Dihydropyrimidine compounds and their pharmaceutical applications

By developing novel dihydropyrimidine compounds, the problems of low activity and drug resistance of existing anti-hepatitis B drugs have been solved, providing a drug composition with good solubility and stability, achieving effective inhibition of HBV and alleviation of hepatitis B symptoms.

CN113831359BActive Publication Date: 2026-03-06SUNSHINE LAKE PHARMA CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-21
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Existing anti-hepatitis B drugs, such as interferon, have low activity and toxic side effects, while lamivudine has high resistance and is prone to rebound after treatment. New antiviral drugs are needed to effectively treat and prevent hepatitis B.

Method used

Develop novel dihydropyrimidine compounds with good solubility, stability, and low hepatic enzyme induction to prepare pharmaceutical compositions for inhibiting HBV infection.

Benefits of technology

It effectively inhibits HBV infection, reduces drug toxicity, improves treatment efficacy, and alleviates hepatitis B symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113831359B_ABST
    Figure CN113831359B_ABST
Patent Text Reader

Abstract

This invention relates to a dihydropyrimidine compound and its use in medicine, particularly as a medicament for the treatment and prevention of hepatitis B. Specifically, this invention relates to compounds of general formula (I) or (Ia) or their stereoisomers, tautomers, nitrides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof, and their use as medicines, particularly as medicaments for the treatment and prevention of hepatitis B, wherein the variables are as defined in the specification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medicine. Specifically, this invention relates to a dihydropyrimidine compound and its use as a medicine, particularly its use as a medicine for the treatment and / or prevention of hepatitis B. This invention also relates to compositions of these dihydropyrimidine compounds with other antiviral agents, and their use in the treatment and / or prevention of hepatitis B virus (HBV) infection. Background Technology

[0002] Hepatitis B virus belongs to the Hepatoviridae family. It can cause acute and / or progressively chronic disease. Hepatitis B virus can also cause many other clinical manifestations in pathology—especially chronic inflammation of the liver, cirrhosis, and hepatocellular carcinoma. Furthermore, co-infection with hepatitis D can have adverse effects on the progression of the disease.

[0003] Interferon and lamivudine are the commonly approved drugs for treating chronic hepatitis. However, interferon has only moderate activity and a high rate of toxic side effects; while lamivudine has good activity, its resistance increases rapidly during treatment and often rebounds after discontinuation of treatment. The IC50 of lamivudine (3-TC) is... 50 The value is 300 nM (Science, 299 (2003), 893-896).

[0004] Deres et al. reported heterocyclic substituted dihydropyrimidine (HAP) compounds, represented by Bay41-4109 and Bay39-5493, which can inhibit HBV replication by preventing the formation of normal nucleocapsids. Bay41-4109 showed good pharmacometrine properties in clinical studies (Science, 299 (2003), 893-896). Through studies on its mechanism of action, it was found that heterocyclic substituted dihydropyrimidine compounds interact with amino acid residues 113-143 of the core protein, changing the angle between the dimers that form the nucleocapsid, leading to the formation of an unstable, inflated nucleocapsid and accelerating the degradation of the core protein (Biochem. Pharmacol. 66 (2003), 2273-2279).

[0005] There is still a need for new compounds that can be effectively used as antiviral drugs, especially for the treatment and / or prevention of hepatitis B. Summary of the Invention

[0006] This invention relates to novel dihydropyrimidine compounds and their use in the preparation of medicaments for the treatment and prevention of HBV infection. In particular, this invention relates to a novel dihydropyrimidine compound and pharmaceutically acceptable compositions thereof, which possess advantages such as good solubility, good stability, minimal induction of hepatic drug-metabolizing enzymes, and low toxicity, and especially exhibits excellent pharmacokinetic properties. The compounds of this invention can effectively inhibit HBV infection and show great promise for anti-HBV applications.

[0007] On one hand, the present invention relates to a compound of formula (I) or (Ia) or a stereoisomer, tautomer, nitride, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof.

[0008]

[0009] Among them, each R 1 R 1b and R 1a Independently, it is hydrogen, deuterium, F, Cl, Br, I, cyano, methyl, ethyl, methoxy, ethoxy, methylamino, ethylamino, nitro, 4-trifluoromethylphenyl, 3,5-di(trifluoromethyl)phenyl or trifluoromethyl;

[0010] R 2 C 1-6 Alkyl or C 1-6 Halogenated alkyl groups;

[0011] R 3 The phenyl, imidazolyl, thiophene, furanyl, or thiazolyl groups are used, wherein each of the phenyl, imidazolyl, thiophene, furanyl, and thiazolyl groups is independently unsubstituted or is replaced by 1, 2, 3, 4, or 5 groups selected from deuterium, F, Cl, Br, OH, CN, and C. 1-6 Alkyl, hydroxyl C 1-6 Alkyl, C 1-6 Alkyl-OC(=O)-, C 1-6 Alkyl-OC(=O)-C 1-6 Alkylene, HOOC-C 1-6 Alkylene, C 1-6 Alkoxy-C 1-6 Alkylene and C 1-6 Substituents of alkyl-S(=O)2-;

[0012] W is either CH or N;

[0013] X 1 -C(=O)-, -S(=O)2-, or -(CR) 5 R 6 ) j -;

[0014] Each R 5 and R 6 Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, hydroxyl-C 1-6 Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0015] R is a substructure of the following:

[0016]

[0017] Each R 4a R 4b R 4c R 4d R 5a R 5b R 5c R 6a R 7a R 8a R 8b and R 9a Independently, it can be hydrogen, deuterium, F, Cl, Br, (OH)₂B⁻, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, hydroxyl-C 1-6 Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0018] Each R 7 R a and R b Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, carboxyl group, carboxyl group C 1-6 Alkylene, hydroxyl C 1-6 Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0019] m can be 0, 1, 2, 3, or 4;

[0020] j can be 1, 2, or 3.

[0021] In some embodiments, the R described in this invention 2It can be methyl, ethyl, n-propyl, isopropyl, monofluoromethyl, difluoromethyl, or trifluoromethyl;

[0022] R 3 The radical is methyl, imidazole, thiophene, furanyl, or thiazolyl, wherein each of the radicals is independently unsubstituted or is substituted by 1, 2, 3, 4, or 5 radicals selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, tert-butyl, hydroxyl, C. 1-4 Alkyl, C 1-4 Alkyl-OC(=O)-, C 1-4 Alkyl-OC(=O)-C 1-3 Alkylene-, HOOC-C 1-3 Alkylene-, C 1-4 Alkoxy-C 1-3 Alkylene- and C 1-4 Substituents of alkyl-S(=O)2-.

[0023] In some embodiments, the Rs described in this invention 5 and R 6 Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, hydroxyl-C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups;

[0024] Each R 7 R a and R b Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, carboxyl group, carboxyl group C 1-4 Alkylene, hydroxyl C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups.

[0025] In some embodiments, the Rs described in this invention 4a R 4b R 4c R 4d R 5a R 5b R 5c R 6a R 7a R 8a R8b and R 9a Independently, it can be hydrogen, deuterium, F, Cl, Br, (OH)₂B⁻, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, hydroxyl-C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups.

[0026] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound described herein and pharmaceutically acceptable excipients.

[0027] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0028] In some embodiments, the pharmaceutical composition of the present invention includes, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

[0029] In some embodiments, the pharmaceutical composition of the present invention, wherein the other anti-HBV drugs are lamivudine, telbivudine, tenofovir disoproxil fumarate, entecavir, adefovir disoproxil fumarate, alfaferone, alloferon, simvastatin, clavudine, emtricitabine, faprovir, interferon, bacalanol CP, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mirtovalidone, nitrozonide, pegylated interferon α-2a, ribavirin, roximate, cizonan, eufovac, amplivir, phosphazid, heplisav, interferon α-2b, levamisole, or propanthenium.

[0030] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for the prevention, treatment or relief of viral diseases in patients.

[0031] In some embodiments, the use described in this invention refers to the viral disease as hepatitis B infection or a disease caused by hepatitis B infection.

[0032] In some other embodiments, the uses described in this invention refer to diseases caused by hepatitis B infection as cirrhosis or hepatocellular carcinoma.

[0033] On the other hand, the present invention relates to the use of the said compound or pharmaceutical composition in the preparation of a medicament for the prevention, treatment or relief of hepatitis B in patients, including administering to patients an effective therapeutic dose of the compound or pharmaceutical composition as described in the present invention.

[0034] Another aspect of the present invention relates to a method for preventing, treating, or alleviating HBV symptoms in a patient, the method comprising administering medication to the patient in a pharmaceutically acceptable and effective dose of a compound of the present invention.

[0035] Another aspect of the present invention relates to a method for preventing, treating, or alleviating HBV symptoms in a patient, the method comprising administering medication to the patient in a pharmaceutically acceptable and effective dose of a pharmaceutical composition containing a compound of the present invention.

[0036] Another aspect of the present invention relates to the use of a compound of the present invention to produce a medicament for the prevention or treatment of HBV symptoms in patients and to reduce the severity of those symptoms.

[0037] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compounds of the present invention to produce a medicament for the prevention or treatment of HBV symptoms in patients and to reduce the severity of those symptoms.

[0038] Another aspect of the present invention relates to a method for inhibiting HBV infection, the method comprising contacting cells with a dose of the compound or pharmaceutical composition of the present invention capable of effectively inhibiting HBV. In some further embodiments, the method further comprises contacting the cells with other anti-HBV therapeutic agents.

[0039] Another aspect of the present invention relates to a treatment method for HBV disease in patients, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient requiring treatment. In some further embodiments, the method further comprises administering an effective therapeutic dose of another anti-HBV drug to a patient requiring treatment.

[0040] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient requiring treatment. In some further embodiments, the method further comprises administering an effective therapeutic dose of another anti-HBV drug to a patient requiring treatment.

[0041] Another aspect of the present invention relates to methods for the preparation, separation and purification of compounds contained in formula (I) or formula (Ia).

[0042] The foregoing description only outlines certain aspects of the invention, but is not limited to these aspects. These and other aspects will be described in more detail below.

[0043] Detailed Description of the Invention

[0044] Definitions and general terms

[0045] This invention will list in detail the relevant literature for the specific details provided, and the embodiments are accompanied by diagrams of structural and chemical formulas. This invention is intended to cover all options, variations, and equivalents that may be included in the field of prior art as defined in the claims. Those skilled in the art will recognize many similar or equivalent methods and substances described herein that can be applied in the practice of this invention. This invention is by no means limited to the description of methods and substances. Many documents and similar substances distinguish or conflict with this application, including but not limited to the definitions of terms, usages of terms, described techniques, or the scope controlled as described in this application.

[0046] This invention will apply the following definitions unless otherwise indicated. For the purposes of this invention, chemical elements are defined according to the periodic table, CAS version, and the Chemical Handbook, 75. th Ed., 1994, defines it. Additionally, general principles of organic chemistry can be found in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," by Michael B. Smith and Jerry March, John Wiley & Sons, New York: 2007; therefore, all content incorporates references.

[0047] As described in this invention, the compounds of this invention may optionally be substituted with one or more substituents, such as the general formula compounds above, or as the specific examples, subclasses, and a class of compounds included in this invention.

[0048] Generally, the term "substituted" indicates that one or more hydrogen atoms in a given structure are replaced by a specific substituent. Unless otherwise indicated, an optional substituent group may have one substituent at each substituted position of the group. When more than one position in a given structural formula can be replaced by one or more substituents selected from a specific group, the substituents may be substituted at the same or different positions.

[0049] In various parts of this specification, the substituents of the compounds of the present invention are disclosed according to the type or scope of the groups. In particular, the present invention includes every independent secondary combination of the various members of these group types and scopes. For example, the term "C" 1-6"Alkyl" specifically refers to independently disclosed methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and C6 alkyl.

[0050] As used in this invention, the term "alkyl" includes a monovalent hydrocarbon group consisting of a saturated straight-chain or branched chain of 1-20 carbon atoms, wherein the alkyl group may be independently and optionally substituted by one or more substituents described in this invention. Some embodiments have an alkyl group containing 1-12 carbon atoms, others have an alkyl group containing 1-10 carbon atoms, still others have an alkyl group containing 1-8 carbon atoms, still others have an alkyl group containing 1-6 carbon atoms, still others have an alkyl group containing 1-4 carbon atoms, and still others have an alkyl group containing 1-3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), 2-methylpropyl or isobutyl (i-Bu, -CH2CH(CH3)2), 1-methylpropyl or sec-butyl (s-Bu, -CH(CH3)CH 2CH3), tert-butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)) 2) 2-Methyl-1-butyl (-CH2CH(CH3)CH2CH3), n-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-Methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-Methyl-2-pentyl (-CH(CH3)CH(CH3)C H2CH3), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), n-heptyl, n-octyl, etc.

[0051] The term "alkylene" refers to a saturated divalent or polyvalent hydrocarbon group obtained by removing two or more hydrogen atoms from a saturated straight-chain or branched hydrocarbon group. Unless otherwise specified, the alkylene group contains 1-12 carbon atoms. In some embodiments, the alkylene group contains 1-6 carbon atoms; in other embodiments, it contains 1-4 carbon atoms; in still other embodiments, it contains 1-3 carbon atoms; and in still other embodiments, it contains 1-2 carbon atoms. Examples of alkylene groups include, but are not limited to, methylene (-CH2-), ethylene (-CH2CH2-), n-propylene (-CH2CH2CH2-), isopropylene (-CH(CH3)CH2-), etc.

[0052] The terms “hydroxyalkyl” and “hydroxyalkoxy” refer to alkyl or alkoxy groups, which, depending on the context, are replaced by one or more hydroxyl groups. The terms “hydroxyalkyl”, “hydroxyalkylene”, and “hydroxyalkyl” can be used interchangeably. Examples of such interchangeability include, but are not limited to, hydroxymethyl (-CH2OH), hydroxyethyl (-CH2CH2OH,-CHOHCH3), hydroxypropyl (e.g., -CH2CH2CH2OH,-CH2CHOHCH3,-CHOHCH2CH3), hydroxymethoxy (-OCH2OH), etc.

[0053] The term "carboxyl group C" 1-6 "Alkylene" indicates an alkyl group, which, depending on the context, is replaced by one or more carboxyl groups, wherein the "carboxyl C" is... 1-6 The terms "alkylene" and "carboxyalkylene" can be used interchangeably. Examples of such interchangeability include, but are not limited to, carboxymethyl (-CH2COOH), carboxyethyl (-CH2CH2COOH), etc.

[0054] The terms "haloalkyl", "haloalkenyl", or "haloalkoxy" refer to alkyl, alkenyl, or alkoxy groups substituted with one or more halogen atoms, wherein alkyl, alkenyl, and alkoxy have the meanings described herein. Examples include, but are not limited to, difluoroethyl (-CH2CHF2,-CF2CH3,-CHFCH2F), trifluoroethyl (-CH2CF3,-CF2CH2F,-CFHCHF2), trifluoromethyl (-CF3), trifluoromethoxy (-OCF3), difluoromethyl (-CHF2), monofluoromethyl (-CH2F), fluorovinyl (-CH=CHF,-CF=CH2), etc.

[0055] The term "alkenyl" refers to a monovalent hydrocarbon group consisting of a straight or branched chain of 2-12 carbon atoms, wherein at least one CC is sp. 2The double bond, wherein the alkenyl group may be independently and optionally replaced by one or more substituents described in this invention, including groups with "trans", "cis" or "E", "Z" orientation, wherein specific examples include, but are not limited to, vinyl (-CH=CH2), propenyl (-CH=CH2CH3), allyl (-CH2CH=CH2), etc.

[0056] The term "alkoxy group" indicates that an alkyl group is attached to the remainder of the molecule by an oxygen atom, wherein the alkyl group has the meaning as described in this invention. Unless otherwise specified, the alkoxy group contains 1-12 carbon atoms. In some embodiments, the alkoxy group contains 1-8 carbon atoms; in other embodiments, the alkoxy group contains 1-6 carbon atoms; in still other embodiments, the alkoxy group contains 1-4 carbon atoms; and in yet another embodiment, the alkoxy group contains 1-3 carbon atoms. The alkoxy group may optionally be substituted by one or more substituents described in this invention.

[0057] Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH3), ethoxy (EtO, -OCH2CH3), 1-propoxy (n-PrO, n-propoxy, -OCH2CH2CH3), 2-propoxy (i-PrO, i-propoxy, -OCH(CH3)2), 1-butoxy (n-BuO, n-butoxy, -OCH2CH2CH2CH3), 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH2CH(CH3)2), 2-butoxy (s-BuO, s-butoxy, -OCH(CH3)CH2CH3), 2-methyl-2- Propoxy (t-BuO, t-butoxy, -OC(CH3)3), 1-pentoxy (n-pentoxy, -OCH2CH2CH2CH2CH3), 2-pentoxy (-OCH(CH3)CH2CH2CH3), 3-pentoxy (-OCH(CH2CH3)2), 2-methyl-2-butoxy (-OC(CH3)2CH2CH3), 3-methyl-2-butoxy (-OCH(CH3)CH(CH3)2), 3-methyl-l-butoxy (-OCH2CH2CH(CH3)2), 2-methyl-l-butoxy (-OCH2CH(CH3)CH2CH3), etc.

[0058] The term "cycloalkyl" refers to a monovalent or polyvalent saturated monocyclic, bicyclic, or tricyclic system containing 3-12 carbon atoms. In one embodiment, the cycloalkyl group comprises 3-12 carbon atoms; in another embodiment, it comprises 3-8 carbon atoms; in yet another embodiment, it comprises 3-7 carbon atoms; and in still some embodiments, it comprises 3-6 carbon atoms. The cycloalkyl group may be independently unsubstituted or substituted by one or more substituents described in this invention.

[0059] The term "heterocyclic group" refers to a non-aromatic, saturated or partially unsaturated, monovalent or polyvalent monocyclic, bicyclic or tricyclic system comprising 3-12 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur or oxygen atoms. The heterocyclic group may optionally be substituted by one or more substituents described in this invention. Unless otherwise stated, the -CH2- group of the heterocyclic group may optionally be replaced by -C(=O)- or -C(=S)-. The sulfur atom of the ring may optionally be oxidized to an S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxide. In some embodiments, the heterocyclic group is a monocyclic heterocyclic group consisting of 5-7 atoms. In some embodiments, the heterocyclic group is a monocyclic heterocyclic group consisting of 5-6 atoms. In some embodiments, the heterocyclic group is a bicyclic heterocyclic group consisting of 7-12 ring atoms. In some embodiments, the heterocyclic group is a bicyclic heterocyclic group consisting of 8-10 ring atoms. In some embodiments, the heterocyclic group is a heterocyclic group composed of 4 atoms, referring to a monocyclic or polyvalent, saturated or partially unsaturated, non-aromatic monocyclic ring containing 4 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur, and oxygen atoms. In other embodiments, the heterocyclic group is a heterocyclic group composed of 5 atoms, referring to a monocyclic or polyvalent, saturated or partially unsaturated, non-aromatic monocyclic ring containing 5 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur, and oxygen atoms. In still other embodiments, the heterocyclic group is a heterocyclic group composed of 6 atoms, referring to a monocyclic or polyvalent, saturated or partially unsaturated, non-aromatic monocyclic ring containing 6 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur, and oxygen atoms.

[0060] Examples of "heterocyclic groups" include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiophenyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxyl, piperazinyl, homopiperazinyl, oxacyclopropyl, azircyclopropyl, azircyclobutyl, oxacyclobutyl, thiohercyclobutyl, homopiperidinyl, azircycloheptyl, oxacycloheptyl, thiohercycloheptyl, oxazheptanyl, diazheptanyl, thioazheptanyl, 2-pyrrolidinyl Linoyl, 3-pyrrololinyl, dihydroindolyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1,3-dioxapentyl, pyrazolinyl, dithiaalkyl, dithiamonyl, dihydrothiophenyl, pyrazolylimidazolinyl, imidazoalkyl, 1,2,3,4-tetrahydroisoquinolinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 3H-indolylquinazinyl and N-pyridylurea. Examples of heterocyclic groups also include 1,1-dioxothiomorpholino, wherein examples of carbon atoms on the ring being substituted by oxy (=O) include, but are not limited to, pyrimidinidone, 1,2,4-thiadiazole-5(4H)-keto, 1,2,4-oxadiazole-5(4H)-keto, 1H-1,2,4-triazole-5(4H)-keto, etc., wherein examples of carbon atoms on the ring being substituted by the =S group include, but are not limited to, 1,2,4-oxadiazole-5(4H)-thionol, 1,3,4-oxadiazole-2(3H)-thionol, etc.

[0061] The terms “heterocyclic alkyl” and “heterocyclic alkylene” are used interchangeably and refer to alkyl groups that have been substituted with heterocyclic groups. Examples of such alkyl groups include, but are not limited to, pyrrole-2-methyl and morpholino-4-methyl.

[0062] The term “heterocyclic alkoxy” refers to an alkoxy group that is substituted with a heterocyclic group, in which the oxygen atom is attached to the rest of the molecule. Examples of such alkoxy groups include, but are not limited to, pyrrole-2-methoxy and piperidine-2-ethoxy.

[0063] The term "heterocyclic alkylamino" refers to an alkylamino group substituted with a heterocyclic group, wherein the nitrogen atom is attached to the rest of the molecule; wherein the heterocyclic group, alkyl group and alkylamino group have the meaning as described in this invention, and examples of such groups include, but are not limited to, 2-morpholinoethylamino.

[0064] The term "heteroatom" refers to one or more O, S, N, P, and Si, including N, S, and P in any oxidation state; primary, secondary, tertiary amines, and quaternary ammonium salts; or forms in which the hydrogen atom on the nitrogen atom in the heterocycle is substituted, for example, N (like N in 3,4-dihydro-2H-pyrrole), NH (like NH in pyrrolidinyl), or NR (like NR' in N-substituted pyrrolidinyl, where R' represents a substituent described in this invention).

[0065] The term "halogen" or "halogen atom" refers to F, Cl, Br, or I.

[0066] The term "unsaturated" as used in this invention means that the portion contains one or more degrees of unsaturation.

[0067] The term "aryl" refers to a monocyclic, bicyclic, or tricyclic carbocyclic system containing 6-14, 6-12, or 6-10 ring atoms, wherein at least one ring system is aromatic, and each ring system comprises a ring of 3-7 atoms and has one or more bonding sites connected to the remainder of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring." Examples of aryl groups may include phenyl, naphthyl, and anthracene. The aryl group may be optionally and independently substituted by one or more substituents described in this invention.

[0068] The term "heteroaryl" refers to a monocyclic, bicyclic, or tricyclic system containing 5-12 ring atoms, wherein at least one ring is an aromatic ring, and at least one aromatic ring contains one or more heteroatoms, wherein each ring system comprises a ring of 5-7 ring atoms, and has one or more connection points attached to the remainder of the molecule. The term "heteroaryl" may be used interchangeably with the terms "aromatic heterocycle," "heteroaromatic ring," or "heteroaromatic compound." In some embodiments, a heteroaryl is a monocyclic heteroaryl comprising 5-7 ring atoms containing 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, a heteroaryl is a monocyclic heteroaryl comprising 5-6 ring atoms containing 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, a heteroaryl is a bicyclic heteroaryl comprising 7-12 ring atoms containing 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl group is a bicyclic heteroaryl group consisting of 8-10 ring atoms comprising 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl group is a bicyclic heteroaryl group consisting of 9-10 ring atoms comprising 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen.

[0069] Examples of heterocyclic aromatic rings include, but are not limited to, the following monocyclic rings: 1,2,4-oxadiazole-5(4H)-thionyl, 1,2,4-thiadiazole-5(4H)-keto, 1,2,4-oxadiazole-5(4H)-keto, 1,3,4-oxadiazole-2(3H)-thionyl, 1H-1,2,4-triazole-5(4H)-keto, 2-furanyl, 3-furanyl, N-imidazolyl, 2-Imidazolyl, 4-Imidazolyl, 5-Imidazolyl, 3-Isooxazolyl, 4-Isooxazolyl, 5-Isooxazolyl, 2-Oxazolyl, 4-Oxazolyl, 5-Oxazolyl, N-Pyrroloyl, 2-Pyrroloyl, 3-Pyrroloyl, 2-Pyridinyl, 3-Pyridinyl, 4-Pyridinyl, 2-Pyrimidinyl, 4-Pyrimidinyl, 5-Pyrimidinyl, Pyridazinyl (e.g., 3-Pyridazinyl), 2-Thiazolyl, 4-Thiazolyl, 5-Thiazolyl Tetraazolyl (e.g., 5-tetraazolyl), triazolyl (e.g., 2-triazolyl and 5-triazolyl), 2-thienyl, 3-thienyl, pyranyl, pyrazolyl (e.g., 2-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiodiazolyl, 1,3,4-thiodiazolyl, 1,2,5-thiodiazolyl Pyrazinyl, 1,3,5-triazinyl, diazolyl, thiadiazolyl, triazinyl, etc.; also includes the following bicyclic compounds, but is by no means limited to these: benzothiazolyl, benzimidazolyl, benzofuranyl, benzothiophene, indolyl (such as 2-indolyl), purinyl, quinolinyl (such as 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), isoquinolinyl (such as 1-isoquinolinyl, 3-isoquinolinyl or 4-isoquinolinyl), etc.

[0070] The term "composed of M-M1 ring atoms" indicates that the cyclic group is composed of M-M1 ring atoms, including carbon atoms and / or heteroatoms such as O, N, S, and P. For example, "heterocyclic group composed of 3-6 ring atoms" means that it is a heterocyclic group composed of 3, 4, 5, or 6 ring atoms.

[0071] The terms “heteroarylalkyl” and “heteroarylalkylene” are used interchangeably to indicate that an alkyl group is replaced by one or more identical or different heteroaryl groups, wherein the alkyl group and the heteroaryl group have the meaning as described in this invention. Examples of such groups include, but are not limited to, pyridine-2-ethyl, thiazol-2-methyl, imidazole-2-ethyl, pyrimidin-2-propyl, etc.

[0072] The terms "aralkyl" and "arylalkyl" are used interchangeably to refer to an aryl-substituted alkyl group, wherein the aryl and alkyl groups have the meanings as described in this invention. In some embodiments, an aralkyl group or arylalkyl group refers to a "lower-order aralkyl" group, i.e., an aryl group attached to a C12C4 group. 1-6On an alkyl group. In other embodiments, an aralkyl group or arylalkyl group refers to an aryl group attached to C. 1-3 On an alkyl group. Specific examples include phenylmethyl (i.e., benzyl), diphenylmethyl, phenethyl, etc.

[0073] The terms "alkylamino" and "alkamino" are used interchangeably, including "N-alkamino" and "N,N-dialkylamino," wherein the hydrogen atom in the amino group is independently replaced by one or two alkyl groups. In some embodiments, the alkamino group is one or two C1-C... 12 An alkyl group is attached to a nitrogen atom to form a lower-order alkylamino group. In other embodiments, the alkylamino group is formed by one or two C1-C6 alkyl groups attached to a nitrogen atom. In other embodiments, the alkylamino group is formed by one or two C1-C4 alkyl groups attached to a nitrogen atom. In still other embodiments, the alkylamino group is formed by one or two C1-C3 alkyl groups attached to a nitrogen atom. Suitable alkylamino groups can be monoalkylamino or dialkylamino, and examples of alkylamino groups include, but are not limited to, N-methylamino, N-ethylamino, N,N-dimethylamino, N,N-diethylamino, N-ethyl-N-propylamino, etc.

[0074] The terms "cycloalkylalkyl" and "cycloalkylalkylene" are used interchangeably to indicate that an alkyl group can be replaced by one or more identical or different cycloalkyl groups, wherein cycloalkyl and alkyl groups have the meanings as described in this invention. Examples of such alkyl groups include, but are not limited to, cyclohexylmethylene, cyclopropylethylene, etc.

[0075] The terms "alkoxyalkyl" and "alkoxyalkylene" are used interchangeably to indicate that an alkyl group can be replaced by one or more identical or different alkoxy groups, wherein the alkoxy and alkyl groups have the meanings as described in this invention. Examples of such groups include, but are not limited to, methoxyethyl, ethoxymethyl, etc.

[0076] As described in this invention, a ring system formed by drawing a bond between a substituent and a central ring (as shown in formula a) represents that the substituent can be substituted at any substituted position on the ring, as shown in formulas b, c, d, e, f, g, and h.

[0077]

[0078] Additionally, it should be noted that, unless otherwise explicitly stated, the descriptive phrases "each and each independently is," "each and each independently is," and "each and each independently is" used throughout this document are interchangeable and should be interpreted broadly. They can mean either that the specific options expressed by the same symbol in different groups do not affect each other, or that the specific options expressed by the same symbol in the same group do not affect each other. For example, as shown in equation p, multiple R... 7 The specific options do not affect each other.

[0079]

[0080] Unless otherwise indicated, the structural formulas described in this invention include all isomers (e.g., enantiomers, diastereomers, and geometric isomers (or conformational isomers): for example, R and S configurations containing an asymmetric center, (Z) and (E) isomers of double bonds, and (Z) and (E) conformational isomers. Therefore, any single stereochemical isomer of the compounds of this invention, or a mixture of its enantiomers, diastereomers, or geometric isomers (or conformational isomers), is within the scope of this invention.

[0081] As used in this invention, the term "prodrug" represents the conversion of a compound into the compound shown in (I) or (Ia) in vivo. Such conversion is influenced by the hydrolysis of the prodrug in the blood or its enzymatic conversion into the parent structure in the blood or tissues. The prodrug compounds of this invention can be esters; among existing inventions, esters that can serve as prodrugs include phenyl esters and aliphatic (C) esters. 1-24Esters, acyloxymethyl esters, carbonates, carbamates, and amino acid esters. For example, one compound in this invention contains a hydroxyl group, meaning it can be acylated to yield a prodrug form. Other prodrug forms include phosphate esters, such as those obtained by phosphorylation of a parent compound with a hydroxyl group. For a complete discussion of prodrugs, please refer to the following literature: T. Higuchi and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the ACSSymposium Series; Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987; J. Rautio et al, Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery, 2008, 7, 255-270; and SJ Hecker et al, Prodrugs of Phosphates and Phosphonates, Journal of Medicinal Chemistry, 2008, 51, 2328-2345.

[0082] Unless otherwise stated, all tautomeristic forms of the compounds of this invention are included within the scope of this invention. Furthermore, unless otherwise stated, the structural formulas of the compounds described in this invention comprise enriched isotopes of one or more different atoms.

[0083] "Metabolic products" refer to the products obtained in vivo through the metabolic processes of a specific compound or its salt. The metabolites of a compound can be identified using techniques known in the art, and their activity can be characterized experimentally as described in this invention. Such products can be obtained by subjecting the compound to oxidation, reduction, hydrolysis, acylation, deacylation, esterification, defatting, enzymatic cleavage, etc. Accordingly, this invention includes the metabolites of compounds, including metabolites produced by sufficiently exposing the compounds of this invention to mammals for a period of time.

[0084] The definitions and conventions of stereochemistry used in this invention are generally referenced in the following literature: S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984), McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of this invention may contain asymmetric or chiral centers, and therefore exist as different stereoisomers. All stereoisomers of the compounds of this invention, including, but not limited to, diastereomers, enantiomers, transisomers, and mixtures thereof, such as racemic mixtures, constitute a part of this invention. Many organic compounds exist in optically active forms, i.e., they are capable of rotating the plane of plane-polarized light. In describing optically active compounds, the prefixes D, L, or R, S are used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l, or (+), (-) are used to name compounds whose plane polarization is rotated. (-) or l indicates the compound is levorotatory, while (+) or d indicates it is dextrorotatory. These stereoisomers have the same chemical structure, but their stereostructures differ. Specific stereoisomers can be enantiomers, and mixtures of isomers are usually called enantiomeric mixtures. A 50:50 enantiomeric mixture is called a racemic mixture or racemate, which may result in a lack of stereoselectivity or stereodirection during chemical reactions. The terms "racemic mixture" and "racemate" refer to a mixture of two equimolar enantiomers that lack optical activity.

[0085] The terms "tautomer" or "tautomer form" refer to isomers of different energies that can interconvert through a low energy barrier. For example, proton tautomers (i.e., proton-transfer tautomers) include interconversions via proton migration, such as isomerization between keto-enol and imine-enamine forms. Valence tautomers include interconversions involving the recombination of bonding electrons. Unless otherwise stated, all tautomer forms of the compounds of this invention are within the scope of this invention.

[0086] The term "pharmaceutically acceptable salt" as used in this invention refers to the organic and inorganic salts of the compounds of this invention. Pharmaceutically acceptable salts are well-known in the field, as described in the literature: SMBerge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19, 1977. Salts formed from pharmaceutically acceptable non-toxic acids include, but are not limited to, inorganic acid salts formed by reactions with amino groups, such as hydrochlorides, hydrobromic acids, phosphates, sulfates, perchlorates, and organic acid salts such as acetates, oxalates, maleates, tartrates, citrates, succinates, malonates, or salts obtained by other methods described in the literature, such as ion exchange. Other pharmaceutically acceptable salts include adipate, malate, 2-hydroxypropionate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentylpropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, transbutenedioic acid, glucono-heptahydrate, glycerophosphate, gluconate, hemisulfate, heptahydrate, hexanoate, hydroiodate, 2-hydroxy-ethanesulfonate, lacturonate, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pyruvate, pectinate, persulfate, 3-phenylpropionate, picrate, pentanoate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Salts obtained by means of appropriate bases include alkali metals, alkaline earth metals, ammonium, and nitrogen. + (C 1-4 Salts of alkyl groups (4). This invention also contemplates quaternary ammonium salts formed from any compound containing an N group. Water-soluble or oil-soluble or dispersed products can be obtained by quaternization. Alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts, and amine cations that resist the formation of equilibrium ions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C... 1-8 Sulfonates and aromatic sulfonates.

[0087] In this invention, "solvent" refers to an association formed by one or more solvent molecules and the compound of this invention. Solvents forming solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association formed by solvent molecules that are water.

[0088] The term "protecting group" or "Pg" refers to a substituent that, when reacting with other functional groups, is typically used to block or protect specific functionalities. For example, a "protecting group for an amino group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in a compound. Suitable amino protecting groups include acetyl, trifluoroacetyl, tert-butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ), and 9-fluorenemethoxycarbonyl (Fmoc). Similarly, a "hydroxyl protecting group" refers to a substituent of a hydroxyl group used to block or protect its functionality; suitable protecting groups include acetyl and silyl. A "carboxyl protecting group" refers to a substituent of a carboxyl group used to block or protect its functionality. Common carboxyl protecting groups include -CH2CH2SO2Ph, cyanoethyl, 2-(trimethylsilyl)ethyl, 2-(trimethylsilyl)ethoxymethyl, 2-(p-toluenesulfonyl)ethyl, 2-(p-nitrobenzenesulfonyl)ethyl, 2-(diphenylphosphine)ethyl, nitroethyl, and so on. For a general description of protecting groups, please refer to: T W. Greene, Protective Groups in Organic Synthesis, John Wiley & Sons, New York, 1991; and PJ Kocienski, Protecting Groups, Thieme, Stuttgart, 2005.

[0089] Description of the compounds of the present invention

[0090] The compounds involved in this invention, and their pharmaceutically acceptable compositions, can effectively inhibit HBV infection.

[0091] On one hand, the present invention relates to a compound of formula (I) or (Ia) or a stereoisomer, tautomer, nitride, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof.

[0092]

[0093] Among them, each R 1 R 1b and R 1a Independently, it is hydrogen, deuterium, F, Cl, Br, I, cyano, methyl, ethyl, methoxy, ethoxy, methylamino, ethylamino, nitro, 4-trifluoromethylphenyl, 3,5-di(trifluoromethyl)phenyl or trifluoromethyl;

[0094] R 2 C 1-6 Alkyl or C 1-6 Halogenated alkyl groups;

[0095] R3 The phenyl, imidazolyl, thiophene, furanyl, or thiazolyl groups are used, wherein each of the phenyl, imidazolyl, thiophene, furanyl, and thiazolyl groups is independently unsubstituted or is replaced by 1, 2, 3, 4, or 5 groups selected from deuterium, F, Cl, Br, OH, CN, and C. 1-6 Alkyl, hydroxyl C 1-6 Alkyl, C 1-6 Alkyl-OC(=O)-, C 1-6 Alkyl-OC(=O)-C 1-6 Alkylene, HOOC-C 1-6 Alkylene, C 1-6 Alkoxy-C 1-6 Alkylene and C 1-6 Substituents of alkyl-S(=O)2-;

[0096] W is either CH or N;

[0097] X 1 -C(=O)-, -S(=O)2-, or -(CR) 5 R 6 ) j -;

[0098] Each R 5 and R 6 Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, hydroxyl-C 1-6 Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0099] R is a substructure of the following:

[0100]

[0101] Each R 4a R 4b R 4c R 4d R 5a R 5b R 5c R 6a R 7a R 8a R 8b and R 9a Independently, it can be hydrogen, deuterium, F, Cl, Br, (OH)₂B⁻, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, hydroxyl-C 1-6Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0102] Each R 7 R a and R b Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, or C. 1-6 Alkyl, NH2C(=O)-, C 1-6 Alkyl-OC(=O)-, carboxyl group, carboxyl group C 1-6 Alkylene, hydroxyl C 1-6 Alkyl, C 1-4 Alkoxy C 1-4 Alkylene or C 1-6 Halogenated alkyl groups;

[0103] m can be 0, 1, 2, 3, or 4;

[0104] j can be 1, 2, or 3.

[0105] In some embodiments, the R described in this invention 2 It can be methyl, ethyl, n-propyl, isopropyl, monofluoromethyl, difluoromethyl, or trifluoromethyl;

[0106] R 3 The radical is α-, imidazole, thiophene, furanyl, or thiazolyl, wherein each of the α-, imidazole, thiophene, furanyl, or thiazolyl groups is independently unsubstituted or substituted by 1, 2, 3, 4, or 5 groups selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, tert-butyl, hydroxyl, C. 1-4 Alkyl, C 1-4 Alkyl-OC(=O)-, C 1-4 Alkyl-OC(=O)-C 1-3 Alkylene-, HOOC-C 1-3 Alkylene-, C 1-4 Alkoxy-C 1-3 Alkylene- and C 1-4 Substituents of alkyl-S(=O)2-.

[0107] In some embodiments, the Rs described in this invention 5 and R 6 Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, hydroxyl-C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups;

[0108] Each R 7 R a and R b Independently, it can be hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, carboxyl group, carboxyl group C 1-4 Alkylene, hydroxyl C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups.

[0109] In some embodiments, the Rs described in this invention 4a R 4b R 4c R 4d R 5a R 5b R 5c R 6a R 7a R 8a R 8b and R 9a Independently, it can be hydrogen, deuterium, F, Cl, Br, (OH)₂B⁻, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(=O)⁻, C 1-4 Alkyl-OC(=O)-, hydroxyl-C 1-4 Alkyl, C 1-4 Alkoxy C 1-2 Alkylene or C 1-4 Halogenated alkyl groups.

[0110] In some embodiments, the compounds of the present invention have one of the following structures, or stereoisomers, tautomers, nitrides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof.

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound described herein and pharmaceutically acceptable excipients.

[0124] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0125] In some embodiments, the pharmaceutical composition of the present invention includes, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

[0126] In some embodiments, the pharmaceutical composition of the present invention, wherein the other anti-HBV drugs are lamivudine, telbivudine, tenofovir disoproxil fumarate, entecavir, adefovir disoproxil fumarate, alfaferone, alloferon, simvastatin, clavudine, emtricitabine, faprovir, interferon, bacalanol CP, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mirtovalidone, nitrozonide, pegylated interferon α-2a, ribavirin, roximate, cizonan, eufovac, amplivir, phosphazid, heplisav, interferon α-2b, levamisole, or propanthenium.

[0127] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for the prevention, treatment or relief of viral diseases in patients.

[0128] In some embodiments, the use described in this invention refers to the viral disease as hepatitis B infection or a disease caused by hepatitis B infection.

[0129] In some other embodiments, the uses described in this invention refer to diseases caused by hepatitis B infection as cirrhosis or hepatocellular carcinoma.

[0130] On the other hand, the compounds or pharmaceutical compositions described in this invention are used to prepare remedies for the prevention, treatment, or relief of viral diseases in patients.

[0131] In some embodiments, the use of the compound or pharmaceutical composition of the present invention, wherein the viral disease refers to hepatitis B infection or a disease caused by hepatitis B infection.

[0132] In other embodiments, the use of the compound or pharmaceutical composition of the present invention, wherein the disease caused by the hepatitis B infection refers to cirrhosis or hepatocellular carcinoma.

[0133] On the other hand, the present invention relates to methods for preventing, treating or alleviating viral diseases in patients, wherein the methods comprise administering medication to the patient in a pharmaceutically acceptable and effective dose of a compound or pharmaceutical composition of the present invention.

[0134] In some embodiments, the method of the present invention refers to the viral disease as hepatitis B infection or a disease caused by hepatitis B infection.

[0135] In some other embodiments, the method of the present invention refers to the disease caused by hepatitis B infection as cirrhosis or hepatocellular carcinoma.

[0136] On the other hand, the present invention relates to the use of the aforementioned compound or pharmaceutical composition in the preparation of a medicine for the prevention, treatment or relief of hepatitis B in patients.

[0137] Another aspect of the present invention relates to a method for preventing, treating, or alleviating HBV symptoms in a patient, the method comprising administering medication to the patient in a pharmaceutically acceptable and effective dose of a compound of the present invention.

[0138] Another aspect of the present invention relates to a method for preventing, treating, or alleviating HBV symptoms in a patient, the method comprising administering medication to the patient in a pharmaceutically acceptable and effective dose of a pharmaceutical composition containing a compound of the present invention.

[0139] Another aspect of the present invention relates to the use of a compound of the present invention to produce a medicament for the prevention or treatment of HBV symptoms in patients and to reduce the severity of these symptoms.

[0140] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compounds of the present invention to produce a medicine for the prevention or treatment of HBV symptoms in patients and to reduce the severity of those symptoms.

[0141] In some embodiments, the patient is a mammal; in others, the patient is a human. Still other embodiments further include contact between cells and an anti-HBV therapeutic agent.

[0142] Another aspect of the present invention relates to a method for inhibiting HBV infection, the method comprising contacting cells with a dose of the compound or pharmaceutical composition of the present invention capable of effectively inhibiting HBV. In some further embodiments, the method further comprises contacting the cells with other anti-HBV therapeutic agents.

[0143] Another aspect of the present invention relates to a treatment method for HBV disease in patients, the method comprising administering an effective therapeutic dose of the compound of the present invention or a pharmaceutical composition thereof to a patient requiring treatment.

[0144] Other implementations include the method further comprising administering an effective therapeutic dose of another anti-HBV therapeutic agent to a patient requiring treatment.

[0145] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient requiring treatment. In some further embodiments, the method further comprises administering an effective therapeutic dose of another anti-HBV therapeutic agent to a patient requiring treatment.

[0146] Another aspect of the present invention relates to methods for the preparation, separation and purification of compounds contained in formula (I) or formula (Ia).

[0147] This invention also relates to the use of the compounds of this invention and their pharmaceutically acceptable salts in the production of pharmaceutical products to effectively inhibit HBV infection, and the use of the compounds of this invention in the production of medicaments for effectively inhibiting HBV infection. The compounds of this invention are also used in the production of a pharmaceutical product to alleviate, prevent, control, or treat symptoms of hepatitis B in patients.

[0148] Unless otherwise indicated, all stereoisomers, geometric isomers, tautomers, nitrides, hydrates, solvates, metabolites, pharmaceutically acceptable salts, and prodrugs of the compounds of this invention are within the scope of this invention.

[0149] Specifically, the salt is a pharmaceutically acceptable salt. The term "pharmaceutically acceptable" means that the substance or composition must be chemically or toxicologically appropriate in relation to the other components of the formulation and the mammal intended for treatment.

[0150] The salts of the compounds of the present invention also include salts for the preparation or purification of intermediates of the compounds of formula (I) or (Ia) or for the isolation of enantiomers of the compounds of formula (I) or (Ia), but are not necessarily pharmaceutically acceptable salts.

[0151] If the compound of the present invention is basic, the desired salt can be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, etc. Alternatively, organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid, and salicylic acid; pyranonic acids such as glucuronic acid and galacturonic acid; α-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoromethanesulfonic acid, etc., or combinations thereof, can be used.

[0152] If the compounds of the present invention are acidic, the desired salts can be prepared by suitable methods, such as using inorganic or organic bases, such as ammonia (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N2, etc. + (R 14 Salts of 4 and alkaline earth metal hydroxides, etc. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, such as primary, secondary, and tertiary ammonia, N... + (R 14 )4 salts, such as R 14 It is H, C 1-4 Alkyl, C 6-10 Aryl, C 6-10 Aryl C 1-4 Alkyl groups, and cyclic amines such as piperidine, morpholine, and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium salts, quaternary ammonium salts, and amine cations that resist the formation of equilibrium ions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, and C. 1-8 Sulfonates and aromatic sulfonates.

[0153] Pharmaceutical compositions, formulations, administration, and uses of the compounds and pharmaceutical compositions of the present invention.

[0154] According to another aspect, the pharmaceutical compositions of the present invention are characterized by comprising compounds of formula (I) or (Ia), compounds listed in the present invention, or compounds of the examples, and pharmaceutically acceptable excipients. The compounds in the compositions of the present invention are effective in inhibiting hepatitis B virus and are suitable for the treatment of viral diseases, especially acute and chronic persistent HBV infection. Chronic HBV-induced viral diseases can lead to severe pathological changes, and chronic hepatitis B virus infection can lead to cirrhosis and / or hepatocellular carcinoma in many cases.

[0155] For the compounds of the present invention, the areas of disease treatment that may be mentioned include, for example, the treatment of acute and chronic viral infections that may lead to infectious hepatitis, such as hepatitis B virus infection. The compounds of the present invention are particularly suitable for treating chronic hepatitis B infection and acute and chronic hepatitis B virus infection.

[0156] The present invention includes pharmaceutical preparations containing, in addition to non-toxic, inert, pharmaceutically suitable excipients, one or more of the compounds of formula (I) or (Ia) of the present invention or pharmaceutical compositions thereof, or containing one or more active ingredients of the compounds of formula (I) or (Ia) of the present invention or pharmaceutical compositions thereof.

[0157] The above-mentioned pharmaceutical preparations may also contain other active pharmaceutical ingredients besides compounds of formula (I) or (Ia).

[0158] The compounds of the present invention exist in free form or as suitable, pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adducts or derivatives that can be administered directly or indirectly as needed by a patient, compounds described in other aspects of the present invention, their metabolites, or their residues.

[0159] As described in this invention, the pharmaceutical compositions of this invention comprise any of the compounds shown in formula (I) or (Ia) of this invention, further comprising pharmaceutically acceptable excipients, such as those used in this invention, including any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersant, flavoring agent or suspending agent, surfactant, isotonic agent, thickener, emulsifier, preservative, solid binder or lubricant, etc., suitable for a particular target dosage form. As described in the following literature: In Remington: The Science and Practice of Pharmacy, 21st edition, 2005, ed. D.B. Troy, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J.C. Boylan, 1988-1999, Marcel Dekker, New York, the contents of which are summarized herein demonstrate that various excipients can be used in the formulation of pharmaceutically acceptable compositions and their known methods of preparation. Except for any conventional excipients that are incompatible with the compounds of the present invention, such as any adverse biological effects produced or interactions with any other component of a pharmaceutically acceptable composition that occur in a harmful manner, their use is also within the scope of this invention.

[0160] Substances that can be used as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffering substances such as phosphates; glycine; sorbic acid; potassium sorbate; mixtures of partial glycerides of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; polyacrylates; waxes; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as carboxymethyl cellulose. Sodium cellulose, ethyl cellulose, and cellulose acetate; gum powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salts; Ringer's solution; ethanol; phosphate buffer solutions; and other non-toxic and suitable lubricants such as sodium lauryl sulfate and magnesium stearate; colorants; release agents; coatings; sweeteners; flavorings; fragrances; preservatives and antioxidants.

[0161] The pharmaceutical compositions of the compounds of the present invention can be administered in any of the following ways: oral administration, inhalation via aerosol, local administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intrasternal, or intracranial injection or infusion, or administration via an external reservoir. Preferred methods are oral administration, intramuscular injection, intraperitoneal administration, or intravenous injection.

[0162] The compounds or pharmaceutical compositions thereof of this invention can be administered in unit doses. The dosage form can be a liquid or a solid. Liquid dosage forms can be true solutions, colloids, microparticles, or suspensions. Other dosage forms include tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, suppositories, lyophilized powders for injection, inclusion complexes, implants, patches, and liniments.

[0163] Oral tablets and capsules may contain excipients such as binders, like syrup, gum arabic, sorbitol, astragalus gum, or polyvinylpyrrolidone; fillers such as lactose, sucrose, corn starch, calcium phosphate, sorbitol, or glycine; lubricants such as magnesium stearate, talc, polyethylene glycol, or silica; disintegrants such as potato starch; or acceptable wetting agents such as sodium lauryl sulfate. Tablets may be coated using pharmaceutically known methods.

[0164] Oral liquids can be formulated as hydrated oil suspensions, solutions, emulsions, syrups, or elixirs, or as dry products to be replenished with water or other suitable media before use. These liquid formulations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelling agents, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, hydrogenated edible oils, emulsifiers such as lecithin, sorbitan monooleate, and gum arabic; or non-aqueous excipients (which may contain edible oils such as almond oil), fats such as glycerin, ethylene glycol, or ethanol; preservatives such as methylparaben or propylparaben, and sorbic acid. Flavorings or colorings may be added if desired.

[0165] Suppositories may contain a conventional suppository base, such as cocoa butter or other glycerides.

[0166] When applied topically to the skin, the compounds of the present invention can be formulated into suitable ointments, lotions, or creams, wherein the active ingredient is suspended or dissolved in one or more excipients. Excipients that may be used in ointment formulations include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax, and water. Excipients that may be used in lotions and creams include, but are not limited to, mineral oil, sorbitan monostearate, Tween 60, hexadecyl ester wax, hexadecene aromatic alcohol, 2-octyldodecyl alcohol, benzyl alcohol, and water.

[0167] Generally, it has been proven advantageous, in both human and veterinary medicine, that the total dosage of the active compound of the present invention is about 0.5-500 mg per 24 hours, preferably 1-100 mg / kg body weight, administered in multiple single doses if appropriate, to achieve the desired effect. The amount of active compound in a single dose is preferably about 1-80 mg, more preferably 1-50 mg / kg body weight, but may not follow the above dosages, depending on the type and weight of the patient, the nature and severity of the disease, the type of formulation and the route of administration, and the dosing cycle or time interval.

[0168] The pharmaceutical composition provided by this invention further comprises an anti-HBV drug. The anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, or interferon.

[0169] The anti-HBV drugs mentioned include lamivudine, telbivudine, tenofovir disoproxil fumarate, entecavir, adefovir disoproxil fumarate, alfaferone, alloferon, simmointerleukin, clavudine, emtricitabine, faprovir, interferon, bacalanol CP, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mirtovalidone, nitrozonide, pegylated interferon α-2a, ribavirin, roximate, cizonan, eufovac, amprigin, phosphazid, heplisav, interferon α-2b, levamisole, or propafenone, etc.

[0170] Another aspect of this invention relates to the use of a compound or pharmaceutical composition of the invention in the preparation of a medicament for the prevention, treatment, or relief of hepatitis B disease in a patient, including administering the medication to the patient in a pharmaceutically acceptable and effective dose. Hepatitis B disease refers to liver disease caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, cirrhosis, and hepatitis B stem cell carcinoma. Acute hepatitis B virus infection can be asymptomatic or present with symptoms of acute hepatitis. Patients with chronic viral infection have active disease that can develop into cirrhosis and hepatitis B cancer.

[0171] Anti-HBV drugs can be administered separately from compositions containing compounds of the present invention as part of a multiple-dose regimen. Alternatively, those drugs can be part of a single-dose formulation, mixed with compounds of the present invention to form a single composition. If administration is part of a multiple-dose regimen, the two active agents can be delivered simultaneously and continuously or over a period of time to achieve the target agent activity.

[0172] The amount of compounds and compositions that can be combined with excipients to produce single-dose formulations (those comprising a single composition as described in this invention) varies depending on the indication and specific dosing regimen. Normally, the amount of the compositions of this invention will not exceed the amount in a normal dosing where the composition contains the sole active agent. On the other hand, the amounts of the compositions disclosed herein range from approximately 50% to 100% of the normal amounts in existing compositions, containing the agent as the sole active therapeutic agent. In those compositions, the composition will act synergistically with the compounds of this invention.

[0173] The compounds of this invention exhibit potent antiviral activity. These compounds possess unexpected antiviral activity against HBV, making them suitable for treating various viral diseases, particularly those caused by acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity; chronic hepatitis B virus infection is well known to cause cirrhosis and / or hepatocellular carcinoma.

[0174] Examples of indications for treatment with the compounds of the present invention include acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis B virus infection. Chronic hepatitis B infection and acute hepatitis B virus infection are particularly preferred.

[0175] This invention also relates to the use of the compounds and pharmaceutical compositions of this invention in the preparation of medicaments for the treatment and prevention of viral diseases, particularly hepatitis B.

[0176] General synthesis methods

[0177] Generally, the compounds of the present invention can be prepared by the methods described herein, unless otherwise specified, wherein the substituents are defined as shown in formula (I) or (Ia). The following synthetic schemes and examples are provided to further illustrate the content of the present invention.

[0178] Those skilled in the art will recognize that the chemical reactions described in this invention can be suitably used to prepare many other compounds of this invention, and that other methods for preparing the compounds of this invention are considered to be within the scope of this invention. For example, the synthesis of those non-illustrative compounds according to this invention can be successfully accomplished by those skilled in the art through modification methods, such as by appropriately protecting interfering groups, by utilizing other known reagents besides those described in this invention, or by making some conventional modifications to the reaction conditions. Furthermore, the reactions disclosed in this invention or the known reaction conditions are also generally accepted to be applicable to the preparation of other compounds of this invention.

[0179] In the examples described below, all temperatures are specified in degrees Celsius (°C) unless otherwise stated. Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company, and Alfa Chemical Company, and were used without further purification unless otherwise stated. Common reagents were purchased from Shantou Xilong Chemical Plant, Guangdong Guanghua Chemical Reagent Plant, Guangzhou Chemical Reagent Plant, Tianjin Haoyuyu Chemical Co., Ltd., Qingdao Tenglong Chemical Reagent Co., Ltd., and Qingdao Haiyang Chemical Plant.

[0180] Silica gel columns were used, and the silica gel (200-300 mesh) was purchased from Qingdao Ocean Chemical Plant. Nuclear magnetic resonance spectroscopy used CDCl3, DMSO-d6, CD3OD, or acetone-d6 as solvents (reported in ppm), with TMS (0 ppm) or chloroform (7.25 ppm) as reference standards. When multiplets are observed, the following abbreviations will be used: s (singlet), d (doublet), t (triplet), m (multiplet), br (broadened), dd (doublet of doublets), dt (doublet of triplets), br.s (broadened singlet). The coupling constant J is expressed in Hertz (Hz).

[0181] Low-resolution mass spectrometry (MS) data were determined using an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature maintained at 30°C). A G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was used in the LC-MS spectrometer.

[0182] Low-resolution mass spectrometry (MS) data were also determined using an Agilent 6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30°C). A G1329A autosampler and a G1315D DAD detector were used for analysis, and an ESI source was used in the LC-MS spectrometer.

[0183] Both spectrometers were equipped with an Agilent Zorbax SB-C18 column, 2.1 × 30 mm, 5 μm. Injection volume was determined by sample concentration; flow rate was 0.6 mL / min; HPLC peak values ​​were recorded and read using UV-Vis wavelengths at 210 nm and 254 nm. The mobile phase consisted of 0.1% formic acid-acetonitrile solution (phase A) and 0.1% formic acid ultrapure aqueous solution (phase B). Gradient elution conditions are shown in Table 1.

[0184] Table 1: Gradient elution conditions

[0185] Time (min) <![CDATA[A(CH3CN,0.1%HCOOH)]]> <![CDATA[B(H2O,0.1%HCOOH)]]> 0-3 5-100 95-0 3-6 100 0 6-6.1 100-5 0-95 6.1-8 5 95

[0186] Compound purification was evaluated using an Agilent 1100 series high-performance liquid chromatography (HPLC) system with UV detection at 210 nm and 254 nm, a Zorbax SB-C18 column (2.1 × 30 mm, 4 μm), a flow rate of 0.6 mL / min for 10 min, and a concentration of 5-95% (0.1% formic acid acetonitrile solution) or (0.1% formic acid aqueous solution) at a column temperature of 40 °C.

[0187] The following abbreviations are used throughout this invention:

[0188] MeOH, methanol, EtOAc, EA, ethyl acetate

[0189] MeOH-d4 Deuterated methanol EtOH Ethanol

[0190] DCM, CH2Cl2, dichloromethane, Et3N, TEA, triethylamine

[0191] tBu XPhos 2-Di-tert-butylphosphino-2',4',6'-triisopropylbiphenyl mL, ml

[0192] TFA (trifluoroacetic acid) RT,rt room temperature

[0193] (dppf)PdCl2 [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride Rt Retention time

[0194] (dppf)PdCl2·CH2Cl2 [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride dichloromethane complex 1 atm 101.325 kPa

[0195] X-PHOS,X-Phos,t-BuX-PHOS 2-Dicyclohexylphosphine-2,4,6-triisopropylbiphenyl h hours

[0196] Xantphos 4,5-bis(diphenylphosphine-9,9-dimethyloxanthracene) DMF, N,N-dimethylformamide

[0197] Boc tert-butyloxycarbonyl THF tetrahydrofuran

[0198] (Boc)₂O ditert-butyl dicarbonate DMSO dimethyl sulfoxide

[0199] Pd2(dba)3 tris(dibenzylacetone)dipalladiumAc2O acetic anhydride

[0200] PE petroleum ether

[0201] Synthesis method

[0202] The following synthetic scheme outlines the experimental steps for preparing the compounds disclosed in this invention. Wherein, each R... 1 R 2 R 3 R 1a R 1b R 4a R 4b R 4c R 4d R 7 "and m" have the meanings as described in this invention.

[0203] Synthesis Scheme 1

[0204]

[0205] Compound (b-6) can be prepared by the method described in Synthesis Scheme 1. First, compound (b-1) reacts with compound (a-3) under alkaline conditions (e.g., cesium carbonate), a catalyst (e.g., palladium acetate), a ligand (e.g., X-PHOS, t-BuX-PHOS), and a suitable solvent (e.g., 1,4-dioxane) to generate compound (b-2). Next, compound (b-2) reacts with pinacol diboronate under a catalyst (e.g., (dppf)PdCl2·CH2Cl2) and alkaline conditions (e.g., potassium acetate) to generate compound (b-3). Compound (b-3) is hydrolyzed under alkaline conditions (e.g., ammonium acetate, NaIO4) to give compound (b-4). Compound (b-4) loses Boc to give compound (b-5). Finally, compound (b-5) or its salt (e.g., trifluoroacetic acid or hydrochloride) reacts with compound (a-7) under alkaline conditions (e.g., potassium carbonate) and a suitable solvent (e.g., ethanol) to give the target compound (b-6). Detailed Implementation

[0206] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0207] Preparation Examples

[0208] In the following preparation examples, the inventors have described in detail the preparation process of the compounds of the present invention using some of the compounds of the present invention as examples.

[0209] Synthesis of F1 fragment:

[0210]

[0211] F1-1 Synthesis:

[0212] In a dry reaction flask, (R)-3-oxohexahydroimidazole[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester (2 g, 8.3 mmol), F3-0 (2.8 g, 9.9 mmol), Pd2(dba)3 (0.39 g, 0.42 mmol), Xantphos (0.61 g, 1.0 mmol), cesium carbonate (5.7 g, 17 mmol), and 1,4-dioxane (50 mL) were added sequentially. The reaction was carried out at 90°C for 6 h under nitrogen protection. The mixture was then filtered with diatomaceous earth, and the filter cake was washed with dichloromethane (200 mL). The filtrate was evaporated to dryness to obtain the crude product. Ethanol (50 mL) was added, and the mixture was stirred at room temperature for 1 h. After filtration, the title compound was obtained as a gray solid (3 g, 91%). MS (ESI, pos.ion) m / z: 340.0 [M+H-56] + .

[0213] F1-2 Synthesis:

[0214] In a dry reaction flask, F1-1 (0.5 g, 1 mmol), pinacol diboronate (0.64 g, 2.5 mmol), (dppf)PdCl2·CH2Cl2 (0.1 g, 0.1 mmol), KOAc (0.25 g, 2.5 mmol), and 1,4-dioxane (20 mL) were added sequentially. The mixture was stirred at 90°C for 10 h under nitrogen protection. The solvent was removed by vacuum distillation, and the residue was purified by silica gel column chromatography (PE / EA (V / V) = 5 / 1) to give the title compound as a white solid (0.48 g, 86%). MS (ESI, pos.ion) m / z: 388.2 [M+H-56] + .

[0215] F1-3 Synthesis:

[0216] F1-2 (0.28 g, 0.63 mmol) and THF (20 mL) were added sequentially to a dry reaction flask. After stirring at room temperature, CH3COONH4 aqueous solution (12 mL, 2 mmol, 0.2 mol / L) and NaIO4 (0.27 g, 1.3 mmol) were added. The reaction mixture was stirred at room temperature for 12 h. The solvent was removed by vacuum distillation, and the residue was diluted with EA (100 mL). The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the solvent was removed by vacuum distillation. The residue was purified by silica gel column chromatography (DCM / CH3OH (V / V = 50 / 1)) to give the title compound as a brown solid (0.11 g, 48%). MS (ESI, pos.ion) m / z: 306.2 [M+H-56] + .

[0217] F1 Synthesis:

[0218] F1-3 (0.11 g, 0.30 mmol) and DCM (3 mL) were added sequentially to a dry reaction flask. After complete dissolution by stirring at room temperature, TFA (3 mL) was added, and the mixture was stirred at room temperature for 3 h. The solvent was removed by vacuum distillation to obtain the title compound as a brown solid (0.11 g, 96%). MS (ESI, pos.ion) m / z: 262.2 [M+H] + .

[0219] Synthesis of Example 1:

[0220]

[0221] In a dry reaction flask, (R)-6-(bromomethyl)-4-(2-chloro-4-fluorophenyl)-2-(thiazolyl-2-yl)-1,4-dihydropyrimidin-5-carboxylic acid methyl (0.17 g, 0.38 mmol), F1 (0.11 g, 0.29 mmol), K2CO3 (0.12 g, 0.87 mmol), and ethanol (10 mL) were added sequentially, and the mixture was stirred at room temperature for 12 h. The solvent was removed by vacuum distillation, and the crude product was purified by silica gel column chromatography (DCM / CH3OH(V / V) = 50 / 1) to give a yellow solid (40 mg, 22%). 1 H NMR (400MHz, DMSO-d6) δ (ppm): 9.72 (s, 1H), 8.05 (d, J = 3.1Hz, 1H), 7.96 (d, J = 3.0H z,1H),7.88(s,2H),7.75(d,J=8.4Hz,2H),7.53(d,J=8.5Hz,2H),7.47–7.38(m,2H) ,7.23–7.14(m,1H),6.06(s,1H),4.06–3.79(m,5H),3.51-3.49(m,4H),3.07(t,J=1 1.2Hz, 1H), 2.94 (d, J = 10.8Hz, 2H), 2.31 (t, J = 10.1Hz, 1H), 2.15 (t, J = 10.7Hz, 1H).

[0222] Synthesis of Example 2

[0223]

[0224] Ethyl (R)-4-(2-bromo-4-fluorophenyl)-6-(bromomethyl)-2-(thiazo-2-yl)-1,4-dihydropyrimidine-5-carboxylate (0.15 g, 0.3 mmol), F1 (0.11 g, 0.3 mmol), potassium carbonate (0.14 g, 1.0 mmol), and ethanol (8 mL) were added sequentially to a dry reaction flask, and the mixture was stirred at room temperature for 12 h. The solvent was removed under reduced pressure, and ethyl acetate (30 mL) and water (20 mL) were added to the residue. The mixture was extracted and separated into layers. The organic layer was washed once with saturated brine (30 mL), and then the solvent was removed under reduced pressure. The crude product was purified by silica gel column chromatography (DCM / CH3OH (V / V) = 50 / 1) to give a yellow solid (96 mg, 47%). MS (ESI, pos.ion) m / z: 683.1 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ (ppm): 9.68 (s, 1H), 8.04 (d, J = 3.1Hz, 1H), 7.95 (d, J = 3.0Hz, 1H ),7.89(s,2H),7.75(d,J=7.5Hz,2H),7.59–7.50(m,3H),7.46–7.38(m,1H),7.27–7.19 (m,1H),6.05(s,1H),4.04–3.82(m,7H),3.49(d,J=5.4Hz,1H),3.07(t,J=10.8Hz,1H), 2.95(d,J=9.1Hz,2H),2.36–2.24(m,1H),2.15(t,J=9.9Hz,1H),1.05(t,J=7.1Hz,3H).

[0225] Synthesis of Example 3

[0226]

[0227] Methyl (R)-4-(2-bromo-4-fluorophenyl)-6-(bromomethyl)-2-(thiazo-2-yl)-1,4-dihydropyrimidine-5-carboxylate (0.26 g, 0.53 mmol), F1 (0.18 g, 0.47 mmol), potassium carbonate (0.22 g, 1.59 mmol), and ethanol (8 mL) were added sequentially to a dry reaction flask, and the mixture was stirred at room temperature for 12 h. The solvent was removed by vacuum distillation, and the crude product was purified by silica gel column chromatography (DCM / CH3OH (V / V) = 50 / 1) to give a yellow solid (142 mg, 45.1%). MS (ESI, pos.ion) m / z: 669.2 [M+H] + ; 1H NMR (400MHz, DMSO-d6) δ (ppm): 9.73 (s, 1H), 8.04 (d, J = 3.1Hz, 1H), 7.96 (d, J = 3.1Hz, 1H), 7.89 (s, 2H) ,7.75(d,J=8.4Hz,2H),7.57(dd,J=8.5,2.5Hz,1H),7.53(d,J=8.5Hz,2H),7.40(dd,J=8.6,6.2Hz,1H) ,7.23(td,J=8.4,2.5Hz,1H),6.03(s,1H),4.03–3.94(m,2H),3.93–3.82(m,3H),3.52(s,3H),3.50–3 .46(m,1H),3.07(t,J=11.1Hz,1H),2.94(d,J=10.8Hz,2H),2.36–2.26(m,1H),2.16(t,J=10.8Hz,1H).

[0228] Synthesis of Example 4

[0229]

[0230] Ethyl (R)-6-(bromomethyl)-4-(2-chloro-4-fluorophenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidin-5-carboxylate (0.12 g, 0.26 mmol), F1 (0.09 g, 0.24 mmol), potassium carbonate (0.18 g, 1.3 mmol), and ethanol (8 mL) were added sequentially to a dry reaction flask, and the mixture was stirred at room temperature for 12 h. The solvent was removed under reduced pressure, and ethyl acetate (30 mL) and water (20 mL) were added to the residue. Extraction and separation were performed, and the organic layer was washed once with saturated brine (30 mL). The solvent was removed from the organic layer under reduced pressure. The crude product was purified by silica gel column chromatography (DCM / CH3OH (V / V) = 50 / 1) to give a yellow solid (112 mg, 67%). MS (ESI, pos.ion) m / z: 639.1 [M+H] + ; 1H NMR (400MHz, DMSO-d6) δ (ppm): 9.68 (s, 1H), 8.04 (d, J = 3.1Hz, 1H), 7.95 (d, J = 3.0Hz, 1H) ,7.89(s,2H),7.75(d,J=8.5Hz,2H),7.53(d,J=8.6Hz,2H),7.47–7.39(m,2H),7.19(td,J =8.5,2.5Hz,1H),6.07(s,1H),4.04–3.83(m,7H),3.53–3.45(m,1H),3.07(t,J=11.2Hz, 1H),3.00–2.87(m,2H),2.35–2.25(m,1H),2.15(t,J=10.7Hz,1H),1.04(t,J=7.1Hz,3H).

[0231] Biological tests

[0232] Test 1: Evaluation of the inhibitory activity of compounds on HBV DNA replication in HepAD38 cells (Q-PCR method)

[0233] HBV cell line and culture conditions

[0234] HepAD38: Ladner et al. (Ladner, Otto et al. 1997) ligated the tetracycline-sensitive cytomegalovirus (CMV) promoter to the PBR322 plasmid and linked it to ayw subtype HBV DNA to form the ptetHBV plasmid. This plasmid was transfected into HepG2 cells to obtain the HepAD38 cell line. Due to the disruption of the pre-C region gene, the HBV DNA yield was approximately 11 times higher than that of HepG2.2.15 cells. HBV replication can be regulated using tetracycline, and the culture time required is only half that of HepG2.2.15 cells, making it suitable for studying the HBV replication process and intermediates, as well as screening anti-HBV drugs. HepAD38 cells were cultured in DMEM / F-12K medium containing 10% FBS and 1% penicillin antibiotics (also containing 300 ng / ml Tetracycline and 400 μg / ml G418).

[0235] Viral particle DNA secreted by HepAD38 cells can be quantified using qPCR, thereby detecting the effect of compounds on viral replication.

[0236] In vitro anti-HBV activity assay

[0237] After resuscitating HepAD38 cells with few passages and ensuring they were in good condition, Tetracycline (final concentration 300 ng / ml) and G418 (final concentration 400 μg / ml) were added to the culture medium. Virus expression was inhibited in the presence of Tetracycline. Once the cells reached confluence, they were digested, counted, and diluted to a concentration of 2 × 10⁻⁶ cells / ml using DMEM / F-12K medium containing 10% FBS (containing Tetracycline at a final concentration of 300 ng / ml and G418 at a final concentration of 400 μg / ml, plus 1% penicillin antibody). 5 Cell suspension was seeded at a rate of 100 μL per well in a 96-well plate (covering the entire plate), and incubated at 37°C in a 5% CO2 incubator for 24 h. After 24 h, the old culture medium was discarded, and fresh DMEM / F-12K medium containing 2% FBS and 1% antibiotics was added.

[0238] Compound preparation and cell treatment in the antiviral assay: The compound was dissolved in DMSO to 20 mM, further diluted with DMSO to 800 μM, and then subjected to eight 4-fold dilutions, with the highest concentration being 800 μM. 1 μL of each serially diluted compound was added to each well of the cell plate, with the highest final concentration being 4 μM (200-fold dilution). TDF (tenofovir disoproxil fumarate, Selleck, Cat S1400) was used as a positive control compound, with a highest concentration of 4 μM. 1 μL of DMSO was added to each negative control well, resulting in a final concentration of 0.5%.

[0239] HBV DNA Q-PCR

[0240] Quantitative PCR (Q-PCR) was performed using the Sansure Biotech 48-sample (PCR-fluorescent probe method) one-step hepatitis B virus nucleic acid quantitative assay kit. 2.5 μL of supernatant was used for Q-PCR. Before use, the kit reagents were thawed and vortexed to mix. After centrifugation, the enzyme mixture was placed on ice until ready to use, ensuring subsequent steps were performed on ice. 2.5 μL of sample release agent and 2.5 μL of test sample supernatant were added to each well of the Q-PCR plate (experimental group, control group, standard curve group). The viral DNA copy number was obtained after the Q-PCR reaction. The concentration-viral copy number was processed using Graphpad Prism 5 software, and the EC50 of the compound on viral replication was calculated using a four-parameter nonlinear regression model. The experimental results are shown in Table 2.

[0241] Table 2: EC50 of the compounds of this invention against HBV replication 50 value

[0242] Patent Examples <![CDATA[EC 50 (nM)]]> Example 1 5.9 Example 2 5 Example 3 4 Example 4 8

[0243] Conclusion: Experimental data show that the compound of this invention has good inhibitory activity against HBV and has good application prospects in anti-HBV virus.

[0244] Test 2: Evaluation of the inhibitory activity of compounds on HBV DNA replication in HepG2.2.15 cells

[0245] HBV cell lines and culture conditions

[0246] HepG2.2.15 cells (SELLS, PNAS, 1987 and SELLS, JV, 1988) have a fully integrated HBV genome and stably express viral RNA and viral proteins. HepG2.2.15 cells can secrete mature hepatitis B virus particles, HBsAg, and HBeAg into the culture medium. HepG2.2.15 cells are cultured in DMEM medium containing 10% fetal bovine serum, 100 U / mL penicillin, 100 U / mL streptomycin, 1% non-essential amino acids, and 1 mM sodium pyruvate 300 μg / mL G418.

[0247] Viral particle DNA secreted by HepG2.2.15 cells can be quantified using qPCR, thereby detecting the effect of compounds on viral replication.

[0248] In vitro anti-HBV activity assay

[0249] HepG 2.2.15 cells were seeded at 8,000 cells per well in 96-well cell culture plates and cultured at 37°C with 5% CO2 for 3 days until the cells reached confluence. On day 0 of the assay, the old culture medium was discarded and 200 μL of fresh assay medium (5% FBS) was added.

[0250] Compound preparation and cell treatment in the antiviral assay: The compound was dissolved in DMSO to 30 mM, further diluted with DMSO to 800 μM, and then subjected to eight 4-fold dilutions, with the highest concentration being 800 μM. 1 μL of each serially diluted compound was added to each well of the cell plate, with the highest final concentration being 4 μM (200-fold dilution). TDF (tenofovir disoproxil fumarate, Selleck, Cat S1400) was used as a positive control compound, with a highest concentration of 4 μM. 1 μL of DMSO was added to the negative control wells, resulting in a final concentration of 0.5%, and TDF was added to the positive control wells, resulting in a final concentration of 1 μM.

[0251] Q-PCR method for detecting viral genomic DNA

[0252] Primers: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Using the SYBR Premix Ex Taq II–Takara DRR081S kit, with 1 μL of cell culture supernatant as a template, a standard curve was constructed using a plasmid containing the HBV genome, and viral copy number was calculated based on the standard curve. The concentration-viral copy number profile was processed using Graphpad Prism 5 software, and the EC50 of the compound on viral replication was calculated using a four-parameter nonlinear regression model. 50 .

[0253] Conclusion: Experimental data show that the compound of this invention has good inhibitory activity against HBV and has good application prospects in anti-HBV virus.

[0254] Test 3: Cytotoxicity and Selectivity Index

[0255] Experimental methods for testing the cytotoxicity and selectivity index of compounds:

[0256] Serially diluted compounds were added to 384-well cytotoxicity plates, with 50 μL of HepG2.2.15 cells (3000 cells / well) added to each well. The highest final concentration was 150 μM (200-fold dilution). After incubation at 37°C in a CO2 incubator for 4 days, the cytotoxic effects of the compounds were detected using CellTiter Glo reagent.

[0257] Compound cytotoxicity was calculated using the following formula: Cytotoxicity (%) = 100 - (Detected value / Average value of DMSO control wells × 100). Concentration-cytotoxicity (%) data were processed using Graphpad Prism 5 software, and CC was calculated using a four-parameter nonlinear regression model. 50 CC 50 A value greater than 50 μM indicates relatively low toxicity. The experimental results for the compounds of this invention are shown in Table 3.

[0258] Table 3: Cytotoxicity of the compounds of this invention (CC) 50 value

[0259] Patent Examples <![CDATA[CC 50 (μM)]]> Comparison of compound A 46.75 Example 1 >100 Example 2 >100 Example 3 >100 Example 4 >100

[0260] Comparative compound A is Example 25 in PCT application WO2015132276, and its structure is as follows:

[0261] Conclusion: Cytotoxicity test data show that the compounds of this invention have low cytotoxicity.

Claims

1. A compound, which is a compound of Formula (I) or (la) or a pharmaceutically acceptable salt of a compound of Formula (I) or (la), wherein each R 1 , R 1b , and R 1a is independently hydrogen, deuterium, F, Cl, Br, I, cyano, methyl, or ethyl; R 2 is methyl, ethyl, n-propyl or i-propyl; R 3 is thiazolyl; W is N; X 1 is -C(=O)-; R is the following substructure: each R 4a , R 4b , R 4c , and R 4d is independently hydrogen, deuterium, F, Cl, or Br; R 7 is hydrogen or deuterium; m is 0, 1, 2, 3, or 4.

2. The compound of claim 1, comprising the structure of one of the following: or a pharmaceutically acceptable salt thereof.

3. A pharmaceutical composition, comprising the compound of any one of claims 1-2, and a pharmaceutically acceptable excipient thereof.

4. The pharmaceutical composition of claim 3, further comprising another anti-HBV agent, wherein the another anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

5. The pharmaceutical composition of claim 4, further comprising another anti-HBV agent, wherein the another anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir, Alfaferone, Alloferon, Celmolex, Crisantasp, Emtriva, Fampridovir, Bao Gan Ling CP, Inotefin, Interferon alfa-1b, Interferon alfa, Interferon alfa-2a, Interferon beta-1a, Interferon alfa-2, Interleukin-2, Miv-501, Nitazoxanide, Peginterferon alfa-2a, Ribavirin, Roferon-A, Zanamivir, Euforavac, Ampligen, Phosphazid, Heplisav, Interferon alfa-2b, Levamisole, or Progipid.

6. Use of the compound of any one of claims 1-2 or the pharmaceutical composition of any one of claims 3-5 in the manufacture of a medicament for preventing, managing, treating, or alleviating a viral disease in a patient, wherein the viral disease is hepatitis B infection or a disease caused by hepatitis B infection.

7. The use of claim 6, wherein the disease caused by hepatitis B infection is cirrhosis or hepatocellular carcinoma.

Citation Information

Patent Citations

  • Push-pull chain actuator with reduced chain vibrations

    WO2010000260A1

  • Novel 6-fused heteroaryldihydropyrimidines for the treatment and prophylaxis of hepatitis b virus infection

    WO2015132276A1

  • Novel 6-fused heteroaryldihydropyrimidines for the treatment and prophylaxis of hepatitis b virus infection

    CN106061978A

  • Dihydropyridine compound and application thereof to drugs

    CN109678859A