A mutant polynucleotide and its application

Abstract

The present invention provides a mutant polynucleotide and its application, specifically, the present invention provides an isolated 5'-UTR nucleotide mutant, wherein the 5'-UTR nucleotide mutant has one or more nucleotide differences compared with the 5'-UTR nucleotide of the parent, and the difference includes mutations at positions 35 and / or 42 corresponding to SEQ ID NO.: 1. The present invention firstly finds that mutating the nucleotides of the 5'-untranslated region (5'-UTR) of the HPPD genome in plant cells can enhance the plant's resistance to herbicides.

Description

Technical Field

[0001] The present invention relates to the field of botany, and more particularly to a mutant polynucleotide and application thereof. Background Art

[0002] Gene expression plays an important role in determining the phenotypic diversity of organisms. Artificial manipulation of gene expression is the key to optimizing the economic traits of industrial organisms, livestock and crops, among which controlling gene transcription and translation is one of the commonly used methods. The translation of eukaryotic proteins transmits the genetic information of genes. The untranslated region (UTR) of mRNA plays a delicate regulatory role in the post-transcriptional translation process. The 5'UTR is the starting structure of mRNA and plays an important regulatory role in the post-transcriptional translation process; while the 3'UTR is located at the end of mRNA, regulating mRNA stability and subcellular localization, and can interact with regulatory proteins to exert its regulatory function.

[0003] The 5'UTR in biological genes contains multiple structural sequences, including 5' cap, hairpin structure, uORF, G4 domain and internal ribosome entry site (IRFS), etc. These sequences regulate the transcription level, in vivo stability (half-life) and translation rate of mRNA by binding to different transcription protein factors or translation regulatory factors and forming a secondary structure of nucleic acid folding.

[0004] Breeding herbicide-resistant crops has always been one of the main means to solve weed resistance and expand the scope of application of herbicides. There are many forms of crop resistance to herbicides, such as changing the structure of the herbicide target protein. Changing a single amino acid in the protein will not change the function of the protein, and at the same time it can greatly reduce the binding force between the protein and the herbicide compound, so that the plant can enhance herbicide tolerance while its photosynthetic process or metabolic process can proceed normally; in addition, increasing the accumulation of proteins targeted by herbicide compounds in plant tissues is also one of the mechanisms to improve resistance. Although the protein has a certain binding with the herbicide compound, a large amount of protein can still perform normal biological functions, thereby showing herbicide resistance. The methods for breeding herbicide resistance in the prior art include transgenic technology, gene mutagenesis, gene editing technology, etc. Currently, gene editing technology has become one of the research hotspots due to its unique advantages of site-directed mutagenesis without introducing exogenous genes. It mainly obtains mutant polypeptides with herbicide resistance without affecting its normal function through site-directed mutagenesis of herbicide target encoding genes. However, high-resistance mutation sites are often difficult to obtain in a short period of time, or may require the combined use of multiple mutation sites, and the screening efficiency is subject to certain limitations.

[0005] Therefore, those skilled in the art urgently need to utilize the transcription and translation regulatory mechanisms of genes to develop new methods for breeding herbicide-resistant crops. Summary of the invention

[0006] The purpose of the present invention is to develop a new method for cultivating herbicide-resistant crops by utilizing the transcription and translation regulatory mechanism of genes.

[0007] Another object of the present invention is to provide a polynucleotide sequence capable of conferring or enhancing plant resistance to HPPD-inhibiting herbicides and its use in breeding resistant plants. Furthermore, the present invention is to enhance plant resistance to HPPD-inhibiting herbicides by mutating the 5' untranslated region (5'-UTR) of the HPPD genome to regulate the expression of the endogenous HPPD gene of the plant.

[0008] In a first aspect of the present invention, an isolated 5'-UTR nucleotide mutant is provided, wherein the 5'-UTR nucleotide mutant has one or more nucleotide differences compared to the 5'-UTR nucleotide of the parent, wherein the difference comprises a mutation at position 35 and / or position 42 corresponding to SEQ ID NO.: 1:

[0009] G in position 35; and / or

[0010] C at No. 42.

[0011] In another preferred embodiment, the mutation includes deletion, substitution, and / or insertion.

[0012] In another preferred embodiment, the G at position 35 is mutated to A or T.

[0013] In another preferred embodiment, the C at position 42 is mutated to T or G.

[0014] In another preferred embodiment, the mutation is selected from the group consisting of G35A, G35T, C42T, C42G, or a combination thereof.

[0015] In another preferred embodiment, the mutation is selected from the following group: G35A, C42T, or a combination thereof.

[0016] In another preferred embodiment, the nucleotide sequence of the mutant is shown in SEQ ID NO.:2 or SEQ ID NO.:3 or SEQ ID NO.:4.

[0017] In another preferred embodiment, the mutant is a nucleotide having a nucleotide sequence shown in SEQ ID NO.: 2 or SEQ ID NO.: 3 or SEQ ID NO.: 4, a fragment thereof, or a conservative variant nucleotide thereof.

[0018] In another preferred embodiment, except for the mutation (such as position 35 and / or 42), the remaining nucleotide sequence of the mutant is identical or substantially identical to the sequence shown in SEQ ID NO.: 1.

[0019] In another preferred embodiment, the substantially identical sequences are different in at most 50 (preferably 1-40, more preferably 1-30, more preferably 1-15, more preferably 1-5) nucleotides, wherein the differences include substitution, deletion or addition of nucleotides.

[0020] In another preferred embodiment, the mutant has a homology with the sequence shown in SEQ ID NO.: 1 of at least 80%, preferably at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99%.

[0021] In another preferred embodiment, the mutation is obtained by one or more of the following methods: natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (such as nitrite, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacteria-mediated mutagenesis), gene editing or biosynthesis.

[0022] In another preferred embodiment, the parent 5'-UTR is a nucleotide sequence related to the expression regulation of hydroxyphenylpyruvate dioxygenase (HPPD) in the cell genome.

[0023] In another preferred embodiment, the parent 5'-UTR is located upstream of the start codon of the nucleotide sequence encoding hydroxyphenylpyruvate dioxygenase in the cell genome.

[0024] In another preferred embodiment, the cells include eukaryotic cells and prokaryotic cells.

[0025] In another preferred embodiment, the cells are derived from plants, animals or microorganisms.

[0026] In another preferred example, the plants include monocotyledonous plants and dicotyledonous plants.

[0027] In another preferred embodiment, the plant is selected from the following group: Gramineae, Leguminosae, Cruciferae, or a combination thereof.

[0028] In another preferred embodiment, the plant is selected from the group consisting of rice, corn, tobacco, sorghum, wheat, barley, corn, soybean, Arabidopsis, potato, tomato, lettuce, rapeseed, cabbage, quinoa, or a combination thereof.

[0029] In another preferred embodiment, the parent 5'-UTR is derived from a monocotyledonous plant or a dicotyledonous plant.

[0030] In another preferred embodiment, the parent 5'-UTR is derived from one or more plants selected from the following group: Gramineae, Leguminosae, and Cruciferae.

[0031] In another preferred embodiment, the parent 5'-UTR is derived from one or more plants selected from the group consisting of rice, corn, tobacco, sorghum, wheat, barley, corn, soybean, Arabidopsis, potato, tomato, lettuce, rapeseed, cabbage, and quinoa.

[0032] In another preferred embodiment, the mutant is derived from a monocotyledonous plant or a dicotyledonous plant.

[0033] In another preferred embodiment, the mutant is derived from one or more plants selected from the following group: Gramineae, Leguminosae, and Cruciferae.

[0034] In another preferred embodiment, the mutant is derived from one or more plants selected from the following group: rice, corn, tobacco, sorghum, wheat, barley, corn, soybean, Arabidopsis, potato, tomato, lettuce, rapeseed, cabbage, and quinoa.

[0035] In another preferred example, the nucleotide sequence of the parent 5'-UTR has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence shown in SEQ ID No.1.

[0036] In another preferred embodiment, the parent 5'-UTR is derived from rice (Oryza sativa).

[0037] In another preferred embodiment, the mutant is derived from rice (Oryza sativa).

[0038] In another preferred embodiment, the mutant is selected from the following group:

[0039] (a) a polynucleotide whose sequence is shown in SEQ ID NO.: 2, SEQ ID NO.: 3 or SEQ ID NO.: 4;

[0040] (b) a polynucleotide having a nucleotide sequence homology ≥ 80% (preferably ≥ 90%, more preferably ≥ 95%, and most preferably ≥ 98%) to the sequence shown in SEQ ID NO.: 2, SEQ ID NO.: 3, or SEQ ID NO.: 4;

[0041] (c) A polynucleotide complementary to the polynucleotide described in any one of (a) to (b).

[0042] In another preferred embodiment, the mutant is formed by mutation of the 5'-UTR nucleotide shown in SEQ ID NO.1.

[0043] In another preferred embodiment, the mutant is DNA.

[0044] The second aspect of the present invention provides a nucleic acid construct, wherein the nucleic acid construct comprises the 5'-UTR nucleotide mutant described in the first aspect of the present invention.

[0045] In another preferred embodiment, the nucleic acid construct further comprises one or more selected from the following groups: a promoter, a HPPD enzyme encoding gene, an enhancer, a terminator or a tag gene.

[0046] In another preferred embodiment, the promoter is selected from the following group: a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0047] In another preferred embodiment, the promoter is selected from the following group: UBI, UBQ, 35S, Actin, SPL, CmYLCV, YAO, CDC45, rbcS, rbcL, PsGNS2, UEP1, TobRB7, Cab, 6, U3, U6a, U6b, U6c, U6-1, U3b, U3d, U6-26, U6-29, H1, or a combination thereof.

[0048] In another preferred embodiment, the HPPD enzyme encoding gene is derived from plants or microorganisms.

[0049] In another preferred embodiment, the HPPD enzyme encoding gene originates from monocotyledonous plants or dicotyledonous plants.

[0050] In another preferred embodiment, the HPPD enzyme encoding gene is derived from rice, corn, tobacco, sorghum, wheat, barley, corn, soybean, Arabidopsis, potato, tomato, lettuce, rapeseed, cabbage, and quinoa.

[0051] In another preferred embodiment, the HPPD enzyme encoding gene includes wild-type and mutant genes.

[0052] The third aspect of the present invention provides a vector, wherein the vector contains the 5'-UTR nucleotide mutant described in the first aspect of the present invention or the nucleic acid construct described in the second aspect of the present invention.

[0053] In another preferred embodiment, the vector includes an expression vector, a shuttle vector, and an integration vector.

[0054] In another preferred embodiment, the vector is a plant expression vector.

[0055] In another preferred embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0056] In another preferred embodiment, the vector is an Agrobacterium Ti vector.

[0057] In another preferred embodiment, the construct is integrated into the T-DNA region of the vector.

[0058] In another preferred embodiment, the vector is circular or linear.

[0059] In another preferred embodiment, the vector is a pCambia vector.

[0060] In another preferred embodiment, a Cas9 expression cassette and a targeting site recognition sequence expression cassette (gRNA expression cassette) are also integrated into the T-DNA region.

[0061] In another preferred embodiment, the vector further comprises a selection marker expression cassette.

[0062] The fourth aspect of the present invention provides a genetically engineered cell, which contains the vector described in the third aspect of the present invention or a genome in which the mutant described in the first aspect of the present invention or the nucleic acid construct described in the second aspect of the present invention is integrated.

[0063] In another preferred embodiment, the cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell, or a prokaryotic cell, such as Escherichia coli.

[0064] In another preferred embodiment, the cell is a plant cell.

[0065] In another preferred embodiment, the cell is resistant or tolerant to HPPD-inhibiting herbicides.

[0066] In another preferred embodiment, the genetically engineered cells are prepared by introducing the 5'-UTR nucleotide mutant or the nucleic acid construct or the vector into the cells using a method selected from the group consisting of Agrobacterium transformation, gene gun, microinjection, electric shock, ultrasound and polyethylene glycol (PEG)-mediated method.

[0067] In another preferred example, the plants include angiosperms and gymnosperms.

[0068] In another preferred embodiment, the gymnosperm is selected from the following groups: Cycadaceae, Podocarpaceae, Araucariaceae, Pinaceae, Taxaceae, Cupressaceae, Cephalotaxaceae, Taxaceae, Ephedraceae, Gnetaceae, Monotypaceae, Welwitschiaceae, or a combination thereof.

[0069] In another preferred example, the plants include monocotyledonous plants and dicotyledonous plants.

[0070] In another preferred embodiment, the plants include herbaceous plants and woody plants.

[0071] In another preferred embodiment, the herb is selected from the group consisting of Solanaceae, Poaceae, Leguminosae, or a combination thereof.

[0072] In another preferred embodiment, the woody plant is selected from the following group: Actinidiaceae, Rosaceae, Moraceae, or a combination thereof.

[0073] In another preferred embodiment, the plant is selected from the following group: cruciferous plants, gramineous plants, leguminous plants, solanaceae, actinidiaceae, malvaceae, peonyaceae, rosaceae, lily family, or a combination thereof.

[0074] In another preferred embodiment, the plant is selected from the group consisting of Arabidopsis, rice, cabbage, soybean, tomato, corn, tobacco, barley, wheat, potato, tomato, rapeseed, lettuce, cabbage, quinoa, sorghum or a combination thereof.

[0075] The fifth aspect of the present invention provides a method for changing the HPPD enzyme encoding gene or the expression level or activity of the HPPD enzyme in a cell, comprising the step of introducing the 5'-UTR nucleotide mutant of the first aspect of the present invention into the cell.

[0076] In another preferred embodiment, in the method, introducing a 5'-UTR nucleotide mutant comprises expressing the 5'-UTR nucleotide mutant in a cell, for example, expressing the mutant via an expression vector, or integrating the mutant into a plant genome for expression, or expressing the mutant after mutating the endogenous 5'-UTR of the cell.

[0077] In another preferred embodiment, the change includes increasing the HPPD enzyme encoding gene or the HPPD enzyme expression level.

[0078] In another preferred embodiment, the expression level of the HPPD enzyme encoding gene or the HPPD enzyme in the cells containing the mutant is increased by at least 1.2 times, preferably 1.5 times, preferably 1.8 times, preferably 2 times, preferably 2.5 times, preferably 3 times, preferably 5 times, preferably 6 times, preferably 8 times, preferably 10 times, preferably 12 times, relative to the expression level of the HPPD enzyme encoding gene or the HPPD enzyme in the wild-type same cells.

[0079] A sixth aspect of the present invention provides a method for improving plants, the method comprising the steps of:

[0080] (a) providing a plant cell, plant tissue or plant part, and introducing the 5'-UTR nucleotide mutant described in the first aspect of the present invention or the nucleic acid construct described in the second aspect of the present invention into the plant cell, plant tissue or plant part;

[0081] (b) regenerating the plant cells, plant tissues, or plant parts in step (a) into plants.

[0082] In another preferred embodiment, the introduction of a 5'-UTR nucleotide mutant or a nucleic acid construct comprises expressing the 5'-UTR nucleotide mutant or the nucleic acid construct in a cell, for example, expressing the mutant via an expression vector, or integrating the mutant into a plant genome for expression, or expressing the mutant after mutating the endogenous 5'-UTR of the cell.

[0083] In another preferred embodiment, in step (a), the method comprises the following steps:

[0084] (1) Providing Agrobacterium carrying an expression vector, wherein the expression vector contains the 5'-UTR nucleotide mutant or nucleic acid construct;

[0085] (2) contacting plant cells, plant tissues, or plant parts with the Agrobacterium of step (1), so that the 5'-UTR nucleotide mutant or nucleic acid construct or an active fragment thereof is transferred into the plant cells and integrated into the chromosomes of the plant cells; and

[0086] (3) selecting plant cells, plant tissues, or plant parts into which the 5'-UTR nucleotide mutant or nucleic acid construct or an active fragment thereof has been transferred.

[0087] In another preferred embodiment, in step (a), the plant cell, plant tissue, or plant part is modified using gene editing technology, so that the 5'-UTR nucleotide in the plant cell, plant tissue, or plant part is mutated at position 35 and / or position 42 corresponding to SEQ ID NO.: 1:

[0088] G in position 35; and / or

[0089] C at No. 42.

[0090] In another preferred embodiment, the gene editing technology is selected from the following group: CRISPR gene editing system, error-prone PCR, gene recombination, TALEN and ZFN.

[0091] In another preferred embodiment, the gene editing technology includes a base editor.

[0092] In another preferred embodiment, the method is used to improve the herbicide tolerance of plants.

[0093] In another preferred embodiment, the herbicide comprises an HPPD-inhibiting herbicide.

[0094] In another preferred embodiment, the method is used to enhance the resistance of plants to HPPD-inhibiting herbicides.

[0095] In another preferred embodiment, the method is used to regulate the expression of endogenous HPPD gene.

[0096] In another preferred embodiment, the HPPD-inhibiting herbicide is selected from the group consisting of triketones, diketonitriles, isoxazoles, pyrazoles, benzophenones, quinazolinediones, or a combination thereof.

[0097] In another preferred embodiment, the triketone herbicide is selected from the following group: bicyclon, mesotrione, mesotrione, cypermethrin, teflonone, fluazifop, or a combination thereof.

[0098] In another preferred embodiment, the isoxazole herbicide is selected from the following group: isoxathiapiprolin, isoxathiapiprolin, isoxathiapiprolin, or a combination thereof.

[0099] In another preferred embodiment, the pyrazole herbicide is selected from the following group: benzylpyrazone, pyraclostrobin, pyrazoline, sulfamethoxazole, benomyl, or a combination thereof.

[0100] In another preferred embodiment, the quinazolinedione herbicide is selected from the following group: quinclorac, methylquinclorac, compounds described in CN104557739A and CN110669016A, or a combination thereof.

[0101] In another preferred embodiment, the HPPD-inhibiting herbicide is a quinazolinedione, and the quinazolinedione herbicide is preferably quinclorac, methylquinclorac, or the compounds described in CN104557739A and CN110669016A.

[0102] In another preferred example, the plants include angiosperms and gymnosperms.

[0103] In another preferred embodiment, the gymnosperm is selected from the following groups: Cycadaceae, Podocarpaceae, Araucariaceae, Pinaceae, Taxaceae, Cupressaceae, Cephalotaxaceae, Taxaceae, Ephedraceae, Gnetaceae, Monotypaceae, Welwitschiaceae, or a combination thereof.

[0104] In another preferred example, the plants include monocotyledonous plants and dicotyledonous plants.

[0105] In another preferred embodiment, the plants include herbaceous plants and woody plants.

[0106] In another preferred embodiment, the herb is selected from the group consisting of Solanaceae, Poaceae, Leguminosae, or a combination thereof.

[0107] In another preferred embodiment, the woody plant is selected from the following group: Actinidiaceae, Rosaceae, Moraceae, or a combination thereof.

[0108] In another preferred embodiment, the plant is selected from the following group: cruciferous plants, gramineous plants, leguminous plants, solanaceae, actinidiaceae, malvaceae, peonyaceae, rosaceae, lily family, or a combination thereof.

[0109] In another preferred embodiment, the plant is selected from the group consisting of Arabidopsis, rice, cabbage, soybean, tomato, corn, tobacco, barley, wheat, potato, tomato, rapeseed, lettuce, cabbage, quinoa, sorghum or a combination thereof.

[0110] In another preferred embodiment, the method further comprises the step of testing the herbicide resistance of the plant cells, plant tissues, plant parts or plants.

[0111] In another preferred embodiment, the tolerance concentration V1 of the plant improved by the method to the herbicide is compared with the tolerance concentration V2 of the wild-type plant of the same species to the same herbicide, and V1 / V2≥2, preferably V1 / V2≥3, preferably V1 / V2≥4, preferably V1 / V2≥5, preferably V1 / V2≥6, preferably V1 / V2≥7, preferably V1 / V2≥8, preferably V1 / V2≥10, preferably V1 / V2≥12, preferably V1 / V2≥14, and more preferably V1 / V2≥16.

[0112] In another preferred embodiment, the plant can tolerate a herbicide at a concentration of ≥0.01 mg / L, preferably ≥0.02 mg / L, preferably ≥0.03 mg / L, preferably ≥0.05 mg / L, preferably ≥0.08 mg / L, preferably ≥0.1 mg / L, preferably ≥0.2 mg / L, preferably ≥0.5 mg / L, preferably ≥0.8 mg / L, preferably ≥1 mg / L, preferably ≥2 mg / L, preferably ≥5 mg / L, preferably ≥10 mg / L under culture medium conditions.

[0113] In another preferred embodiment, the plant can tolerate a herbicide concentration of ≥50 mg / L, preferably ≥100 mg / L, preferably ≥200 mg / L, preferably ≥300 mg / L, preferably ≥400 mg / L, preferably ≥450 mg / L, preferably ≥500 mg / L, preferably ≥550 mg / L, preferably ≥600 mg / L, preferably ≥700 mg / L, preferably ≥800 mg / L under field conditions.

[0114] In another preferred embodiment, the herbicide includes a quinazolinedione herbicide.

[0115] In another preferred embodiment, the herbicide includes quinclorac, methylquinclorac, and the compounds described in CN104557739A and CN110669016A.

[0116] The seventh aspect of the present invention provides a reagent comprising the mutant described in the first aspect of the present invention, the nucleic acid construct described in the second aspect of the present invention, the vector described in the third aspect of the present invention, or the genetically engineered cell described in the fourth aspect of the present invention.

[0117] In another preferred embodiment, the agent is used to improve the herbicide resistance or tolerance of plant cells, plant tissues or plants.

[0118] The eighth aspect of the present invention provides a kit comprising the reagent described in the seventh aspect of the present invention.

[0119] In another preferred embodiment, the kit further comprises a label or instructions.

[0120] The ninth aspect of the present invention provides the use of the mutant described in the first aspect of the present invention, the nucleic acid construct described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the genetically engineered cell described in the fourth aspect of the present invention, the reagent described in the seventh aspect of the present invention, or the kit described in the eighth aspect of the present invention, for cultivating plant herbicide-resistant strains, or for preparing reagents or kits for cultivating plant herbicide-resistant strains.

[0121] The tenth aspect of the present invention provides a method for identifying or selecting transformed plant cells, plant tissues, plants or parts thereof, comprising: (i) providing transformed plant cells, plant tissues, plants or parts thereof, wherein the transformed plant cells, plant tissues, plants or parts thereof comprise the mutant according to the first aspect of the present invention or the nucleic acid construct according to the second aspect of the present invention or the vector according to the third aspect of the present invention or the plant cells, plant tissues, plants or parts thereof obtained by the method according to the sixth aspect of the present invention;

[0122] (ii) contacting the transformed plant cell, plant tissue, plant or part thereof with a herbicide;

[0123] (iii) determining whether plant cells, plant tissues, plants or parts thereof are affected by the herbicide; and

[0124] (iv) identifying or selecting transformed plant cells, plant tissues, plants or parts thereof.

[0125] In another preferred embodiment, the plant cell, plant tissue, plant or part thereof may contain another isolated polynucleotide.

[0126] The eleventh aspect of the present invention provides a method for identifying a herbicide-tolerant plant, comprising:

[0127] (i) Identifying whether the plant sample has the mutant described in the first aspect of the present invention, the nucleic acid construct described in the second aspect of the present invention, or the vector described in the third aspect of the present invention.

[0128] In another preferred embodiment, in step (i), sequencing is performed to determine whether the plant sample contains the mutant described in the first aspect of the present invention, the nucleic acid construct described in the second aspect of the present invention, or the vector described in the third aspect of the present invention.

[0129] A twelfth aspect of the present invention provides a method for controlling unwanted plants at a plant cultivation site, the method comprising:

[0130] (1) planting a plant comprising the mutant described in the first aspect of the present invention, the nucleic acid construct described in the second aspect of the present invention, or the vector described in the third aspect of the present invention, or a plant obtained by the method described in the sixth aspect of the present invention at the cultivation site;

[0131] (2) applying an effective amount of a herbicide to the plants at the cultivation site.

[0132] A thirteenth aspect of the present invention provides a method for producing a herbicide-resistant plant, comprising:

[0133] The first plant is hybridized with the second plant, wherein the first plant is a herbicide-resistant plant containing the mutant described in the first aspect of the present invention or the nucleic acid construct described in the second aspect of the present invention or the vector described in the third aspect of the present invention or obtained by the method described in the sixth aspect of the present invention.

[0134] In another preferred embodiment, the second plant is a plant that is not resistant to herbicides or has weak herbicide resistance.

[0135] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0136] Figure 1 .Structure diagram of Crispr-ABE and Crispr-CBE editing tools.

[0137] Figure 2.Growth of transgenic callus in differentiation medium containing 0.03 mg / L quinclorac.

[0138] Figure 3 .Growth of differentiated seedlings in rooting medium containing 0.03 mg / L quinclorac.

[0139] Figure 4 .Edit the genetic sequencing map of the seedlings.

[0140] Figure 5 . Differences in expression between wild-type and edited plants after 15 days in soil. DETAILED DESCRIPTION

[0141] After extensive and in-depth research, the inventors unexpectedly discovered for the first time that mutating the nucleotides in the 5' untranslated region (5'-UTR) of the HPPD genome in plant cells can regulate the expression of the endogenous HPPD gene in plants, thereby enhancing the resistance of plants to herbicides (such as HPPD-inhibiting herbicides). On this basis, the inventors completed the present invention.

[0142] the term

[0143] As used herein, the term "AxxB" means that the nucleotide A at position xx is changed to nucleotide B, for example, "G35A" means that the nucleotide G at position 35 is mutated to A, and so on. For double or multiple mutations, each mutation is separated by " / ", for example, G35A / C42T means that relative to the nucleotide sequence of SEQ ID NO.1, the guanine at position 35 is replaced by adenine, and the cytosine at position 42 is replaced by thymine, and both mutations are present in the specific mutant nucleotide.

[0144] As used herein, the term "HPPD" refers to 4-Hydroxyphenylpyruvate Dioxygenase (HPPD, EC 1.13.11.27), which exists in various organisms and is a key enzyme that catalyzes the oxygenation of 4-hydroxyphenylpyruvate (HPP), a degradation product of tyrosine, to generate homogentisate (HGA). Inhibition of HPPD can lead to photosynthesis decoupling and lack of auxiliary light-harvesting pigments in plant cells. At the same time, due to the lack of light protection usually provided by carotenoids, reactive oxygen intermediates and photooxidation lead to chlorophyll destruction, resulting in albinism symptoms in plant photosynthetic tissues, growth inhibition, and even death. HPPD-inhibiting herbicides have been proven to be very effective selective herbicides with broad-spectrum herbicidal activity. They can be used both before and after germination, and have the characteristics of high activity, low residue, safety to mammals, and environmental friendliness.

[0145] As used herein, the terms "HPPD inhibitor", "HPPD-inhibiting herbicide" and "HPPD-inhibiting herbicide" are used interchangeably and refer to substances that have herbicidal activity themselves or are used in combination with other herbicides and / or additives that can change their effects. By inhibiting HPPD, it is manifested as a preparation that inhibits plant growth or even kills plants. Substances that can inhibit HPPD and have herbicidal effects are well known in the art and include many types, 1) triketides, for example, sulcotrione (CAS No.: 99105-77-8); mesotrione (CAS No.: 104206-82-8); bicyclopyralidone (CAS No.: 104206-82-8); yrone, CAS No.: 352010-68-5); tembotrione (CAS No.: 335104-84-2); tefuryltrione (CAS No.: 473278-76-1); benzobicyclon (CAS No.: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione (CAS No.: 143701-75-1); 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4-dichlorophenyl)propane-1,3-dione (CAS No.: 1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione (CAS No.: 143659-52-3); 3) isoxazoles, for example, isoxaflutole (CAS No.: 141112-29-0); isoxachlortole (CAS No.: 141112-06-3); clomazone (CAS No.: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS No.: 210631-6 8-8); pyrasulfotole (CAS No.: 365400-11-9); pyrazoxyfen (CAS No.: 71561-11-0); pyrazolate (CAS No.: 58011-68-0); benzofenap (CAS No.: 82692-44-2); bispyribac (CAS No.: 1622908-18-2); Tolpyralate (CAS No.: 1101132-67-5); fenpyrasulfotole (CAS No.: 1992017-55-6); cypermethrin (CAS No.: 1855929-45-1);Triazosulfuron (CAS No.: 1911613-97-2); 5) benzophenones; 6) Others: lancotrione (CAS No.: 1486617-21-3); fenquinotrione (CAS No.: 1342891-70-6). Preferably, the herbicide is isoxazole or triketone; preferably, the herbicide is isoxazosulfuron or mesotrione. The herbicide can be used in combination with the type of crop or weed to be used, and is used to control unwanted plants (such as weeds) before, after, before and during seedling emergence. Preferably, it is a quinazolinedione herbicide, such as quinazoline, methylquinazoline, and the compounds described in CN104557739A and CN110669016A. ;

[0146] The term "effective amount" or "effective concentration" means such an amount or concentration, respectively, which is enough to kill non-target plants, plant tissues, plant cells or host cells or inhibit their growth, but the amount does not kill the herbicide-resistant plants, plant tissues, plant cells and host cells of the present invention or does not seriously inhibit their growth (target plants). The non-target plants can be similar parent (or wild-type) plants, plant tissues, plant cells or host cells, and can also be weeds, or wild-type plants (such as soybeans grown in corn fields) grown at the cultivation site that are not related to the target plants. Generally, the effective amount of a herbicide is the amount routinely used to kill the target weeds in agricultural production systems. This amount is known to those of ordinary skill in the art. The herbicides of the present invention are applied directly to plants or to the site of plants at any growth stage or before planting or emergence, and they show herbicidal activity. The observed effect depends on the plant species to be controlled, the growth stage of the plants, the application parameters of the dilution and the spray droplet size, the particle size of the solid components, the environmental conditions at the time of use, the specific compound used, the specific adjuvants and carriers used, the soil type, etc., and the amount of chemical applied. As is known in the art, these and other factors can be adjusted to promote non-selective or selective herbicidal action.

[0147] As used herein, the terms "herbicide resistance", "herbicide tolerance" and "herbicide tolerance activity" are used interchangeably and refer to tolerance to HPPD-inhibiting herbicides, especially quinazolinedione herbicides, such as quinclorac, methylquinclorac, and the compounds described in CN104557739A and CN110669016A. The tolerance to herbicide resistance of the present invention can be characterized by characteristics such as the concentration or amount of the herbicide used.

[0148] The term "parent nucleotide" refers to a nucleic acid molecule that can be found in nature, including wild-type nucleic acid molecules that have not been artificially modified, and also nucleic acid molecules that have been artificially modified but do not contain the mutation site of the present invention. Its nucleotides can be obtained by genetic engineering technology, such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino acid sequence can be deduced from the nucleotide sequence. The "parent plant" is a plant containing parent nucleotides or polypeptides. The "parent nucleotide" can be extracted from the parent plant according to techniques well known to those skilled in the art, or it can be obtained by chemical synthesis. The sequence of the parent 5'-UTR nucleotide is shown in, for example, SEQ ID No. 1.

[0149] As used herein, "isolated" means that a substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state in living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances that exist with them in their natural state.

[0150] The term "homology" or "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a certain position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (for example, a certain position in each of the two DNA molecules is occupied by adenine, or a certain position in each of the two polypeptides is occupied by lysine), then each molecule is identical at that position. For example, the identity of two nucleotide sequences can be confirmed by the following method: BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215: 403-10) obtained from the National Center for Biotechnology Information (NCBI) of the United States, determined using default parameters.

[0151] In the present invention, "plant" is understood to be any differentiated multicellular organism capable of photosynthesis, including crop plants at any maturity or development stage, in particular monocotyledonous or dicotyledonous plants, for example: (1) food crops: Oryza spp., such as rice (Oryza sativa), broadleaf rice (Oryza latifolia), rice (Oryza sativa), light leam rice (Oryza glaberrima); Triticum spp., such as common wheat (Triticum aestivum), durum wheat (T. Turgidum ssp. durum); Hordeum spp., such as barley (Hordeum vulgare), Arizona barley (Hordeum arizonicum); rye (Secale cereale); Avena spp., such as oats (Avena sativa), wild oats (Avena fatua, Avena byzantina, Avena fatuava r. sa tiva, Avena hybrida; Echinochloa spp., for example, Pennisetum glaucum, Sorghum (Sorghum bicolor, Sorghum vulgare), triticale, maize or corn, foxtail millet, rice, foxtail millet, broomcorn millet, Fagopyrum spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) pulse crops: Glycine spp., such as Glycine max, Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., field bean, Lupinus spp., Vicia spp., Tamarindus indica, Lens culinaris, Lathyrus spp.), Lablab, broad bean, mung bean, red bean, chickpea; (3) Oil crops: peanut (Arachis hypogaea), Arachis spp., Sesamum spp., Helianthus spp. (e.g., Helianthus annuus), Elaeis (e.g., Eiaeis guineensis, Elaeis oleifera), soybean, Brassica napus, Brassica juncea, oilseed rape, Camellia oleifera, oil palm, olive, castor, Brassica napus L., canola; (4) Fiber crops: sisal (Agave sisalana), cotton (cotton, Gossypium barbadense, Gossypium hirsutum), hirsutum), kenaf, sisal, abaca, flax (Linum usitatissimum), jute, ramie, hemp (Cannabis sativa), and hemp; (5) Fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatum, Citrus spp., Fig (Ficus carica), Fortunella spp., Strawberry spp., and Hawthorn spp. pp.), Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Coconut spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (banana), Avocado spp.) (avocado (Persea americana), guava (Psidium guajava), Mammea apple (Mammeaamericana), mango (Mangifera indica), olive (Olea europaea), papaya (Caricapapaya), coconut (Cocos nucifera), Malpighia emarginata, sapodilla (Manilkara zapota), pineapple (Ananas comosus), sugar apple (Annona spp.), citrus (Citrus spp.), jackfruit (Artocarpus spp.), lychee (Litchi chinensis), ribes (Ribes spp.), Rubus spp., pear, peach, apricot, plum, bayberry, lemon, kumquat, durian, orange, strawberry (strawberry rry, blueberry, cantaloupe, melon, date palm, walnut tree, cherry tree; (6) root crops: cassava (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), mustard tuber, onion, water chestnut, sedge, yam; (7) vegetable crops: spinach (Spinacia spp.), bean (Phaseolus spp.), lettuce (Lactuca sativa), bitter melon (Momordica spp.), parsley (Petroselinum crispum), pepper (Capsicum spp.), Solanum spp. (such as potato (Solanum tuberosum), red eggplant (Solanum integrifolium) or tomato (Solanum lycopersicum)), Lycopersicon spp. (such as tomato (Lycopersicon esculentum), tomato (Lycopersicon lycopersicum), Lycopersicon pyriforme), Macrotyloma spp.), kale, Luffa acutangula, lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, squash, benincasa hispida, asparagus officinalis, celery, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum), Ethiopian mustard (B. carinata), radish (Rapbanus sativus), Brassica species (e.g., Brassica napus, Brassica rapasp., canola, oilseed rape, turnip rape, mustard, cabbage, black mustard, rapeseed rape), Brussels sprouts, Solanaceae (eggplant), bell pepper, cucumber, sponge gourd, cabbage, rapeseed, kale, gourd, leek, lotus, lotus root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp.), orchid, crinum, Clivia, amaryllis, rose, Chinese rose, jasmine, tulip, cherry blossom, morning glory, marigold, lotus, daisy, carnation, petunia, tulip, lily, plum blossom, narcissus, forsythia, primrose, daphne, camellia, magnolia, purple magnolia, magnolia, Clivia, begonia, peony, peony, lilac, azalea, rhododendron, Michelia, Bauhinia, Deutzia, Weigela, Forsythia, Yunnan Huangxin, broom, cyclamen, Phalaenopsis, dendrobium, hyacinth, iris, calla lily, calendula, lily, begonia, bell begonia, bamboo begonia, geranium; (9) medicinal crops: safflower (Carthamus tinctorius), mint (Mentha spp.), Rheum rhabarbarum, Crocus sativus, Lycium barbarum, Polygonatum odoratum, Polygonatum sibiricum, Anemarrhena asphodeloides, Ophiopogon japonicus, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum, Polygonum multiflorum, Rhubarb, Licorice, Astragalus, Ginseng, Panax notoginseng, Acanthopanax elegans, Angelica sinensis, Ligusticum chuanxiong, Bupleurum chinense, Datura stramonium, Mentha suspensa, Motherwort, Patchouli, Scutellaria baicalensis, Prunella vulgaris, Pyrethrum cinnamomum, Ginkgo biloba, Cinchona, Natural rubber tree, Alfalfa, Pepper; (10) Raw material crops: Rubber, Ricinus communis, Tung oil tree, Mulberry, Hop, Birch, Alder, Rhus; (11) Forage crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea), switchgrass (Panicum virgatum), prairiegrasses, Indiangrass, big bluestem grass, timothy grass (Phleum pratense), turf grass, sedge (alpine kobresia, Carex pediformis, low sedge), alfalfa, timothy grass, alfalfa, sweet vetch, tamarind, sesbania, azolla, water hyacinth, amorpha fruticosa, lupine, clover, astragalus, water lettuce, water peanut, ryegrass; (1 2) sugar crops: sugarcane (Saccharum spp.), sugar beet (Beta vulgaris); (13) beverage crops: large-leaf tea (Camellia sinensis), tea (Camellia Sinensis), tea, coffee (Coffea spp.), cocoa (Theobroma cacao), Humulus lupulus (hops); (14) Lawn plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass)), Agrostis spp. (Agrostis palustris), Lolium spp. (ryegrass), Festuca spp. (fescue), Zoysia spp. (Zoysia japonica), Cynodon spp. (Bermuda grass, Cynodon dactylon), Stenotaphrum secunda tum (St. Augustine grass), Paspalum spp.) (Baja grass), Eremochloa ophiuroides (centipede grass), Axonopus spp. (carpet grass), Bouteloua dactyloides (buffalo grass), Bouteloua var. spp. (Grammar grass), Digitaria sanguinalis, Cyperus rotundus, Kyllinga brevifolia, Cyperus amurica, Eregelon canadensis, Hydrocotyles ibthorpioides, Kummerowia striata, Euphorbia humifusa, Viola arvensis, Carex leucoderma, Carex heterota, turf grass; (15) Tree crops: Pinus spp.), Salix sp., Acer spp., Hibiscus spp., Eucalyptus sp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceibapentandra, Cinnamomum spp., Corchorus sp., Phragmites australis, Physalis spp., Desmodium spp.), poplar, ivy, poplar, coral tree, ginkgo, oak, ailanthus altissima, Schima superba, holly, sycamore, privet, yellow poplar, larch, black wattle, masson pine, Simiao pine, Yunnan pine, South Asian pine, Chinese pine, red pine, black walnut, lemon, sycamore, Syzygium wilfordii, Davidia involucrata, kapok, Java kapok, Bauhinia, Bauhinia, rain tree, Albizzia, Aralia, Erythrina, Magnolia grandiflora, Cycas, Lagerstroemia, conifers, trees, shrubs; (16) nut crops: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp.), pistachio (Pistaciavera), cashew (Anacardium, occidentale), macadamia (Macadamia integrifolia), pecan, macadamia nut, pistachio, almond and nut-producing plants; (17) Others: Arabidopsis thaliana, Brachiaria, Tribulus terrestris, Setaria officinalis, Goosegrass, Cadaba farinosa, algae (algae), Carex elata, ornamentals, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicagosativa, Melilotus spp.), Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sina pis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, etc.

[0152] The term "unwanted plants" is understood to mean plants that affect the normal growth of desired plants (such as crops) and have no practical or application value, and may include weeds, such as dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, weeds of the following genera: Sinapis, Lepidium, Galium, Stellaria, Matricaria, Anthemis, Galinsoga, Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Xanthium, Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, and , Cirsium, Carduus, Sonchus, Solanum, Rorippa, Rotala, Lindernia, Lamium, Veronica, Abutilon, Emex, Datura, Viola, Galeopsis, Papaver, Centaurea, Trifolium, Ranunculus, and Taraxacum.Monocotyledonous weeds include, but are not limited to, weeds from the genera Echinochloa, Setaria, Panicum, Digitaria, Phleum, Poa, Festuca, Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus, Sorghum, Agropyron, and Cyperus. The undesirable plants may include Cynodon, Cynodon, Monochoria, Fimbristyslis, Sagittaria, Eleocharis, Scirpus, Paspalum, Ischaemum, Sphenoclea, Dactyloctenium, Agrostis, Alopecurus and Apera. The undesirable plants may also include other plants different from the desired cultivated plants, such as parts of crops naturally grown in rice cultivation areas or a small amount of soybeans.

[0153] In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue culture, plant callus, plant pieces, and plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, spikes, roots, root tips, anthers, etc.

[0154] In the present invention, the term "gene editing" technology mainly includes CRISPR technology, TALEN technology, and ZFN technology. The gene editing tools referred to in CRISPR technology include guideRNA, Cas proteins (such as Cas9, Cpf1, Cas12b, etc.), and Cas proteins can recognize and cut target DNA under the guidance of guideRNA. The gene editing tools referred to in TALEN technology are restriction enzymes that can cut specific DNA sequences, which include a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tools referred to in ZFN technology are also restriction enzymes that can cut specific DNA sequences, which include a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that the nucleotides encoding the gene editing tools and other regulatory elements are constructed in a suitable vector, and then the cells are transformed to achieve the editing of the genome in the cell. The types of editing include gene knockout, insertion, and base editing.

[0155] UTR

[0156] UTR, the full name of untranslated region, usually refers to the region of mature mRNA located upstream of the coding region (CDS) that is not translated into protein. The UTR referred to in the present invention describes its structure and function based on the sequence in the DNA molecule. The untranslated region includes the 5' untranslated region and the 3' untranslated region. Studies have shown that the untranslated region is related to gene expression regulation. The 5' untranslated region starts from the transcription start site and ends at the nucleotide before the start codon. It can contain elements that control gene expression through regulatory elements. The diversity of the 5' untranslated region will lead to changes in its gene expression.

[0157] The 5'-UTR of the present invention can be a non-translated region in the genome including introns, or a coding sequence of a mature mRNA non-translated region (e.g., without introns). The 5'-UTR of the present invention is preferably a nucleotide sequence located 1-250 bp, preferably 1-200 bp, preferably 1-100 bp upstream of the start codon of the HPPD enzyme encoding gene.

[0158] The present invention provides an isolated 5'-UTR nucleotide mutant, wherein the 5'-UTR nucleotide mutant has one or more nucleotide sequence differences compared with the parent 5'-UTR nucleotide, wherein the difference comprises a mutation at position 35 and / or position 42 corresponding to SEQ ID NO.: 1:

[0159] G in position 35; and / or

[0160] C at No. 42;

[0161] Furthermore, mutation of the parental 5'-UTR nucleotide may regulate the expression of the endogenous HPPD gene of the plant, thereby enhancing the plant's resistance to herbicides (such as HPPD-inhibiting herbicides).

[0162] The 35th and 42nd positions of the 5'-UTR nucleotides shown in SEQ ID NO.: 1 of the present invention are respectively located at -33 and -26 upstream of the start codon of the rice HPPD enzyme encoding gene. Those skilled in the art will understand that using different methods to describe the nucleotide positions will not cause misunderstanding of the present invention.

[0163] Among them, SEQ ID NO.1:

[0164] CGCCGCCACTGTCATCCACTCCCCACACCCCACGACGCCACGCCACGCCGCGCCGCGCCGCGCC.

[0165] It should be understood that the numbering in the mutants of the present invention is based on SEQ ID NO.: 1. When a specific mutant has a homology of 80% or more with the sequence shown in SEQ ID NO.: 1, the nucleotide numbering of the mutant may be misplaced relative to the nucleotide numbering of SEQ ID NO.: 1. Using conventional sequence alignment techniques in the art, those skilled in the art can generally understand that such misplacement is within a reasonable range, and mutants with a homology of 80% (such as 90%, 95%, 98%) and the same or similar herbicide tolerance activity should not be excluded from the mutants of the present invention due to the misplacement of nucleotide numbers.

[0166] The mutant of the present invention can improve, increase or promote the expression level of the HPPD enzyme encoding gene or HPPD enzyme in the cell, such as promoting the transcription of the HPPD enzyme encoding gene, increasing the amount of mRNA, and thus increasing the content of the HPPD enzyme in the plant. The degree of improvement of the expression level of the HPPD enzyme encoding gene or HPPD enzyme in the present invention can be described by selecting different references according to different improvement technologies, such as obtaining cells containing the 5'-UTR mutant of the present invention by transgenic technology, and the reference can be the same wild-type non-transgenic cells that do not contain the mutant of the present invention; such as obtaining cells containing the 5'-UTR of the present invention by mutating the endogenous UTR, and the reference can be the same wild-type cells that have not been mutated (i.e., the parent cells from which the UTR is derived). Those skilled in the art are familiar with selecting reasonable references in different situations.

[0167] The mutants of the present invention can confer or improve the tolerance of plant cells, plant tissues, plant parts or plants to HPPD-inhibiting herbicides. This includes introducing the nucleotide mutants of the present invention into plants that have no resistance or tolerance to HPPD-inhibiting herbicides, or have a certain or low tolerance to HPPD-inhibiting herbicides (at the same herbicide concentration), thereby giving plants without resistance a certain degree of herbicide resistance or tolerance, and improving the tolerance of plants with a certain or low tolerance to herbicides.

[0168] Preferably, the mutant is shown in SEQ ID NO.:2 or SEQ ID NO.:3 or SEQ ID NO.:4.

[0169] SEQ ID NO.2:

[0170] CGCCGCCACTGTCATCCACTCCCCCACACCCCACAACGCGCCACGCCACGCCGCCGCCGCGCCG CGCC

[0171] SEQ ID NO.3:

[0172] CGCCGCCACTGTCATCCACTCCCCCACACCCCACGACGCGCTACGCCACGCCGCGCCGCGCCGCGCC

[0173] SEQ ID NO.4:

[0174] CGCCGCCACTGTCATCCACTCCCCCACACCCCACAACGCGCTACGCCACGCCGCGCCGCGCCGCGCC.

[0175] The polynucleotide mutants of the present invention are preferably provided in an isolated form, and more preferably, purified to homogeneity.

[0176] The full-length sequence of the mutant of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis, and can also be obtained by natural or induced recombination or mutation in natural or artificial sequences. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified each time together in the correct order.

[0177] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0178] In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is shorter. Usually, a long fragment of sequence can be obtained by synthesizing multiple small fragments first and then connecting them.

[0179] At present, the mutant of the present invention can be obtained completely by chemical synthesis. Then the mutant sequence can be introduced into various existing DNA molecules (or vectors) and cells known in the art.

[0180] The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the polynucleotides of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0181] The 5'-UTR nucleotide mutation of the present invention also includes active fragments, variants, derivatives and analogs thereof, which can be produced by any substitution, deletion, mutation, addition, modification (such as methylation, demethylation) of nucleotides. It is clear to those skilled in the art that the function of 5'-UTR may be controlled by one or more nucleotides (such as the 35th or 42nd position of SEQ ID NO.1 of the present invention), and changing the nucleotides that are not involved in the regulation will not significantly affect its function. Therefore, the present invention also includes mutants of one or more other nucleotide substitution derivatives, as long as the substitution does not significantly affect the required function and biological activity of the 5'-UTR nucleotide mutation of the present invention. It should be understood that the variant generally has a higher homology (identity) than the sequence shown in SEQ ID NO.: 2 or SEQ ID NO.: 3 or SEQ ID NO.: 4. Preferably, the mutant has a homology of at least 80% with the sequence shown in SEQ ID NO.: 2 or SEQ ID NO.: 3 or SEQ ID NO.: 4, preferably at least 85%-90%, more preferably at least 95%, and most preferably at least 98% or 99%.

[0182] Nucleic acid constructs, expression vectors, plant improvement

[0183] The 5'-UTR nucleotide mutant of the present invention is not limited to being combined with other elements to form a nucleic acid construct, such as a combination with a promoter sequence, an HPPD enzyme encoding gene, an enhancer sequence, a terminator sequence, a tag gene, a leader sequence, a polyadenylation sequence, and the like. The HPPD enzyme can be derived from any species, including animals, plants, microorganisms, preferably plants, especially monocotyledons or dicotyledons. The prior art documents have disclosed some sources of p-hydroxyphenylpyruvate dioxygenase protein sequences and coding sequences, including wild-type HPPD enzymes, mutant HPPD enzymes or fusion proteins thereof, and these prior art documents are hereby incorporated herein by reference. Preferably, the parent p-hydroxyphenylpyruvate dioxygenase protein of the present invention is derived from the genus Oryza, especially rice.

[0184] The promoter of the present invention can be any nucleotide sequence showing transcriptional activity in a selected host cell, including mutant, truncated and hybrid promoters, and may obtain genes encoding extracellular or intracellular polypeptides homologous or heterologous to the host cell. As a promoter expressed in a plant cell or plant, it is preferred to use a natural promoter of p-hydroxyphenylpyruvate dioxygenase, or a heterologous promoter active in a plant. The promoter can be constitutively expressed, or can be inducibly expressed. Examples of promoters include, for example, histone promoters, rice actin promoters, plant virus promoters such as cauliflower mosaic virus promoters, etc.

[0185] The present invention also provides an expression vector, which contains a nucleic acid construct encoding the 5'-UTR nucleotide mutant of the present invention or the second aspect of the present invention. The expression vector also contains at least one replication origin to achieve self-replication. The choice of the vector usually depends on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, that is, a vector that exists as an extrachromosomal entity, and its replication is independent of the replication of the chromosome, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector may contain any element that ensures self-replication. Alternatively, the vector may be a vector that is integrated into the genome when introduced into the host cell and replicated together with the chromosome into which it is integrated. In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the host cell genome, or a transposon, may be used. Alternatively, the vector may also be a vector for gene editing of endogenous 5'-UTR nucleotides of the host cell.

[0186] The vector can be, for example, a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art and are described in detail in the art. Preferably, the expression vector in the present invention is a plasmid. The expression vector can also contain one or more selectable marker genes for selecting host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase, genes that confer neomycin resistance, genes that confer resistance to tetracycline or ampicillin, etc.

[0187] Vectors suitable for use in the present invention include plasmids available from commercial channels, such as but not limited to: pCambia, pBR322 (ATCC37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharma cia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia), etc.

[0188] Methods well known to those skilled in the art can be used to construct expression vectors containing the 5'-UTR nucleotide mutant sequence of the present invention or its combination with other elements to form a nucleic acid construct. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The 5'-UTR nucleotide mutant sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0189] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.

[0190] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells.

[0191] The present invention also provides a host cell comprising a 5'-UTR nucleotide mutant, a nucleic acid construct or an expression vector of the present invention. The vector comprising a 5'-UTR nucleotide mutant is introduced into the host cell so that the vector exists as part of a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier, or the vector can perform gene editing on the endogenous 5'-UTR of the host cell. The host cell can be any host cell familiar to those skilled in the art, including prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells (such as cells of crops and forestry plants). Representative examples include: Escherichia coli, Streptomyces, Agrobacterium; fungal cells such as yeast; plant cells, animal cells, etc.

[0192] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0193] Plant transformation can also be carried out by Agrobacterium transformation or gene gun transformation, for example, leaf disc method. Transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain plants with altered herbicide tolerance.

[0194] The present invention also provides a method for improving plants, specifically including introducing the 5'-UTR nucleotide mutant of the present invention or its nucleic acid construct or expression vector into plant cells, plant tissues, and plant parts, and then regenerating the plant cells, plant tissues, and plant parts into plants. The introduction method is as described above, including transforming an expression vector containing a 5'-UTR nucleotide mutant, and can also use gene editing technology to directly edit the 5'-untranslated region (5'-UTR) of HPPD in the target plant genome, thereby regulating the expression of endogenous HPPD genes and improving the properties of plants. The regeneration method includes tissue culture, greenhouse culture, or soil cultivation. The improved plant properties include improving or conferring or enhancing the tolerance or resistance of plants to HPPD-inhibiting herbicides, and the HPPD inhibitor is as described above.

[0195] The present invention also provides a method for controlling unwanted plants at a cultivation site, comprising applying an effective amount of one or more HPPD-inhibiting herbicides to a cultivation site containing a plant or seed of the present invention. The term "effective amount for controlling unwanted plants" refers to an amount of herbicide sufficient to affect the growth or development of unwanted plants, such as weeds, for example, to prevent or inhibit the growth or development of unwanted plants, or to kill the unwanted plants. Advantageously, the effective amount for controlling unwanted plants does not significantly affect the growth and / or development of the plant seeds, plant seedlings or plants of the present invention. Such an effective amount for controlling unwanted plants can be determined by routine experiments by those skilled in the art.

[0196] The present invention also provides a method for improving plants, comprising hybridizing a plant containing the 5'-UTR nucleotide mutant of the present invention and having tolerance to HPPD-inhibiting herbicides with a plant that is not resistant to HPPD-inhibiting herbicides or has a weaker resistance to herbicides, wherein the plant that is not resistant to HPPD-inhibiting herbicides or has a weaker resistance to herbicides may have one or more other excellent traits. The herbicide resistance of the plant that is not resistant to HPPD-inhibiting herbicides or has a weaker resistance to herbicides is improved by hybridization, or other traits of the plant containing the 5'-UTR nucleotide mutant of the present invention and having tolerance to HPPD-inhibiting herbicides are improved.

[0197] The main advantages of the present invention include:

[0198] (a) The present invention first discovered that by mutating the 5' untranslated region (5'-UTR) of the rice HPPD genome, the expression of the endogenous HPPD gene can be changed, thereby enhancing the plant's resistance to herbicides (such as HPPD-inhibiting herbicides).

[0199] (b) The present invention provides for the first time a 5'-UTR region mutant gene that can improve plant resistance to HPPD-inhibiting herbicides.

[0200] (c) The present invention first discovered that plants containing the mutants of the present invention have at least 2-16 times higher tolerance to herbicides (such as quinazolinedione herbicides) than parent plants (or wild-type plants), and confer a tolerance concentration of at least 0.01 mg / L to at least 10 mg / L to herbicides (such as quinazolinedione herbicides).

[0201] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0202] Unless otherwise specified, the reagents and materials in the examples of the present invention are all commercially available products.

[0203] Example 1: Construction of gene editing vector and screening of herbicide-resistant mutation sites

[0204] 1.1 Vector library construction

[0205] (1) Vector selection: Select Crispr-ABE and Crispr-CBE vectors with high editing efficiency that have been optimized for plants (see Figure 1 ), using NG as the PAM domain of the recognition position, sgRNA was saturatedly designed on the HPPD gene (including UTR and exon regions). A total of 1007 sgRNA sites were designed and constructed into Crispr-ABE and Crispr-CBE vectors respectively.

[0206] (2) Enzyme digestion system for vector 100 μL: Mix ddH2O (make up to 100 μL), Vector (4 μg), CutSmart (10 μL), and BsaI-HF (4 μL), then quickly centrifuge.

[0207] Reaction conditions:

[0208] temperature time 37℃ 4h 12℃ ∞

[0209] (3) Using gel recovery method, electrophoresis: agarose concentration: 0.8%; electrophoresis voltage: 80V; electrophoresis time: 1.5h

[0210] Weigh and mark the gel after cutting, and add Binding Buffer at a ratio of 0.1g gel weight: 100μL. During this period, the amount of gel loaded on the column each time is 700μL, 2000rcf, centrifuge for 30s, discard the waste liquid, repeat this process, the last time the gel solution is centrifuged at 10000rcf, 1min, discard the waste liquid, add 300μL Binding Buffer, centrifuge at 13000rcf, 1min, and discard the waste liquid. Wash 3 times with SPW Wash Buffer with anhydrous ethanol added. Dry the column, add 40μL of ddH2O preheated at 55℃, centrifuge at 13000rcf, 1min, add 40μL of ddH2O again, centrifuge at 13000rcf, 1min. Mix the eluate and measure the concentration.

[0211] (4) Primer annealing

[0212] The synthetic DNA oligonucleotide double strands are annealed as follows:

[0213] Dilute each DNA oligonucleotide to 10 μM with 1× Taq buffer, and take 5 μL of upstream and downstream primers for annealing. After annealing, store on ice or at -20℃.

[0214]

[0215]

[0216]

[0217] (5) T4 ligation vector

[0218] Use the single ligation method, 5 μL ligation system, prepare ligation mix according to the number of primer pairs, add annealing products after aliquoting, and ligate with T4 DNA ligase system at 25℃ for 30 minutes.

[0219] 5μL ligation system:

[0220]

[0221] Reaction conditions:

[0222] temperature time 25℃ 30min 65℃ 10min 12℃ ∞

[0223] (6) Ethanol precipitation vector library

[0224] All the ligation products (96) on a 96-well plate are pipetted and mixed into a 1.5mL centrifuge tube (sterilized). Add 1 volume (480μL) of chloroform (i.e. trichloroethane), and mix thoroughly by inverting. Centrifuge at 4℃, 13000rmp, 10min. Pipet the upper layer (water layer) into a new 1.5mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix thoroughly by inverting, and place at -80℃ for 30min or more. At 4℃, 13000rmp, 15min, pour out the ethanol, and pipet out the remaining solution. Vacuum dry at 30℃, about 15min. Centrifuge at 12000rmp, 1min, and add 20μL ddH2O to fully dissolve.

[0225] (7) Transformation to E. coli (electroporation / chemical transformation)

[0226] This method uses electroporation, the method is as follows:

[0227] Electrode cup: After washing with ddH2O, soak in 75% ethanol for 20 minutes, soak in anhydrous ethanol for 20 minutes, blow dry, and pre-cool on ice; use 1.5mL centrifuge tubes to dispense LB, preheat at 28℃; melt competent cells on ice for 5min; take 10μL of ligation product and add 100μL of E. coli electroporation competent cells and mix well. Pipette the mixed solution into the electrode cup, mix well, and shock; pour 700μL of preheated LB into the electrode cup and rinse the bacteria into a 2ml tube. Soak the bacterial solution in 75% ethanol and shake it at 200rpm at 37℃ for 1h; spread the bacterial solution on the LB plate containing the selected resistance, and invert and culture it at 37℃ overnight.

[0228] (8) Extraction of plasmid

[0229] Take 10mL of LB resistance culture medium and pour it into the bacterial plate, soak it for 5 minutes. Use a spreader (autoclaved) to circle all the colonies in each culture dish to dissolve them in the culture medium. Gently shake the bacterial solution, slowly tilt the bacterial plate, and transfer the bacterial solution to a 50mL centrifuge tube. Take another 5mL of LB resistance culture medium and add it to the bacterial plate, wash it once, collect the remaining bacterial solution, and transfer it to the corresponding 50mL centrifuge tube. Culture at 37℃200rpm for 2h. Extract the plasmid to obtain the final gene editing vector library.

[0230] (9) Transformation with Agrobacterium (electroporation)

[0231] Electrode cup: After washing with ddH2O, soak in 75% ethanol for 20 minutes, soak in anhydrous ethanol for 20 minutes, blow dry in a fume hood, and precool on ice; use 1.5mL centrifuge tubes to pack YEP, preheat at 28℃; melt competent cells on ice for 5min; draw 1μl plasmid and mix with competent cells; draw the mixed solution into the electrode cup, mix well, and shock; pour 700μL of preheated LB into the electrode cup, and rinse the bacteria into a 2ml tube. Wash the electrode cup and soak it in 75% ethanol; shake the bacterial solution at 200rpm at 28℃ for 1.5-2h; draw 500μL of the bacterial solution and spread it on the YEP plate containing the selected resistance, and invert and culture for 2d.

[0232] Pour LB resistance culture solution into the bacterial plate, so that the culture solution covers the bacterial plaque. Use a spreader to draw circles on all the colonies in each culture dish to dissolve them in the culture medium. Gently shake the bacterial solution, slowly tilt the bacterial plate, and transfer the bacterial solution to the 1L conical flask that has been added with 400mL, and make up to 500mL of LB resistance culture solution. Culture overnight at 28℃200rpm.

[0233] 1.2. Genetic transformation and gene editing detection

[0234] (1) Inducing rice Xiushui 134 callus: peel off rice seeds, wash the seeds with sterile water until the water becomes clear, disinfect with 70% alcohol for 30 seconds, then culture with 5% sodium hypochlorite on a horizontal shaker for 20 minutes, wash with sterile water 5 times after disinfection with sodium hypochlorite, place on sterile absorbent paper, air-dry the surface moisture of the seeds, inoculate on induction medium and culture callus at 28°C.

[0235] (2) Screening of the adaptive concentration of untransformed callus to herbicides: Select Xiushui 134 callus tissue with a diameter of 2-3 mm after 14 days of subculture, and place the callus tissue in a screening medium containing quinclorac. The callus grows well at different concentrations. About 14 days later, the callus is transferred to a differentiation medium containing quinclorac. It is found that when the medium contains 0.01 mg / L of quinclorac, most of the callus cannot be transformed into green dots. When the concentration of quinclorac is 0.03 mg / L, almost no green dots can be seen. The green buds are placed in a rooting medium with the same concentration of herbicide added. No seedlings can be obtained at a concentration of 0.03 mg / L of quinclorac. The specific screening concentrations and results are shown in Table 1 below.

[0236] Table 1 Screening of the adaptive concentration of untransformed rice callus to herbicides

[0237]

[0238] The more + signs there are, the better the status is, with three being the maximum.

[0239] (3) Agrobacterium infection of rice callus: In each batch of transformation, about 2,000 Xiushui 134 calli with a diameter of 2-3 mm after subculture for 14 days were selected and collected into a triangular flask; the Agrobacterium culture suspension resuspended with the infection solution was poured into the triangular flask containing the callus, and the callus was placed in a shaking incubator at 28°C and 200 rpm for infection for 20 minutes; after the infection, the culture solution was poured out, and the callus was placed on a sterile filter paper to air-dry for about 20 minutes, and then placed on a co-culture medium plate for co-culture, on which was spread a sterile filter paper soaked in AAM (with acetosyringone AS) liquid culture medium; after 3 days of infection, the Agrobacterium was washed and removed (first washed with sterile water 5 times, and then washed with 500 mg / L cephalosporin antibiotics for 20 minutes), and the callus was placed on a 40 mg / L hygromycin selection medium for selection and culture.

[0240] (4) Screening, differentiation and rooting of resistant calli: The co-cultivated callus tissue was transferred to the screening medium for the first round of screening (2 weeks); after the first round of screening, the newly grown callus was transferred to the screening medium (containing 40 mg / L hygromycin) for the second round of screening (2 weeks); after the screening was completed, the yellow-white callus tissue with good growth status was selected for differentiation, and 0.03 mg / L quinclorac and 40 mg / L hygromycin were added to the differentiation medium for herbicide resistance screening. After 3 to 4 weeks, seedlings of about 1 cm in diameter can be obtained (see Figure 2 ); the differentiated seedlings were transferred to rooting medium (supplemented with 0.03 mg / L quinclorac and 20 mg / L hygromycin) for rooting culture.

[0241] (5) Detection of editing type: Select leaves of green seedlings grown in rooting medium (see Figure 3 ), genomic DNA was extracted by CTAB method. Primers HPPD-F: CGTCCGCAACCACTAGACTT (SEQ ID NO.: 5) and HPPD-R: TTCTGCGCCTAATCGATGCT (SEQ ID NO.: 6) were used. The amplified products were detected by 1% agarose electrophoresis and then Sanger sequencing was performed, and base editing was found in the UTR region of green seedlings.

[0242] (6) Phenotypic observation: Since the effective period of quinclorac is 20 days, the seedlings were cultured in the rooting medium for 5 days and then transferred to a pot filled with soil and placed in a greenhouse for 15 days.

[0243] 1.3 Experimental Results

[0244] By sequencing, it was found that in green seedlings, the G at position -33 upstream (position 35 of SEQ ID NO.1 of the present invention) of the OsHPPD start codon ATG was mutated to A and the C at position -26 upstream (position 42 of SEQ ID NO.1 of the present invention) was mutated to T (see Figure 4 ).

[0245] After 15 days of potting soil cultivation, the plants with edited UTR regions showed excellent herbicide resistance compared with wild-type plants (see Figure 5 ).

[0246] 1.4 Experimental Conclusion

[0247] The results show that the change of nucleotide sequence in 5'-UTR of rice HPPD can improve the tolerance of plants to HPPD-inhibiting herbicides, especially quinazolinedione herbicides, thereby conferring or enhancing the resistance of plants to herbicides. The present invention has important application value in cultivating crops resistant to HPPD-inhibiting herbicides.

[0248] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Shandong Shunfeng Biotechnology Co., Ltd. <120> A mutant polynucleotide and its application <130> P2020-0260 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 67 <212> DNA <213> Artificial sequence <400> 1 cgccgccact gtcatccact cccccacacc ccacgacgcg ccacgccacg ccgcgccgcg 60 ccgcgcc 67 <210> 2 <211> 67 <212> DNA <213> Artificial sequence <400> 2 cgccgccact gtcatccact cccccacacc ccacaacgcg ccacgccacg ccgcgccgcg 60 ccgcgcc 67 <210> 3 <211> 67 <212> DNA <213> Artificial sequence <400> 3 cgccgccact gtcatccact cccccacacc ccacgacgcg ctacgccacg ccgcgccgcg 60 ccgcgcc 67 <210> 4 <211> 67 <212> DNA <213> Artificial sequence <400> 4 cgccgccact gtcatccact cccccacacc ccacaacgcg ctacgccacg ccgcgccgcg 60 ccgcgcc 67 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 cgtccgcaac cactagactt 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 ttctgcgcct aatcgatgct 20

Claims

1. An isolated 5'-UTR nucleotide mutant, characterized in that The 5'-UTR nucleotide mutant has one or more nucleotide differences compared to the 5'-UTR nucleotide of the parent, and the differences include mutations at positions 35 and 42 corresponding to SEQ ID NO.: 1, wherein the G at position 35 is mutated to A, and the C at position 42 is mutated to T. The nucleotide sequence of the mutant is shown in SEQ ID NO.:

3.

2. A nucleic acid construct, characterized in that: The nucleic acid construct comprises the 5'-UTR nucleotide mutant according to claim 1.

3. A carrier, characterized in that The vector contains the 5'-UTR nucleotide mutant according to claim 1 or the nucleic acid construct according to claim 2.

4. A genetically engineered cell, wherein the genetically engineered cell is not a plant cell, characterized in that: The genetically engineered cell contains the vector of claim 3 or a mutant of claim 1 or a nucleic acid construct of claim 2 integrated into its genome.

5. A method for changing the HPPD enzyme encoding gene or the expression level or activity of the HPPD enzyme in a cell, characterized in that: The method comprises the step of introducing the 5'-UTR nucleotide mutant according to claim 1 into the cell.

6. The method according to claim 5, characterized in that The change includes increasing the HPPD enzyme encoding gene or the HPPD enzyme expression level.

7. A method for improving plants, characterized in that: The method comprises the steps of: (a) providing a plant cell, plant tissue, or plant part, and introducing the 5'-UTR nucleotide mutant of claim 1 or the nucleic acid construct of claim 2 into the plant cell, plant tissue, or plant part; (b) regenerating the plant cells, plant tissues, or plant parts in step (a) into plants.

8. A reagent, characterized in that Containing the mutant according to claim 1, the nucleic acid construct according to claim 2, the vector according to claim 3, or the genetically engineered cell according to claim 4.

9. A kit, characterized in that: Comprising the reagent according to claim 8.

10. Use of the mutant according to claim 1, the nucleic acid construct according to claim 2, the vector according to claim 3, the genetically engineered cell according to claim 4, the reagent according to claim 8, or the kit according to claim 9, characterized in that: A reagent or kit for cultivating plant herbicide-resistant strains, or for preparing a reagent or kit for cultivating plant herbicide-resistant strains.

11. A method for identifying or selecting transformed plant cells, plant tissues, plants or parts thereof, characterized in that: include: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed plant cell, plant tissue, plant or part thereof comprises the mutant according to claim 1 or the nucleic acid construct according to claim 2 or the vector according to claim 3 or the plant cell, plant tissue, plant or part thereof obtained by the method according to claim 7; (ii) contacting the transformed plant cell, plant tissue, plant or part thereof with a herbicide; (iii) determining whether plant cells, plant tissues, plants or parts thereof are affected by the herbicide; and (iv) identifying or selecting transformed plant cells, plant tissues, plants or parts thereof.

12. A method for identifying herbicide-tolerant plants, characterized in that: include: (i) Identifying whether a plant sample has the mutant according to claim 1, the nucleic acid construct according to claim 2, or the vector according to claim 3.

13. A method for controlling unwanted vegetation at a plant cultivation site, characterized in that The method comprises: (1) planting a plant comprising the mutant according to claim 1, the nucleic acid construct according to claim 2, or the vector according to claim 3, or a plant obtained by the method according to claim 7, at the cultivation site; (2) applying an effective amount of a herbicide to the plants at the cultivation site.

14. A method for producing herbicide-resistant plants, characterized in that include: hybridizing the first plant with the second plant; The first plant is a herbicide-resistant plant, which contains the mutant according to claim 1, the nucleic acid construct according to claim 2, the vector according to claim 3, or is obtained by the method according to claim 7.

Images