A method for screening chicken target protein-interacting transcription factors

Abstract

The present invention relates to a method for screening a chicken target protein interaction transcription factor, and the method is suitable for establishing a cDNA library of 4.5d chicken embryo genital ridges to screen the interaction proteins of known genes. A large number of transcription factors related to the formation of PGCs can be captured, the corresponding signal pathways can be improved, the formation regulatory network of PGCs can be drawn, and experimental data and theoretical foundations can be laid for a large number of in vitro inductions to obtain PGCs. The method is low in cost, easy to operate, high in throughput, and can reach the level of the whole genome, making up for the inaccuracy and incompleteness of other ways of exploring protein interaction, and paving the way for later in-depth exploration of the functions of new proteins, research on the interaction dependency relationship between proteins and proteins, etc. It is suitable for establishing a cDNA library of 4.5d chicken embryo genital ridges to screen the interaction proteins of known genes. Using this method, a large number of transcription factors related to the formation of PGCs can be captured, the corresponding signal pathways can be improved, the formation regulatory network of PGCs can be drawn, and experimental data and theoretical foundations can be laid for a large number of in vitro inductions to obtain PGCs.

Description

Technical Field

[0001] The invention relates to a method for screening a chicken target protein interaction transcription factor, and belongs to the field of biotechnology. Technical Background

[0002] The yeast two-hybrid system is a common molecular biology technique for studying protein-protein interactions. It can combine the recombinant vector BD-Bait produced by fusing a known protein (bait protein) with a DNA binding domain and the recombinant vector AD-Prey produced by fusing an unknown protein (capture protein) with a transcriptional activation domain, and screen the combined interacting proteins by observing the activated expression of the reporter gene. It has a wide range of applications in studying new proteins, exploring protein functions, understanding metabolic regulation and signal transduction, targeted therapy, and studying human and animal DNA libraries. In 2014, Benoit J et al. screened a mouse brain cDNA library using yeast two-hybrid technology and found that the peripheral protein Per-61 had new peripheral protein interactors, and played a role in biological processes such as vesicle transport, signal transduction, DNA / RNA processing, protein folding, and mitochondrial metabolism. In poultry, primordial germ cells (PGCs), as ancestral cells for sperm and egg development, are regulated by multiple factors, but the specific mechanism of their generation and developmental differentiation is still unclear. It is necessary to explore the detailed interactions between key genes, transcription factors, signal pathways, etc. related to their regulation. The intervention and application of yeast two-hybrid technology provides a good scientific research idea for effectively solving the key problems such as the formation mechanism of chicken PGCs, building regulatory networks, and expanding PGCs production in the future. At the same time, this technology is measured in living cells, avoiding the interference of external factors in other methods of verifying protein interactions such as immunoprecipitation, cross-linking, and affinity chromatography, and it also has a good detection effect on transient and unstable proteins. Therefore, exploring the protein interaction network through the yeast two-hybrid system will provide more technical support for analyzing the formation mechanism of chicken PGCs and mass production of chicken embryo PGCs cells, and provide more experimental materials for poultry cell and embryo engineering research. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the above-mentioned prior art and provide a method for screening chicken target protein-interacting transcription factors. The method is low-cost, easy to operate, high-throughput, and can reach the whole genome level, making up for the inaccuracy and incompleteness of other methods of exploring protein interaction, and laying the foundation for further in-depth exploration of the functions of new proteins and the study of protein-protein interaction dependencies in the later stage.

[0004] The object of the present invention is achieved by: a method for screening chicken target protein interaction transcription factors, characterized in that it comprises the following steps:

[0005] (1) Extracting and purifying RNA from 4.5-day-old chicken embryonic PGCs, and reversely transcribing and synthesizing the first strand of cDNA, i.e., single-stranded cDNA;

[0006] (2) Using DNA polymerase, PCR amplifies the single-stranded cDNA to synthesize ds cDNA, which is then purified and extracted after electrophoresis detection;

[0007] (3) ligating the cDNA sequence into the linearized pGADT7 vector, transforming into Y187 yeast competent cells to construct the prey vector pGADT7-cDNA, and then testing the prey vector pGADT7-cDNA to identify its quality;

[0008] (4) The C2EIP gene was amplified, excised and recovered from the gel, and then ligated into the PGBKT7 vector, which was transformed into Y2HGold yeast competent cells to construct the bait vector PGBKT7-C2EIP. The prey vector and the bait vector were co-transformed into the Y2H Gold yeast strain for toxicity and self-activation detection;

[0009] (5) The prey plasmid and bait plasmid were mixed and inoculated into 2×YPDA liquid culture medium, and the production of combined growth products was examined under a microscope. After spreading on TDO / X plates for culture, all blue spot clones were selected and inoculated on QDO / X plates. Positive colonies were selected for PCR and sequencing.

[0010] In step (3), the contents of the prey vector pGADT7-cDNA are detected, including the cDNA library titer, positive rate, and inserted fragment.

[0011] The method of the present invention is advanced and scientific. Through the present invention, a method for screening chicken target protein interaction transcription factors is provided. The method is suitable for establishing a cDNA library of 4.5d chicken embryo genital ridges to screen the interaction proteins of known genes. By using this method, a large number of transcription factors related to the formation of PGCs can be captured, the corresponding signal pathways can be improved, and the formation regulatory network of PGCs can be drawn, laying the experimental data and theoretical foundation for a large number of in vitro induction to obtain PGCs. The scheme included is: first, extract and purify 4.5d chicken embryo PGCs RNA, and reverse transcribe to synthesize the first chain of cDNA; then, use DNA polymerase to perform PCR amplification on the single-stranded cDNA to synthesize ds cDNA, and then purify and extract it after electrophoresis detection; then, connect the cDNA sequence to the linearized pGADT7 vector, transform it into Y187 yeast competent cells to construct the prey vector pGADT7-cDNA, and identify its quality by detecting the titer, positive rate, and inserted fragment of the cDNA library; then, amplify the C2EIP gene, cut the gel and recover it, connect it to the PGBKT7 vector, and transform it into Y2H Gold yeast competent cells to construct the bait vector PGBKT7-C2EIP, and co-transform the prey vector and the bait vector into Y2H The Gold yeast strain was tested for toxicity and self-activation; finally, the prey plasmid and the bait plasmid were mixed and inoculated in 2×YPDA liquid culture medium, and the production of combined growth products was examined under a microscope. After coating TDO / X plates for culture, all blue spot clones were selected and inoculated on QDO / X plates, and positive colonies were selected for PCR and sent to the company for sequencing.

[0012] The advantages of the present invention are:

[0013] 1. The method of obtaining interacting proteins using yeast two-hybrid technology in the present invention is feasible and can be used to analyze the interactions between known proteins in large quantities and screen genes encoding unknown proteins. It has important guiding significance for studying protein functions, understanding protein domains, establishing gene linkage maps, etc., and greatly enriches biological information.

[0014] 2. The present invention has a wide range of applications and can be extended to construct cDNA libraries using materials from different tissues, organs, cell types and differentiation stages, and to analyze proteins in various subcellular locations and functions such as cytoplasm, nucleus and membrane-bound proteins, laying a foundation for studying overall cDNA information and its relevance and deciphering genetic laws;

[0015] 3. The method of screening interacting proteins in the present invention is simpler, more sensitive and more efficient than other methods such as co-immunoprecipitation, cross-linking, affinity chromatography, etc. It can detect weak or temporary interactions between proteins, and is carried out in eukaryotic cells and operates at the nucleic acid level, avoiding the protein separation and purification process, ensuring the activity of the protein, and can more realistically reflect the protein interaction situation, and has a good value for promotion and application.

[0016] In summary, the present invention discloses a method for screening chicken protein-interacting transcription factors, which is low-cost, easy to operate, high-throughput, and can reach the whole genome level, making up for the inaccuracy and incompleteness of other ways of exploring protein interactions, and paving the way for further exploring the functions of new proteins and studying the interaction dependencies between proteins. This method is suitable for establishing a cDNA library of 4.5d chicken embryo genital ridges to screen for interacting proteins of known genes. Using this method, a large number of transcription factors related to the formation of PGCs can be captured, the corresponding signal pathways can be improved, and the formation regulatory network of PGCs can be drawn, laying the experimental data and theoretical foundation for a large number of in vitro inductions to obtain PGCs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is an agarose gel electrophoresis diagram of the purified mRNA of the present invention;

[0018] Figure 2 It is the agarose gel electrophoresis diagram of the purified double-stranded cDNA of the present invention;

[0019] Figure 3 It is an agarose gel electrophoresis diagram of PCR products identified by the library of the present invention;

[0020] Figure 4 is an agarose gel electrophoresis diagram of the bait protein of the present invention;

[0021] Figure 5 This is a diagram of the bait protein toxicity detection and self-activation detection of the present invention;

[0022] Figure 6 This is a picture of the present invention combining microscopic examination of growing yeast cells and coating with TDO / X and QDO / X plates;

[0023] Figure 7 It is an agarose gel electrophoresis diagram of the PCR product of the universal primer of the combined outgrowth positive colony of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples.

[0025] A method for screening chicken target protein-interacting transcription factors comprises the following steps:

[0026] (1) Extract tissue RNA and synthesize single-stranded cDNA;

[0027] Take a 4.5d (day) chicken embryo and peel off its genital ridge. Cut the tissue with ophthalmic scissors, digest it with trypsin, filter it, centrifuge it, and fully homogenize it with 1mL Trizol reagent, let it stand for 5min, add 200μL chloroform and shake it for 15s, let it stand for 2min, centrifuge it at 12000g at 4℃ for 15min, take the supernatant and add an equal amount of isopropanol, let it stand for 10min, centrifuge it at 7500g at 4℃ for 5min, wash it with 75% ethanol, centrifuge it at 4℃ for 5min, dry the precipitate, bath it in 65℃ water for 15min, take a sample for agarose gel electrophoresis and concentration determination; take 200μg RNA and dilute it to 100μL, bath it at 65℃ for 2min, and then ice bath it, and add the RNA sample to the magnetic beads treated with Binding Buffer and mix it to make it mix with the oligothymine (dT) on the magnetic beads. 25 After annealing, place on a magnetic rack until the solution is clear, remove the supernatant, elute twice with Washing Buffer and once with Tris-HCl, incubate at 80°C for 2 minutes, and quickly place on a magnetic rack to take the supernatant, which is the purified mRNA. The product was reverse transcribed into cDNA. The PCR reaction system was as follows: 1 μg mRNA, 1 μL CDSⅢ primer, 4 μL water was added, incubated at 72℃ for 2 min and then placed on ice for 2 min; after centrifugation at 14000g for 10 s, 2 μL 5×First–Strand Buffer, 1 μL DTT (100 mM), 1 μL dNTP Mix (10 mM), 1 μL SMART MMLV Reverse transcriptase were added, and the mixture was incubated at 42℃ for 10 min; 1 μL SMARTⅢ-modified oligo was added and mixed, and the mixture was incubated at 42℃ for 1 hour. The reaction was terminated by incubation at 75℃ for 10 min, and the total volume was 10 μL; after cooling to room temperature, 1 μL RNase H was added, and the mixture was incubated at 37℃ for 20 min. Samples were taken for electrophoresis detection ( Figure 1 ), and the remaining samples were stored at -20°C.

[0028] (2) synthesizing and purifying double-stranded cDNA;

[0029] Using single-stranded cDNA as template, DNA polymerase was used to amplify gene fragments. The LD-PCR reaction system was: First-Strand cDNA 2μL, Deionized H2O 70μL, 10×Advantage 2PCR Buffer 10μL, 50×dNTPMix 2μL, 5'PCR Primer 2μL, 3'PCR Primer 2μL, 10×Melting Solution 10μL, 50×Advantage 2Polymerase Mix 2μL, total volume 100μL; reaction conditions: 95℃30s, 95℃10s, 65℃6min, 20 cycles, 68℃6min, each cycle time increased by 5s. Take 7μL for electrophoresis detection, and add the rest to the column material treated with CHROMA SPIN TE-400 for purification. Centrifuge at 700g for 5min, take the supernatant, add 1 / 10 volume of 3M sodium acetate and 2.5 times volume of anhydrous ethanol, freeze at -20℃ for 1h, centrifuge at 14000rmp for 20min, remove the supernatant and dry the precipitate for 10min; add 20μL deionized water to dissolve the precipitate and take a sample for agarose gel electrophoresis detection ( Figure 2 ).

[0030] (3) cDNA library construction;

[0031] ①Prepare Y187 competent cells;

[0032] a. Streak yeast Y187 on YPDA solid medium and culture inverted at 30°C for 3 days;

[0033] b. Pick a single colony and culture it in YPDA liquid medium at 30℃ and 250rpm for 8h;

[0034] c. Take 5 μL of bacterial solution and add it to 50 mL of YPDA. Cultivate at 30℃ and 250rpm until OD 600 The value is 0.15~0.3

[0035] d. Centrifuge at 700 g for 5 min, remove the supernatant, resuspend the cells in 100 mL YPDA, and culture at 30°C, 250 rpm until OD 600 0.4~0.5;

[0036] e. The bacterial solution was divided into two parts, centrifuged at 700g for 5 minutes, the supernatant was removed, and the bacteria were resuspended in 30mL of deionized water;

[0037] f. Centrifuge at 700 g for 5 min, remove the supernatant, and resuspend the cells in 1.5 mL TE / LiAc;

[0038] g. Centrifuge at high speed for 15 seconds, remove the supernatant, and resuspend the cells in 600 μL TE / LiAc.

[0039] ②Homologous recombination connection;

[0040] The purified ds cDNA and the linearized prey pGADT7-Smal after restriction digestion were connected. The reaction system was: dscDNA 7μL, pGADT7-Smal-1 3μL, Infusion recombinase 5μL, sterile water 5μL, total reaction volume 20μL, reaction conditions 50℃1h. 2μL Proteinase K was added to inactivate the recombinase and 78μL sterile water was added to 100μL, Glycogen 20μg, 7.5M NH4OAc 50μL, 100% ethanol 375μL were added in sequence, mixed evenly and placed at -80℃1h, centrifuged at 4℃16000rpm for 30min, carefully removed the supernatant and added 150μL 70% ethanol, repeated twice to elute the precipitate, removed the supernatant and dried at room temperature for 5min, added 10μL DEPC water to resuspend and collect cDNA, and immediately placed on ice.

[0041] ③ Transform competent cells and spread on plates;

[0042] The ligation product was transformed into Y187 yeast competent cells, 2.5 mL PEG / LiAc was added and mixed gently, cultured at 30°C for 45 min, 160 μL DMSO was added and mixed, water bathed at 42°C for 20 min, centrifuged at 700 g for 5 min, and the supernatant was removed. The bacteria were resuspended in 3 mL YPD Plus Medium, cultured at 30°C for 90 min, and then centrifuged to remove the supernatant, and the bacteria were resuspended in 15 mL 0.9% NaCl solution; 100 μL of the 10-fold and 100-fold diluted bacterial solutions were respectively coated on 100 mm SD / -Leu plates, cultured at 37°C for 3 days, and the number of colonies was counted and the transformation efficiency was calculated; the remaining bacterial solution was coated on the plate at 150 μL / plate, cultured at 30°C for 3 days, placed at 4°C for 3 hours, and 5 mL of pre-cooled bacterial culture medium was added to collect the transformants, and the cDNA library was obtained, which was stored at -80°C after aliquoting;

[0043] (4) cDNA library quality assessment;

[0044] ① Library titer detection (Table 1);

[0045] a. Take 10 μL of cDNA library solution and gently mix it in 1 mL of YPDA to obtain dilution A;

[0046] b. Take 10 μL of dilution A and gently mix it in 1 mL of YPDA to obtain dilution B;

[0047] c. Take 10 μL of dilution B and gently mix it in 1 mL of YPDA to obtain dilution C;

[0048] d. Take 100 μL of dilution C and coat a 100 mm SD / -Leu plate;

[0049] e. Incubate at 30℃ for 3-5 days;

[0050] f. Count the number of colonies and calculate the titer of the cDNA library:

[0051] Cfu=[#of colonies on plate] / [plating volume(mL)*dilution facter]

[0052] ② Library positive rate and insert fragment detection;

[0053] The tip of the pipette randomly picked 20 monoclonal colonies, added 3 mL of YPDA for culture, extracted the plasmid, and performed PCR identification. The reaction system was: Plasmid template 0.5 μL, 10×PCR Buffer 2 μL, Mgcl 2 (50mM) 1μL, dNTP (10mM) 0.5μL, 5'PCR Primer (20uM) 0.5μL, 3'PCR Primer (20uM) 0.5μL, DNA Polymerase (5U / μL) 0.3μL, deionized water 14.7μL to make up 20μL. LD-PCR reaction conditions are the same as those in VI (2). After PCR results, 3μL was mixed with loading buffer and then subjected to nucleic acid electrophoresis to determine the insert fragment and positive rate of the library ( Figure 3 ), which is the prey vector pGADT7-cDNA.

[0054] (5) Construction of bait vector recombinant plasmid and toxicity and self-activation tests;

[0055] ① Construction of bait vector recombinant plasmid;

[0056] Y2H Gold yeast competent cells were prepared using the same method as (3)①. The genital ridges of 4.5-day-old chicken embryos were peeled off, and PGCs were isolated and collected using their differential adhesion properties. After reverse transcription into cDNA, the bait gene C2EIP was amplified by PCR. The upstream primer of C2EIP was TGGAGCAAGTCCATGGAGCAT, and the downstream primer of C2EIP was TTTGAGGAACAGAGA GGCTG. The reaction system was: PrimeSTAR Max Premix 10μL, upstream primer 1μL, downstream primer 1μL, cDNA 1μL, RNase-Free ddH2O 7μL, reaction conditions: 98℃2min, 98℃10s, 55℃10s, 72℃15s, 35 cycles, 72℃2min, and agarose gel electrophoresis ( Figure 4 ) and sent to the company for sequencing, and the full-length sequence fragment of the bait gene was recovered from the gel. After double restriction digestion, it was connected to the bait vector (pGBKT7 vector), transformed into the Y2H Gold yeast strain, and positive monoclonal colonies were selected. The positive clones were identified by bacterial PCR and sent to the company for sequencing verification and named PGBKT7-C2EIP.

[0057] ② Bait carrier toxicity detection and self-activation detection;

[0058] a. Boil the carrier DNA in 100℃ water for 5 minutes, then immediately place on ice for 2 minutes, and repeat this process once;

[0059] b. Take a 1.5mL sterile EP tube and prepare the transformation system: 50μL competent cells + 5μL carrier DNA + 100ng bait plasmid + 100ng prey empty vector;

[0060] c. Slowly and gently add 500 μL PEG / LiAc (8 mL 50% PEG + 1 mL LiAc + 1 mL TE), mix and invert;

[0061] d. Incubate in a 30°C water bath (or 30°C incubator) for 30 minutes, gently mixing every 10 minutes;

[0062] e. Add 20 μL DMSO and mix gently;

[0063] f. Bath in 42℃ water for 15min, gently mix every 5min;

[0064] g. Centrifuge at 800 g for 1 min, remove the supernatant, add 800 μL YPDA to resuspend, and seal with sealing film;

[0065] h. 30℃150rpm, shaking culture for 1.5h;

[0066] i. Centrifuge at 800 g for 5 min, discard the supernatant, add 1 mL of 0.9% NaCl to resuspend, and take 150 μL to coat the plate;

[0067] j. Incubate at 30℃ for 3 days and observe the diameter and color of the colonies ( Figure 5 ).

[0068] (6) Combined growth screening library and PCR identification;

[0069] 1 mL of cDNA library and 5 mL of bait bacterial solution were inoculated into 45 mL of 2×YPDA liquid medium, cultured at 30°C and 50 rpm for 20 h, and the production of combined growth was examined under a microscope; similarly, colonies in the positive control (pGBKT7-53+pGADT7-T) and negative control (pGBKT7-lam+pGADT7-T) plates were selected, and the production of combined growth was examined under a microscope in the same way; the bacterial solution was centrifuged at 1000 g for 10 min, the supernatant was removed, and the bacteria were resuspended in 10 mL of 0.9% NaCl solution; the remaining bacterial solution was coated on 50 150 mm TDO / X plates at 200 μL / plate, cultured inverted at 30°C for 3-5 days, and the growth status was observed; all blue spot clones were selected and inoculated into 3 mL of QDO / X liquid medium for binding ability detection ( Figure 6 ).

[0070] Extract the plasmid and perform PCR amplification with universal primers of prey plasmid PGADT7. Use pGADT7-T plasmid as template for PCR as positive control and water as template for PCR as negative control. The reaction system is the same as (4)②. Take 3 μL of PCR result and mix it with loading buffer for nucleic acid electrophoresis detection ( Figure 7 ), and the corresponding plasmids with agarose detection bands larger than the negative control were sequenced using the PGADT7 universal primer.

[0071] Table 1 cDNA library quality analysis data table of the present invention

[0072]

Claims

1. A method for screening chicken protein-interacting transcription factors, Its characteristics are: The following steps are involved: (1) Extracting and purifying RNA from 4.5-day-old chicken embryo PGCs, and reversely transcribing and synthesizing the first strand of cDNA, i.e., single-stranded cDNA; specifically: The genital ridges of 4.5-day-old chicken embryos were peeled off, and the tissues were cut into pieces with ophthalmic scissors, digested with trypsin, filtered, and centrifuged. The mixture was fully homogenized with 1 mL of Trizol reagent, allowed to stand for 5 minutes, and 200 μL of chloroform was added and shaken for 15 seconds, then allowed to stand for 2 minutes, and centrifuged at 12000 g at 4°C for 15 minutes. The supernatant was added with an equal amount of isopropanol and allowed to stand for 10 minutes and centrifuged for 10 minutes. After washing with 75% ethanol, the supernatant was centrifuged at 7500 g at 4°C for 5 minutes, and the precipitate was dried and placed in a water bath at 65°C for 15 minutes. The sample was then subjected to agarose gel electrophoresis and concentration determination. 200 μg of RNA was diluted to 100 μL, and then placed in an ice bath at 65°C for 2 minutes. The RNA sample was added to the magnetic beads treated with Binding Buffer and mixed to make it mix well with the oligothymidine (dT) on the magnetic beads. 25 After annealing and binding, the mixture was placed on a magnetic rack until the solution was clear. After removing the supernatant, the mixture was eluted twice with Washing Buffer and once with Tris-HCl. The mixture was incubated at 80°C for 2 min, and the supernatant was quickly placed on a magnetic rack to obtain the purified mRNA. The product was reverse transcribed into cDNA. The PCR reaction system was as follows: 1 μg mRNA, 1 μL CDSⅢ primer, 4 μL water was added, the mixture was incubated at 72°C for 2 min, and then placed on ice for 2 min. After centrifugation at 14000g for 10 s, 2 μL 5×First–Strand Buffer, 1 μL 100 mM DTT, 1 μL 10 mM dNTP Mix, and 1 μL SMART MMLV Reverse transcriptase were added, and the mixture was incubated at 42°C for 10 min. 1 μL SMARTⅢ-modified oligo was added and mixed, and the mixture was incubated at 42°C for 1 hour. The reaction was terminated by incubation at 75°C for 10 min, and the total volume was 10 μL. After cooling to room temperature, 1 μL RNase was added. H, incubate at 37°C for 20 min, take samples for electrophoresis, and store the remaining samples at -20°C; (2) Using DNA polymerase, PCR amplification is performed on the single-stranded cDNA to synthesize ds cDNA, which is then purified and extracted after electrophoresis detection; specifically: Using single-stranded cDNA as template, DNA polymerase was used to amplify gene fragments. The LD-PCR reaction system was: First-Strand cDNA 2 μL, Deionized H 2 O 70μL, 10×Advantage 2PCR Buffer 10μL, 50×dNTP Mix 2μL, 5'PCR Primer 2μL, 3'PCR Primer 2μL, 10×Melting Solution 10μL, 50×Advantage2Polymerase Mix 2μL, total volume 100μL; reaction conditions: 95℃30s, 95℃10s, 65℃6min, 20 cycles, 68℃6min, each cycle time increased by 5s; take 7μL for electrophoresis detection, and add the rest to CHROMA Purification was performed in a column material treated with SPINTE-400; centrifugation at 700 g for 5 min, supernatant was taken, 1 / 10 volume of 3M sodium acetate and 2.5 volumes of anhydrous ethanol were added, frozen at -20°C for 1 h, centrifuged at 14000 rpm for 20 min, supernatant was removed and the precipitate was dried for 10 min; 20 μL of deionized water was added to dissolve the precipitate, and a sample was taken for agarose gel electrophoresis detection; (3) Connect the cDNA sequence to the linearized pGADT7 vector, transform it into Y187 yeast competent cells to construct the prey vector pGADT7-cDNA, and then identify the quality of the prey vector pGADT7-cDNA; specifically: ①Prepare Y187 competent cells; a. Streak yeast Y187 on YPDA solid medium and culture inverted at 30°C for 3 days; b. Pick a single colony and culture it in YPDA liquid medium at 30℃ and 250rpm for 8h; c. Take 5 μL of bacterial solution and add it to 50 mL of YPDA. Cultivate at 30℃ and 250rpm until OD 600 The value is 0.15~0.3 d. Centrifuge at 700 g for 5 min, remove the supernatant, resuspend the cells in 100 mL YPDA, and culture at 30°C, 250 rpm until OD 600 0.4~0.5; e. The bacterial solution was divided into two parts, centrifuged at 700g for 5 minutes, the supernatant was removed, and the bacteria were resuspended in 30mL of deionized water; f. Centrifuge at 700 g for 5 min, remove the supernatant, and resuspend the cells in 1.5 mL TE / LiAc; g. Centrifuge at high speed for 15 seconds, remove the supernatant, and resuspend the cells in 600 μL TE / LiAc; ②Homologous recombination connection; The purified ds cDNA and the linearized prey pGADT7-Smal after restriction digestion were connected. The reaction system was: dscDNA 7μL, pGADT7-Smal-1 3μL, Infusion recombinase 5μL, sterile water 5μL, the total reaction volume was 20μL, and the reaction conditions were 50℃ for 1h; 2μL of Proteinase K was added to inactivate the recombinase and 78μL of sterile water was added to 100μL, Glycogen 20μg, 7.5M NH4OAc 50μL, 100% ethanol 375μL were added in sequence, mixed evenly and placed at -80℃ for 1h, centrifuged at 4℃ 16000rpm for 30min, carefully removed the supernatant and added 150μL 70% ethanol, repeated twice to elute the precipitate, removed the supernatant and dried at room temperature for 5min, added 10μL DEPC water to resuspend and collect cDNA, and immediately placed on ice; The quality identification method of cDNA library is as follows: ① Library titer detection; a. Take 10 μL of cDNA library solution and gently mix it in 1 mL of YPDA to obtain dilution A; b. Take 10 μL of dilution A and gently mix it in 1 mL of YPDA to obtain dilution B; c. Take 10 μL of dilution B and gently mix it in 1 mL of YPDA to obtain dilution C; d. Take 100 μL of dilution C and coat a 100 mm SD / -Leu plate; e. Incubate at 30℃ for 3-5 days; f. Count the number of colonies and calculate the titer of the cDNA library: Cfu=[#of colonies on plate] / [plating volume(mL)*dilution facter] ② Library positive rate and insert fragment detection; The tip of the pipette randomly picked 20 monoclonal colonies, added 3 mL of YPDA for culture, extracted the plasmid, and performed PCR identification; the reaction system was: Plasmid template 0.5 μL, 10×PCR Buffer 2 μL, MgCl at a concentration of 50 mM 2 1μL, 10mM dNTP0.5μL, 20uM 5'PCR Primer0.5μL, 20uM 3'PCR Primer0.5μL, 5U / μL DNA Polymerase 0.3μL, deionized water 14.7μL to make up to 20μL; 3μL of PCR results were mixed with loading buffer and then subjected to nucleic acid electrophoresis to determine the insert fragment and positive rate of the library, which was the prey vector pGADT7-cDNA; ③ Transform competent cells and spread on plates; The ligation product was transformed into Y187 yeast competent cells, 2.5 mL PEG / LiAc was added and mixed gently, cultured at 30°C for 45 min, 160 μL DMSO was added and mixed, water bathed at 42°C for 20 min, centrifuged at 700 g for 5 min, and the supernatant was removed. The bacteria were resuspended in 3 mL YPD Plus Medium, cultured at 30°C for 90 min, and then centrifuged to remove the supernatant, and the bacteria were resuspended in 15 mL 0.9% NaCl solution; 100 μL of the 10-fold and 100-fold diluted bacterial solutions were respectively coated on 100 mm SD / -Leu plates, cultured at 37°C for 3 days, and the number of colonies was counted and the transformation efficiency was calculated; the remaining bacterial solution was coated on the plate at 150 μL / plate, cultured at 30°C for 3 days, placed at 4°C for 3 hours, and 5 mL of pre-cooled bacterial culture medium was added to collect the transformants, and the cDNA library was obtained, which was stored at -80°C after aliquoting; (4) The C2EIP gene was amplified, excised and recovered, and then connected to the PGBKT7 vector, which was transformed into Y2HGold yeast competent cells to construct the bait vector PGBKT7-C2EIP. The prey empty vector and the bait vector were co-transformed into the Y2H Gold yeast strain for toxicity detection and self-activation detection; specifically: ① Construction of bait vector recombinant plasmid; Y2H Gold yeast competent cells were prepared; the genital ridges of 4.5-day-old chicken embryos were peeled off, and PGCs cells were separated and collected by using their differential adhesion characteristics. After reverse transcription into cDNA, the bait gene C2EIP was amplified by PCR, and the upstream primer of C2EIP was TGGAGCAAGTCCATGGAGCAT, and the downstream primer of C2EIP was TTTGAGGAACAGAGA GGCTG. The reaction system was: PrimeSTARMax Premix 10μL, upstream primer 1μL, downstream primer 1μL, cDNA 1μL, RNase-Free ddH2O 7μL, reaction conditions: 98℃2min, 98℃10s, 55℃10s, 72℃15s, 35 cycles, 72℃2min, agarose gel electrophoresis was performed and sent to the company for sequencing, and the full-length sequence fragment of the bait gene was recovered from the gel; after double enzyme digestion, it was connected to the bait vector and transformed into Y2H From the Gold yeast strain, positive monoclonal colonies were selected, and positive clones were identified by bacterial test PCR. After being sent to the company for sequencing verification, they were named PGBKT7-C2EIP. ② Bait carrier toxicity detection and self-activation detection; a. Boil the carrier DNA in 100℃ water for 5 minutes, then immediately place on ice for 2 minutes, and repeat this process once; b. Take a 1.5mL sterile EP tube and prepare the transformation system: 50μL competent cells + 5μL carrier DNA + 100ng bait plasmid + 100ng prey empty vector; c. Slowly and gently add 500 μL PEG / LiAc, PEG / LiAc consists of 8 mL 50% PEG, 1 mL LiAc, 1 mL TE, mix well by inversion; d. Incubate in a 30°C water bath for 30 min, gently mixing every 10 min; e. Add 20 μL DMSO and mix gently; f. Bath in 42℃ water for 15min, gently mix every 5min; g. Centrifuge at 800 g for 1 min, remove the supernatant, add 800 μL YPDA to resuspend, and seal with sealing film; h. 30℃150rpm, shaking culture for 1.5h; i. Centrifuge at 800 g for 5 min, discard the supernatant, add 1 mL of 0.9% NaCl to resuspend, and take 150 μL to coat the plate; j. Incubate at 30℃ for 3 days and observe the diameter and color of the colonies; (5) The prey plasmid and the bait plasmid were mixed and inoculated in 2×YPDA liquid culture medium, and the production of combined growth was examined under a microscope. After coating on TDO / X plates for culture, all blue spot clones were selected and inoculated on QDO / X plates. Positive colonies were selected for PCR and sequencing; specifically: Inoculate 1mL cDNA library and 5mL bait bacterial solution into 45mL 2×YPDA liquid medium, culture at 30℃50rpm for 20h, and examine the production of combined growth products under a microscope; similarly, select colonies in the positive control and negative control plates, and examine the production of combined growth products under a microscope in the same way; centrifuge the bacterial solution at 1000g for 10min, remove the supernatant, and resuspend the bacteria in 10mL 0.9% NaCl solution; apply the remaining bacterial solution to 50 150mm TDO / X plates at 200μL / plate, culture at 30℃ inverted for 3-5d, and observe the growth status; select all blue spot clones and inoculate them into 3mL QDO / X liquid medium for binding ability detection; The plasmid was extracted and PCR amplification was performed with universal primers of prey plasmid PGADT7. PCR with pGADT7-T plasmid as template was used as positive control, and PCR with water as template was used as negative control. 3 μL of the PCR result was mixed with loading buffer and then detected by nucleic acid electrophoresis. The corresponding plasmid with agarose detection band larger than the negative control was sequenced with PGADT7 universal primers.

2. A method for screening chicken target protein-interacting transcription factors according to claim 1, Its characteristics are: In step (3), the contents of the detection of the prey vector pGADT7-cDNA include the cDNA library titer, positive rate, and inserted fragment.

Images