 10 <210> 9 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 9 aattaggatg 10 <210> 10 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 10 ataatggatc 10 <210> 11 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 11 taataaggtg 10 <210> 12 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 12 tagttagagc 10 <210> 13 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 13 atagagaagg 10 <210> 14 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 14 ttgatgatac 10 <210> 15 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 15 atagtgattc 10 <210> 16 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 16 tataacgatg 10 <210> 17 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 17 ttaagtttag 10 <210> 18 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 18 atacgttatg 10 <210> 19 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 19 tgtactatag 10 <210> 20 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 20 ttaacaagtg 10 <210> twenty one <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty one aactatgtac 10 <210> twenty two <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty two taactatgac 10 <210> twenty three <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty three actaatgttc 10 <210> twenty four <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty four tcattgaatg 10 <210> 25 <211> 14 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 25 ctgtctcatc tctt 14 <210> 26 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 26 ctgtctcatc tcttgctgca tcctgt 26 <210> 27 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 27 ctgtctcatc tcttgctgca tcctgtcggt tcacgttg 38 <210> 28 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 28 ctgtctcatc ttgctgcatc ctgtcggttc acgttg 36 <210> 29 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 29 ctgtctcattttgctgcatc ctgtccgttc acgttg 36 <210> 30 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 30 gactgtaccc acgcgatgac gttcgtcaag agtcgcataa tct 43 <210> 31 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 31 agactgtacc acaagaatcc ctgctagctg aaggagggtc aaac 44 <210> 32 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 32 gagactgtac cctacgtata tatccaagtg gttatgtccg acggc 45 <210> 33 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 33 tgagactgta ccacccctcc aaacgcattc ttatggcaa atggaa 46 <210> 34 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 34 ctgagactgt acccgggaat cggcatttcg cattcttagg atctaaa 47 <210> 35 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 35 caatgtgagt ctcttggtac agtctcagtt agtcactccc taag 44 <210> 36 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 36 gagacagtac cctggtctag gtatctaatt cgtgggtcgg gtact 45 <210> 37 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 37 gagaccgtac cgctcatttt gaacatacga ttgcgattac ggaaa 45 <210> 38 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 38 gagacggtac cttaaagcta tccacgaatg tcaaaaatgt ggttt 45 <210> 39 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 39 gagagtgtac ccaatgcttg cagtatgtat cctgatcgtg cgtgc 45 <210> 40 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 40 gagaatgtac cctcatacca atgtaaagta tagttaacgc cctgt 45 <210> 41 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 41 gagattgtac cctacatata taggaaaagg gaaggtagaa gagct 45 <210> 42 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 42 cacgaacgtc ag 12 <210> 43 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 43 catcgcatgc ct 12 <210> 44 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 44 gtcatctcct ac 12 <210> 45 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 45 gtcatccgct ac 12 <210> 46 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 46 gtcatcgact ac 12 <210> 47 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 47 gtcatcttct ac 12 <210> 48 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 48 gtcatcacct ac 12 <210> 49 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 49 gtcatcactc ac 12 <210> 50 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 50 gtcatcttcg ac 12 <210> 51 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 51 gtcatcaact ac 12 <210> 52 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 52 gtcatccgta ac 12 <210> 53 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 53 gtcatccgaa ac 12 <210> 54 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 54 gtcatcacaa ac 12 <210> 55 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 55 gtcatcttgc ac 12 <210> 56 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 56 gtcatcttgc ct 12 <210> 57 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 57 gtcatccgtc ct 12 <210> 58 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 58 cttttcacct ct 12 <210> 59 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 59 cttttcctct ct 12 <210> 60 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 60 cttttcgact ct 12 <210> 61 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 61 cttttctgct ct 12 <210> 62 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 62 cttttctgta ct 12 <210> 63 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 63 cttttctgtg ct 12 <210> 64 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 64 cttttctgtc ct 12 <210> 65 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 65 cttttcactc ct 12 <210> 66 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 66 cttttcgttc ct 12 <210> 67 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 67 cttttcgtac ct 12 <210> 68 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 68 cttttccgtc ct 12 <210> 69 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 69 cttttctgac ct 12 <210> 70 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 70 aggcatgcga tg 12 <210> 71 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 71 aggcattgtg ct 12 <210> 72 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 72 aggcattgct ct 12 <210> 73 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 73 aggcatttct ac 12 <210> 74 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 74 aggcatacct ac 12 <210> 75 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 75 aggcatttgc ac 12 <210> 76 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 76 aggcatcgtc ct 12 <210> 77 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 77 tcctgtcggt tc 12 <210> 78 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 78 gttcaatgct ct 12 <210> 79 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 79 attcggtgct ct 12 <210> 80 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 80 gatgcctgct ct 12 <210> 81 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 81 tttgcttgct ct 12 <210> 82 <211> 100 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 82 ttcactgtag ctgtctcatt ttgctgcatc ctgtccgttc acgttggagc ttgtcatccg 60 tcctcttttc actcctaggc atttgcctat tcggcgtcct 100 <210> 83 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 83 cgatctggtt 10 <210> 84 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 84 cgatctggtt 10 <210> 85 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 85 gctagaccaa 10 <210> 86 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 86 gctggaccaa 10 <210> 87 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 87 gctcgaccaa 10 <210> 88 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 88 gcttgaccaa 10 <210> 89 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 89 gagactgtac 10 <210> 90 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 90 gagacagtac 10 <210> 91 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 91 gagaccgtac 10 <210> 92 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 92 gagacggtac 10 <210> 93 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 93 gagagtgtac 10 <210> 94 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 94 gagaatgtac 10 <210> 95 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 95 gagattgtac 10 <210> 96 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 96 gagactgtac 10 <210> 97 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 97 gagattgtac 10 <210> 98 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 98 gagaccgtac 10 <210> 99 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 99 gagagtgtac 10 <210> 100 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 100 ctgagactgt ac 12 <210> 101 <211> 11 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 101 tgagactgta c 11 <210> 102 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 102 gagactgtac 10 <210> 103 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 103 catgtcagag tc 12 <210> 104 <211> 11 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 104 catgtcagag t 11

Claims

1. A sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least 12 nucleotides and is capable of binding to a target nucleic acid; wherein the barcode domain comprises a synthetic backbone, wherein the synthetic backbone comprises single-stranded DNA, the barcode domain comprises at least two attachment sites, each attachment site comprises at least one attachment region, and the attachment region comprises at least one nucleic acid sequence capable of binding by a complementary nucleic acid molecule, wherein the at least two attachment positions correspond to a nucleotide sequence of the target binding domain, and wherein at least one of the at least two attachment positions has a different nucleic acid sequence, and The nucleic acid sequence of each of the at least two attachment positions determines the position and identity of the corresponding nucleotide in the target nucleic acid bound by the target binding domain.

2. The probe of claim 1, wherein the barcode domain comprises: i) at least 3 attachment locations; or ii) At least 4 attachment locations.

3. The sequencing probe of claim 1, wherein the number of nucleotides in the target binding domain is at least two greater than the number of attachment regions in the barcode domain.

4. The sequencing probe of claim 1, wherein each position in the barcode domain has: (a) the same number of attachment regions; (b) one attachment region; or (c) more than one attachment region.

5. The sequencing probe of any one of claims 1 to 4, further comprising a complementary nucleic acid molecule that hybridizes to the first attachment region of the first attachment position of the barcode domain.

6. The sequencing probe of claim 5, wherein the complementary nucleic acid molecule comprises a detectable label.

7. The sequencing probe of claim 5, wherein the complementary nucleic acid molecule is a complementary nucleic acid molecule of a reporter complex comprising a detectable label.

8. The sequencing probe of claim 7, wherein the complementary nucleic acid molecule is directly or indirectly linked to the primary nucleic acid molecule.

9. The sequencing probe of claim 5, wherein the complementary nucleic acid comprises 8 to 20 nucleotides.

10. The sequencing probe of claim 9, wherein the complementary nucleic acid comprises 12 nucleotides.

11. The sequencing probe of claim 8, wherein the primary nucleic acid molecule hybridizes to at least one, two, three, four or five secondary nucleic acid molecules.

12. The sequencing probe of claim 11, wherein the one or more secondary nucleic acid molecules comprise at least one detectable label.

13. The sequencing probe of claim 11, wherein each secondary nucleic acid molecule hybridizes to at least one, two, three, four, five, six or seven tertiary nucleic acid molecules comprising at least one detectable label.

14. A sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least 12 nucleotides and is capable of binding to a target nucleic acid; wherein the barcode domain comprises a synthetic backbone, wherein the synthetic backbone comprises single-stranded DNA, the barcode domain comprises at least 4 attachment sites, each attachment site comprises at least one attachment region, and the attachment region comprises at least one nucleic acid sequence capable of binding by a complementary nucleic acid molecule, wherein the at least four attachment positions correspond to the nucleotide sequence of the target binding domain, and wherein the at least two attachment positions each have a different nucleic acid sequence, and The nucleic acid sequence of each of the at least four attachment positions determines the position and identity of the corresponding nucleotide in the target nucleic acid bound by the target binding domain.

15. A sequencing probe population comprising a plurality of sequencing probes according to any one of claims 1 to 4.

16. A method comprising the steps of: (1) hybridizing a population of at least one sequencing probe comprising a plurality of sequencing probes according to any one of claims 1 to 4 with a target nucleic acid immobilized to a substrate; (2) allowing a first complementary nucleic acid molecule comprising a detectable marker or a first complementary nucleic acid molecule of a first reporter complex comprising a detectable marker to bind to a first attachment site of the at least two attachment sites; (3) detecting a detectable label of the bound first complementary nucleic acid molecule or a detectable label of the bound first reporter complex; (4) preventing the detectable label of the first complementary nucleic acid molecule or the first reporter complex from binding to the first attachment site; (5) binding a second complementary nucleic acid molecule comprising a detectable label or a second complementary nucleic acid molecule of a second reporter complex comprising a detectable label to a second attachment site of the at least two attachment sites; (6) detecting the detectable label of the bound second complementary nucleic acid molecule or the bound second reporter complex; (7) Repeat steps (4) to (6) until each of the at least two attachment positions has been bound by a complementary nucleic acid molecule comprising a detectable marker or a complementary nucleic acid molecule of a reporter complex comprising a detectable marker, and the detectable marker of the bound complementary nucleic acid molecule or the detectable marker of the bound reporter complex has been detected, thereby identifying the target nucleic acid hybridized by the target binding domain of the sequencing probe.

17. The method of claim 16, wherein steps (4) and (5) occur sequentially or simultaneously.

18. The method of claim 16, wherein the first complementary nucleic acid molecule of the first reporter complex comprising a detectable label is directly or indirectly linked to the primary nucleic acid molecule.

19. The method of claim 18, wherein the primary nucleic acid molecule hybridizes to at least one, two, three, four or five secondary nucleic acid molecules.

20. The method of claim 19, wherein each secondary nucleic acid molecule comprises at least one detectable label.

21. The method of claim 19, wherein each secondary nucleic acid molecule hybridizes to at least one, two, three, four, five, six or seven tertiary nucleic acid molecules comprising at least one detectable label.

22. A kit comprising a plurality of sequencing probes according to any one of claims 1 to 4, and At least two complementary nucleic acid molecules comprising a detectable label, wherein the complementary nucleic acid comprising a detectable label comprises a nucleic acid sequence that hybridizes to one of the at least two attachment sites of the sequencing probe, and a detectable label.

Images