Treatment of erythropoietic protoporphyria (EPP) and X-linked protoporphyria (XLP)

Abstract

Disclosed herein are novel compositions and methods of use for treating erythropoietic protoporphyria (EPP) and X-linked protoporphyria (XLP). Disclosed are methods and compositions for treating erythropoietic protoporphyria and X-linked protoporphyria. Also described are therapeutic agents that can inhibit ABCG2. For example, provided herein are therapeutic agents defined by Formula I.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 850,061, filed May 20, 2019, which is hereby incorporated by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under grant R01 DK090305 awarded by the National Institute of Diabetes and Digestive and Kidney Diseases. The government has certain rights in this invention. Background Art

[0005] Porphyrias are a group of metabolic disorders of the heme biosynthetic pathway. Erythropoietic protoporphyria (EPP) is the third most common type of porphyria and the most common porphyria in childhood. EPP is caused by loss-of-function mutations in ferrochelatase (FECH), the last enzyme in the heme biosynthetic pathway that converts Fe 2+ Combined with protoporphyrin IX (PPIX) to form heme. Due to FECH deficiency, PPIX accumulates significantly in EPP patients, mainly in red blood cells (R b C), plasma, and liver. In addition to EPP, PPIX accumulation also occurs in X-linked protoporphyria (XLP), another porphyria caused by gain-of-function mutations in delta-aminolevulinic acid synthase 2 (ALAS2), the rate-limiting enzyme in the heme biosynthetic pathway. In addition, many clinically used drugs and environmental toxins including rifampicin (RIF), isoniazid (INH), diethoxycarbonyl-1,4-dihydrocollidine (DDC), and griseofulvin (GSF) can lead to accumulation of PPIX in the liver and / or inhibition of FECH via induction of ALAS. What is needed are therapies for EPP and XLP. Summary of the invention

[0006] Disclosed are methods and compositions directed to treating erythropoietic protoporphyria and X-linked protoporphyria.

[0007] Also described are therapeutic agents that can inhibit ABCG2. For example, provided herein are therapeutic agents defined by the following formula I

[0008]

[0009] in

[0010] A is selected from the group consisting of: and

[0011]

[0012] n is an integer from 0 to 6;

[0013] X, when present, is selected from the group consisting of CH2, O and S;

[0014] R 1 Selected from the group consisting of: H, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, CN, NO2, OR a , SR a 、C(O)R b 、C(O)NR c R d 、C(O)OR a 、OC(O)R b 、OC(O)NR c R d NR c R d NR c OR d NR c C(O)R b NR c C(O)OR a NR c C(O)NR c R d 、C(=NR e )R b 、C(=NR e )NR c R d NR c C(=NR e )NR c R d NR c S(O)R b NR c S(O)2R b NR c S(O)2NR c R d 、S(O)R b 、S(O)NR c R d 、S(O)2R b and S(O)2NR c R d , wherein the C 1-6 Alkyl, C2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0015] R 2 and R 3 independently selected from the group consisting of: H, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, CN, NO2, OR a and SR a , wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0016] R 4 and R 5 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A group substitution;

[0017] R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group;

[0018] R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group;

[0019] R 10 Selected from the group consisting of: C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0020] Each R a , R b , R c and R d Independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl; wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are each optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0021] Each R e Independently selected from H, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkylthio, C 1-6 Alkylsulfonyl, C 1-6 Alkylcarbonyl, C 1-6 Alkylaminosulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, aminosulfonyl, C 1-6 Alkylaminosulfonyl and di(C 1-6 alkyl)aminosulfonyl; and

[0022] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0023] or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0024] Also disclosed herein is a pharmaceutical composition comprising the therapeutic agent of any of the aforementioned aspects, further comprising rifampicin (RIF), isoniazid (INH), diethoxycarbonyl-1,4-dihydrocollidine (DDC) or griseofulvin (GSF).

[0025] In one aspect, disclosed herein is a method for treating, preventing, reducing or inhibiting erythropoietic protoporphyria (EPP) or X-linked protoporphyria (XLP) in a subject, comprising administering to the subject a therapeutic agent that inhibits ABCG2 activity, including but not limited to any of the therapeutic agents that inhibit ABCG2 activity of the aforementioned aspects.

[0026] Also disclosed herein are methods of reducing PPIX efflux from erythrocytes or hepatocytes of a subject comprising administering to the subject a therapeutic agent that inhibits ABCG2 activity.

[0027] In one aspect, disclosed herein are methods of treating, preventing, reducing or inhibiting purpura, erythema, edema or burning sensation in the skin of a subject suffering from EPP, comprising administering to the subject a therapeutic agent that inhibits ABCG2 activity.

[0028] In one aspect, disclosed herein are methods of treating, preventing, reducing or inhibiting hepatotoxicity in the skin of a subject (eg, a subject suffering from EPP) comprising administering to the subject a therapeutic agent that inhibits ABCG2 activity.

[0029] In one aspect, disclosed herein is a method for treating, preventing, reducing or inhibiting EPP, XLP, PPIX outflow from erythrocytes or hepatocytes, purpura in the skin, erythema, edema or burning sensation of any of the foregoing aspects, wherein the therapeutic agent is an antibody, a peptide, a protein, RNAi, a small molecule or a targeted nucleic acid integration system, such as an anti-ABCG2 antibody, a targeted nucleic acid integration system comprising a guide RNA targeting the ABCG2 gene (e.g., clustered regularly interspaced short palindromic repeats) (CRISPR) / CRISPR-associated 9 (Cas9) integration system), or RNAi targeting the ABCG2 gene.

[0030] In one aspect, disclosed herein is a method of treating, preventing, reducing or inhibiting EPP, XLP, PPIX efflux from erythrocytes or hepatocytes, purpura, erythema, edema or burning sensation in the skin of any of the foregoing aspects, wherein the agent comprises a tissue-specific targeting moiety or expression vector.

[0031] In one aspect, disclosed herein are cells comprising an ABCG2 knockout. Also disclosed herein are transgenic animals comprising the cell of any of the foregoing aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and, together with the description, explain the disclosed compositions and methods.

[0033] Figures 1A, 1B, 1C, 1D, 1E and 1F show the role of ABCG2 in EPP-related phototoxicity. Figure 1A shows the genotyping results of WT, Abcg2-null, Fech-mut and Fech-mut / Abcg2-null mice. Fech-mut / Abcg2-null mice are deficient in Fech and Abcg2. Figure 1B shows the gross appearance of mice after exposure. The back skin of mice was shaved and exposed to ultraviolet light (395-410nm) for 30 minutes per day for 5 days. Figures 1C, 1D, 1E and 1F show histological sections of mouse skin after exposure to ultraviolet light and H&E staining. Bars equal 40μm.

[0034] Figures 2A, 2B and 2C show oxidative stress and inflammation in the skin of WT, Abcg2-null, Fech-mut and Fech-mut / Abcg2-null mice after exposure to ultraviolet light. The back skin of mice was shaved and exposed to ultraviolet light (395-410nm) for 30 minutes a day for 5 days. Figure 2A shows the level of glutathione (GSH) in the skin. Figures 2B and 2C show the mRNA expression of tumor necrosis factor-α (TNF-α) and interleukin 1β (IL-1β) in the skin. All data are expressed as mean ± SEM (n = 4 / group). *P < 0.05, ***P < 0.001, by one-way analysis of variance (ANOVA).

[0035] Figures 3A, 3B, 3C, and 3D show that ABCG2 regulates the distribution of PPIX in red blood cells (RBC), plasma, and skin of EPP mouse models. Figure 3A shows the PPIX levels in RBC. Figure 3B shows the PPIX levels in serum. Figure 3C shows the PPIX levels in mouse skin after exposure to UV light. PPIX was analyzed by UPLC-QTOFMS. All data are expressed as mean ± SEM (n = 4 / group). *P<0.05, ***P<0.001, analyzed by one-way ANOVA. Figure 3D shows a schematic diagram showing that ABCG2 deficiency reduces PPIX distribution on the skin and eliminates PPIX-mediated phototoxicity in EPP.

[0036] Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I show that EPP-associated hepatotoxicity depends on ABCG2. WT, Abcg2-null, Fech-mut, and Fech-mut / Abcg2-null mice were maintained under the same environment and sacrificed at similar ages. Figures 4A, 4B, and 4C show serum activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP). Figure 4D shows serum total bilirubin. Figure 4E shows PPIX in the liver, analyzed by UPLC-QTOFMS. Data are expressed as mean ± SEM (n = 4 / group). ***P < 0.001, analyzed by one-way ANOVA. Figures 4F, 4G, 4H, and 4I show representative liver sections with H&E staining. Arrows indicate bile thrombi. Bars equal 10 μm. PV, portal vein; BD, bile duct.

[0037] Figures 5A, 5B, 5C, 5D, 5E, and 5F show that ABCG2 deficiency eliminates DDC-induced PPIX accumulation and hepatotoxicity. WT and Abcg2-null mice were treated with DDC, a porphyrinogen, for 14 days. Figures 5A, 5B, and 5C show serum activities of ALT, AST, and ALP. Figure 5D shows PPIX in the liver, analyzed by UPLC-QTOFMS. All data are expressed as mean ± SEM (n = 3-4 / group). **P<0.01, ***P<0.001, analyzed by one-way analysis of variance (ANOVA). Figures 5E and 5F show histological analysis of the liver using H&E staining. Arrows indicate bile thrombi. Bars equal 10 μm. PV, portal vein; BD, bile duct.

[0038] Figures 6A, 6B, 6C, 6D, 6E, and 6F show that ABCG2 deficiency eliminates griseofulvin (GSF)-induced PPIX accumulation and hepatotoxicity. WT and Abcg2-null mice were treated with GSF, a porphyrin-generating agent, for 14 days. Figures 6A, 6B, and 6C show serum activities of ALT, AST, and ALP. Figure 6D shows PPIX in the liver. All data are expressed as mean ± SEM (n = 3-4 / group). ***P < 0.001, analyzed by one-way analysis of variance (ANOVA). Figures 6E and 6F show histological analysis of the liver using H&E staining. Arrows indicate bile thrombi. Bars equal 10 μm. PV, portal vein; BD, bile duct.

[0039] Figures 7A, 7B, 7C, 7D, 7E and 7F show PPIX accumulation and hepatotoxicity in hPXR and hPXR / Abcg2-null mice treated with rifampicin (RIF) and isoniazid (INH). Figure 7A shows the genotyping results of hPXR and hPXR / Abcg2-null mice. Figures 7B and 7C show serum activities of ALT and ALP. Figure 7D shows PPIX in the liver, analyzed by UPLC-QTOFMS. All data are expressed as mean ± SEM (n = 3-4 / group. *P < 0.05, **P < 0.01, analyzed by one-way analysis of variance (ANOVA). Figures 7E and 7F show histological analysis of the liver using H&E staining. Arrows indicate bile thrombi. PV, portal vein; BD, bile duct.

[0040] Fig. 8A , 8B , 8C, 8D, 8E, 8F, 8G, 8H, and 8I show that deficiency in ABCG2 regulates PPIX distribution, metabolism, and excretion. Fig. 8A , 8B, 8C, 8D, 8E, and 8F show metabolomic analysis of WT and Abcg2-null mice treated with deuterium-labeled aminolevulinic acid (D2-ALA), a precursor of PPIX. Liver and bile samples were collected 1 hour after D2-ALA treatment. Fig. 8A Scoring plots of liver samples generated by principal component analysis (PCA) are shown. Each point represents a mouse sample. Figure 8B and 8C Figure 8D shows the S-plots of liver and bile metabolomes generated by orthogonal partial least squares discriminant analysis (OPLS-DA). Each dot represents a metabolite. All metabolites were analyzed by UPLC-QTOFMS. Figure 8D shows the D 16 Figures 8E and 8F show the expression of D in liver and bile 16 -protoporphyrin-1-O-acyl-glucuronide (D 16 -PPIX-glu). All data are expressed as mean ± SEM. Data in WT were set as 100% or 1. *P < 0.05, **P < 0.01, by two-tailed Student's t-test. Figure 8G shows the structures of PPIX and its metabolites bound to glucuronic acid, xylose and glucose. Figure 8H shows the percentages of PPIX and its bound metabolites in the bile of Fech-mut and Fech-mut / Abcg2-null mice. Figure 8I shows a schematic diagram showing that deficiency of ABCG2 eliminates EPP-related liver injury by regulating PPIX distribution, metabolism and excretion.

[0041] Fig.9A , 9B , 9C and 9D show the identification of protoporphyrin-1-O-acyl-glucuronide (PPIX-glu). Fig.9A The results show that D2-ALA was expressed in the liver of Abcg2-null mice treated with D2-ALA. 16 Extraction chromatogram of -PPIX-glu. Fig. 9B Shows D 16 -MS / MS of PPIX-glu. Fig. 9C A schematic diagram of the PPIX-glu synthesis route is shown. Fig.9D MS / MS of synthesized PPIX-glu is shown.

[0042] Figures 10A and 10B show a summary of the role of ABCG2 in the pathophysiology of EPP. ABCG2 is expressed in red blood cells (RBCs) and hepatocytes. Figure 10A shows a schematic diagram showing that ABCG2 drives phototoxicity and hepatotoxicity in EPP by: (1) increasing the distribution of PPIX to the skin and increasing photosensitivity; (2) increasing the delivery of PPIX to the hepatobiliary system, causing bile duct obstruction and cholestatic liver injury; (3) ABCG2-dependent bile duct obstruction further increases the accumulation of PPIX in the body, thereby enhancing phototoxicity and hepatotoxicity. Figure 10B shows a schematic diagram showing that ABCG2 deficiency eliminates phototoxicity and hepatotoxicity in EPP by (1) reducing the distribution of PPIX to the skin and reducing photosensitivity; (2) reducing the delivery of PPIX to the hepatobiliary system, alleviating PPIX-mediated bile duct obstruction; (3) PPIX retained in hepatocytes can be further metabolized into conjugated products, promoting their excretion; (4) preventing PPIX-mediated bile duct obstruction can reduce the accumulation of PPIX in the body and attenuate phototoxicity and hepatotoxicity.

[0043] Fig.11 Pharmacokinetic analysis of KO143, K2, K31 and K34 in mice is shown.

[0044] Figures 12A and 12B show the efficacy of K31 on EPP-related phototoxicity. The Fech-mut mouse model was used as an EPP model. Figure 12A shows the skin appearance of EPP mice before light exposure. Figure 12B shows the skin appearance of EPP mice exposed to light after pretreatment with or without K31.

[0045] Fig.13 Phototoxicity in Fech-mut mice after K31 withdrawal is shown. Mice were pretreated with K31 and then exposed to light from day 1 to day 4. From day 5 onwards, mice were exposed to light only without K31 treatment.

[0046] Fig.14 The effect of K31 on RBC PPIX efflux in Fech-mut mice is shown. The results are expressed as mean ± SEM (n = 3). **P < 0.01, ***P < 0.001, ****P < 0.0001. DETAILED DESCRIPTION

[0047] Before disclosing and describing the compounds, compositions, articles, devices and / or methods of the present invention, it should be understood that, unless otherwise specified, they are not limited to specific synthetic methods or specific recombinant biotechnology methods, or to specific reagents, unless otherwise specified, and thus can of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0048] definition

[0049] As used in the specification and the appended claims, the singular forms "a", "an" and "the" include plural forms unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

[0050] Ranges can be expressed as from "about" a particular value, and / or to "about" another particular value. When such a range is expressed, another embodiment includes from a particular value and / or to another particular value. Similarly, when a numerical value is expressed as an approximation, by using the antecedent "about", it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each range are important relative to the other endpoint and are independent of the other endpoint. It will be further understood that multiple values ​​are disclosed herein, and each value is also disclosed herein as "about" the particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" will also be disclosed. It should also be understood that when a value is disclosed, "less than or equal to" the value, "greater than or equal to" the value, and the possible range between the values ​​are also disclosed, as appropriately understood by the technician. For example, if the value "10" is disclosed, "less than or equal to 10" and "greater than or equal to 10" are also disclosed. It should also be understood that throughout the application, data is provided in a variety of different formats, and the data represents endpoints and starting points, as well as the range of any combination of data points. For example, if a specific data point "10" and a specific data point 15 are disclosed, it should be understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15, as well as between 10 and 15 are contemplated for disclosure. It should also be understood that every unit between two specific units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0051] Throughout this specification and the claims that follow, reference will be made to a number of terms which shall be defined to have the following meanings:

[0052] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0053] "Primers" are subsets of probes that are capable of supporting a certain type of enzymatic manipulation and can hybridize to a target nucleic acid so that enzymatic manipulation can be performed. Primers can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art that do not interfere with enzymatic manipulation.

[0054] A "probe" is a molecule that is capable of interacting with a target nucleic acid, typically in a sequence-specific manner, such as by hybridization. The hybridization of nucleic acids is well known in the art and discussed herein. Typically, a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.

[0055] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein (thus both DNA and mRNA encode proteins), or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), guide RNA, etc.).

[0056] A "protein coding sequence," or a sequence encoding a specific protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated into a polypeptide in vitro or in vivo (in the case of mRNA) when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' end (N-terminus) and a translation termination nonsense codon at the 3' end (C-terminus). Coding sequences may include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. The transcription termination sequence is usually located at the 3' end of the coding sequence.

[0057] The terms "naturally occurring" or "unmodified" or "wild-type" as applied to nucleic acids, polypeptides, cells or organisms refer to nucleic acids, polypeptides, cells or organisms that are found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) can be isolated from a source in nature, and a polypeptide or polynucleotide sequence that has not been intentionally modified by man in the laboratory is wild-type (and naturally occurring).

[0058] " using " to experimenter comprises any approach of introducing or delivering therapeutic agent to experimenter.Using can be carried out by any suitable approach, including oral, local, intravenous, subcutaneous, percutaneous, transdermal, intramuscular, intraarticular, parenteral, intraarteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by suction, via implanted reservoir, parenteral (for example, subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional and intracranial injection or infusion technique) etc.As used herein, " concurrent administration ", " combined administration ", " simultaneous administration " refers to compound administration at the same time point or basically one immediately after another administration.In the latter case, the administration time of two kinds of compounds is close enough, so that the observed result is not different from the result obtained when the compound is administered at the same time point. "Systemic administration" refers to the introduction or delivery of a therapeutic agent to a subject by a route that introduces or delivers the therapeutic agent to a wide area of ​​the subject's body (e.g., greater than 50% of the body), such as by entering the subject's circulatory or lymphatic system. In contrast, "local administration" refers to a route that introduces or delivers a therapeutic agent to a subject by introducing or delivering a therapeutically significant amount to an area immediately adjacent to the point of administration, rather than systemically. For example, a locally administered agent is readily detected in the local vicinity of the point of administration, but is undetectable or detectable in negligible amounts in distal portions of the subject's body. Administration includes self-administration and administration by another person.

[0059] The "effective amount" of a therapeutic agent refers to the amount of the therapeutic agent sufficient to provide the desired effect. The amount of an "effective" agent will vary from subject to subject, depending on many factors, such as the age and general condition of the subject, the specific agent, etc. Therefore, it is not always possible to specify a quantitative "effective amount". However, a person of ordinary skill in the art can use routine experiments to determine the appropriate "effective amount" in any subject situation. In addition, as used herein, unless otherwise specifically stated, the "effective amount" of a therapeutic agent may also refer to an amount covering a therapeutically effective amount and a preventive effective amount. The "effective amount" of the therapeutic agent required to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. The dosage regimen may be adjusted to provide the best therapeutic response. For example, several separate doses may be administered daily, or the dosage may be reduced proportionally according to the urgency of the treatment situation.

[0060] A "pharmaceutically acceptable" component may refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into the pharmaceutical formulation of the present invention and administered to a subject as described above without causing significant undesirable biological effects or interacting in a deleterious manner with any other component of the formulation containing it. When used for human administration, the term generally means that the component has met the required standards of toxicology and manufacturing testing, or it is included in the inactive ingredient guidelines established by the U.S. Food and Drug Administration.

[0061] "Pharmaceutically acceptable carrier" (sometimes referred to as "carrier") refers to a carrier or excipient that can be used to prepare a generally safe and non-toxic pharmaceutical or therapeutic composition, and includes carriers that are acceptable for veterinary and / or human pharmaceutical or therapeutic use. The term "carrier" or "pharmaceutically acceptable carrier" may include, but is not limited to, phosphate buffered saline solution, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "carrier" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material known in the art for pharmaceutical formulations, and as further described herein.

[0062] "Pharmacological activity" (or simply "activity"), as in "pharmacologically active" derivatives or analogs, may refer to derivatives or analogs (e.g., salts, esters, amides, conjugates, metabolites, isomers, fragments, etc.) that have the same type and approximately equivalent degree of pharmacological activity as the parent compound.

[0063] "Therapeutic agent" refers to any composition having a beneficial biological effect. Beneficial biological effects include therapeutic effects, such as treating a disorder or other undesirable physiological condition, and preventive effects, such as preventing a disorder or other undesirable physiological condition (e.g., non-immunogenic cancer). The term also includes pharmaceutically acceptable pharmacologically active derivatives of the specifically mentioned beneficial agents, which include, but are not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the term "therapeutic agent" is used, or when a particular agent is specifically identified, it should be understood that the term includes the therapeutic agent itself as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, and the like.

[0064] A "therapeutically effective amount" or "therapeutically effective dose" of a composition (e.g., a composition comprising a therapeutic agent) refers to an amount that effectively achieves a desired therapeutic outcome. In certain embodiments, the desired therapeutic outcome is control of type I diabetes. In certain embodiments, the desired therapeutic outcome is control of obesity. The therapeutically effective amount of a given therapeutic agent will typically vary with factors such as the type and severity of the disorder or disease being treated and the age, sex, and weight of the subject. The term can also refer to the amount of the therapeutic agent that effectively promotes the desired therapeutic effect (e.g., pain relief), or the delivery rate of the therapeutic agent (e.g., the amount over time). The exact desired therapeutic effect will vary according to the disorder to be treated, the tolerance of the subject, the therapeutic agent to be administered and / or the pharmaceutical preparation (e.g., the efficacy of the therapeutic agent, the concentration of the agent in the preparation, etc.), and various other factors understood by those of ordinary skill in the art. In some cases, the desired biological or medical response is achieved after multiple doses of the composition are administered to the subject over a period of days, weeks, or years.

[0065] The term "n-membered", where n is an integer, generally describes the number of ring atoms in a moiety having a ring number of n. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaromatic ring, pyridinyl is an example of a 6-membered heteroaromatic ring, and 1,2,3,4-tetrahydronaphthalene is an example of a 10-membered cycloalkyl.

[0066] As used herein, the phrase "optionally substituted" refers to unsubstituted or substituted. As used herein, the term "substituted" refers to hydrogen atoms being removed and replaced by substituents. It should be understood that substitution on a given atom is limited by valence.

[0067] Throughout this definition, the term “C n-m " indicates a range including endpoints, wherein n and m are integers and represent the number of carbons. Examples include C 1-4 , C 1-6 wait.

[0068] As used herein, the term “C n-m "Alkyl" refers to a saturated hydrocarbon group that can be straight or branched and has n to m carbons. Examples of alkyl moieties include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; higher homologues such as 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, etc. In certain embodiments, the alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

[0069] As used herein, “C n-m"Alkenyl" refers to an alkyl group having one or more carbon-carbon double bonds and having n to m carbons. Exemplary alkenyl groups include, but are not limited to, ethenyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl, and the like. In certain embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0070] As used herein, “C n-m “Alkynyl” refers to an alkyl group having one or more carbon-carbon triple bonds and having n to m carbons. Exemplary alkynyl groups include, but are not limited to, ethynyl, propyn-1-yl, propyn-2-yl, and the like. In certain embodiments, the alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0071] As used herein, the term “C n-m "Alkylene" refers to a divalent alkyl linking group having n to m carbons. Examples of alkylene include, but are not limited to, ethane-1,2-diyl, propane-1,3-diyl, propane-1,2-diyl, butane-1,4-diyl, butane-1,3-diyl, butane-1,2-diyl, 2-methyl-propane-1,3-diyl, and the like. In certain embodiments, the alkylene moiety contains 2 to 6, 2 to 4, 2 to 3, 1 to 6, 1 to 4, or 1 to 2 carbon atoms.

[0072] As used herein, the term “C n-m "Alkoxy" refers to a radical of the formula -O-alkyl, wherein the alkyl has n to m carbons. Example alkoxy groups include methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), tert-butoxy, and the like. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0073] As used herein, the term “C n-m "Alkylamino" refers to a radical of the formula NH(alkyl), wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0074] As used herein, the term “C n-m "Alkoxycarbonyl" refers to a radical of the formula C(O)O-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0075] As used herein, the term “C n-m "Alkylcarbonyl" refers to a radical of the formula -C(O)-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0076] As used herein, the term “Cn-m "Alkylcarbonylamino" refers to a radical of the formula -NHC(O)-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0077] As used herein, the term “C n-m "Alkylsulfonylamino" is a radical of the formula -NHS(O)2-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0078] As used herein, the term "aminosulfonyl" refers to a group of formula -S(O)2NH2.

[0079] As used herein, the term “C n-m "Alkylaminosulfonyl" refers to a radical of the formula -S(O)2NH(alkyl) wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0080] As used herein, the term " n-m "S(O)2N(alkyl)sulfonyl" refers to a radical of the formula -S(O)2N(alkyl)2, wherein each alkyl independently has n to m carbon atoms. In certain embodiments, each alkyl independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0081] As used herein, the term "aminosulfonylamino" refers to a group of formula -NHS(O)2NH2.

[0082] As used herein, the term “C n-m "Alkylaminosulfonylamino" refers to a radical of the formula -NHS(O)2NH(alkyl) wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0083] As used herein, the term " n-m "alkyl)aminosulfonylamino" refers to a radical of the formula -NHS(O)2N(alkyl)2, wherein each alkyl independently has n to m carbon atoms. In certain embodiments, each alkyl independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0084] As used herein, the term "aminocarbonylamino," employed alone or in combination with other terms, refers to a radical of the formula -NHC(O)NH2.

[0085] As used herein, the term “C n-m"Alkylaminocarbonylamino" refers to a radical of the formula -NHC(O)NH(alkyl) wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0086] As used herein, the term " n-m "alkyl)aminocarbonylamino" refers to a radical of the formula -NHC(O)N(alkyl)2, wherein each alkyl independently has n to m carbon atoms. In certain embodiments, each alkyl independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0087] As used herein, the term “C n-m "Alkylcarbamoyl" refers to a radical of the formula -C(O)-NH(alkyl) wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0088] As used herein, the term "thio" refers to a group of formula -SH

[0089] As used herein, the term “C n-m "Alkylsulfinyl" refers to a radical of the formula -S(O)-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0090] As used herein, the term “C n-m "Alkylsulfonyl" refers to a radical of the formula -S(O)2-alkyl, wherein the alkyl has n to m carbon atoms. In certain embodiments, the alkyl has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0091] As used herein, the term "amino" refers to a group of formula -NH2.

[0092] As used herein, the term "aryl", used alone or in combination with other terms, refers to an aromatic hydrocarbon group which may be monocyclic or polycyclic (eg, having 2, 3 or 4 fused rings). n-m "Aryl" refers to an aromatic radical having n to m ring carbon atoms. Aryl includes, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, and the like. In certain embodiments, the aryl radical has 6 to about 20 carbon atoms, 6 to about 15 carbon atoms, or 6 to about 10 carbon atoms. In certain embodiments, the aryl radical is a substituted or unsubstituted phenyl radical.

[0093] As used herein, the term "carbamyl" refers to a group of formula -C(O)NH2.

[0094] As used herein, the term "carbonyl," employed alone or in combination with other terms, refers to a -C(=O)- group, which may also be written as C(O).

[0095] As used herein, the term " n-m "-alkyl)amino" refers to a radical of the formula -N(alkyl)2, wherein each of the two alkyl radicals independently has n to m carbon atoms. In certain embodiments, each alkyl radical independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0096] As used herein, the term " n-m -alkyl)carbamoyl" refers to a group of the formula -C(O)N(alkyl)2, wherein the two alkyl groups each independently have n to m carbon atoms. In certain embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0097] As used herein, the term "halogen" refers to F, Cl, Br, or I. In certain embodiments, halogen is F, Cl, or Br. In certain embodiments, halogen is F or C.

[0098] As used herein, “C n-m "Haloalkoxy" refers to a radical of the formula -O-haloalkyl having n to m carbon atoms. An exemplary haloalkoxy radical is OCF3. In certain embodiments, the haloalkoxy radical is only fluorinated. In certain embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0099] As used herein, the term “C n-m "Haloalkyl" refers to an alkyl group having from 1 halogen atom to 2s+1 halogen atoms which may be the same or different, wherein "s" is the number of carbon atoms in the alkyl group, wherein the alkyl group has n to m carbon atoms. In certain embodiments, the haloalkyl group is only fluorinated. In certain embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0100] As used herein, "cycloalkyl" refers to a non-aromatic cyclic hydrocarbon including cyclized alkyl and / or alkenyl groups. Cycloalkyl groups may include monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) groups and spirocyclic groups. Cycloalkyl groups may have 3, 4, 5, 6, 7, 8, 9, or 10 ring carbons (C 3-10). The ring-forming carbon atoms of the cycloalkyl group may be optionally substituted with oxo or thio (e.g., C(O) or C(S)). Cycloalkyl also includes cycloalkylene. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norpinyl, norcarny, etc. In certain embodiments, the cycloalkyl group is cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclopentyl or adamantyl. In certain embodiments, the cycloalkyl group has 6-10 ring-forming carbon atoms. In certain embodiments, the cycloalkyl group is adamantyl. The definition of cycloalkyl also includes a portion having one or more aromatic rings fused to the cycloalkyl ring (i.e., having a common bond), such as benzo or thienyl derivatives of cyclopentane, cyclohexane, etc. The cycloalkyl group comprising a fused aromatic ring may be connected by any ring-forming atom, including the ring-forming atoms of the fused aromatic ring.

[0101] As used herein, "heteroaryl" refers to a monocyclic or polycyclic aromatic heterocycle having at least one heteroatom ring member selected from sulfur, oxygen and nitrogen. In certain embodiments, the heteroaryl ring has 1, 2, 3 or 4 heteroatom ring members independently selected from nitrogen, sulfur and oxygen. In certain embodiments, any ring-forming N in the heteroaryl moiety can be an N-oxide. In certain embodiments, the heteroaryl has 5-10 ring atoms and 1, 2, 3 or 4 heteroatom ring members independently selected from nitrogen, sulfur and oxygen. In certain embodiments, the heteroaryl has 5-6 ring atoms and 1 or 2 heteroatom ring members independently selected from nitrogen, sulfur and oxygen. In certain embodiments, the heteroaryl is a five-membered or six-membered heteroaromatic ring. A five-membered heteroaromatic ring is a heteroaryl ring with five ring atoms, wherein one or more (e.g., 1, 2 or 3) ring atoms are independently selected from N, O and S. Exemplary five-membered ring heteroaryls are thienyl, furanyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl and 1,3,4-oxadiazolyl. Six-membered heteroaryl rings are heteroaryl rings having six ring atoms, wherein one or more (e.g., 1, 2 or 3) ring atoms are independently selected from N, O and S. Exemplary six-membered ring heteroaryls are pyridinyl, pyrazinyl, pyrimidinyl, triazinyl and pyridazinyl.

[0102] As used herein, "heterocycloalkyl" refers to a non-aromatic monocyclic or polycyclic heterocycle having one or more ring-forming heteroatoms selected from O, N or S. Included in heterocycloalkyl are monocyclic 4-, 5-, 6- and 7-membered heterocycloalkyls. Heterocycloalkyl may also include spirocycles. Exemplary heterocycloalkyls include pyrrolidin-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydropyran, oxetanyl, azetidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazapene, etc. The ring-forming carbon atoms and heteroatoms of heterocycloalkyl may be optionally substituted with oxo or thio (e.g., C(O), S(O), C(S) or S(O)2, etc.). Heterocycloalkyl can be connected by ring-forming carbon atoms or ring-forming heteroatoms. In some embodiments, heterocycloalkyl contains 0 to 3 double bonds. In some embodiments, heterocycloalkyl contains 0 to 2 double bonds. The definition of heterocycloalkyl also includes the part of the aromatic ring with one or more condensed (i.e., having a common bond) with cycloalkyl ring, such as the benzo or thienyl derivatives of piperidine, morpholine, azepane, etc. The heterocycloalkyl comprising fused aromatic rings can be connected by any ring-forming atoms, including the ring-forming atoms of fused aromatic rings. In some embodiments, heterocycloalkyl has 4-10,4-7 or 4-6 ring atoms and 1 or 2 heteroatoms independently selected from nitrogen, oxygen or sulfur and has one or more oxidized ring members.

[0103] In some places, definitions or embodiments refer to specific rings (e.g., azetidine rings, pyridine rings, etc.). Unless otherwise indicated, these rings can be attached to any ring member as long as the valence is not exceeded. For example, the azetidine ring can be attached to any position of the ring, while the pyridine-3-yl ring is attached to the 3-position.

[0104] The term "compound" as used herein is intended to include all stereoisomers, geometric isomers, tautomers, and isotopes of the depicted structure. Unless otherwise indicated, a compound identified by name or structure as one particular tautomeric form is intended to include the other tautomeric forms.

[0105] Compounds provided herein also include tautomeric forms. Tautomeric forms are derived from the exchange of single bonds with adjacent double bonds and the concomitant migration of protons. Tautomeric forms include proton tautomers, which are isomeric protonation states with the same empirical formula and total charge. Exemplary proton tautomers include keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms in which protons can occupy more than two positions of heterocyclic systems, for example, 1H- and 3H-imidazoles, 1H-, 2H- and 4H-1,2,4-triazoles, 1H- and 2H-isoindoles, and 1H- and 2H-pyrazoles. Tautomeric forms can be in equilibrium or spatially locked into one form by appropriate substitution.

[0106] In certain embodiments, the compounds described herein may contain one or more asymmetric centers, and thus are racemates and racemic mixtures, enantiomerically enriched mixtures, single enantiomers, single diastereomers, and diastereomeric mixtures (e.g., including (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, (+) (dextrorotatory) forms, (-) (levorotatory) forms, racemic mixtures thereof, and other mixtures thereof). Additional asymmetric carbon atoms may be present in substituents, such as alkyl groups. All such isomeric forms of these compounds and mixtures thereof are explicitly included in this specification. The compounds described herein may also or further contain bonds, wherein bond rotation is restricted to that particular bond, such as restrictions caused by the presence of a ring or double bond (e.g., a carbon-carbon bond, a carbon-nitrogen bond, such as an amide bond). Therefore, all cis / trans and E / Z isomers and rotamers are explicitly included in this specification. Unless otherwise mentioned or indicated, the chemical name of a compound includes a mixture of all possible stereochemical isomeric forms of the compound.

[0107] Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, and include, but are not limited to, diastereoisomerization, kinetic resolution, and asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen, SH et al., Tetrahedron 33: 2725 (1977); Eliel, EL Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); Wilen, SH Tables of Resolving Agents and Optical Resolutions, p. 268 (EL Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972), each of which is incorporated herein by reference as a whole. It should also be understood that the compounds described herein include all possible regioisomers and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, and include, but are not limited to, column chromatography, dilute layer chromatography, and high performance liquid chromatography.

[0108] Unless specifically defined, the compounds provided herein may also include all isotopes of atoms present in the intermediates or final compounds. Isotopes include those atoms with the same atomic number but different mass numbers. Unless otherwise indicated, when an atom is designated as an isotope or radioisotope (e.g., deuterium, 11 C]、[ 18 F]), the atom is understood to contain the isotope or radioisotope in an amount at least greater than the natural abundance of the isotope or radioisotope. For example, when an atom is designated as "D" or "deuterium", the position is understood to have at least 3000 times more deuterium (i.e., at least 45% deuterium incorporation) than the natural abundance of deuterium, which is 0.015%.

[0109] All compounds and pharmaceutically acceptable salts thereof may be found together with other substances such as water and solvents (eg, hydrates and solvates) or may be isolated.

[0110] In certain embodiments, preparation of the compounds may involve the addition of an acid or base to effect, for example, catalysis of a desired reaction or the formation of a salt form (eg, an acid addition salt).

[0111] Exemplary acids can be inorganic or organic acids and include, but are not limited to, strong acids and weak acids. Some exemplary acids include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, p-toluenesulfonic acid, 4-nitrobenzoic acid, methanesulfonic acid, benzenesulfonic acid, trifluoroacetic acid, and nitric acid. Some weak acids include, but are not limited to, acetic acid, propionic acid, butyric acid, benzoic acid, tartaric acid, valeric acid, caproic acid, enanthic acid, octanoic acid, nonanoic acid, and decanoic acid.

[0112] Exemplary bases include lithium hydroxide, sodium hydroxide, potassium hydroxide, lithium carbonate, sodium carbonate, potassium carbonate and sodium bicarbonate. Certain exemplary strong bases include, but are not limited to, hydroxides, alkoxides, metal amides, metal hydrides, metal dialkylamides and aromatic amines, wherein: alkoxides include lithium, sodium and potassium salts of methyl, ethyl and tert-butyl oxides; metal amides include sodium amide, potassium amide and lithium amide; metal hydrides include sodium hydride, potassium hydride and lithium hydride; metal dialkylamides include lithium, sodium and potassium salts of amides substituted with methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, trimethylsilyl and cyclohexyl.

[0113] The present application also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the compounds described herein, wherein the parent compound is modified by converting an existing acid or base moiety into its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, organic acid salts of mineral or basic residues (such as amines); alkali metal salts or organic salts of acidic residues (such as carboxylic acids); etc. The pharmaceutically acceptable salts of the present application include conventional non-toxic salts formed by the parent compound, for example, formed by non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present application can be synthesized by conventional chemical methods from a parent compound containing a basic or acidic moiety. Typically, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or an organic solvent or a mixture of the two; typically, non-aqueous media such as ether, ethyl acetate, alcohols (e.g., methanol, ethanol, isopropanol or butanol) or acetonitrile (MeCN) are preferred. Lists of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th edition, Mack Publishing Company, Easton, Pa., 1985, page 1418 and Journal of Pharmaceutical Science, 66, 2 (1977). Conventional methods for preparing salt forms are described, for example, in Pharmaceutical Salts: Properties, Selection, and Use, Wiley-VCH, 2002.

[0114] In certain embodiments, provided herein are compounds or salts thereof that are substantially isolated. "Substantially isolated" means that a compound is at least partially or substantially isolated from the environment in which it is formed or detected. Partial separation may include, for example, a composition rich in a compound provided herein. Substantially isolated may include a composition containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or at least about 99% weight of a compound or salt thereof provided herein. Methods for separating compounds and their salts are conventional methods in the art.

[0115] Throughout this application, various publications are cited. The disclosures of these publications are hereby incorporated by reference into this application in their entirety to more fully describe the prior art related thereto. The disclosed references are also individually and specifically incorporated by reference into the materials contained therein, which are discussed in the sentence in which the reference is relied upon.

[0116] Composition

[0117] Disclosed are components for preparing disclosed compositions and compositions themselves used in methods disclosed herein. These and other materials are disclosed herein, and it should be understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed, although specific references to each different individual and collective combination and arrangement of these compounds may not be explicitly disclosed, each is specifically considered and described herein. For example, if a specific compound is disclosed and discussed and many modifications that can be made at multiple positions of the compound are discussed, each combination and arrangement of the compound and possible modifications are specifically considered, unless otherwise specifically indicated. Therefore, if a class of molecules A, B and C and a class of molecules D, E and F and an example AD of a combined molecule are disclosed, then even if each is not separately narrated, each is a meaningful combination considered separately and together, AE, AF, BD, BE, BF, CD, CE and CF are considered to be disclosed. Similarly, any subset or combination of these is also disclosed. Therefore, for example, AE, BF and CE subgroups will be considered to be disclosed. This concept applies to all aspects of the present application, including but not limited to steps in the method of making and using the disclosed composition. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

[0118] Accumulation of protoporphyrin IX (PPIX) in the skin contributes to phototoxicity in patients with erythropoietic protoporphyria (EPP). PPIX is an electron-rich tetrapyrrole. When patients with EPP are exposed to light, PPIX excites and releases its energy into oxygen, which generates free radicals and causes skin damage. Symptoms of skin reactions include purpura, erythema, edema, and a burning sensation in the skin. As a result, patients with EPP must avoid light by reducing outdoor activities and / or using protective clothing, which can significantly reduce their social and work activities and overall quality of life. Current therapies for phototoxicity in patients with EPP focus on reducing light penetration into the skin and / or managing skin damage caused by light-excited PPIX. Beta-carotene has been used in patients with EPP for its antioxidant effects and ability to increase skin pigmentation and reduce light penetration into the skin, but with limited success. Afamelanotide reduces skin symptoms in patients with EPP by increasing melanin synthesis and reducing light penetration into the skin. Despite these treatment options, no treatment currently addresses the underlying cause of EPP phototoxicity, which is the accumulation of PPIX in the skin. Likewise, accumulation of PPIX has been shown to be the underlying cause of phototoxicity in X-linked protoporphyria (XLP).

[0119] The composition may include a small molecule ABCG2 inhibitor. ABCG2 inhibitors are known in the art and have been described (see, e.g., Ricci et al. J Develop Drugs, 2015, 4: 138, which is attached as an appendix to this application and incorporated herein by reference). Exemplary ABCG2 inhibitors are also described in U.S. Patent Application Publication No. 2017 / 0224837 to Chang et al., which is incorporated herein by reference in its entirety.

[0120] Examples of ABCG2 inhibitors include, for example, 1,4-dihydropyridines; artesunate; AST1306; bifendate-chalcone mixtures; Botryllamides; cadmium; calcium channel blockers (e.g., nicardipine, nitrendipine, nimodipine, dipyridamole); camptothecin analogs (e.g., ST1481, CHO793076); cannabinoids; CCT129202; chalcone; curcumin; cyclosporin (e.g., cyclosporin A); dihydropyridines and pyridines; dimethoxyaurone; dofequindane fumarate; EGFR inhibitors; flavonoids and benzoflavonoids; flavonoids; bergamot; 6′,7′-dihydroxybergamot; Hesperidin; nobiletin; hesperidin; hesperidin; quercetin; kaempferol; fumonisin C; fumonisin C analogs (e.g., KO143); gefitinib; GF120918; BNP1350; GW583340; GW2974; HM30181 and its derivatives; antimicrobial peptides (e.g., human antimicrobial peptides); imatinib mesylate; MBL-II-141; ML753286; lapatinib; LY294002; MBLI-87; methoxystilbene; mithramycin A; quercetin derivatives; naphthopyranone; nilotinib; novobiocin; NP-1250; olomocin II and purvalanol A; organochlorines and pyrethroids; OSI-930; phytoestrogens / flavonoids; piperazinylbenzopyrones; phenylalkylaminobenzopyrones; ponatinib; PZ-39; quinazolines; quizartinib; sildenafil; sorafenib; substituted chromones; sunitinib; tandutinib; tariquidar; terpenes; CI1033; toremifene; XR9577; WK-X-34; WK-X-50; WK-X-84; YHO-13177; and YHO-13351.

[0121] In certain embodiments, the ABCG2 inhibitor can include fumonisin C, KO143, GF120918, YHO-13351, curcumin, CID44640177, CID1434724, CID46245505, CCT129202, artesunate, ST1481, dihydropyridine, dofequindafumarate, gefitinib, imatinib mesylate, lapatinib, WK-X-34, YHO-13177, MBL-II-141, ML753286, or any combination thereof.

[0122] In certain embodiments, the ABCG2 inhibitor can include fumonisin C, KO143, GF120918, YHO-13351, curcumin, CID44640177, CID1434724, CID46245505, CCT129202, artesunate, ST1481, dihydropyridine, dofequine fumarate, gefitinib, imatinib mesylate, lapatinib, WK-X-34, YHO-13177, or any combination thereof.

[0123] The structures of some of these ABCG2 inhibitors are provided below.

[0124]

[0125]

[0126]

[0127] In certain embodiments, the ABCG2 inhibitor can be defined by the following formula I

[0128]

[0129] in

[0130] A Choose freedom The group composed of;

[0131] n is an integer from 0 to 6;

[0132] X, when present, is selected from the group consisting of CH2, O and S;

[0133] R 1 Selected from the group consisting of: H, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, CN, NO2, OR a , SR a 、C(O)R b 、C(O)NR c R d 、C(O)OR a 、OC(O)R b 、OC(O)NR c R d NR c R d NR c OR d NR cC(O)R b NR c C(O)OR a NR c C(O)NR c R d 、C(=NR e )R b 、C(=NR e )NR c R d NR c C(=NR e )NR c R d NR c S(O)R b NR c S(O)2R b NR c S(O)2NR c R d 、S(O)R b 、S(O)NR c R d 、S(O)2R b and S(O)2NR c R d , wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0134] R 2 and R 3 independently selected from the group consisting of: H, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, CN, NO2, OR a and SR a , wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected RA Group;

[0135] R 4 and R 5 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0136] R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group;

[0137] R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group;

[0138] R 10 Selected from the group consisting of: C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0139] Each R a , R b , R c and R d Independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl; wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are each optionally substituted with 1, 2, 3 or 4 independently selected R A Group;

[0140] Each R e Independently selected from H, CN, C 1-6 Alkyl, C 1-6Haloalkyl, C 1-6 Alkylthio, C 1-6 Alkylsulfonyl, C 1-6 Alkylcarbonyl, C 1-6 Alkylaminosulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, aminosulfonyl, C 1-6 Alkylaminosulfonyl and di(C 1-6 alkyl)aminosulfonyl; and

[0141] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0142] or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0143] In certain embodiments, R 4 and R 5 Both can be hydrogen.

[0144] In certain embodiments, R 2 and R 3 Independently selected from H and C1-6 alkyl group, wherein the C 1-6 The alkyl group is optionally substituted with 1, 2, 3 or 4 independently selected R A Group.

[0145] In certain embodiments, R 2 It may be isobutyl.

[0146] In certain embodiments, R 3 Can be hydrogen. In other embodiments, R 3 It may be methyl.

[0147] In certain embodiments, R 1 Can be selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl and OR a ; wherein, the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl and C 1-4 The haloalkyl group is optionally substituted with 1, 2, 3 or 4 independently selected R A group; and wherein, when present, R A Selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 haloalkyl; wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl and C 1-4 Each haloalkyl group is optionally substituted with 1, 2, 3 or 4 independently selected R A Group.

[0148] In certain embodiments, R 1 Can be hydrogen. In other embodiments, R 1 It can be selected from hydroxyl, C 1-4 Alkyl and C 1-4 The group consisting of alkoxy groups, wherein the C 1-4 Alkyl and C 1-4 Each alkoxy group is optionally substituted with 1, 2, 3 or 4 independently selected R A For example, in some embodiments, R 1 It may be methoxy.

[0149] In certain embodiments, when present, X is selected from O and S.

[0150] The composition may comprise a small molecule defined by Formula IA

[0151]

[0152] in

[0153] n is an integer from 0 to 6;

[0154] R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A group; and

[0155] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0156] or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0157] In certain embodiments, n can be an integer from 1 to 4.

[0158] In certain embodiments, R 6 and R 7 Each independently selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 The group consisting of cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A In other embodiments, R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group.

[0159] The composition may comprise a small molecule defined by the following formula IB

[0160]

[0161] in

[0162] n is an integer from 0 to 6;

[0163] R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group substitution, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A group; and

[0164] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0165] or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0166] In certain embodiments, n can be an integer from 1 to 4.

[0167] In certain embodiments, R 9 It's hydrogen.

[0168] In certain embodiments, R 8 Can be selected from the group consisting of: H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A In other embodiments, R 8 and R 9 Together with the atoms to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group.

[0169] The composition may comprise a small molecule defined by the following formula IC

[0170]

[0171] in

[0172] n is an integer from 0 to 6;

[0173] R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected RA group; and

[0174] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0175] Or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0176] In certain embodiments, n can be an integer from 1 to 4.

[0177] In certain embodiments, R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected RA In other embodiments, R 6 and R 7 Together with the N atom to which they are attached, they form a 4-9 membered heterocycloalkyl or a 5-6 membered heteroaryl, each optionally substituted with 1, 2 or 3 independently selected R A Group.

[0178] In certain embodiments, the ABCG2 inhibitor can be defined by the following formula ID

[0179]

[0180] in

[0181] n is an integer from 0 to 6;

[0182] X is selected from the group consisting of CH2, O and S;

[0183] R 10 Selected from the group consisting of: C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 3-10 Cycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl are optionally substituted with 1, 2, 3 or 4 independently selected R A group; and

[0184] Each R A independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 Alkyl)aminocarbonylamino;

[0185] or a pharmaceutically acceptable salt, ester or N-oxide thereof.

[0186] In certain embodiments, when present, X is selected from the group consisting of O and S. In certain embodiments, X is O. In certain embodiments, X is S.

[0187] In certain embodiments, n is an integer from 1 to 4 (eg, n is 3).

[0188] The above-mentioned ABCG2 inhibitors (e.g., ABCG2 inhibitors described in Formula I, Formula IA, Formula IB, Formula IC and / or Formula ID) can also be used in combination with other treatment methods involving inhibition of ABCG2. For example, these ABCG2 inhibitors can be used to enhance chemotherapy of tumor cells, reduce resistance of cancer cells to chemotherapeutic agents, reduce ABCG2 transporter activity in cancer cells, or a combination thereof. For example, such methods are described in U.S. Patent Nos. 9,937,217; 9,314,448; and 9,056,111, each of which is incorporated herein by reference in its entirety. Similarly, the above-mentioned ABCG2 inhibitors (e.g., ABCG2 inhibitors described in Formula I, Formula IA, Formula IB, Formula IC and / or Formula ID) can be used in methods described in, for example, U.S. Patent Nos. 9,937,217; 9,314,448; and 9,056,111.

[0189] Pharmaceutical carriers / delivery of pharmaceutical products

[0190] As mentioned above, the composition can also be administered in vivo in a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" refers to materials that are not biological or otherwise undesirable, i.e., the material can be administered to a subject together with a nucleic acid or a carrier without causing any undesirable biological effects or interacting in a harmful manner with other components of any pharmaceutical composition comprising it. As is well known to those skilled in the art, the carrier will naturally be selected to minimize any degradation of the active ingredient and minimize any adverse side effects in the subject.

[0191] The composition can be administered orally, parenterally (e.g., intravenously), intramuscularly, intraperitoneally, transdermally, in vitro, topically, etc., including topical intranasal administration or inhalant administration. As used herein, "topical intranasal administration" refers to delivery of the composition to the nose and nasal passages through one or both nostrils, and may include delivery by a spray mechanism or a drop mechanism, or by aerosolization of nucleic acids or vectors. Administration of the composition by inhalant can be delivered through the nose or mouth by a spray or drop mechanism. It can also be delivered directly to any area of ​​the respiratory system (e.g., lungs) by intubation. The exact amount of the composition required varies from subject to subject, depending on the species, age, weight, and general condition of the subject, the severity of the allergic disease being treated, the specific nucleic acid or vector used, its mode of administration, etc. Therefore, it is impossible to specify an exact amount for each composition. However, the appropriate amount can be determined by a person of ordinary skill in the art using only routine experiments given the teachings.

[0192] If parenteral administration of the composition is used, it is generally characterized by injection. Injections can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for dissolving the suspension in a liquid prior to injection, or as an emulsion. Recently revised parenteral administration methods involve the use of slow-release or sustained-release systems to maintain a constant dose. See, e.g., U.S. Pat. No. 3,610,795, which is incorporated herein by reference.

[0193] The material may be a solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). These can be targeted to specific cell types via antibodies, receptors, or receptor ligands. The following references are examples of using this technology to target specific proteins to tumor tissues (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). Carriers such as "stealth" and other antibody-coupled liposomes (including lipid-mediated drug targeting of colon cancer), receptor-mediated targeting of DNA through cell-specific ligands, lymphocyte-mediated tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of using this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49: 6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)). In general, receptors participate in constitutive or ligand-induced endocytosis pathways. These receptors are aggregated in clathrin-coated pits, enter cells through clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and then recycle to the cell surface, stored in the cell, or degraded in lysosomes. The internalization pathway has a variety of functions, such as nutrient absorption, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and receptor level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, ligand valence, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0194] Pharmaceutically acceptable carrier

[0195] Compositions including antibodies can be combined with a pharmaceutically acceptable carrier for use in therapy.

[0196] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th edition), ed. A. R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically acceptable salt is used in the formulation to make the formulation isotonic. Examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution. The pH of the solution is preferably from about 5 to about 8, more preferably from about 7 to about 7.5. Other carriers include sustained release formulations, such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which are in the form of molded articles, such as films, liposomes, or microparticles. It will be apparent to those skilled in the art that certain carriers may be more preferred, depending, for example, on the route of administration and the concentration of the composition being administered.

[0197] Pharmaceutical carriers are known to those skilled in the art. These are most typically standard carriers for administering drugs to humans, including solutions such as sterile water, saline, and buffered solutions with physiological pH. The composition can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0198] In addition to the selected molecule, the pharmaceutical composition may also include carriers, thickeners, diluents, buffers, preservatives, surfactants, etc. The pharmaceutical composition may also include one or more active ingredients, such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.

[0199] The pharmaceutical composition can be administered in a variety of ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be topical (including ocular, vaginal, rectal, intranasal), oral, inhaled, or parenteral, such as by intravenous infusion, subcutaneous, intraperitoneal or intramuscular injection. The disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavitary or transdermally.

[0200] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution or fixed oils. Intravenous carriers include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose), etc. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, etc.

[0201] Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

[0202] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be required.

[0203] Certain compositions may be administered as pharmaceutically acceptable acid or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.

[0204] Therapeutic Uses

[0205] The effective dose and schedule for administering the composition can be determined empirically, and such determination is made within the technical scope of the art. The dosage range of the composition is large enough to produce the desired effect affecting the symptoms of the disease. The dose should not be so large as to cause adverse side effects, such as undesirable cross-reactions, allergic reactions, etc. Generally, the dosage will vary with the patient's age, condition, sex and degree of disease, route of administration or whether other drugs are included in the regimen, and can be determined by those skilled in the art. In the case of any contraindications, the dosage can be adjusted by an individual physician. The dosage can vary and can be administered once or more per day for one or more days. Guidance on the appropriate dosage of a given class of drugs can be found in the literature. For example, guidance for selecting an appropriate antibody dosage can be found in the literature on the therapeutic use of antibodies, for example, Handbook of Monoclonal Antibodies, Ferrone et al., ed., Noges Publications, Park Ridge, NJ, (1985) Chapter 22 and pages 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., ed., Raven Press, New York (1977) pages 365-389. Depending on the above factors, a typical daily dosage of an antibody used alone may be about 1 μg / kg to as high as 100 mg / kg body weight or more per day.

[0206] Methods of treating erythropoietic protoporphyria (EPP) or X-linked protoporphyria (XLP)

[0207] It is understood and contemplated herein that the efflux of PPIX and the resulting accumulation of PPIX (i.e., the cause of phototoxicity) is dependent on the activity of ABCG2. Thus, the disclosed ABCG2 inhibitors can prevent PPIX efflux and thus treat EPP and XLP and any symptoms associated therewith. Thus, in one aspect, disclosed herein is a method of treating, preventing, reducing or inhibiting erythropoietic protoporphyria (EPP) or X-linked protoporphyria (XLP) in a subject, comprising administering to the subject any therapeutic agent disclosed herein that inhibits ABCG2 activity.

[0208] As used herein, "treating," and grammatical variations thereof, as used herein, include administering a composition with the intent or purpose of partially or completely preventing, delaying, treating, curing, alleviating, mitigating, altering, remedying, ameliorating, improving, stabilizing, alleviating, and / or reducing the intensity or frequency of one or more diseases or conditions, symptoms of a disease or condition, or the underlying cause of a disease or condition. Treatment according to the invention may be applied preventively, prophylactically, alleviatingly, or therapeutically. Preventive treatment is administered to a subject prior to onset (e.g., prior to overt signs of EPP or XLP), during early onset (e.g., after initial signs and symptoms of EPP or XLP), or after development of established cancer. Preventive administration may be performed from days to years before symptoms of infection appear.

[0209] " reduction " can refer to any variation of the amount that causes less gene expression, protein production, symptom, disease, composition, situation or activity.When the genetic output of the gene product utilizing this material is lower than the output of the gene product that does not utilize this material, this material is also understood to reduce the genetic output of gene.In addition, for example, reduction can be the variation of disease symptom, makes symptom less than observed before.Reduction can be any individual, median or average reduction of disease, symptom, activity, composition with statistically significant amount.Therefore, reduction can be 1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100% reduction, as long as reduction is statistically significant.

[0210] "Inhibit" refers to reducing an activity, response, condition, disease or other biological parameter. This can include, but is not limited to, completely eliminating an activity, response, condition or disease. This can also include, for example, a 10% reduction in activity, response, condition or disease compared to a native or control level. Thus, the reduction can be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100% or any reduction therebetween compared to a native or control level.

[0211] As used herein, the term "prevent," "prevent," "prevent," "preventing," and grammatical variations thereof refer to a method of partially or completely delaying or preventing the onset or recurrence of a disease and / or one or more of its attendant symptoms, or preventing a subject from acquiring or reacquiring a disease or reducing the risk of a subject acquiring or reacquiring a disease or one or more of its attendant symptoms.

[0212] It should be understood and contemplated herein that treating, inhibiting, preventing or reducing EPP or XLP is not necessarily associated with a cure outcome, but may include alleviating symptoms of EPP or XLP, including but not limited to phototoxicity, purpura, erythema, edema, or burning sensation of the skin. Thus, in one aspect, disclosed herein is a method of treating, preventing, reducing or inhibiting phototoxicity, purpura, erythema, edema, or burning sensation of a subject's skin, comprising administering to the subject any therapeutic agent disclosed herein that inhibits ABCG2 activity.

[0213] In addition to the skin, the liver is another target organ of PPIX toxicity in EPP, the severity of which is affected by genetic polymorphisms that regulate porphyrin homeostasis. The liver is responsible for eliminating PPIX from the body through the hepatobiliary system. Because PPIX is highly hydrophobic, excessive PPIX in the bile will precipitate and cause bile duct obstruction and cholestatic liver injury. This is a vicious cycle because PPIX-mediated bile duct obstruction causes PPIX to accumulate further in the body. A variety of pharmacological methods have been tried clinically to manage EPP-related liver damage, but none of them has produced satisfactory results. Liver transplantation is effective, but recurrence of EPP-related liver damage is common because liver transplantation cannot restore FECH function in the bone marrow or prevent PPIX from accumulating in the liver. It should be understood and expected herein that the disclosed ABCG2 inhibitor therapeutic agents disclosed herein can be used to manage EPP-related liver damage. Therefore, on the one hand, a method for reducing PPIX outflow from hepatocytes of a subject is disclosed herein, which includes administering a therapeutic agent that inhibits ABCG2 activity to the subject.

[0214] In EPP, PPIX is primarily produced in the bone marrow and transported to other organs, including the skin and liver, through the circulatory system via RBCs and plasma. The efflux of PPIX from RBCs into plasma depends on the transporter ABCG2, and exposure to light promotes PPIX efflux. These data lead to the hypothesis that inhibition of ABCG2 will reduce the distribution of PPIX to the skin and alleviate the phototoxicity of EPP. In addition, the retention of PPIX in hepatocytes and Kupffer cells but not in the biliary system attenuates EPP-associated hepatotoxicity. ABCG2 is expressed in hepatocytes and is responsible for the influx of PPIX from hepatocytes into the biliary system. Therefore, it is also hypothesized that inhibition of ABCG2 will reduce the amount of PPIX in the biliary system and alleviate PPIX-mediated bile duct obstruction and cholestatic liver injury. Therefore, on the one hand, a method for reducing PPIX efflux from red blood cells in a subject is disclosed herein, comprising administering to the subject a therapeutic agent that inhibits ABCG2 activity.

[0215] On the one hand, the therapeutic agent used in the disclosed method may include, but is not limited to, any small molecule disclosed herein, as well as GF120918, MBL-II-141, ML753286, and antibodies, oligonucleotides, small interfering RNA, RNAi, peptides, proteins, and / or targeted nucleic acid integration systems. Reducing or inhibiting the expression of a gene or its encoded protein may have unforeseen consequences, particularly if the induced gene expression or activity is inhibited on the off-target side. On the one hand, ABCG2 inhibitory therapeutic agents can be designed to be expressed in specific tissues (e.g., under the control of a tissue-specific promoter), expressed under induction conditions (cre-lox, flp or tet inducible promoter systems, which are activated by administering a triggering compound (e.g., tetracycline), or wherein the ABCG2 knockout locus is transfected with a construct expressing Cre to remove the floxed box), or targeted to specific tissues (e.g., tissue-specific double antibodies or bivalent constructs). On the one hand, the therapeutic agent can be a targeted nucleic acid integration system, such as a CRISPR / Cas9 system, in which a guide RNA (gRNA) targets the ABCG2 gene.

[0216] Antibody

[0217] As described above, the disclosed methods of treatment may include administering an anti-ABCG2 antibody, including an immunotoxin, variant or fragment thereof.

[0218] General Antibodies

[0219] The term "antibody" is used in a broad sense herein and includes polyclonal and monoclonal antibodies. In addition to complete immunoglobulin molecules, the term "antibody" also includes fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or their fragments, including bivalent single-chain antibodies, double antibodies, three antibodies, and four antibodies, as long as they are selected because they can interact with ABCG2, thereby inhibiting ABCG2 to allow PPIX to flow out. The desired activity of the antibody can be tested using the in vitro assay described herein or by similar methods, and then their in vivo therapeutic and / or preventive activity is tested according to known clinical testing methods. There are five main categories of human immunoglobulins: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), such as IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2. Those skilled in the art will recognize comparable categories of mice. The heavy chain constant domains corresponding to different categories of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[0220] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, i.e., the individual antibodies in the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies, in which a portion of the heavy and / or light chain is identical or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity.

[0221] The disclosed monoclonal antibodies can be prepared using any procedure for producing monoclonal antibodies. For example, the disclosed monoclonal antibodies can be prepared using a hybridoma method, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, mice or other suitable host animals are typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Alternatively, the lymphocytes can be immunized in vitro.

[0222] Monoclonal antibodies can also be prepared by recombinant DNA methods. DNA encoding the disclosed monoclonal antibodies can be easily separated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to the heavy and light chains of encoding mouse antibodies). Phage display technology can also be used to generate and screen libraries of antibodies or active antibody fragments, for example, as described in U.S. Patent Nos. 5,804,440, 6,096,441, such as Burton et al. and Barbas et al.

[0223] In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly Fab fragments, can be accomplished using conventional techniques known in the art. For example, papain can be used for digestion. Examples of papain digestion are described in WO 94 / 29348 and U.S. Patent No. 4,342,566 published on December 22, 1994. Papain digestion of antibodies typically produces two identical antigen-binding fragments, called Fab fragments, each of which has an antigen-binding site and a residual Fc fragment. Pepsin treatment produces a fragment with two antigen-binding sites and still capable of cross-linking antigens.

[0224] In one aspect, the ABCG2 binding antibody may comprise an antibody fragment. As used herein, the term "antibody or fragment thereof" includes chimeric antibodies and hybrid antibodies having dual or multiple antigen or epitope specificities, as well as fragments such as F(ab')2, Fab', Fab, Fv, scFv, etc., including mixed fragments. Thus, antibody fragments that retain the ability to bind to their specific antigens are provided. For example, antibody fragments that retain ABCG2 binding activity are included within the meaning of the term "antibody or fragment thereof". Such antibodies and fragments can be prepared by techniques known in the art and can be screened for specificity and activity according to the methods described in the examples and methods generally used to produce antibodies and screen for specificity and activity of antibodies (see Harlow and Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988)).

[0225] The meaning of "antibody or fragment thereof" also includes conjugates of antibody fragments and antigen binding proteins (single-chain antibodies). A conjugated antibody or fragment refers to an antibody or fragment that is operably linked or otherwise physiologically or functionally associated with an effector moiety or tag, such as, inter alia, a toxic substance, a radioactive substance, a fluorescent substance, a liposome or an enzyme, as described in U.S. Pat. No. 4,704,692, the contents of which are incorporated herein by reference.

[0226] Fragments, whether or not connected to other sequences, may also include insertions, deletions, substitutions or other selected modifications of specific regions or specific amino acid residues, provided that the activity of the antibody or antibody fragment is not significantly changed or impaired compared to unmodified antibodies or antibody fragments. These modifications may provide some additional characteristics, such as removal / addition of amino acids that can form disulfide bonds, to increase their biological lifespan, change their secretion characteristics, etc. In any case, antibodies or antibody fragments must have biologically active properties, such as specific binding to their cognate antigens. The function or active region of an antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are apparent to those skilled in the art, and may include site-specific mutagenesis of nucleic acids encoding antibodies or antibody fragments. (Zoller, MJ Curr. Opin. Biotechnol. 3: 348-354, 1992).

[0227] As used herein, the term "antibody" or "antibodies" may also refer to human antibodies and / or humanized antibodies. Many non-human antibodies (e.g., antibodies from mice, rats or rabbits) have natural antigenicity in humans and therefore can cause undesirable immune responses when administered to humans. Therefore, the use of human antibodies or humanized antibodies in this method helps reduce the chance of antibodies administered to humans causing undesirable immune responses.

[0228] Human Antibodies

[0229] Any technology can be used to prepare the disclosed human antibodies. The disclosed human antibodies can also be obtained from transgenic animals. For example, transgenic mutant mice that can produce a complete human antibody library in response to immunity have been described (see, for example, Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90: 2551-255 (1993); Jakobovits et al., Nature, 362: 255-258 (1993); Bruggermann et al., Year in Immunol., 7: 33 (1993)). Specifically, the homozygous deletion of the antibody heavy chain joining region (J (H)) gene in these chimeric and germline mutant mice leads to complete suppression of endogenous antibody production, and the successful transfer of human germline antibody gene arrays into this germline mutant mouse leads to the production of human antibodies when antigens are attacked. The Env-CD4-co-receptor complex described herein is used to select antibodies with desired activity.

[0230] Humanized Antibodies

[0231] Antibody humanization techniques generally involve the use of recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule. Therefore, a humanized form of a non-human antibody (or fragment thereof) is a chimeric antibody or antibody chain (or fragment thereof, such as sFv, Fv, Fab, Fab', F(ab')2, or other antigen-binding portion of an antibody) comprising a portion of the antigen-binding site of a non-human (donor) antibody integrated into a human (acceptor) antibody framework.

[0232] In order to produce humanized antibodies, the residues from one or more complementary determining regions (CDR) of the recipient (human) antibody molecule are replaced by the residues from one or more CDRs of the donor (non-human) antibody molecule known to have desired antigen binding characteristics (for example, specificity and affinity to a specific level of target antigen). In some cases, the Fv framework (FR) residues of human antibodies are replaced by corresponding non-human residues. Humanized antibodies may also be included in residues not found in the recipient antibody and the CDR or framework sequences imported. Usually, humanized antibodies have one or more amino acid residues introduced from non-human sources. In practice, humanized antibodies are typically human antibodies, in which some CDR residues and possible some FR residues are replaced by residues in similar sites in rodent antibodies. A humanized antibody generally comprises at least a portion of an antibody constant region (Fc), typically that of a human antibody (Jones et al., Nature, 321:522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988), and Presta, Curr. Opin. Struct. Biol., 2:593-596 (1992)).

[0233] Methods for humanizing non-human antibodies are well known in the art. For example, humanized antibodies can be produced according to the method of Winter and colleagues (Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239:1534-1536 (1988)), for the corresponding sequence of human antibodies, by replacing rodent CDR sequences. Methods that can be used to produce humanized antibodies are also described in U.S. Pat. No. 4,816,567 (Cabilly et al.), U.S. Pat. No. 5,565,332 (Hoogenboom et al.), U.S. Pat. No. 5,721,367 (Kay et al.), U.S. Pat. No. 5,837,243 (Deo et al.), U.S. Pat. No. 5,939,598 (Kucherlapati et al.), U.S. Pat. No. 6,130,364 (Jakobovits et al.), and U.S. Pat. No. 6,180,377 (Morgan et al.).

[0234] Antibody administration

[0235] Administration of the antibody can be performed as disclosed herein. There are also nucleic acid methods for antibody delivery. Anti-ABCG2 antibodies and antibody fragments can also be administered to a patient or subject as a nucleic acid formulation (e.g., DNA or RNA) encoding the antibody or antibody fragment so that the patient's or subject's own cells take up the nucleic acid and produce and secrete the encoded antibody or antibody fragment. Delivery of the nucleic acid can be performed by any means, for example, as disclosed herein.

[0236] Transgenic cells and animals

[0237] The EPP mouse model was developed through a loss-of-function mutation of FECH (Fech-mut). To test the hypothesis, an EPP mouse model with ABCG2 deficiency (Fech-mut / Abcg2-null) was generated. It was found that ABCG2 deficiency abolished phototoxicity and hepatotoxicity in EPP mice. It was also found that when these mice were challenged with liver-specific porphyrin chemicals, Abcg2-null mice failed to develop PPIX accumulation and hepatotoxicity. Metabolomic analysis showed that ABCG2 deficiency can prevent PPIX-mediated phototoxicity and hepatotoxicity by regulating PPIX distribution, metabolism, and excretion.

[0238] In various embodiments, provided herein are genetically modified cells and non-human animals (e.g., rodents, such as mice or rats) comprising a nucleic acid sequence encoding an ineffective mutation of an ABCG2 gene in its genome (e.g., in its germline genome). In certain aspects, the modified cells may also comprise a mutation of a FECH gene.

[0239] The term "cell" includes any cell suitable for expressing a recombinant nucleic acid sequence. Cells include prokaryotic and eukaryotic cells (single or multicellular), bacterial cells (e.g., strains of Escherichia coli, Bacillus, Streptomyces, etc.), mycobacterial cells, fungal cells, yeast cells (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, P. methylica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions, such as hybridomas or quadromas. In certain embodiments, the cell is a human, monkey, ape, hamster, rat, or mouse cell. In certain embodiments, the cell is a eukaryotic cell and is selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney (e.g., HEK293, 293EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, ColO205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT 060562, podocytes, BRL 3A cells, HT1080 cells, myeloma cells, tumor cells, and cell line cells derived from the above. In certain embodiments, the cell comprises one or more viral genes, eg, a retinal cell expressing a viral gene (eg, a PER.C6.TM. cell). In certain embodiments, the cell is an ES cell.

[0240] On the one hand, transgenic cells can include selection boxes that provide inducible and / or tissue-specific expression. Selection boxes are nucleotide sequences inserted into the targeting construct to promote the selection of cells (e.g., bacterial cells, ES cells) that have integrated the target construct. Many suitable selection boxes are known in the art (Neo, Hyg, Pur, CM, SPEC, etc.). In addition, the flanks of the selection boxes can be recombination sites, which allow the selection boxes to be deleted when treated with recombinases. Commonly used recombination sites are loxP and Frt, which are recognized by Cre and Flp enzymes, respectively, but other sites are known in the art. The selection box can be located at any position in the construct outside the coding region. In one embodiment, the selection box is inserted upstream of the invalid insertion sequence of people ABCG2.

[0241] The selection cassette used in this method can be removed by methods known to those skilled in the art. For example, ES cells with ABCG2 knockout locus can be transfected with a construct expressing Cre to remove the floxed cassette. The selection cassette can be removed alternatively by breeding with mice expressing Cre recombinase. Alternatively, the selection cassette is retained in the mouse.

[0242] Example

[0243] The following examples are presented to provide a person of ordinary skill in the art with a complete disclosure and description of how to make and evaluate the compounds, compositions, articles, devices and / or methods claimed herein, and are intended to be purely exemplary and not intended to limit the present disclosure. Efforts have been made to ensure the accuracy of numbers (e.g., amounts, temperatures, etc.), but some errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, temperatures are in ° C or ambient temperature, and pressures are equal to or close to atmospheric pressure.

[0244] Example 1: Genetic deficiency of the transporter protein ABCG2 protects against phototoxicity and hepatotoxicity in erythropoietic protoporphyria (EPP)

[0245] result

[0246] ABCG2 deficiency protects against EPP-associated phototoxicity

[0247] Fech-mut / Abcg2-null mice have a FECH loss-of-function mutation and are ABCG2-deficient (Figure 1A). When Fech-mut / Abcg2-null and Fech-mut mice were exposed to light with PPIX excitation wavelengths, Fech-mut mice developed severe skin lesions, but these phenotypes were absent in Fech-mut / Abcg2-null mice (Figures 1B, 1C, 1D, 1E, and 1F). In addition, oxidative stress and inflammation were observed in the skin of Fech-mut mice after light exposure, but not in Fech-mut / Abcg2-null mice (Figures 2A, 2B, and 2C). These data indicate that ABCG2 is a key mediator of EPP-associated phototoxicity. Next, PPIX levels in RBCs, serum, and skin of the EPP mouse model were analyzed. We found that deficiency of ABCG2 significantly increased PPIX levels in RBCs but decreased PPIX levels in serum and skin (Figures 3A, 3B, and 3C), suggesting that ABCG2 dysfunction prevents the influx of PPIX from RBCs into plasma, thereby reducing PPIX distribution to the skin and attenuating PPIX-mediated phototoxicity (Figure 3D).

[0248] ABCG2 deficiency protects against EPP-associated hepatotoxicity

[0249] As expected, liver damage occurred in Fech-mut mice, but it was abolished in Fech-mut / Abcg2-null mice (Figure 4). Serum biomarkers of liver damage were significantly reduced in Fech-mut / Abcg2-null mice compared with Fech-mut mice (Figures 4A, 4B, 4C, and 4D). The reduction in serum alkaline phosphatase (ALP) activity in Fech-mut / Abcg2-null mice (Figure 4C) indicated a reduction in cholestatic liver damage. In fact, PPIX levels in the livers of Fech-mut / Abcg2-null mice were significantly reduced (Figure 4E), and PPIX-mediated bile duct obstruction and bile thrombus were not observed in the livers of Fech-mut / Abcg2-null mice (Figures 4F, 4G, 4H, and 4I). Liver fibrosis is a key step in the progression of EPP-related liver damage. Liver fibrosis was observed in Fech-mut mice, but it was abolished in Fech-mut / Abcg2-null mice (measured by total fibrosis area and mRNA expression). The data showed that the expression levels of collagen 1a1 and 1a2 in Fech-mut mice were more than 15 times that of Fech-mut / Abcg2-null mice. In addition, compared with Fech-mut mice, where the fibrosis area increased 8-fold, the fibrosis area in Fech-mut / Abcg2-null mice was at background levels. These data suggest that ABCG2 plays a crucial role in the development of EPP-related liver damage.

[0250] ABCG2 deficiency protects against chemical-induced PPIX accumulation and hepatotoxicity

[0251] To further determine the role of ABCG2 in PPIX-mediated liver injury, wild-type (WT) and Abcg2-null mice were challenged with DDC or GSF, two model chemicals that cause hepatic PPIX accumulation and hepatotoxicity. While DDC and GSF caused liver injury, PPIX accumulation, and bile thrombosis in WT mice, these effects did not occur in Abcg2-null mice (Figures 5 and 6). In addition to DDC and GSF, previous studies have found that combined treatment with RIF and INH causes hepatic PPIX accumulation and hepatotoxicity through a pathway mediated by the human pregnane X receptor (hPXR). To determine the role of ABCG2 in RIF- and INH-induced PPIX accumulation and hepatotoxicity, an ABCG2-deficient hPXR mouse model (hPXR / Abcg2-null) was generated (Figure 7A). Hepatotoxicity as well as PPIX accumulation and bile thrombus were observed in hPXR mice co-treated with RIF and INH, but these phenotypes were abolished in hPXR / Abcg2-null mice (Figures 7B, 7C, 7D, 7E, and 7F). These data further confirmed that PPIX-mediated liver injury is dependent on ABCG2.

[0252] ABCG2 deficiency regulates PPIX distribution, metabolism, and excretion

[0253] To understand the mechanism by which ABCG2 deficiency abolishes PPIX accumulation and hepatotoxicity, metabolomic analysis of liver and bile samples was performed in WT and Abcg2-null mice treated with deuterium-labeled aminolevulinic acid (D2-ALA), a precursor of PPIX ( Fig. 8A , 8B and 8C). As expected, D 16 -PPIX was identified as a downstream metabolite of D2-ALA. Consistent with the concept that PPIX is a substrate of ABCG2, D 16 -PPIX excretion into bile was significantly reduced (Figure 8D), indicating that ABCG2 deficiency can directly reduce PPIX levels in the biliary system, thereby preventing PPIX-mediated bile duct obstruction. Interestingly, a small amount of D 16 -PPIX (Fig. 8D), suggesting that transporters other than ABCG2 may be involved in PPIX efflux, although they are less efficient. We observed compensatory changes in efflux transporters (e.g., Mdr1, Mdr2, Bsep, Mrp2, Abcg5, and Abcg8) in the livers of ABCG2-deficient mice.

[0254] Metabolomics analysis also revealed D16-protoporphyrin-1-O-acyl-glucuronide (D 16 -PPIX-glu), a D16 -Conjugated metabolite of PPIX. 16 The structure of -PPIX-glu was verified by comparing it with a synthetic PPIX-glu chemical standard (Figure 9). Interestingly, D 16 -PPIX-glu levels were significantly increased (Figures 8E and 8F). PPIX-glu was also identified in the bile of Fech-mut / Abcg2-null mice (Figure 8G). In addition to PPIX-glu, two known conjugated metabolites of PPIX, protoporphyrin-1-O-acyl-β-glucoside and protoporphyrin-1-O-acyl-β-xyloside, were also identified in the bile of Fech-mut / Abcg2-null mice (Figure 8G). Overall, the conjugated metabolites of PPIX in the bile of Fech-mut / Abcg2-null mice were significantly increased compared with Fech-mut mice (Figure 8H). Conjugated metabolites are considered to be detoxified metabolites because they are more hydrophilic and more easily excreted than the parent compound. Therefore, the data indicate that deficiency of ABCG2 in hepatocytes increases the binding pathway of PPIX and promotes PPIX excretion under EPP conditions (Figure 8I). Furthermore, deficiency of ABCG2 in RBCs reduced PPIX levels in plasma ( Figure 3B ), which in turn reduced PPIX uptake by hepatocytes and decreased PPIX levels in the biliary system, thereby alleviating PPIX-mediated bile duct obstruction ( Figure 8I ).

[0255] discuss

[0256] Phototoxicity is the most common symptom in patients with EPP. This work shows that phototoxicity in EPP depends on ABCG2. PPIX levels in RBCs were significantly increased compared to Fech-mut mice, but PPIX levels were reduced in the serum and skin of Fech-mut / Abcg2-null mice. Consistently, the phototoxicity observed in Fech-mut mice disappeared in Fech-mut / Abcg2-null mice. These data indicate that ABCG2 in RBCs drives phototoxicity in EPP by increasing the distribution of PPIX to the skin (Figure 10A). In addition, ABCG2-dependent delivery of PPIX to the biliary system leads to bile duct obstruction, which further increases the accumulation of PPIX in vivo and enhances phototoxicity (Figure 10A). The data suggest that inhibiting ABCG2 can be used as a strategy to manage EPP-associated phototoxicity, as ABCG2 deficiency reduces the accumulation of PPIX in the skin and prevents phototoxicity (Figure 10B).

[0257] In EPP, PPIX in the liver comes mainly from the bone marrow through the circulatory system, followed by de novo synthesis in hepatocytes to a lesser extent. Accumulation of PPIX in the liver can lead to liver damage, which can be life-threatening due to liver failure. It is demonstrated here that hepatotoxicity associated with EPP depends on ABCG2, which establishes high levels of PPIX in the biliary system and leads to bile duct obstruction and cholestatic liver injury (Figure 10A). In other words, EPP-related hepatotoxicity depends on ABCG2. It is shown in this article that ABCG2 deficiency eliminates hepatotoxicity in EPP by reducing the delivery of PPIX to the hepatobiliary system and alleviating PPIX-mediated bile duct obstruction (Figure 10B). In addition, ABCG2 deficiency retains PPIX in hepatocytes, where it can be metabolized into conjugated products to facilitate their excretion. Overall, ABCG2 deficiency breaks the vicious cycle of PPIX accumulation in EPP patients, thereby reducing the accumulation of PPIX in the body and attenuating hepatotoxicity (Figure 10B). These data indicate that ABCG2 is a target for managing EPP-related hepatotoxicity.

[0258] The work disclosed in this article changes the current research paradigm on the role of ABCG2 in porphyrin homeostasis and toxicity. Previous reports have shown that Abcg2-null mice are sensitive to the exogenous phototoxin pheophytin A (PPA), which is an analog of PPIX and a substrate of ABCG2. This model of phototoxicity is completely different from EPP because oral PPA bypasses ABCG2 in RBCs, and PPA is delivered directly to the skin; while the distribution of PPIX to the skin in EPP depends on ABCG2 in RBCs, and defects in ABCG2 reduce the distribution of PPIX to the skin. In addition, defects in ABCG2 in the intestine increase the bioavailability of PPA by preventing PPA from efflux back to the intestinal lumen. In addition, PPA cannot be further metabolized through the conjugation pathway because the methyl group has occupied one of the conjugation positions of PPA. In addition, defects in ABCG2 in hepatocytes hinder the excretion of PPA through the biliary system, so that PPA returns to the circulation system and is more deposited in the skin and increases phototoxicity.

[0259] Some relevant questions regarding ABCG2 dysfunction in EPP are: Is the accumulation of PPIX in RBCs safe and what is the fate of high levels of PPIX in RBCs? Mean corpuscular hemoglobin (MCH) and total hemoglobin (tHb) in the blood of the EPP mouse model were analyzed. Reduced MCH and tHb were observed in Fech-mut mice but not in Fech-mut / Abcg2-null mice. In addition, Fech-mut / Abcg2-null mice appeared healthy and had a normal breeding pattern compared to the reproductively impaired Fech-mut mice. Splenomegaly is observed in patients with EPP. Interestingly, although the levels of PPIX in the spleen of Fech-mut / Abcg2-null mice were higher than those of Fech-mut mice, deficiency in ABCG2 attenuated EPP-associated splenomegaly. These data suggest that accumulation of PPIX in RBCs is safe in ABCG2-deficient EPP. The life span of RBCs is approximately 120 days; they are then recycled by macrophages in the spleen and liver. Thus, high levels of PPIX in RBCs of Fech-mut / Abcg2-null mice ultimately enter macrophages in the spleen and liver, which is protective because PPIX is retained in Kupffer cells, resident liver macrophages, attenuating EPP-associated hepatotoxicity.

[0260] In conclusion, the present work demonstrates that the transporter protein ABCG2 is a key mediator in the pathophysiology of EPP, suggesting that ABCG2 is a target for EPP therapy. The findings in EPP may also be useful in managing the toxicity of porphyrin drugs / chemicals and another porphyria, XLP, as they both share a similar biochemical basis to EPP in terms of PPIX accumulation.

[0261] Materials and methods

[0262] Animal development, characterization, and maintenance

[0263] Fech-mut / Abcg2-null mice were generated by crossing Fech-mut mice with Abcg2-null mice. Abcg2-null mice were originally generated in Dr. Schinkel's group and obtained from Taconic Biosciences, Inc (Hudson, NY). Fech-mut mice were purchased from Jackson Laboratory (Bar Harbor, ME), which was originally developed based on the loss-of-function mutation of FECH. Fech-mut / Abcg2-null mice were validated by PCR genotyping of Fech mutation and mouse Abcg2. hPXR / Abcg2-null mice were generated by crossing hPXR mice with Abcg2-null mice. hPXR mice were originally generated by bacterial artificial chromosome (BAC) transgenesis. hPXR / Abcg2-null mice were validated by PCR genotyping of human PXR, mouse Pxr, and mouse Abcg2. All mice (2-4 months old, male) were maintained under a standard 12-hour light / dark cycle. The mice were treated in accordance with the research protocol approved by the Institutional Animal Care and Use Committee.

[0264] Animal studies to determine the role of ABCG2 in EPP-associated phototoxicity

[0265] WT, Abcg2-null, Fech-mut and Fech-mut / Abcg2-null mice were used to determine the role of ABCG2 in EPP-related phototoxicity. In brief, the back skin of mice was shaved and exposed to ultraviolet light (395-410nm) for 30 minutes every day for 5 days. All mice were killed on the 6th day. The back skin was harvested for histological analysis. Skin samples were also used to measure PPIX.

[0266] Animal studies to determine the role of ABCG2 in EPP-associated hepatotoxicity

[0267] WT, Abcg2-null, Fech-mut, and Fech-mut / Abcg2-null mice were maintained under the same conditions and sacrificed at similar ages. Liver and blood samples were collected for assessment of liver injury. Liver, bile, spleen, and blood samples were used for analysis of PPIX and its metabolites.

[0268] Animal studies to determine the role of ABCG2 in chemically induced PPIX accumulation and hepatotoxicity

[0269] WT and Abcg2-null mice were treated with DDC (0.1% in the diet) or GSF (2.5% in the diet) for two weeks. In addition, hPXR and hPXR / Abcg2-null mice were treated with RIF (100 mg / Kg diet) and INH (400 mg / L drinking water) for 4 weeks. After treatment, blood and liver samples were collected for assessment of liver damage and analysis of PPIX.

[0270] Animal studies to determine the role of ABCG2 in regulating PPIX distribution, metabolism, and excretion

[0271] WT and Abcg2-null mice were treated with D2-ALA (50 mg / Kg, ip), a stable isotope-labeled PPIX precursor. One hour after D2-ALA treatment, liver and bile samples were collected for metabolomics analysis. In brief, liver and bile samples were analyzed by ultra-high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (UPLC-QTOFMS, Waters Corp, Milford, MA). The centroid and integrated mass spectrometry data were processed by MarkerLynx software (Waters Corp, Milford, MA) to generate a multivariate data matrix. These data were then exported to SIMCA-P+ software (Umetrics, Kinnelon, NJ) for multivariate data analysis. Principal component analysis (PCA) and orthogonal projection of latent structure discriminant analysis (OPLS-DA) were performed to represent the main latent variables in the data matrix. Structural identification was performed on variables that contributed significantly to the distinction between groups.

[0272] statistics

[0273] Data are shown as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism 7.0. One-way analysis of variance (ANOVA) with Tukey post hoc test was used to compare differences between multiple groups. Two-tailed Student's t-test was used to compare differences between two groups. P values ​​< 0.05 were considered statistically significant.

[0274] Chemicals and reagents

[0275] Protoporphyrin IX (PPIX), 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC), griseofulvin (GSF), rifampicin (RIF), isoniazid (INH), N-methylmorpholine, and glucuronic acid were purchased from Sigma-Aldrich (St. Louis, MO). Deuterium-labeled aminolevulinic acid (D2-ALA) was purchased from CDN Isotopes (Pointe-Claire, Quebec, Canada). 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridine 3-oxide hexafluorophosphate (HATU) was purchased from Oakwood Products, Inc. (West Columbia, SC). All solvents used for metabolite analysis were of the highest grade commercially available.

[0276] Sample preparation for metabolite analysis

[0277] PPIX and / or its metabolites were analyzed in RBC, serum, liver, skin, spleen, and bile. Briefly, 100 μl of 80% methanol was used to extract PPIX from 3 × 10 7 PPIX was extracted from 10 RBCs. The mixture was sonicated for 10 seconds and centrifuged at 15,000g for 10 minutes. 30μl of serum sample was added to 70μl of methanol, then vortexed and centrifuged at 15,000g for 10 minutes. Liver and spleen samples were homogenized in water (100mg tissue in 500μl water), and then 200μl of acetonitrile: methanol (1:1, v / v) was added to 100μl of each homogenate, followed by vortexing and centrifugation at 15,000g for 10 minutes. Skin tissue was ground into powder under liquid nitrogen and then placed in lysis buffer [0.1M Tris.HCl (pH=8), 5mM EDTA, 0.2% SDS, 0.2M NaCl and 0.2mg / ml proteinase K] at 54°C for 18 hours (100mg tissue powder in 500μl buffer). 200 μl of acetonitrile:methanol (1:1, v / v) was added to 100 μl of each skin mixture, followed by vortexing and centrifugation at 15,000 g for 10 min. 2 μl of bile sample was added to 80 μl of 50% acetonitrile in water, followed by vortexing for 30 s and centrifugation at 15,000 g for 10 min. Each supernatant was transferred to an autosampler vial, and 1.0 μl was injected into UPLC-QTOFMS for metabolite analysis.

[0278] UPLC-QTOFMS analysis

[0279] An Acquity BEH C18 column (2.1×100 mm, 1.7 μm, Waters, Milford, MA) was used for metabolite separation. The flow rate of the mobile phase was 0.5 ml / min, using a gradient ranging from 5% to 95% acetonitrile / water containing 2 mM NH4HCO3 and 0.05% ammonia. The column temperature was maintained at 50°C. The QTOFMS was operated in the positive mode of electrospray ionization. The source and desolvation temperatures were set to 150°C and 500°C, respectively. Argon was used as a collision gas. Nitrogen was used as a cone and desolvation gas. The capillary and cone voltages were set to 0.8 kV and 40 V, respectively. MS data (50-1,000 Da) were acquired in a centroid format. Tandem mass fragmentation scans with collision energies rising from 20 eV to 60 eV were used for structural elucidation of the metabolites.

[0280] Synthesis of Protoporphyrin-1-O-acyl-glucuronide (PPIX-glu)

[0281] Based on MS / MS data, PPIX-glu was considered to be a metabolite of PPIX. To confirm its structure, PPIX-glu was synthesized. Briefly, PPIX was first activated using HATU in the presence of N-methylmorpholine at room temperature for 14 h and then reacted with D-glucuronic acid to form PPIX-glu.

[0282] Clinical Chemistry

[0283] Liver injury was assessed by analyzing serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) (Pointe Scientific Canton, MI) and total bilirubin (Sigma-Aldrich, St. Louis, MO). These liver injury biomarkers were analyzed according to the standard procedures provided by the manufacturer. Hematologic toxicity was assessed by analyzing mean corpuscular hemoglobin (MCH) (HESKA HemaTrue; Loveland, CO) and total hemoglobin (tHb) (AVOXimeter 4000; Edison, NJ).

[0284] Histological analysis

[0285] Liver and skin tissues were first fixed overnight in 4% phosphate-formaldehyde solution, then dehydrated and embedded in paraffin. 4 μm sections were cut and stained. For hematoxylin and eosin (H&E) staining, tissue sections were stained in hematoxylin solution for 5 min, rinsed in tap water for 1 min, then differentiated in 1% acetic acid solution for 1 min, and then stained in eosin solution for 1 min. For Sirius red staining, tissue sections were stained in 0.1% Sirius red solution for 1 h, then washed twice with 1% acetic acid solution.

[0286] Fluorescence analysis of PPIX

[0287] Frozen liver tissue was mounted in Tissue-Tek OCT compound (Sakura Finetek, Torrance, CA) and cut into 10 μm sections. Liver sections were then analyzed by fluorescence microscopy (BZ-X710; Keyence Corporation, Osaka, Japan). PPIX is represented in red. Cell nuclei were stained with DAPI and represented in blue.

[0288] Quantitative PCR (qPCR) analysis

[0289] Total mRNA was extracted from liver and skin tissues using TRIzol reagent (Invitrogen, Carlsbad, CA), and complementary DNA (cDNA) was generated from 1 μg of total RNA using the SuperScript II reverse transcriptase kit and random oligonucleotides (Invitrogen). qPCR analysis used 25 ng cDNA, 150 nM of each primer (TNF-α forward primer (SEQ ID NO: 1), TNF-α reverse primer (SEQ ID NO: 2), IL-1β forward primer (SEQ ID NO: 3), IL-1β reverse primer (SEQ ID NO: 4), collagen 1a1 forward primer (SEQ ID NO: 5), collagen 1a1 reverse primer (SEQ ID NO: 6), collagen 1a2 forward primer (SEQ ID NO: 7), collagen 1a2 reverse primer (SEQ ID NO: 8), Mdr1 forward primer (SEQ ID NO: 9), Mdr1 reverse primer (SEQ ID NO: 10), Mdr2 forward primer (SEQ ID NO: 11), Mdr2 reverse primer (SEQ ID NO: 12), Bsep forward primer (SEQ ID NO: 13), Bsep reverse primer (SEQ ID NO: 14), and Bsep reverse primer (SEQ ID NO: 15). NO: 14), Mrp2 forward primer (SEQ ID NO: 15), Mrp2 reverse primer (SEQ ID NO: 16), Abcg5 forward primer (SEQ ID NO: 17), Abcg5 reverse primer (SEQ ID NO: 18), Abcg8 forward primer (SEQ ID NO: 19), and Abcg8 reverse primer (SEQ ID NO: 20)) and 5 μL of SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in a total volume of 10 μL. qPCR plates were read on an ABI-Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA) and quantified using the comparative CT method.

[0290] Example 2: Development of ABCG2 inhibitors and their use in the treatment of erythropoietic protoporphyria (EPP)

[0291] Although several structures with different scaffolds have been published as ABCG2 inhibitors, they hardly work effectively in vivo. KO143, a structural analog of fumonisin C, is a potent and selective ABCG2 inhibitor. However, KO143 has poor oral pharmacokinetic characteristics. KO143 was found to be very unstable because the tert-butyl ester group in the KO143 structure is rapidly hydrolyzed by carboxylesterase 1 (Scheme 1). The current work developed KO143 analogs with a focus on improving metabolic stability. The inhibitory activity and cytotoxicity of these ABCG2 inhibitors were also determined. In addition, the efficacy of these ABCG2 inhibitors was evaluated in the EPP mouse model.

[0292] result

[0293] Table 1 shows the ABCG2 inhibitors developed based on amide I and their inhibitory activity, cytotoxicity, and metabolic stability. 50 , half maximum inhibitory concentration; CC 50 , 50% cytotoxic concentration.

[0294]

[0295]

[0296] Table 2 shows the ABCG2 inhibitors developed based on amide II and their inhibitory activity, cytotoxicity, and metabolic stability. 50 , half maximum inhibitory concentration; CC 50 , 50% cytotoxic concentration.

[0297]

[0298] Table 3 shows the ABCG2 inhibitors developed based on amide III and their inhibitory activity, cytotoxicity, and metabolic stability. 50 , half maximum inhibitory concentration; CC 50 , 50% cytotoxic concentration.

[0299]

[0300] Table 4 shows the ABCG2 inhibitors developed based on O-ethers and their inhibitory activity, cytotoxicity, and metabolic stability. 50 , half maximum inhibitory concentration; CC 50 , 50% cytotoxic concentration.

[0301]

[0302] Pharmacokinetics.

[0303] Based on inhibitory activity, cytotoxicity, and metabolic stability, K2, K31, and K34 were selected for pharmacokinetic studies in mice. All three KO143 analogs showed better pharmacokinetic characteristics than KO143, especially K31 ( Fig.11 ).

[0304] Efficacy of K31 against phototoxicity in the EPP mouse model.

[0305] K31 has high ABCG2 inhibitory activity, low cytotoxicity, high metabolic stability, and ideal pharmacokinetic characteristics ( Table 2 and Fig.11 ). Therefore, the effect of K31 on phototoxicity in the EPP mouse model was further investigated. It was found that treatment with K31 completely protected EPP mice from phototoxicity (Figure 12). K31 withdrawal experiments in Fech-mut mice also showed phototoxicity shortly after K31 withdrawal ( Fig.13 ).

[0306] Effects of ABCG2 inhibitors on PPIX efflux from RBCs.

[0307] The effect of K31 on PPIX efflux was evaluated. Fig.14 As shown, K31 significantly inhibited PPIX efflux from RBCs.

[0308] Summary and discussion

[0309] In conclusion, the present work developed ABCG2 inhibitors with improved metabolic stability. This paper also shows that ABCG2 inhibitors can be used to treat EPP-related phototoxicity, which is the most common symptom in EPP patients.

[0310] In addition to EPP treatment, the developed ABCG2 inhibitors can also be used to prevent multidrug resistance (MDR) in cancer treatment. Many anticancer drugs used clinically are substrates of ABCG2, and ABCG2 is overexpressed in cancer cells, pumping out anticancer drugs, leading to MDR and chemotherapy failure. Therefore, ABCG2 is a target for overcoming MDR in cancer treatment. The developed ABCG2 inhibitors can be used to prevent MDR in cancer treatment.

[0311] method

[0312] Design of ABCG2 inhibitors

[0313] To develop stable ABCG2 inhibitors, we replaced the tert-butyl ester group with different carboxylesterase resistant groups (including amides and ethers) based on the ester moiety. The structures of three series of amides (I, II, III) are disclosed in Scheme 1.

[0314]

[0315] Chemical synthesis.

[0316] 25 target compounds were synthesized (Table 1, Table 2, Table 3 and Table 4). The synthetic strategies used to prepare these compounds are detailed in the following Schemes 2-4.

[0317]

[0318] Scheme 2. Synthesis of glutamic acid-linked KO143 analogs. Reagents and conditions: (a) R6R7NH, EDCI, HOBt, CH2Cl2, room temperature, overnight; (b) Pd / C, methanol, room temperature, 3-5 hours; (c) Fmoc N-hydroxysuccinimide ester, NaHCO3, 1,4-dioxane, room temperature, overnight; (d) Compound 4, SOCl2, DMF, CH2Cl2, 0℃~room temperature, 2h, then Et3N, room temperature, overnight; or 2-chloro-1,3-dimethylimidazolinium hexafluorophosphate (CIP), DIEA N-methylpyrrolidone, room temperature, 5 days; (e) Piperidine, THF, room temperature, overnight.

[0319]

[0320] Scheme 3. Synthesis of aspartate-linked KO143 analogs. Reagents and conditions: (a) Compound 5, CIP, DIEAN-methylpyrrolidone, room temperature, 5 days; (b) Piperidine, tetrahydrofuran, room temperature, overnight; (c) Pd / C, methanol, room temperature, 3 hours; (d) R6R7NH, EDCI, HOBt, CH2Cl2, room temperature, overnight.

[0321]

[0322] Scheme 3. Synthesis of lysine-linked KO143 analogs. (a) Compound 5, CIP, DIEA N-methylpyrrolidone, room temperature, 5 days; (b) piperidine, tetrahydrofuran, room temperature, overnight; (c) Pd / C, HCl, MeOH, room temperature, 4 hours; (d) R8COCl, Et3N, CH2Cl2, 0°C to room temperature, 4h; or R8COOH, EDCI, HOBt, CH2Cl2, room temperature, overnight.

[0323] The syntheses of exemplified compounds are described in detail below.

[0324] S)-2-(((Benzyloxy)carbonyl)amino)-5-(tert-butylamino)-5-oxopentanoic acid benzyl ester (2a)

[0325]

[0326] (S)-5-(Benzyloxy)-4-(((Benzyloxy)carbonyl)amino)-5-oxopentanoic acid (1) was purchased from Chem-Impex (Wood Dale, IL). EDCI (7 g, 36 mmol), HOBt (4.9 g, 36.5 mmol) and tert-butylamine (3.37 mL, 32.3 mmol) were added to a solution of compound 1 (8 g, 21.5 mmol) in CH2Cl2. The mixture was stirred at room temperature overnight, then quenched with saturated aqueous NaHCO3 and extracted with dichloromethane. The combined organic phases were washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (PE / EtOAc=2:1) ​​to give compound 2a (8.9 g, 97%) as a colorless oil. 1 HNMR (400MHz, CDCl3) δ7.34 (m, 10H), 5.66 (d, J=8.0Hz, 1H), 5.44 (brs, 1H), 5.23-5 .12(m, 2H), 5.10(s, 2H), 4.37(m, 1H), 2.24-2.06(m, 3H), 1.99(m, 1H), 1.29(s, 9H). HRMS(ESI):C 24 H 30 m / z of N2O5Na (M+Na) + Calculated value: 449.2052, measured value: 449.2062.

[0327] (S)-2-Amino-5-(tert-butylamino)-5-oxopentanoic acid (3a)

[0328]

[0329] 10% Pd / C (900 mg) was added to a solution of compound 2a (8.9 g, 20.9 mmol) in MeOH, and the suspension was hydrogenated at room temperature for 5 hours until the starting material was consumed. The mixture was then filtered and the filtrate was concentrated to give compound 3a (2.09 g, 49%) as a white solid. HRMS (ESI): C9H 19 m / z of N2O3 (M+H) + Calculated value: 203.1396, measured value: 203.1392.

[0330] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(tert-butylamino)-5-oxopentanoic acid (4a)

[0331]

[0332] Acid 3a (7.16 g, 35.4 mmol) was dissolved in NaHCO aqueous solution (8.92 g, 106.2 mmol, 100 mL H2O), and a solution of Fmoc N-hydroxysuccinimide ester (11.94 g, 35.4 mmol) in 1,4-dioxane (100 mL) was slowly added. The reaction mixture was stirred at room temperature overnight. The resulting mixture was then concentrated to remove most of the organic solvent, and the aqueous residue was adjusted to pH = 1 with concentrated HCl. The mixture was extracted with EtOAc, and the combined organic phases were washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (CH2Cl2 / MeOH=10:1) to give compound 4a (13 g, 87%) as a white solid. 1 H NMR (400MHz, CDCl3) δ7.76 (d, J=7.5Hz, 2H), 7.59 (m, 2H), 7.40 (t, J=7.4Hz, 2H), 7.31 (t, J=7.2Hz, 2H), 6.06 (d, 1H), 5.76 ( brs, 1H), 4.43-4.27 (m, 3H), 4.21 (t, J=6.9Hz, 1H), 2.49 (m, 1H), 2.37 (m, 1H), 2.23-2.11 (m, 1H), 2.06 (m, 1H), 1.35 (s, 9H). HRMS(ESI):C 24 H 27 m / z of N2O5 (MH) - Calculated value: 423.1920, measured value: 423.1922.

[0333] N-(tert-butyl)-3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)propanamide (K2)

[0334]

[0335] To a solution of compound 4a (8 g, 19 mmol) in dry CH2Cl2 at 0°C under nitrogen was added anhydrous DMF (0.3 mL, 3.8 mmol) followed by SOCl2 (13.8 mL, 190 mmol). The mixture was stirred at room temperature for 2 hours until all the starting material was consumed. The mixture was concentrated and the residue was washed 3 times with CH2Cl2 to evaporate most of the remaining SOCl2. The crude acid chloride was redissolved in dry CH2Cl2 and the solution was added dropwise to a mixture of compound 5 (1.8 g, 5.7 mmol, see Li Y, Hayman E, Plesescu M, et al. Synthesis of potent BCRP inhibitor—Ko143. Tetrahedron Letters 2008; 49: 1480-1483) and Et3N (2.35 mL, 17 mmol) in CH2Cl2 at 0°C. The mixture was then warmed to room temperature and stirred overnight. The reaction was quenched with saturated aqueous NaHCO3 and extracted with CH2Cl2. The combined organic phases were washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (PE / EtOAc=2:1) ​​to give 3.0 g of crude (1S,3S)-methyl 2-((S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(tert-butylamino)-5-oxopentanoyl)-1-isobutyl-7-methoxy-2,3,4,9-tetrahydro-1H-pyrido[3,4-b]indole-3-carboxylate (6a). HRMS (ESI): C 42 H 51 m / z(M+H) of N4O7 + Calculated value: 723.3758, measured value: 723.3754.

[0336] The above crude compound 6a was dissolved in THF (60 mL), piperidine (3 mL) was added and stirred at room temperature overnight. The resulting mixture was concentrated, and the crude product was dissolved in EtOAc. The organic phase was washed with brine, dried over magnesium sulfate and concentrated. The residue was purified by silica gel chromatography (PE / EtOAc=1:1), and then recrystallized in PE / EtOAc / CH2Cl2 to obtain K2 (820 mg, 31%) as a light yellow solid. 1H NMR (400MHz, CDCl3) δ7.92 (s, 1H), 7.62 (s, 1H), 7.44 (d, J = 8.6Hz, 1H), 6.89 (d, J = 2.1Hz, 1H), 6.83 (dd, J=8.6, 2.2Hz, 1H), 5.45 (m, 2H), 4.05-3.95 (m, 2H), 3.85 (s, 3H), 3.52 (dd, J =15.8, 5.0Hz, 1H), 3.04 (dd, J = 15.8, 11.7Hz, 1H), 2.42-2.34 (m, 3H), 2.30-2.20 (m, 1H), 1 .73 (m, 1H), 1.59-1.48 (m, 2H), 1.36 (s, 9H), 1.06 (d, J=6.5Hz, 3H), 0.83 (d, J=6.4Hz, 3H). HRMS(ESI):C 26 H 37 m / z of N4O4 (M+H) + Calculated value: 469.2815, measured value: 469.2818.

[0337] (S)-2-(((Benzyloxy)carbonyl)amino)-5-(cyclopropylamino)-5-oxopentanoic acid benzyl ester (2b)

[0338]

[0339] Compound 2b (2.0 g, 92%) was prepared as a white solid from cyclopropylamine (0.75 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.33 (m, 10H), 5.86 (brs, 1H), 5.62 (m, 1H), 5.22-5.11 (m, 2H), 5.10 (s, 2H), 4.3 7 (m, 1H), 2.66 (m, 1H), 2.27-2.08 (m, 3H), 1.97 (m, 1H), 0.77-0.66 (m, 2H), 0.46 (m, 2H). HRMS (ESI): C 23 H 26 m / z of N2O5Na (M+Na) + Calculated value: 433.1739, measured value: 433.1741.

[0340] (S)-2-Amino-5-(cyclopropylamino)-5-oxopentanoic acid (3b)

[0341]

[0342] 10% Pd / C (200 mg) was added to a THF / MeOH solution of compound 2b (2 g, 4.9 mmol), and the suspension was hydrogenated at room temperature for 3 hours until the starting material was consumed. The mixture was then dissolved in water and filtered, and the filtrate was concentrated and further freeze-dried to give crude compound 3b (1.2 g). 1 H NMR (400MHz, DMSO) δ3.11 (m, 1H), 2.60 (m, 1H), 2.19 (t, J = 7.5Hz, 2H), 1.86 (m, 2H), 0.58 (m, 2H), 0.37 (m, 2H). HRMS(ESI):C8H 13 m / z (MH)-calculated value for N2O3: 185.0926, found: 185.0942.

[0343] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(cyclopropylamino)-5-oxopentanoic acid (4b)

[0344]

[0345] Compound 4b (1.2 g, 60% yield for 2 steps) was prepared as a white solid from compound 3b (1.2 g) following a procedure similar to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ7.89 (m, 3H), 7.73 (d, J=7.4Hz, 2H), 7.60 (d, J=8.0Hz, 1H), 7.42 (t, J=7.3Hz, 2H), 7.33 (t, J=7.4Hz, 2H), 4.3 3-4.14 (m, 3H), 3.92 (m, 1H), 2.58 (m, 1H), 2.12 (t, J=7.6Hz, 2H), 1.97 (m, 1H), 1.76 (m, 1H), 0.62-0.50 (m, 2H), 0.41-0.31 (m, 2H). HRMS(ESI):C 23 H 23 m / z of N2O5 (MH) - Calculated value: 407.1607, measured value: 407.1541.

[0346] N-Cyclopropyl-3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)propanamide (K12)

[0347]

[0348] Compound 4b (306mg, 0.75mmol), DIEA (131 μL, 0.75mmol) and CIP (140mg, 0.5mmol) were added to the N-methylpyrrolidone solution of compound 5 (158mg, 0.5mmol). The reaction mixture was stirred at room temperature for 24 hours. After 24 hours, the second and third portions of compound 4b, DIEA and CIP were added respectively, and the mixture was stirred for another 24 hours. After 4 days, the reaction was monitored by TLC until most of the raw materials were consumed. The resulting mixture was then diluted with water and extracted with EtOAc. The organic phase was washed with salt water, dried and concentrated with MgSO4. The residue was purified by silica gel chromatography (PE / EtOAc=1:1) to give (1S,3S)-methyl 2-((S)-2-(((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(cyclopropylamino)-5-oxopentanoyl)-1-isobutyl-7-methoxy-2,3,4,9-tetrahydro-1H-pyrido[3,4-b]indole-3-carboxylate (6b) as a pale yellow solid, 130 mg crude product. HRMS (ESI): C 25 H 32 m / z of N4O4 (M+H) + Calculated value: 707.3445, measured value: 707.3452.

[0349] 120 mg of the above compound 6b (0.17 mmol) was dissolved in THF and piperidine (0.3 mL) was added. The mixture was stirred at room temperature overnight. The resulting mixture was concentrated and the crude product was dissolved in EtOAc. The organic phase was washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (PE / EtOAc=2:1) ​​to give K12 (40 mg, 52%) as a white solid. 1H NMR (400 MHz, CDCl3, about 4:1 mixture of atropisomers) δ 7.90 (s, 0.8H), 7.85 (s, 0.2H), 7.60 (s, 0.2H), 7.51 (s, 0.8H), 7.44 (d, J = 8.6 Hz, 1H), 6.89 (d, J = 1.8 Hz, 1H), 6.83 (dd, J = 8.7, 2.2 Hz, 1H), 5.89 (brs, 0.2H), 5.80 (brs, 0.8H), 5.44 (m, 1H) , 4.02 (m, 2H), 3.85 (s, 3H), 3.52 (dd, J=15.8, 4.9Hz, 1H), 3.04 (dd, J=15.7, 11.6Hz, 1H), 2.78-2.68 (m, 1H), 2.4 0 (m, 2H), 2.30 (m, 1H), 1.71 (m, 1H), 1.54 (m, 2H), 1.06 (m, 3H), 0.87-0.75 (m, 5H), 0.60 (m, 0.4H), 0.52 (m, 1.6H). HRMS(ESI):C 25 H 32 m / z of N4O4 (M+H) + Calculated value: 453.2502, measured value: 453.2508.

[0350] (S)-Benzyl 2-(((Benzyloxy)carbonyl)amino)-5-(cyclohexylamino)-5-oxopentanoate (2c)

[0351]

[0352] Compound 2c (2.14 g, 87%) was prepared as a white solid from cyclohexylamine (1.22 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.44-7.32 (m, 10H), 5.71 (d, J=7.8Hz, 1H), 5.58 (d, J=7.0Hz, 1H), 5.25-5.14 (m, 2H), 5.13 (s, 2H), 4.41 (m, 1H), 3. 81-3.68 (m, 1H), 2.28-2.13 (m, 3H), 2.07-1.97 (m, 1H), 1.89 (d, J=12.1Hz, 2H), 1.76-1.62 (m, 3H), 1.44-1.27 (m, 2H), 1.23-1.01 (m, 3H). HRMS(ESI):C 26 H 32 m / z of N2O5Na (M+Na) + Calculated value: 475.2209, measured value: 475.2202.

[0353] (S)-2-Amino-5-(cyclohexylamino)-5-oxopentanoic acid (3c)

[0354]

[0355] Compound 3c (1.06 g, 98%) was prepared as a white solid from compound 2c (2.14 g, 4.7 mmol) following a procedure analogous to that described for the preparation of compound 3b. 1 H NMR (400MHz, D2O) δ3.64 (t, J=6.1Hz, 1H), 3.49 (m, 1H), 2.35-2.21 (m, 2H), 2 .02(m, 2H), 1.72(m, 2H), 1.68-1.57(m, 2H), 1.51(m, 1H), 1.31-1.01(m, 5H). HRMS(ESI):C 11 H 19 m / z of N2O3 (MH) - Calculated value: 227.1396, measured value: 227.1402.

[0356] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(cyclohexylamino)-5-oxopentanoic acid (4c)

[0357]

[0358] Compound 4c (2.09 g, 93%) was prepared as a white solid from compound 3c (1.05 g, 4.6 mmol) following a procedure analogous to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ12.57 (brs, 1H), 7.89 (d, J=7.5Hz, 2H), 7.73 (d, J=7.4Hz , 2H), 7.66 (t, J=8.1Hz, 2H), 7.42 (dt, J=7.5, 3.8Hz, 2H), 7.33 (t, J=7.5Hz, 2 H), 4.31-4.15 (m, 3H), 3.94 (m, 1H), 3.50 (d, J=7.4Hz, 1H), 2.15 (t, J=7.6Hz, 2H), 2.02-1.92(m, 1H), 1.73(m, 5H), 1.53(m, 1H), 1.24(m, 2H), 1.10(m, 3H). HRMS(ESI):C 26 H 29 m / z of N2O5 (MH) - Calculated value: 449.2076, measured value: 449.2077.

[0359] N-Cyclohexyl-3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)propanamide (K14)

[0360]

[0361] K14 (73 mg, 30%) was prepared as a light grey solid from compound 4c (1.01 g, 2.25 mmol) following a procedure analogous to that described for the preparation of K12. 1 H NMR (400MHz, CDCl3) δ8.45 (brs, 1H), 7.83 (brs, 1H), 7.41 (d, J=8.7Hz, 1H), 6.89 (d, J=2.1Hz, 1H), 6.81 (d d, J=8.6, 2.0Hz, 1H), 5.88 (brs, 1H), 5.52-5.43 (m, 1H), 4.06-3.93 (m, 2H), 3.84 (s, 3H), 3.83-3.72 (m, 1H) ), 3.51 (dd, J=15.8, 4.9Hz, 1H), 3.04 (dd, J=15.7, 11.7Hz, 1H), 2.51-2.24 (m, 4H), 1.97-1.87 (m, 2H), 1.7 7-1.66 (m, 3H), 1.58 (m, 3H), 1.36 (m, 2H), 1.23-1.09 (m, 3H), 1.03 (d, J=6.2Hz, 3H), 0.81 (d, J=6.3Hz, 3H). HRMS(ESI):C 28 H 39 m / z of N4O4 (M+H) + Calculated value: 495.2971, measured value: 495.2969.

[0362] 3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)-N,N-dimethylpropanamide (K18)

[0363]

[0364] K18 was prepared as a white solid following a procedure similar to that described for the preparation of K12. 1H NMR (400MHz, CDCl3) δ8.02 (s, 1H), 7.82 (s, 1H), 7.43 (d, J=8.5Hz, 1H), 6.88 (d, J=2.0H z, 1H), 6.82 (dd, J=8.6, 2.0Hz, 1H), 5.45 (m, 1H), 4.00 (m, 2H), 3.84 (s, 3H), 3.50 (dd, J= 15.9, 5.0Hz, 1H), 3.08-3.00 (m, 1H), 3.00 (s, 3H), 2.98 (s, 3H), 2.56 (m, 3H), 2.34 (m, 1 H), 1.77-1.68 (m, 1H), 1.60-1.49 (m, 2H), 1.06 (d, J=6.4Hz, 3H), 0.83 (d, J=6.3Hz, 3H). HRMS(ESI):C 24 H 33 m / z of N4O4 (M+H) + Calculated value: 441.2502, measured value: 441.2499.

[0365] (S)-2-(((Benzyloxy)carbonyl)amino)-5-oxo-5-(phenylamino)pentanoic acid benzyl ester (2d)

[0366]

[0367] Compound 2d (2.2 g, 93%) was prepared as a white solid from aniline (0.98 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.94 (brs, 1H), 7.53 (d, J=7.9Hz, 2H), 7.39-7.28 (m, 12H), 7.10 (t, J=7.4Hz, 1H), 5.63 (d, J=7.6Hz, 1H), 5.22-5.13 (m, 2H), 5.09 (m, 2H), 4.47 (m, 1H), 2.37 (m, 3H), 2.03 (m, 1H). HRMS(ESI):C 26 H 26 m / z of N2O5Na (M+Na) + Calculated value: 469.1739, measured value: 469.1734.

[0368] (S)-2-Amino-5-oxo-5-(phenylamino)pentanoic acid (3d)

[0369]

[0370] Compound 3d (1.08 g, 99%) was prepared as a white solid from compound 2d (2.2 g, 5.0 mmol) following a procedure analogous to that described for the preparation of compound 3b. 1 H NMR (400MHz, DMSO) δ7.56 (d, J=7.7Hz, 2H), 7.26 (t, J=7.9Hz, 2H), 7.00 (t, J=7.4Hz, 1H), 3.15 (m, 1H), 2.35 (s, 2H), 1.82 (m, 2H). HRMS(ESI):C 11 H 13 m / z of N2O3 (MH) - Calculated value: 221.0926, measured value: 221.0936.

[0371] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-oxo-5-(phenylamino)pentanoic acid (4d)

[0372]

[0373] Compound 4d (1.88 g, 86%) was prepared as a light yellow solid from compound 3d (1.08 g, 4.9 mmol) following a procedure analogous to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ10.01 (s, 1H), 7.90 (d, J = 7.4Hz, 2H), 7.73 (d, J = 7.5Hz, 2H), 7.59 (d, J = 7.9Hz, 2H), 7.42 (t, J = 7.3Hz, 2H), 7.31 (m, 4H), 7.02 (t, J=7.4Hz, 1H), 4.25 (m, 3H), 3.96 (m, 1H), 2.42 (t, J=7.6Hz, 2H), 2.15-2.04 (m, 1H), 1.89 (m, 1H). HRMS(ESI):C 26 H 23 m / z (MH)-calculated value for N2O5: 443.1607, found: 443.1604.

[0374] 3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)-N-phenylpropanamide (K19)

[0375]

[0376] K19 (45 mg, 18%) was prepared as a light yellow solid from compound 4d (0.99 g, 2.25 mmol) following a procedure similar to that described for the preparation of K12. 1 H NMR (400MHz, CDCl3) δ9.55 (s, 1H), 7.52 (d, J = 8.1Hz, 2H), 7.38 (d, J = 8.6Hz, 1H), 7.29 (d, J = 8.2Hz, 2H) , 7.12-7.03 (m, 1H), 6.87 (d, J=2.1Hz, 1H), 6.76 (dd, J=8.5, 2.0Hz, 1H), 5.46-5.36 (m, 1H), 3.99 (m, 2H) , 3.82 (s, 3H), 3.47 (dd, J=15.6, 4.7Hz, 1H), 3.39 (m, 1H), 3.05-2.92 (dd, J=15.6, 11.7Hz, 1H), 2.52 (m , 2H), 2.39-2.26 (m, 2H), 1.65 (m, 1H), 1.60-1.46 (m, 2H), 1.01 (d, J=6.1Hz, 3H), 0.77 (d, J=6.1Hz, 3H). HRMS(ESI):C 28 H 33 m / z of N4O4 (M+H) + Calculated value: 489.2502, measured value: 489.2481.

[0377] (S)-2-(((Benzyloxy)carbonyl)amino)-5-oxo-5-(pyrrolidin-1-yl)pentanoic acid benzyl ester (2e)

[0378]

[0379] Compound 2e (2.3 g, 100%) was prepared as a colorless oil from pyrrolidine (0.88 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.40-7.28 (m, 10H), 6.04 (d, J=7.4Hz, 1H), 5.22-5.03 (m, 4H), 4.39 (m, 1H), 3. 41 (t, J=6.7Hz, 2H), 3.22 (t, J=6.6Hz, 2H), 2.36-2.17 (m, 3H), 2.15-2.02 (m, 1H), 1.93-1.75 (m, 4H). HRMS(ESI):C 24 H 29 m / z of N2O5 (M+H) + Calculated value: 425.2076, measured value: 425.2076.

[0380] (S)-2-Amino-5-oxo-5-(pyrrolidin-1-yl)pentanoic acid (3e)

[0381]

[0382] Compound 3e (1.07 g, 98%) was prepared as a white solid from compound 2e (2.3 g, 5.4 mmol) following a procedure analogous to that described for the preparation of compound 3a. 1 H NMR (400MHz, MeOD) δ3.61 (t, J=5.8Hz, 1H), 3.53-3.44 (m, 2H), 3.42 (t, J=6.9Hz, 2H), 2.61-2.54(m, 2H), 2.16-2.09(m, 2H), 2.02-1.93(m, 2H), 1.92-1.83(m, 2H). HRMS(ESI):C9H 15 m / z of N2O3 (MH) - Calculated value: 199.1083, measured value: 199.1049.

[0383] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-oxo-5-(pyrrolidin-1-yl)pentanoic acid (4e)

[0384]

[0385] Compound 4e (1.76 g, 78%) was prepared as a white solid from compound 3e (1.07 g, 5.34 mmol) following a procedure analogous to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ7.90 (d, J=7.5Hz, 2H), 7.72 (dd, J=7.1, 4.8Hz, 2H), 7.66 (d, J=7.8Hz, 1H), 7.42 (t, J=7.4Hz, 2H), 7.3 2(t, J=7.4Hz, 2H), 4.32-4.16(m, 3H), 3.98(m, 1H), 3.42-3.29(m, 4H), 2.40-2.21(m, 2H), 2.00(m, 1H), 1.88-1.69(m, 5H). HRMS(ESI):C 24 H 25 m / z of N2O5 (MH) - Calculated value: 421.1763, measured value: 421.1749.

[0386] (3S,6S,12aS)-6-isobutyl-9-methoxy-3-(3-oxo-3-(pyrrolidin-1-yl)propyl)-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K20)

[0387]

[0388] K20 (92 mg, 40%) was prepared as a white solid from compound 4e (0.95 g, 2.25 mmol) following a procedure similar to that described for the preparation of K12. 1 H NMR (400MHz, CDCl3) δ8.08 (s, 2H), 7.42 (d, J=8.6Hz, 1H), 6.88 (d, J=2.1Hz, 1H), 6.82 (dd, J= 8.6, 2.2Hz, 1H), 5.45 (m, 1H), 4.00 (m, 2H), 3.84 (s, 3H), 3.54-3.44 (m, 3H), 3.38 (m, 2H), 3.04 (dd, J=15.8, 11.7Hz, 1H), 2.61-2.43 (m, 3H), 2.40-2.27 (m, 1H), 2.02-1.92 (m, 2H), 1.91-1.8 1 (m, 2H), 1.77-1.68 (m, 1H), 1.60-1.47 (m, 2H), 1.06 (d, J=6.4Hz, 3H), 0.82 (d, J=6.3Hz, 3H). HRMS(ESI):C 26 H 35 m / z of N4O4 (M+H) + Calculated value: 467.2658, measured value: 467.2629.

[0389] N,N-Diethyl-3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)propanamide (K21)

[0390]

[0391] K21 was prepared as a light yellow solid following a procedure similar to that described for the preparation of K12. 1H NMR (400MHz, CDCl3) δ8.00 (s, 1H), 7.87 (s, 1H), 7.43 (d, J = 8.6Hz, 1H), 6.88 (d, J = 1.8Hz, 1H), 6 .82 (dd, J=8.6, 2.0Hz, 1H), 5.46 (m, 1H), 3.99 (m, 2H), 3.84 (s, 3H), 3.50 (dd, J=15.8, 4.9Hz, 1H ), 3.40 (m, 2H), 3.31 (m, 2H), 3.04 (dd, J=15.7, 11.7Hz, 1H), 2.66-2.44 (m, 3H), 2.38-2.28 (m, 1 H), 1.72 (m, 1H), 1.60-1.48 (m, 2H), 1.15 (m, 6H), 1.06 (d, J=6.3Hz, 3H), 0.82 (d, J=6.3Hz, 3H). HRMS(ESI):C 26 H 37 m / z of N4O4 (M+H) + Calculated value: 469.2815, measured value: 469.2802.

[0392] (S)-Benzyl 2-(((Benzyloxy)carbonyl)amino)-5-oxo-5-(piperidin-1-yl)pentanoate (2f)

[0393]

[0394] Compound 2f (2.2 g, 93%) was prepared as a colorless oil from piperidine (0.98 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.39-7.28 (m, 10H), 5.85 (d, J=7.6Hz, 1H), 5.22-5.13 (m, 2H), 5.13-5.04 (m, 2H), 4.40 ( m, 1H), 3.53-3.45 (m, 2H), 3.27-3.18 (m, 2H), 2.40-2.16 (m, 3H), 2.11-2.04 (m, 1H), 1.60 (m, 2H), 1.49 (m, 4H). HRMS(ESI):C 25 H 31 m / z of N2O5 (M+H) + Calculated value: 439.2233, measured value: 439.2239.

[0395] (S)-2-Amino-5-oxo-5-(piperidin-1-yl)pentanoic acid (3f)

[0396]

[0397] Compound 3f (1.02 g, 95%) was prepared as a white solid from compound 2f (2.2 g, 5.0 mmol) following a procedure analogous to that described for the preparation of compound 3a. 1 H NMR (400MHz, DMSO) δ 3.46-3.36 (m, 5H), 3.21-3.13 (m, 2H), 2.39 (m, 2H), 1.94-1.75 (m, 2H), 1.57 (m, 2H), 1.48 (m, 2H), 1.40 (m, 2H). HRMS(ESI):C 10 H 17 m / z of N2O3 (MH) - Calculated value: 213.1239, measured value: 213.1227.

[0398] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-oxo-5-(piperidin-1-yl)pentanoic acid (4f)

[0399]

[0400] Compound 4f (1.82 g, 88%) was prepared as a white solid from compound 3f (1.02 g, 4.76 mmol) following a procedure analogous to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ7.90 (d, J=7.4Hz, 2H), 7.72 (m, 2H), 7.64 (m, 1H), 7.47-7.36 (t, J=7.2Hz, 2H), 7.33 (t, J=7.2Hz, 2H), 4.33-4.14(m, 3H), 4.01(m, 1H), 3.41(m, 4H), 2.36(m, 2H), 1.97(m, 1H), 1.81(m, 1H), 1.55(m, 2H), 1.42(m, 4H). HRMS(ESI):C 25 H 27 m / z of N2O5 (MH) - Calculated value: 435.1920, measured value: 435.1913.

[0401] (3S,6S,12aS)-6-Isobutyl-9-methoxy-3-(3-oxo-3-(piperidin-1-yl)propyl)-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K24)

[0402]

[0403] K24 (42 mg, 18%) was prepared as a white solid from compound 4f (0.97 g, 2.25 mmol) following a procedure similar to that described for the preparation of K12. 1 H NMR (400MHz, CDCl3) δ7.97 (s, 1H), 7.79 (s, 1H), 7.43 (d, J = 8.6Hz, 1H), 6.88 (d, J = 2.1Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz, 1H), 5.45 (dd, J=9.2, 4.2Hz, 1H), 4.03-3.95 (m, 2H), 3.84 (s, 3H), 3.64-3.54 (m, 2H), 3.5 1 (dd, J=15.9, 5.0Hz, 1H), 3.43-3.37 (m, 2H), 3.04 (dd, J=15.8, 11.7Hz, 1H), 2.64-2.45 (m, 3H), 2.31 (m , 1H), 1.73 (m, 1H), 1.67-1.60 (m, 2H), 1.60-1.48 (m, 6H), 1.06 (d, J=6.5Hz, 3H), 0.83 (d, J=6.4Hz, 3H). HRMS(ESI):C 27 H 37 m / z of N4O4 (M+H) + Calculated value: 481.2815, measured value: 481.2817.

[0404] (S)-2-(((Benzyloxy)carbonyl)amino)-5-morpholino-5-oxopentanoic acid benzyl ester (2 g)

[0405]

[0406] Compound 2g (2 g, 84%) was prepared as a light yellow solid from morpholine (0.94 mL, 10.76 mmol) following a procedure analogous to that described for the preparation of compound 2a. 1 H NMR (400MHz, CDCl3) δ7.39-7.29 (m, 10H), 5.71 (d, J=7.6Hz, 1H), 5.24-5.04 (m, 4H), 4.46- 4.37 (m, 1H), 3.64-3.59 (m, 2H), 3.56 (m, 4H), 3.27 (m, 2H), 2.39-2.18 (m, 3H), 2.04 (m, 1H). HRMS(ESI):C 24 H 29 m / z of N2O6 (M+H) + Calculated value: 441.2026, measured value: 441.2032.

[0407] (S)-2-Amino-5-morpholino-5-oxopentanoic acid (3 g)

[0408]

[0409] Compound 3g (0.98 g, 99%) was prepared as a white solid from compound 2g (2 g, 4.54 mmol) following a procedure analogous to that described for the preparation of compound 3a. 1 H NMR (400MHz, DMSO) δ3.77-3.17 (m, 10H), 2.45 (m, 1H), 2.01-1.76 (m, 2H). HRMS(ESI):C9H 15 m / z of N2O4 (MH) - Calculated value: 215.1032, measured value: 215.1031.

[0410] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-morpholino-5-oxopentanoic acid (4 g)

[0411]

[0412] Compound 4g (1.57 g, 79%) was prepared as a white solid from compound 3g (0.98 g, 4.53 mmol) following a procedure analogous to that described for the preparation of compound 4a. 1 H NMR (400MHz, DMSO) δ12.59 (brs, 1H), 7.97-7.87 (m, 2H), 7.73 (m, 2H), 7.66 (m, 1H), 7.49-7.39 (m, 2H), 7.34 (m, 2H), 5 .77 (m, 1H), 4.27 (m, 3H), 4.01 (m, 1H), 3.48-3.30 (m, 7H), 2.55 (m, 1H), 2.39 (m, 2H), 2.00 (m, 1H), 1.89-1.73 (m, 1H). HRMS(ESI):C 24 H 25 m / z of N2O6 (MH) - Calculated value: 437.1713, measured value: 437.1725.

[0413] (3S,6S,12aS)-6-Isobutyl-9-methoxy-3-(3-morpholino-3-oxopropyl)-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K22)

[0414]

[0415] K22 (48 mg, 20%) was prepared as a white solid from compound 4g (0.99 g, 2.25 mmol) following a procedure analogous to that described for the preparation of K12. 1 H NMR (400MHz, CDCl3) δ8.00 (s, 1H), 7.62 (s, 1H), 7.43 (d, J = 8.6Hz, 1H), 6.88 (d, J = 1.9Hz, 1 H), 6.83 (dd, J=8.6, 2.1Hz, 1H), 5.44 (dd, J=9.3, 4.1Hz, 1H), 4.01 (m, 2H), 3.84 (s, 3H), 3.7 3-3.61(m, 6H), 3.55-3.43(m, 3H), 3.04(dd, J=15.7, 11.8Hz, 1H), 2.67-2.43(m, 3H), 2.34( m, 1H), 1.78-1.72 (m, 1H), 1.60-1.48 (m, 2H), 1.06 (d, J=6.4Hz, 3H), 0.82 (d, J=6.3Hz, 3H). HRMS(ESI):C 26 H 35 m / z of N4O5 (M+H) + Calculated value: 483.2607, measured value: 483.2609.

[0416] N-Cyclohexyl-3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)-N-methylpropanamide (K26)

[0417]

[0418] K26 was prepared as a white solid following a procedure similar to that described for the preparation of K12. 1H NMR (400 MHz, CDCl3, ca. 1:1 mixture of atropisomers) δ 7.98 (s, 1H), 7.88 (s, 1H), 7.43 (d, J = 8.6 Hz, 1H), 6.88 (d, J = 2.1 Hz, 1H), 6.82 (dd, J = 8.6, 2.2 Hz, 1H), 5.46 (dd, J = 9.4, 4.6 Hz, 1H), 4.50-4.40 (m, 0.5H), 4.04-3.94 (m, 2H), 3.84 (s, 3H), 3.6 1-3.54 (m, 0.5H), 3.50 (dd, J=15.9, 5.0Hz, 1H), 3.04 (dd, J=15.8, 11.7Hz, 1H), 2.84 (s, 1.5H) 2.83 (s, 1.5H), 2.7 0-2.44 (m, 3H), 2.39-2.26 (m, 1H), 1.90-1.23 (m, 12H), 1.15 (m, 1H), 1.06 (d, J=6.4Hz, 3H), 0.83 (d, J=6.2Hz, 3H). HRMS(ESI):C 29 H 41 m / z of N4O4 (M+H) + Calculated value: 509.3128, measured value: 509.3125.

[0419] 3-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)-N-isopropylpropionamide (K34)

[0420]

[0421] K34 was prepared as a light yellow solid following a procedure similar to that described for the preparation of K12. 1H NMR (400MHz, CDCl3) δ8.17 (s, 1H), 7.76 (s, 1H), 7.42 (d, J = 8.6Hz, 1H), 6.89 (d, J = 2.0Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz, 1H), 5.66 (d, J=7.9Hz, 1H), 5.47 (dd, J=9.2, 4.1Hz, 1H), 4.13-4.07 (m, 1H), 4.06-3.96 (m , 2H), 3.85 (s, 3H), 3.51 (dd, J=15.8, 5.0Hz, 1H), 3.04 (dd, J=15.6, 11.7Hz, 1H), 2.48-2.23 (m, 4H), 1.7 4-1.65 (m, 1H), 1.61-1.47 (m, 2H), 1.17 (d, J=6.6Hz, 6H), 1.04 (d, J=6.5Hz, 3H), 0.82 (d, J=6.4Hz, 3H). HRMS(ESI):C 25 H 35 m / z of N4O4 (M+H) + Calculated value: 455.2658, measured value: 455.2663.

[0422] Benzyl 2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)acetate (K16)

[0423]

[0424] K16 (1.1 g, 37%) was prepared as a white solid from Fmoc-Asp(OBzl)-OH (10.8 g, 27 mmol) following a procedure analogous to that described for the preparation of K12. 1H NMR (400MHz, CDCl3) δ7.91 (s, 1H), 7.47-7.30 (m, 6H), 6.89 (d, J=2.0Hz, 1H), 6.83 (dd, J=8.8, 2.0Hz, 1H), 6.7 8 (s, 1H), 5.42 (dd, J=8.9, 3.3Hz, 1H), 5.25-5.14 (m, 2H), 4.41-4.32 (dd, J=8.7, 3.8Hz, 1H), 4.06 (dd, J=11.6 , 4.5Hz, 1H), 3.85 (s, 3H), 3.55 (dd, J=15.9, 4.6Hz, 1H), 3.36 (dd, J=17.2, 3.9Hz, 1H), 2.99 (dd, J=15.6, 11.7 Hz, 1H), 2.78 (dd, J=17.3, 9.3Hz, 1H), 1.75 (m, 1H), 1.54 (m, 2H), 1.04 (d, J=6.2Hz, 3H), 0.81 (d, J=6.1Hz, 3H). HRMS(ESI):C 28 H 32 m / z of N3O5 (M+H) + Calculated value: 490.2342, measured value: 490.2345.

[0425] 2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)acetic acid (K17)

[0426]

[0427] K17 (750 mg, 96%) was prepared as a light grey solid from K16 (950 mg, 4.33 mmol) following a procedure analogous to that described for the preparation of compound 3a. 1 H NMR (400MHz, MeOD) δ10.46 (brs, 1H), 7.40 (d, J=8.7Hz, 1H), 6.92 (s, 1H), 6.74 (dd, J=8.9, 2.0Hz, 1H), 5.44 (m, 1H), 4.42 (m, 1H), 4.23 (m, 1H), 3.8 3(s, 3H), 3.66(brs, 1H), 3.48(dd, J=15.2, 4.5Hz, 1H), 3.09-2.80(m, 4H) , 1.75 (m, 1H), 1.61 (m, 2H), 1.01 (d, J = 6.1Hz, 3H), 0.83 (d, J = 6.3Hz, 3H). HRMS(ESI):C 21 H 26m / z of N3O5 (M+H) + Calculated value: 400.1872, measured value: 400.1877.

[0428] N-(tert-butyl)-2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)acetamide (K3)

[0429]

[0430] To a CH2Cl2 solution of K17 (105 mg, 0.26 mmol) was added EDCI (100 mg, 0.52 mmol), HOBt (70 mg, 0.52 mmol) and tert-butylamine (55 μL, 0.52 mmol). The mixture was stirred at room temperature overnight. The resulting mixture was then quenched with a saturated aqueous NaHCO3 solution and extracted with CH2Cl2. The combined organic phases were washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (CH2Cl2 / MeOH=40:1) to give K3 (48 mg, 40%) as a white solid. 1 H NMR (400MHz, CDCl3) δ7.94 (s, 1H), 7.43 (d, J = 8.6Hz, 1H), 7.10 (s, 1H), 6.88 (d, J = 2.0Hz, 1H), 6.8 3 (dd, J=8.8, 2.0Hz, 1H), 5.82 (s, 1H), 5.48-5.39 (m, 1H), 4.27 (dd, J=9.4, 4.9Hz, 1H), 4.04 (dd, J= 11.2, 4.2Hz, 1H), 3.85 (s, 3H), 3.55 (dd, J=15.8, 4.7Hz, 1H), 2.97 (m, 2H), 2.63 (dd, J=15.0, 8.6H z, 1H), 1.72 (m, 1H), 1.61-1.47 (m, 2H), 1.35 (s, 9H), 1.04 (d, J=6.3Hz, 3H), 0.82 (d, J=6.2Hz, 3H). HRMS(ESI):C 25 H 35 m / z of N4O4 (M+H) + Calculated value: 455.2658, measured value: 455.2657.

[0431] 2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)-N-isopropylacetamide (K31)

[0432]

[0433] K31 (50 mg, 44%) was prepared as a white solid from isopropylamine hydrochloride (50 mg, 0.52 mmol) following a procedure similar to that described for the preparation of K3. 1 H NMR (400MHz, CDCl3) δ7.92 (s, 1H), 7.43 (d, J = 8.6Hz, 1H), 7.11 (s, 1H), 6.89 (d, J = 2.0Hz, 1H), 6.83 ( dd, J=8.6, 2.0Hz, 1H), 5.85 (d, J=7.6Hz, 1H), 5.42 (dd, J=9.2, 4.0Hz, 1H), 4.28 (dd, J=8.5, 3.8Hz, 1 H), 4.12-4.01 (m, 2H), 3.85 (s, 3H), 3.55 (dd, J=15.8, 4.9Hz, 1H), 2.99 (m, 2H), 2.66 (dd, J=15.1, 8. 5Hz, 1H), 1.72 (m, 1H), 1.60-1.48 (m, 2H), 1.17 (m, 6H), 1.05 (d, J=6.4Hz, 3H), 0.81 (d, J=6.4Hz, 3H). HRMS(ESI):C 24 H 33 m / z of N4O4 (M+H) + Calculated value: 441.2502, measured value: 441.2507.

[0434] N-Cyclohexyl-2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)acetamide (K23)

[0435]

[0436] K23 (55 mg, 44%) was prepared as a light grey solid from cyclohexylamine (60 μL, 0.52 mmol) following a procedure similar to that described for the preparation of K3. 1H NMR (400MHz, CDCl3) δ8.04 (s, 1H), 7.42 (d, J=8.6Hz, 1H), 7.19 (s, 1H), 6.88 (d, J=2.1Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz , 1H), 6.03 (d, J=8.2Hz, 1H), 5.42 (dd, J=9.2, 4.0Hz, 1H), 4.28 (dd, J=8.0, 4.0Hz, 1H), 4.03 (dd, J=11.7, 4.7Hz, 1H), 3 .84 (s, 3H), 3.81-3.69 (m, 1H), 3.54 (dd, J=15.8, 4.8Hz, 1H), 3.05-2.94 (m, 2H), 2.68 (dd, J=15.0, 8.2Hz, 1H), 1.90 ( m, 2H), 1.78-1.65 (m, 3H), 1.65-1.48 (m, 3H), 1.36 (m, 2H), 1.17 (m, 3H), 1.04 (d, J=6.4Hz, 3H), 0.80 (d, J=6.3Hz, 3H). HRMS(ESI):C 27 H 37 m / z of N4O4 (M+H) + Calculated value: 481.2815, measured value: 481.2814.

[0437] (3S,6S,12aS)-6-Isobutyl-9-methoxy-3-(2-oxo-2-(piperidin-1-yl)ethyl)-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K25)

[0438]

[0439] K25 (62 mg, 51%) was prepared as a white solid from piperidine (48 μL, 0.52 mmol) following a procedure similar to that described for the preparation of K3. 1H NMR (400MHz, CDCl3 / d4-MeOD) δ8.87 (s, 1H), 7.40 (d, J=8.5Hz, 1H), 6.86 (d, J=1.1Hz, 1H), 6.7 8 (dd, J=8.3, 1.5Hz, 1H), 5.38 (dd, J=9.9, 4.1Hz, 1H), 4.36 (d, J=9.7Hz, 1H), 4.03 (dd, J=12.3 , 4.8Hz, 1H), 3.82 (s, 3H), 3.54 (m, 3H), 3.41 (m, 3H), 2.99-2.87 (dd, J=11.7, 15.52Hz, 1H), 2. 56 (dd, J=17.1, 10.6Hz, 1H), 1.75-1.45 (m, 10H), 1.01 (d, J=6.1Hz, 3H), 0.78 (d, J=6.3Hz, 3H). HRMS(ESI):C 26 H 35 m / z of N4O4 (M+H) + Calculated value: 467.2658, measured value: 467.2670.

[0440] N-Benzyl-2-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)acetamide (K33)

[0441]

[0442] K33 (68 mg, 53%) was prepared as a white solid from benzylamine (57 μL, 0.52 mmol) following a procedure similar to that described for the preparation of K3. 1H NMR (400MHz, CDCl3) δ7.94 (s, 1H), 7.45 (d, J=8.6Hz, 1H), 7.39-7.33 (m, 2H), 7.32-7.26 (m, 3H), 7.17 (s, 1H), 6.91 (d, J=1.9Hz, 1H), 6.86 (dd, J=8.7, 2.2Hz, 1H), 6.45 (m, 1H), 5.46-5.37 (m, 1H), 4.47 (qd, J=14.8, 5.9Hz, 2 H), 4.34 (dd, J=8.0, 3.5Hz, 1H), 4.05 (dd, J=11.7, 4.2Hz, 1H), 3.87 (s, 3H), 3.56 (dd, J=15.8, 4.7Hz, 1H), 3.06 (m, 2H), 2.75 (dd, J=15.1, 8.2Hz, 1H), 1.65 (m, 1H), 1.52 (m, 2H), 1.04 (d, J=6.3Hz, 3H), 0.81 (d, J=6.3Hz, 3H). HRMS(ESI):C 28 H 33 m / z of N4O4 (M+H) + Calculated value: 489.2502, measured value: 489.2509.

[0443] Benzyl (4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)carbamate (K8)

[0444]

[0445] K8 was prepared as a white solid from Fmoc-Lys(Z)-OH following a procedure similar to that described for the preparation of K12. 1HNMR (400MHz, CDCl3) δ7.92 (s, 1H), 7.44 (d, J = 8.6Hz, 1H), 7.32 (m, 5H), 6.89 (d, J = 1.9Hz, 1H), 6. 83(dd, J=8.5, 2.0Hz, 1H), 6.68(brs, 1H), 5.44(m, 1H), 5.17-5.07(m, 2H), 5.02(m, 1H), 3.98(m, 2 H), 3.84 (s, 3H), 3.53 (dd, J=15.7, 4.7Hz, 1H), 3.41-3.12 (m, 2H), 3.01 (dd, J=15.6, 11.7Hz, 1H), 2.09 (m, 1H), 1.97 (m, 1H), 1.73 (m, 1H), 1.57 (m, 6H), 1.04 (d, J = 6.4Hz, 3H), 0.82 (d, J = 6.2Hz, 3H). HRMS(ESI):C 31 H 39 m / z of N4O5 (M+H) + Calculated value: 547.2920, measured value: 547.2919.

[0446] (3S,6S,12aS)-3-(4-aminobutyl)-6-isobutyl-9-methoxy-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K9)

[0447]

[0448] To a solution of K8 (1.06 g) in MeOH was added 10% Pd / C (100 mg) and concentrated HCl (1 mL). The mixture was hydrogenated at room temperature for 4 hours until the starting material was consumed. The suspension was then filtered and the filtrate was concentrated. The residue was the crude K9 hydrochloride salt as a light green solid. 1H NMR (400MHz, DMSO) δ10.95 (s, 1H), 8.33 (s, 1H), 8.00 (brs, 3H), 7.40 (d, J=8.6Hz, 1H), 6.86 (d , J=2.1Hz, 1H), 6.66 (dd, J=8.6, 2.2Hz, 1H), 5.33 (dd, J=7.9, 4.5Hz, 1H), 4.13 (dd, J=11.5, 4.8 Hz, 1H), 4.02 (m, 1H), 3.75 (s, 3H), 3.30 (dd, J=15.6, 4.7Hz, 1H), 2.77 (m, 3H), 1.92-1.79 (m, 1 H), 1.75 (m, 1H), 1.57 (m, 4H), 1.50-1.35 (m, 3H), 0.90 (d, J=6.4Hz, 3H), 0.75 (d, J=6.5Hz, 3H). HRMS(ESI):C 23 H 33 m / z of N4O3 (M+H) + Calculated value: 413.2553, measured value: 413.2543.

[0449] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)palmitamide (K10)

[0450]

[0451] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-2-pivaloyl-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)palmitamide (K11)

[0452]

[0453] To a dichloromethane solution of K9 (90 mg, 0.22 mmol) and Et3N (89 μL, 0.64 mmol) was added trimethylacetyl chloride (40 μL, 0.32 mmol) at 0 ° C. The resulting mixture was stirred at room temperature for 4 hours and then quenched with water. The organic phase was washed with brine, dried over MgSO4 and concentrated. The residue was purified by silica gel chromatography (CH2Cl2 / MeOH=30:1) to provide K10 (28 mg, 26%) and K11 (26 mg, 18%) as white solids.

[0454] K10: 1H NMR (400MHz, CDCl3) δ8.14 (brs, 1H), 7.43 (d, J=8.6Hz, 1H), 6.89 (d, J=2.0Hz, 1H), 6.82 (dd, J=8.6, 2.0Hz , 1H), 6.75 (brs, 1H), 5.89 (m, 1H), 5.45 (dd, J=9.1, 3.9Hz, 1H), 4.06-3.94 (m, 2H), 3.84 (s, 3H), 3.52 (dd, J =15.8, 4.8Hz, 1H), 3.40 (m, 1H), 3.25 (m, 1H), 3.01 (dd, J = 15.5, 11.9Hz, 1H), 2.13 (m, 1H), 2.01 (m, 1H), 1.7 3 (m, 1H), 1.64-1.49 (m, 4H), 1.49-1.35 (m, 2H), 1.23 (s, 9H), 1.03 (d, J=6.4Hz, 3H), 0.81 (d, J=6.3Hz, 3H). HRMS(ESI):C 28 H 41 m / z of N4O4 (M+H) + Calculated value: 497.3128, measured value: 497.3101.

[0455] K11: 1 H NMR (400MHz, CDCl3) δ7.93 (s, 1H), 7.41 (d, J = 8.7Hz, 1H), 6.88 (d, J = 2.0Hz, 1H), 6.83 (dd, J = 8.4, 2.0Hz, 1H), 5.84 (m, 1H), 5.34 (m, 1H), 4.42 (m, 1H), 4.06 (dd, J=11.3, 4.2Hz, 1H), 3.85 (s, 3H), 3. 62 (dd, J=15.4, 4.0Hz, 1H), 3.26 (m, 2H), 2.95 (dd, J=15.3, 11.6Hz, 1H), 2.04 (m, 1H), 1.95-1.68 ( m, 3H), 1.66-1.41 (m, 5H), 1.34 (s, 9H), 1.20 (s, 9H), 0.98 (d, J=6.5Hz, 3H), 0.86 (d, J=6.5Hz, 3H). HRMS(ESI):C 33 H 49 m / z of N4O5 (M+H) + Calculated value: 581.3703, measured value: 581.3714.

[0456] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)cyclohexanecarboxamide (K28)

[0457]

[0458] N-(4-((3S,6S,12aS)-2-(cyclohexanecarbonyl)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)cyclohexanecarboxamide (K27)

[0459]

[0460] K27 and K28 were prepared as white solids from cyclohexanecarbonyl chloride following a procedure similar to that described for the preparation of K10.

[0461] K28: 1 H NMR (400MHz, CDCl3) δ8.15 (s, 1H), 7.43 (d, J=8.6Hz, 1H), 6.89 (d, J=2.0Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz, 1H), 6.72 (s, 1H), 5.73 (t, J=6 .0Hz, 1H), 5.46 (dd, J=9.1, 4.1Hz, 1H), 4.03 (dd, J=11.5, 4.7Hz, 1H), 3.97 (t, J=4.8Hz, 1H), 3.84 (s, 3H), 3.52 (dd, J=15.8, 4.8Hz, 1H), 3.38 (m, 1H), 3.26 (m, 1H), 3.01 (dd, J=15.7, 11.7Hz, 1H), 2.18-2.05 (m, 2H), 1.98 (m, 1H), 1.87 (d, J=13.4Hz, 2H), 1.78 (t, J=9.2Hz, 2H ), 1.72-1.63 (m, 2H), 1.62-1.52 (m, 4H), 1.46 (dd, J=14.0, 9.0Hz, 4H), 1.33-1.18 (m, 3H), 1.03 (d, J=6.5Hz, 3H), 0.82 (d, J=6.4Hz, 3H). HRMS(ESI):C 30 H 43 m / z of N4O4 (M+H) + Calculated value: 523.3284, measured value: 523.3279.

[0462] K27: 1 H NMR (400MHz, CDCl3) δ7.94 (s, 1H), 7.38 (d, J=8.6Hz, 1H), 6.88 (d, J=2.0Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz, 1H), 5.5 5 (m, 1H), 5.04 (t, J=6.0Hz, 1H), 4.83 (t, J=6.0Hz, 1H), 4.29 (dd, J=11.6, 3.9Hz, 1H), 3.85 (s, 3H), 3.56 (dd, J=15. 4, 3.6Hz, 1H), 3.29 (m, 1H), 3.20 (m, 2H), 2.97 (dd, J=14.5, 12.6Hz, 1H), 2.30-2.21 (m, 1H), 2.12-1.97 (m, 2H), 1.9 0-1.60 (m, 10H), 1.58-1.46 (m, 3H), 1.47-1.34 (m, 7H), 1.22 (m, 7H), 0.94 (d, J=6.6Hz, 3H), 0.90 (d, J=6.6Hz, 3H). HRMS(ESI):C 37 H 53 m / z of N4O5 (M+H) + Calculated value: 633.4016, measured value: 633.4008.

[0463] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)benzamide (K29)

[0464]

[0465] K29 was prepared as a white solid from benzoyl chloride following a procedure analogous to that described for the preparation of K10. 1HNMR (400MHz, CDCl3) δ8.16 (s, 1H), 7.86-7.79 (m, 2H), 7.48 (m, 1H), 7.45-7.38 (m, 3H), 6.90 (s, 1H), 6 .88 (d, J=2.1Hz, 1H), 6.81 (dd, J=8.6, 2.2Hz, 1H), 6.57 (t, J=6.0Hz, 1H), 5.45 (dd, J=9.1, 4.1Hz, 1H), 4 .01 (m, 2H), 3.83 (s, 3H), 3.60 (m, 1H), 3.55-3.45 (m, 2H), 2.99 (dd, J=15.9, 12.0Hz, 1H), 2.18 (m, 1H), 2.08-1.96 (m, 1H), 1.76-1.66 (m, 3H), 1.62-1.47 (m, 4H), 1.01 (d, J=6.4Hz, 3H), 0.78 (d, J=6.3Hz, 3H). HRMS(ESI):C 30 H 37 m / z of N4O4 (M+H) + Calculated value: 517.2815, measured value: 517.2822.

[0466] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)cyclopentanecarboxamide (K30)

[0467]

[0468] K30 was prepared as a white solid following a procedure similar to that described for the preparation of K10. 1H NMR (400MHz, CDCl3) δ8.09 (s, 1H), 7.43 (d, J=8.6Hz, 1H), 6.89 (d, J=2.1Hz, 1H), 6.82 (dd, J=8.6, 2.2Hz, 1H), 6.71 (s, 1 H), 5.77 (t, J=6.0Hz, 1H), 5.45 (dd, J=9.1, 4.1Hz, 1H), 4.03 (dd, J=11.7, 4.8Hz, 1H), 3.97 (t, J=4.8Hz, 1H), 3.85 (s, 3H ), 3.52 (dd, J=15.7, 4.8Hz, 1H), 3.41 (m, 1H), 3.26 (m, 1H), 3.01 (dd, J=15.7, 11.7Hz, 1H), 2.53 (m, 1H), 2.13 (m, 1H), 2. 05-1.94 (m, 1H), 1.92-1.70 (m, 7H), 1.64-1.51 (m, 6H), 1.50-1.40 (m, 2H), 1.04 (d, J=6.5Hz, 3H), 0.82 (d, J=6.4Hz, 3H). HRMS(ESI):C 29 H 41 m / z of N4O4 (M+H) + Calculated value: 509.3128, measured value: 509.3136.

[0469] N-(4-((3S,6S,12aS)-6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6]pyrido[3,4-b]indol-3-yl)butyl)isobutyramide (K32)

[0470]

[0471] K32 was prepared as a white solid following a procedure similar to that described for the preparation of K10. 1H NMR (400MHz, CDCl3) δ8.11 (s, 1H), 7.43 (d, J=8.6Hz, 1H), 6.89 (d, J=2.0Hz, 1H), 6.82 (dd, J=8.6, 2.0Hz, 1H), 6 .70 (s, 1H), 5.78 (t, J=5.7Hz, 1H), 5.46 (dd, J=9.0, 4.0Hz, 1H), 4.07-3.94 (m, 2H), 3.84 (s, 3H), 3.52 (dd, J=15 .8, 4.8Hz, 1H), 3.42 (m, 1H), 3.25 (m, 1H), 3.01 (dd, J=15.6, 11.7Hz, 1H), 2.44-2.31 (m, 1H), 2.17-2.06 (m, 1H) , 2.00 (m, 1H), 1.77-1.70 (m, 1H), 1.63-1.40 (m, 6H), 1.19 (m, 6H), 1.03 (d, J = 6.4Hz, 3H), 0.82 (d, J = 6.4Hz, 3H). HRMS(ESI):C 27 H 39 m / z of N4O4 (M+H) + Calculated value: 483.2971, measured value: 483.2964.

[0472] (3S,6S,12aS)-3-(3-(tert-Butoxy)propyl)-6-isobutyl-9-methoxy-2,3,12,12a-tetrahydropyrazino[1',2':1,6]pyrido[3,4-b]indole-1,4(6H,7H)-dione (K7)

[0473]

[0474] K7 was prepared as a white solid following a procedure similar to that described for the preparation of K12. 1H NMR (400MHz, CDCl3) δ7.98 (s, 1H), 7.72 (s, 1H), 7.44 (d, J = 8.6Hz, 1H), 6.88 (d, J = 2.0Hz, 1H), 6.83 (dd, J=8.6, 2.1Hz, 1H), 5.45 (dd, J=9.3, 4.1Hz, 1H), 4.01 (dd, J=11.7, 4.9Hz, 1H), 3.89- 3.81 (m, 4H), 3.54-3.36 (m, 3H), 3.04 (dd, J=15.8, 11.6Hz, 1H), 2.38 (m, 1H), 1.88 (m, 2H), 1.8 0-1.61 (m, 2H), 1.61-1.48 (m, 2H), 1.27 (s, 9H), 1.06 (d, J=6.4Hz, 3H), 0.82 (d, J=6.3Hz, 3H). HRMS(ESI):C 26 H 38 m / z of N3O4 (M+H) + Calculated value: 456.2862, measured value: 456.2852

[0475] ABCG2 inhibition assay.

[0476] A protoporphyrin IX (PPIX)-based ABCG2 inhibition assay was developed using the A549 cancer cell line. The half-maximal inhibitory concentration (IC 50 KO143 was used as a positive control for the ABCG2 inhibition assay.

[0477] Cytotoxicity assay.

[0478] MTT assay was used to determine cytotoxicity. The 50% cytotoxic concentration (CC) of each KO143 analog was calculated. 50 )value.

[0479] Metabolic stability assay.

[0480] Metabolic stability was determined by incubation of the synthesized KO143 analogs with human liver microsomes (HLM).After incubation (0-60 min), the remaining parent compound was analyzed by UPLC-QTOFMS.

[0481] Pharmacokinetic studies in mice.

[0482] KO143 analogs with high ABCG2 inhibitory activity, low cytotoxicity and high metabolic stability were analyzed for pharmacokinetic properties. Briefly, WT mice (6-8 weeks, male) were treated with selected KO143 analogs (50 mg / kg) by gavage. Blood was collected at 0, 0.25, 0.5, 1, 2, 4, 8, 12, 24 hours after treatment. The concentration of target compounds in serum was analyzed by UPLC-QTOFMS.

[0483] Efficacy of ABCG2 inhibitors against EPP-associated phototoxicity in vivo.

[0484] This work was conducted on KO143 analogs with high ABCG2 inhibitory activity, low cytotoxicity, and high metabolic stability. The Fech-mut mouse model was used as an EPP model to determine the efficacy of ABCG2 inhibitors on EPP-associated phototoxicity, which is the most common symptom in EPP patients (6-8). Briefly, Fech-mut mice with dorsal hair removed were pretreated with the selected KO143 analogs for 30 minutes and then exposed to ultraviolet light (395-410nm) for 30 minutes. After 5 days of treatment, all mice were sacrificed to evaluate skin damage.

[0485] To further verify the protective effect of ABCG2 inhibitors on PPIX-mediated phototoxicity, a withdrawal test was performed using KO143 analogs. In brief, Fech-mut mice were pretreated with KO143 analogs (100 mg / kg, po). 30 minutes after treatment, the mice were exposed to ultraviolet light for 30 minutes. The same treatment (drug plus light) was repeated once a day for 4 days. Drug treatment was stopped from the 5th day, but light was continued for 4 days. The overall appearance of the mouse skin was recorded every day. All mice were killed on the 9th day and the back skin was collected for evaluation of phototoxicity.

[0486] Effects of ABCG2 inhibitors on PPIX efflux from RBCs.

[0487] RBCs were collected from Fech-mut mice and incubated with each selected KO143 analog (10 μM). PPIX in RBCs and culture medium was extracted and analyzed by UPLC-QTOFMS.

[0488] References

[0489] AG Smith, F. De Matteis, Drugs and the hepatic porphyrias. Clin Haematol 9, 399-425 (1980).

[0490] A. Schauder, A. Avital, Z. Malik, Regulation and gene expression of hemesynthesis under heavy metal exposure--review. J Environ Pathol Toxicol Oncol 29, 137-158 (2010).

[0491] A. V. Anstey, R. J. Hift, Liver disease in erythropoietic protoporphyria: insights and implications for management. Gut 56, 1009-1018 (2007).

[0492] American Porphyria Foundation, https: / / porphyriafoundation.org / about-porphyria / types / EPP-XLP. (2018).

[0493] B. M. McGuire et al., Liver transplantation for erythropoietic protoporphyrialiver disease. Liver Transpl 11, 1590-1596 (2005).

[0494] C. LIM, M. RAZZAQUE, J. Luo, P. FARMER, Isolation and characterization ofprotoporphyrin glycoconjugates from rat Harderian gland by HPLC, capillaryelectrophoresis and HPLC / electrospray ionization MS. Biochem J 347, 757-761 (2000).

[0495] C. Xu, C. Y.-T. Li, A.-N. T. Kong, Induction of phase I, II and III drugmetabolism / transport by xenobiotics. Archives of pharmacal research 28, 249 (2005).

[0496] D.M. Becker, J.D. Viljoen, J. Katz, S. Kramer, Reduced ferrochelatase activity: a defect common to porphyria variegata and protoporphyria. Br J Haematol 36, 171 - 179 (1977).

[0497] E. Henin et al., Pharmacokinetic interactions in mice between irinotecan and MBL-II-141, an ABCG2 inhibitor. Biopharmaceutics & drug disposition 38, 351 - 362 (2017).

[0498] E.I. Minder, X. Schneider-Yin, J. Steurer, L.M. Bachmann, A systematic review of treatment options for dermal photosensitivity in erythropoietic protoporphyria. Cellular and molecular biology (Noisy-le-Grand, France) 55, 84 - 97 (2009).

[0499] F. Li et al., Human PXR modulates hepatotoxicity associated with rifampicin and isoniazid co-therapy. Nat Med 19, 418 - 420 (2013).

[0500] G.S. Marks, D.T. Zelt, S.P. Cole, Alterations in the heme biosynthetic pathway as an index of exposure to toxins. Can J Physiol Pharmacol 60, 1017 - 1026 (1982).

[0501] G. Szakacs, J. K. Paterson, J. A. Ludwig, C. Booth-Genthe, M. M. Gottesman, Targeting multidrug resistance in cancer. Nature reviews. Drug discovery 5, 219-234 (2006).

[0502] H. Baart de la Faille et al., Erythropoietic protoporphyria: clinical aspects with emphasis on the skin. Curr Probl Dermatol 20, 123-134 (1991).

[0503] H. L. Bonkovsky et al., Porphyrin and heme metabolism and the porphyrias. Compr Physiol 3, 365-401 (2013).

[0504] H. Puy, L. Gouya, J.-C. Deybach, Porphyrias. The Lancet 375, 924-937 (2010).

[0505] J. D. Allen et al., Potent and specific inhibition of the breast cancer resistance protein multidrug transporter in vitro and in mouse intestine by a novel analogue of fumitremorgin C. Mol Cancer Ther 1, 417-425 (2002).

[0506] J. G. Langendonk et al., Afamelanotide for Erythropoietic Protoporphyria. The New England journal of medicine 373, 48-59 (2015).

[0507] J. R. Bloomer, The liver in protoporphyria. Hepatology 8, 402-407 (1988).

[0508] J.W. Jonker et al., The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria. Proc Natl Acad Sci U S A 99, 15649 - 15654 (2002).

[0509] K. Liu et al., Metabolism of KO143, an ABCG2 inhibitor. Drug Metabolism and Pharmacokinetics 32, 193 - 200 (2017).

[0510] K. Natarajan, Y. Xie, M.R. Baer, D.D. Ross, Role of breast cancer resistance protein (BCRP / ABCG2) in cancer drug resistance. Biochem. Pharmacol. 83, 1084 - 1103 (2012).

[0511] M.B. Poh - Fitzpatrick, A.A. Lamola, Comparative study of protoporphyrins in erythropoietic protoporphyria and griseofulvin - induced murine protoporphyria. Binding affinities, distribution, and fluorescence spectra in various blood fractions. The Journal of clinical investigation 60, 380 - 389 (1977).

[0512] M. Balwani et al., Clinical, Biochemical, and Genetic Characterization of North American Patients With Erythropoietic Protoporphyria and X-linked Protoporphyria. JAMA dermatology 153, 789 - 796 (2017).

[0513] M. Balwani, R. J. Desnick, The porphyrias: advances in diagnosis and treatment. Hematology Am Soc Hematol Educ Program 2012, 19 - 27 (2012).

[0514] M. J. Casanova - Gonzalez, M. Trapero - Marugan, E. A. Jones, R. Moreno - Otero, Liver disease and erythropoietic protoporphyria: a concise review. World J Gastroenterol 16, 4526 - 4531 (2010).

[0515] M. Lecha, H. Puy, J. C. Deybach, Erythropoietic protoporphyria. Orphanet J Rare Dis 4, 19 (2009).

[0516] M. Wiese, BCRP / ABCG2 inhibitors: a patent review (2009 - present). Expert Opin. Ther. Pat. 25, 1229 - 1237 (2015).

[0517] N. S. Key, J. M. Rank, D. Freese, J. R. Bloomer, D. E. Hammerschmidt, Hemolytic anemia in protoporphyria: possible precipitating role of liver failure and photic stress. American journal of hematology 39, 202 - 207 (1992).

[0518] R.J. Hift, S. Thunell, A. Brun, Drugs in porphyria: From observation to a modern algorithm - based system for the prediction of porphyrogenicity. Pharmacol Ther 132, 158 - 169 (2011).

[0519] S. Boulechfar et al., Ferrochelatase structural mutant (Fechm1Pas) in the house mouse. Genomics 16, 645 - 648 (1993).

[0520] S.D. Whatley et al., C - terminal deletions in the ALAS2 gene lead to gain of function and cause X - linked dominant protoporphyria without anemia or iron overload. American journal of human genetics 83, 408 - 414 (2008).

[0521] S. Kramer, J.D. Viljoen, Erythropoietic protoporphyria: evidence that it is due to a variant ferrochelatase. Int J Biochem 12, 925 - 930 (1980).

[0522] S. Lyoumi et al., Protoporphyrin retention in hepatocytes and Kupffer cells prevents sclerosing cholangitis in erythropoietic protoporphyria mouse model. Gastroenterology 141, 1509 - 1519, 1519e1501 - 1503 (2011).

[0523] S. Sandberg, A. Brun, Light-induced protoporphyrin release from erythrocytes in erythropoietic protoporphyria. The Journal of clinical investigation 70, 693 - 698 (1982).

[0524] S. Tutois et al., Erythropoietic protoporphyria in the house mouse. A recessive inherited ferrochelatase deficiency with anemia, photosensitivity, and liver disease. J Clin Invest 88, 1730 - 1736 (1991).

[0525] S. Zhou et al., Increased expression of the Abcg2 transporter during erythroid maturation plays a role in decreasing cellular protoporphyrin IX levels. Blood 105, 2571 - 2576 (2005).

[0526] T. R. Tephly, A. H. Gibbs, F. De Matteis, Studies on the mechanism of experimental porphyria produced by 3,5 - diethoxycarbonyl - 1,4 - dihydrocollidine. Role of a porphyrin - like inhibitor of protohaem ferro - lyase. Biochem. J 180, 241 - 244 (1979).

[0527] X.Ma et al., The pregnane

[0528] Y. Fukuda et al., The severity of hereditary porphyria is modulated by the porphyrin exporter and Lan antigen ABCB6. Nature communications 7, 12353 (2016).

[0529] Y. Li et al., Synthesis of a new inhibitor of breast cancer resistance protein with significantly improved pharmacokinetic profiles. Bioorg Med ChemLett26, 551-555 (2016).

[0530] sequence

[0531] SEQ ID NO: 1TNF-α forward primer

[0532] CATCTTCTCAAAATTCGAGTGACAA

[0533] SEQ ID NO:2TNF-α reverse primer

[0534] TGGGAGTAGACAAGGTACAACCC

[0535] SEQ ID NO:3 IL-1β forward primer

[0536] TTGAGGGACCCCAAAAGATG

[0537] SEQ ID NO:4 IL-1β reverse primer

[0538] TGGACAGCCCAGGTCAAAG

[0539] SEQ ID NO:5 Collagen 1a1 forward primer

[0540] ACTGCAACATGGAGACAGGTCAGA

[0541] SEQ ID NO:6 Collagen 1a1 reverse primer

[0542] ATCGGTCATGCTCTCTCCAAACCA

[0543] SEQ ID NO:7 Collagen 1a2 forward primer

[0544] GAGGACTTGTTGGTGAGCCT

[0545] SEQ ID NO:8 Collagen 1a2 reverse primer

[0546] CTCACCCTTGTTACCGGATT

[0547] SEQ ID NO:9Mdr1 forward primer

[0548] ATTCTGGGAACTCTCGCTGC

[0549] SEQ ID NO: 10Mdr1 reverse primer

[0550] CTCCAGACTGCTGTTGCTGA

[0551] SEQ ID NO:11Mdr2 forward primer

[0552] CGGCGACTTTGAACTAGGCA

[0553] SEQ ID NO: 12Mdr2 reverse primer

[0554] CAGAGTATCGGAACAGTGTCAAC

[0555] SEQ ID NO: 13Bsep forward primer

[0556] GCAGAAGCAAAGGGTAGCCATC

[0557] SEQ ID NO: 14Bsep reverse primer

[0558] GGTAGCCATGTCCAGAAGCAG

[0559] SEQ ID NO: 15 Mrp2 forward primer

[0560] AGCAGGTGTTCGTTGTGTGT

[0561] SEQ ID NO: 160 Mrp2 reverse primer

[0562] CAGGAGGAATTGTGGCTTGTC

[0563] SEQ ID NO: 17Abcg5 forward primer

[0564] TGGATCCAACACCTCTATGCTAAA

[0565] SEQ ID NO: 18Abcg5 reverse primer

[0566] GGCAGGTTTTCTCGATGAACTG

[0567] SEQ ID NO: 19Abcg8 forward primer

[0568] CCGTCGTCAGATTTCCAATGA

[0569] SEQ ID NO:20Abcg8 reverse primer

[0570] GGCTTCCGACCCATGAATG SEQUENCE LISTING <110> University of Pittsburgh Federal System of Higher Education <120> New treatments for erythropoietic protoporphyria (EPP) and X-linked protoporphyria (XLP) <130> 10504-038WO1 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 1 catcttctca aaattcgagt gacaa 25 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 2 tgggagtaga caaggtacaa ccc 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 3 ttgagggacc ccaaaagatg 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 4 tggacagccc aggtcaaag 19 <210> 5 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 5 actgcaacat ggagacaggt caga 24 <210> 6 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 6 atcggtcatg ctctctccaa acca 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 7 gaggacttgt tggtgagcct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 8 ctcacccttg ttaccggatt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 9 attctgggaa ctctcgctgc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 10 ctccagactg ctgttgctga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 11 cggcgacttt gaactaggca 20 <210> 12 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 12 cagagtatcg gaacagtgtc aac 23 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 13 gcagaagcaa agggtagcca tc 22 <210> 14 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 14 ggtagccatg tccagaagca g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 15 agcaggtgtt cgttgtgtgt 20 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 16 caggaggaat tgtggcttgt c 21 <210> 17 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 17 tggatccaac acctctatgc taaa 24 <210> 18 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 18 ggcaggtttt ctcgatgaac tg 22 <210> 19 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 19 ccgtcgtcag atttccaatg a 21 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic construct <400> 20 ggcttccgac ccatgaatg 19

Claims

1. Use of a therapeutic agent that inhibits ABCG2 activity in the preparation of a medicament for treating, preventing, reducing or inhibiting erythropoietic protoporphyria (EPP) in a subject, wherein the therapeutic agent is a compound represented by the following formula I or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

2. Use of a therapeutic agent that inhibits ABCG2 activity in the preparation of a medicament for treating, preventing, reducing or inhibiting X-linked protoporphyria (XLP) in a subject, wherein the therapeutic agent is a compound represented by the following formula I or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

3. Use of a therapeutic agent that inhibits ABCG2 activity in the preparation of a medicament for reducing PPIX outflow from red blood cells or hepatocytes of a subject, wherein the therapeutic agent is a compound represented by the following formula I or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

4. Use of a therapeutic agent that inhibits ABCG2 activity in the preparation of a medicament for treating, preventing, reducing or inhibiting purpura, erythema, edema or burning sensation in the skin of a subject suffering from erythropoietic protoporphyria (EPP) and X-linked protoporphyria (XLP), wherein the therapeutic agent is a compound represented by the following formula I or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

5. Use of a therapeutic agent that inhibits ABCG2 activity in the preparation of a medicament for treating, preventing, reducing or inhibiting hepatotoxicity in a subject, wherein the therapeutic agent is a compound represented by the following formula I or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

6. The use according to any one of claims 1 to 5, wherein: A is 7. The use according to claim 6, wherein: n is 1 or 2.

8. The use according to any one of claims 1 to 5, wherein: R 2 It is isobutyl.

9. The use according to any one of claims 1 to 5, wherein: R 3 It's hydrogen.

10. The use according to any one of claims 1 to 5, wherein: R 3 It's methyl.

11. The use according to any one of claims 1 to 5, wherein: R 1 Yes OR a , where R a Is H or C 1-6 alkyl.

12. The use according to any one of claims 1 to 5, wherein: R 1 It's a halogen.

13. The use according to claim 11, wherein: R 1 Selected from hydroxyl and C 1-4 A group consisting of alkoxy groups.

14. The use according to claim 13, wherein: R 1 It's a methoxy group.

15. The use according to any one of claims 1 to 5, wherein: The compound is a compound represented by the following formula IA or a pharmaceutically acceptable salt thereof 16. The use according to any one of claims 1 to 5, wherein: The compound is a compound represented by the following formula IB or a pharmaceutically acceptable salt thereof 17. The use according to any one of claims 1 to 5, wherein: The compound is a compound represented by the following formula IC or a pharmaceutically acceptable salt thereof 18. The use according to any one of claims 1 to 5, wherein: The compound is a compound represented by the following formula ID or a pharmaceutically acceptable salt thereof 19. The use according to claim 18, wherein: X is O.

20. A compound represented by the following formula I, or a pharmaceutically acceptable salt thereof: in A is selected from n is an integer from 1 to 4; X, when present, is O or S; R 1 Is halogen or OR a ; R 2 It is C 1-6 alkyl; R 3 is hydrogen or methyl; R 4 and R 5 Each is H; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 8 and R 9 Independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; R a Selected from H, C 1-6 Alkyl, C 1-4 Haloalkyl and C 3-10 cycloalkyl; and Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

21. The compound according to claim 20, wherein A is 22. The compound according to claim 20 or 21, wherein n is 1 or 2.

23. The compound according to claim 20 or 21, wherein R 2 It is isobutyl.

24. The compound according to claim 20 or 21, wherein R 3 It's hydrogen.

25. The compound according to claim 20 or 21, wherein R 1 Yes OR a , and R a Is H or C 1-6 alkyl.

26. The compound according to claim 20 or 21, wherein R 1 It's a halogen.

27. The compound of claim 25, wherein R 1 Selected from hydroxyl and C 1-4 A group consisting of alkoxy groups.

28. The compound of claim 27, wherein R 1 It's a methoxy group.

29. A compound represented by the following formula IA, or a pharmaceutically acceptable salt thereof: in n is an integer from 1 to 4; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

30. The compound of claim 29, wherein n is 1 or 2.

31. The compound of claim 20 or 29, wherein R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl.

32. The compound of claim 31, wherein R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-6 Cycloalkyl and phenyl.

33. The compound of claim 20 or 29, wherein R 6 and R 7 Together with the N atom to which they are attached they form a 5-6 membered heteroaryl group having an additional 0-1 heteroatom independently selected from N, S and O.

34. A compound represented by the following formula IB, or a pharmaceutically acceptable salt thereof: in n is an integer from 1 to 4; R 8 and R 9 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein The C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 8 and R 9 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; Each R A independently selected from OH, CN, halogen, C 1-6 Alkyl, C 1-4 Haloalkyl and C 1-4 Alkoxy.

35. The compound of claim 34, wherein n is 4.

36. The compound of claim 20 or 34, wherein R 9 It's hydrogen.

37. The compound of claim 20 or 34, wherein R 8 Selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl.

38. The compound of claim 37, wherein R 8 and R 9 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-6 Cycloalkyl and phenyl.

39. The compound of claim 20 or 34, wherein R 8 and R 9 Together with the atoms to which they are attached they form a 5-6 membered heteroaryl having an additional 0-1 heteroatom independently selected from N, S and O.

40. A compound represented by the following formula IC, or a pharmaceutically acceptable salt thereof: in: n is an integer from 1 to 4; R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group, or R 6 and R 7 Together with the N atom to which they are attached, they form a 4-7 membered heterocycloalkyl group having an additional 0-1 heteroatom independently selected from N, S and O, which is unsubstituted or substituted with 1, 2 or 3 R A Group; Each R A independently selected from OH, CN, halogen, C 1-4 Alkyl, C 1-6 Haloalkyl and C 1-4 Alkoxy.

41. The compound of claim 40, wherein n is 4.

42. The compound of claim 20 or 40, wherein R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl.

43. The compound of claim 42, wherein R 6 and R 7 Each independently selected from the group consisting of: H, C 1-6 Alkyl, C 3-6 Cycloalkyl and phenyl.

44. The compound of claim 20 or 40, wherein R 6 and R 7 Together with the N atom to which they are attached they form a 5-6 membered heteroaryl group having an additional 0-1 heteroatom independently selected from N, S and O.

45. A compound represented by the following formula ID, or a pharmaceutically acceptable salt thereof: in: n is an integer from 1 to 4; X is O or S; R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl, wherein the C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl are unsubstituted or substituted with 1, 2, 3 or 4 R A Group; Each R A independently selected from OH, CN, halogen, C 1-4 Alkyl, C 1-6 Haloalkyl and C 1-4 Alkoxy.

46. ​​The compound of claim 20 or 45, wherein X is O.

47. The compound of claim 45, wherein n is 3.

48. The compound of claim 20 or 45, wherein R 10 Selected from the group consisting of: C 1-6 Alkyl, C 3-10 Cycloalkyl and 6-10 membered aryl.

49. The compound of claim 48, wherein R 10 It is C 1-6 alkyl.

Images