Digital PCR Detection Kit for Burkholderia

Abstract

The present invention relates to the field of biotechnology, and in particular to a digital PCR detection kit for Burkholderia. The present invention provides a primer probe set for digital PCR detection of Burkholderia, and provides a kit for digital PCR detection of Burkholderia. The primer and probe set can accurately identify whether a sample contains DNA of Burkholderia cepacia, Burkholderia glanders, and Burkholderia pseudomallei, and has good sensitivity for detecting the three Burkholderia.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a digital PCR detection kit for Burkholderia. Background Art

[0002] The genus Burkholderia belongs to the rRNA group I, which is common to all Pseudomonas species. Species within the genus include B. cepacia, B. cocovenenans, B. rnallei, B. pseudomallei, B. caruophylli, B. gladioli, B. picketti, and B. solanacearum.

[0003] The species in the genus Burkholderia are infectious to humans, animals and plants, and are pathogenic bacteria. Among them, there are five species related to human diseases, namely Burkholderia cepacia, Burkholderia glanders, Burkholderia pseudomallei, Burkholderia gladiolus and Burkholderia pilaris. Among them, reports on Burkholderia cepacia infection are the most common. Symptoms after Burkholderia infection include high fever, respiratory failure, bacteremia, skin and soft tissue infection, urinary tract infection, etc. Burkholderia generally has the characteristics of high drug resistance, so in the treatment process, it is necessary to first identify the infected pathogens, and then carry out targeted treatment. In the prior art, Burkholderia is still mostly identified by strain separation and culture, but the separation and culture methods mostly take 18 to 24 hours, which consumes a long time and brings inconvenience to treatment.

[0004] Digital PCR technology is an absolute quantitative technology for nucleic acid molecules. Its detection requires a short period of time, a low sample volume, and high detection sensitivity. If digital PCR technology can be applied to the detection of Burkholderia, it can greatly improve the detection efficiency and determine the treatment plan for the infected person in a more timely manner. However, there are currently no reports on the application of digital PCR in the detection of Burkholderia. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a digital PCR detection kit for Burkholderia.

[0006] The present invention provides a primer probe set for digital PCR detection of Burkholderia, comprising:

[0007] Two primers of the nucleic acid sequences shown in SEQ ID NOs: 1-2, and three probes of the nucleic acid sequences shown in SEQ ID NOs: 3-5.

[0008] In the present invention, the two primers of the nucleic acid sequences shown in SEQ ID NOs: 1-2 are universal primers designed based on conservative sequences, and can accurately identify and amplify Burkholderia cepacia, Burkholderia glanders and Burkholderia pseudomallei.

[0009] In the present invention, two probes of nucleic acid sequences as shown in SEQ ID NOs: 3 to 4 target Burkholderia cepacia, and a single probe of nucleic acid sequence as shown in SEQ ID NO: 5 targets Burkholderia mallei and Burkholderia pseudomallei.

[0010] In the present invention, the 5' end and 3' end of the probe are modified with a fluorescent group and a quenching group respectively;

[0011] The fluorescent group is selected from Alexa350, Alexa488, Alexa 532, Alexa 549, Alexa 647, Alexa680, CF350, CF488, CF532, CF594, CF647, CF680, FAM, HEX, VIC, ROX, Cal610, Texas Red, CY5, Quasar670 or Quasar705;

[0012] The quenching group is selected from BHQ-0, BHQ-1, BHQ-2, BHQ-3, MGB, DabCyl or Eclip seλ.

[0013] In the probe of the present invention:

[0014] The 5' and 3' ends of the probe of the nucleic acid sequence shown in SEQ ID NO: 3 are modified with FAM and MGB, respectively;

[0015] The 5' and 3' ends of the probe of the nucleic acid sequence shown in SEQ ID NO: 4 are modified with FAM and MGB, respectively;

[0016] The 5' and 3' ends of the probe of the nucleic acid sequence shown in SEQ ID NO: 5 are modified with CY5 and MGB, respectively.

[0017] In some embodiments,

[0018] The probe of the nucleic acid sequence shown in SEQ ID NO: 3 has a 5' end modified with FAM and a 3' end modified with MGB;

[0019] The probe of the nucleic acid sequence shown in SEQ ID NO: 4 has a 5' end modified with FAM and a 3' end modified with MGB;

[0020] The probe of the nucleic acid sequence shown in SEQ ID NO: 3 has CY5 modified at the 5' end and MGB modified at the 3' end;

[0021] Application of the primer probe set of the present invention in preparing a kit for detecting Burkholderia.

[0022] The Burkholderia species that the primer-probe combination of the present invention is used to detect include Burkholderia cepacia, Burkholderia mallei and Burkholderia pseudomallei.

[0023] The present invention also provides a kit for detecting Burkholderia, which comprises the primer probe set of the present invention.

[0024] The kit of the present invention also includes detection primers and probes for endogenous and external references.

[0025] The kit of the present invention uses IC-S as an exogenous internal reference, and the nucleic acid sequence of the internal reference is TCACAATCTTGACCTGCACGGCAAAGAGACGCTTCTTGTGGAGCTCGACAACGCAACAACGCGACGGATCTACGTCACAGCGAGTATAGTGAAAACGAAGTTGCTGACGGCGGAAGCGACATAGGGATCTGTCAGTTGTCATTCGCGAAA. Studies have shown that the fragment will not cross-react with pathogens or human genomes.

[0026] In the present invention, the nucleic acid sequences of the two detection primers of the endogenous and external references are shown in SEQ ID NOs: 6 to 7;

[0027] In a specific embodiment of the present invention, the endogenous external reference detection probe nucleic acid sequence is shown in SEQ ID NO: 8. The 5' end and 3' end of the probe of the nucleic acid sequence shown in SEQ ID NO: 8 are modified with VIC and BHQ1 respectively.

[0028] The kit described in the present invention also includes a detection reagent for digital PCR, and the detection reagent includes ddPCRMix, ROX dye and ultrapure water.

[0029] The kit of the present invention further comprises a sample processing reagent;

[0030] The samples include: oral swab, blood, peritoneal effusion, wound tissue or sputum;

[0031] The sample processing reagents include genomic DNA extraction reagents.

[0032] In the present invention, the genomic DNA extraction reagent is a magnetic bead method DNA extraction reagent.

[0033] The present invention also provides a method for detecting Burkholderia, which is performed using the kit of the present invention.

[0034] In the detection method of the present invention, the detection system includes: ddPCR Mix, a primer-probe mixture, endogenous and external reference fragments, and DNA of the sample to be tested.

[0035] In the detection method of the present invention, the amplification program includes: 98°C 5min [98°C 15s, 60°C 1min]×40 cycles.

[0036] The present invention provides a primer probe set for digital PCR detection of Burkholderia, and provides a kit for digital PCR detection of Burkholderia. The primer and probe set can accurately identify whether a sample contains DNA of Burkholderia cepacia, Burkholderia glanders, and Burkholderia pseudomallei, and has good sensitivity for detecting the three Burkholderia. DETAILED DESCRIPTION

[0037] The present invention provides a digital PCR detection kit for Burkholderia, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0038] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0039] Example 1

[0040] 1. Primer probe design

[0041] 1.1 Based on the sequence analysis results of Burkholderia cepacia, Burkholderia glanders, and Burkholderia pseudomallei, Primer Express software was used to design primers and probes; a set of exogenous internal reference primers and probes were also used. The specific information is as follows:

[0042]

[0043] 2. Samples

[0044] 2.1 Bacterial DNA samples: Inactivated bacteria were purchased from outside, and genomic DNA was extracted using the magnetic bead method.

[0045] 2.2 Human DNA samples: oral swab, genomic DNA extracted by magnetic bead method.

[0046] 2.3 Exogenous internal reference template: synthesized by a biological company, dissolved and diluted for later use.

[0047] 3. Detection method

[0048] 3.1 Digital PCR amplification system

[0049] 3.1.1 25XB Primer Probe Mixture

[0050] Components Stock solution (μM) Volume (μL / person) 50×ROX dye 0.3 BF 400 0.0375 BR 400 0.0375 Bc-P1 100 0.0375 Bc-P2 100 0.0375 Bm-P 100 0.0375 IC-F 400 0.0375 IC-R 400 0.0375 IC-P 100 0.0375 total / 0.6

[0051] 3.1.2 ddPCR reaction system

[0052] Reagents Volume (μL) Final concentration water 0.4 5×ddPCR Mix 3 1× 25XB Primer Probe Mix 0.6 1× IC-S 1 DNA 10 total 15

[0053] 3.1.3 Amplification Procedure

[0054] 98℃5min【98℃15s, 60℃1min】×40

[0055] 4 Results

[0056] 4.1 Specificity detection

[0057]

[0058]

[0059]

[0060] The results show that the primer and probe combination of the present invention has good specificity for detecting a variety of common bacteria and fungi by digital PCR, and has good stability in detecting three replicates of Burkholderia cepacia, Burkholderia mallei, and Burkholderia pseudomallei, and there is no crossover between Burkholderia cepacia and Burkholderia mallei / Burkholderia pseudomallei.

[0061] 4.2 Minimum detection limit test

[0062]

[0063]

[0064]

[0065]

[0066]

[0067] The results show that the primers and probes provided by the present invention can stably detect 0.3 copies / μL for Burkholderia cepacia, Burkholderia glanders, and Burkholderia pseudomallei, that is, the minimum detection is 4.5 copies / reaction.

[0068] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Peking Union Medical College Hospital, Chinese Academy of Medical Sciences; Linghang Gene Technology (Hangzhou) Co., Ltd. <120> Digital PCR Detection Kit for Burkholderia <130> MP21021106 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <400> 1 cagaagcgtg cggaagc 17 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 gaggctcacg gcttccatc 19 <210> 3 <211> 13 <212> DNA <213> Artificial Sequence <400> 3 cgttgccgat tcg 13 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <400> 4 ctcggcgtga acga 14 <210> 5 <211> 13 <212> DNA <213> Artificial Sequence <400> 5 cgtcggggat gcg 13 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 gcttcttgtg gagctcgaca a 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 ccgtcagcaa cttcgttttc a 21 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <400> 8 cgcgacggat ctacgtcaca gcg 23

Claims

1. A primer probe set for digital PCR detection of Burkholderia, comprising: Two primers of the nucleic acid sequences shown in SEQ ID NOs: 1-2, and two probes of the nucleic acid sequences shown in SEQ ID NOs: 4-5; The probe of the nucleic acid sequence shown in SEQ ID NO:4 targets Burkholderia cepacia. The probe with the nucleic acid sequence shown in SEQ ID NO: 5 targets Burkholderia mallei and Burkholderia pseudomallei.

2. The primer probe set according to claim 1, characterized in that: The 5' end and 3' end of the probe are modified with a fluorescent group and a quenching group respectively; The fluorescent group is selected from Alexa350, Alexa488, Alexa 532, Alexa 549, Alexa 647, Alexa680, CF350, CF488, CF532, CF594, CF647, CF680, FAM, HEX, VIC, ROX, Cal610, Texas Red, CY5, Quasar670 or Quasar705; The quenching group is selected from BHQ-0, BHQ-1, BHQ-2, BHQ-3, MGB, DabCyl or Eclip seλ.

3. The primer probe set according to claim 1, characterized in that: The 5' and 3' ends of the probe of the nucleic acid sequence shown in SEQ ID NO: 4 are modified with FAM and MGB, respectively; The 5' and 3' ends of the probe of the nucleic acid sequence shown in SEQ ID NO: 5 are modified with CY5 and MGB, respectively.

4. Use of the primer probe set according to any one of claims 1 to 3 in the preparation of a kit for detecting Burkholderia; the Burkholderia are Burkholderia cepacia, Burkholderia pseudomallei and Burkholderia pseudomallei.

5. A kit for detecting Burkholderia, characterized in that: A primer-probe set comprising any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that It also includes detection primers and probes for endogenous and external references. The nucleic acid sequences of the detection primers of the endogenous external reference are shown in SEQ ID NOs: 6-7; The nucleic acid sequence of the endogenous external reference probe is shown in SEQ ID NO:

8.

7. The kit according to claim 6, characterized in that The 5' end and 3' end of the probe of the nucleic acid sequence shown in SEQ ID NO: 8 are modified with VIC and BHQ1, respectively.

8. The kit according to claim 5, characterized in that Also included are detection reagents for digital PCR, which include ddPCR Mix, ROX dye, and ultrapure water.

9. The kit according to any one of claims 5 to 8, characterized in that Also included are sample processing reagents; The samples include: oral swab, blood, peritoneal effusion, wound tissue or sputum; The sample processing reagents include genomic DNA extraction reagents.

Images