Lipid-modified oligonucleotides and methods of use thereof

Abstract

The present disclosure generally relates to methods and applications for single cell barcoding and methods for nucleotide sequencing using compositions comprising lipid-modified oligonucleotides.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 871,702, filed on July 8, 2019, which is incorporated by reference in its entirety. Technical Field

[0003] The present disclosure generally relates to methods and applications for single cell barcoding and methods for nucleotide sequencing using compositions comprising lipid-modified oligonucleotides. Background Art

[0004] Single-cell RNA sequencing has become a powerful tool for characterizing transcriptional changes in cells. The main advantage of this technology is the ability to measure the diversity of cells in a sample. All single-cell RNA sequencing protocols share a common initial step, in which the transcribed RNA from the cell is converted into cDNA. The next step is amplification by methods such as PCR and in vitro transcription (IVT). Subsequent steps (ultimately sequencing) allow the expression level of the gene product to be quantified. Isolation of RNA from single cells and barcoding is the first and key limiting step in single-cell RNA-seq.

[0005] Recently, large-scale screening (genetic perturbations using shRNA or CRISPR) has been combined with single-cell RNA sequencing to understand complex biological phenomena. These have the unique advantage of easily identifying / barcoding samples through shRNA or CRISPR gRNA sequences. Genetic perturbation techniques can be directly combined with barcode introduction (i.e., by adding polyA+ barcodes to the gRNA or shRNA itself), while chemical / drug / patient screening that does not involve genetic manipulation cannot be barcoded in a way that can be "read out" via scRNA-seq. See, for example, Adamson et al., Cell 167(7):1867-82(2016); Aarts et al., Genes Dev.31(20):2085-98(2017); Jaitin et al., Cell 167(7):1883-96(2016).

[0006] In single-cell RNA sequencing assays, multiplexing is traditionally achieved by adding molecular barcodes to cDNA fragments or beads, depending on the application. This is done after separating cells using droplet microfluidics or using microwells. In order to allow labeling of cDNA from cells separated in a single droplet (or microwell), beads can be used with real-time PCR (RT) primers that also contain barcodes (or in some cases with barcodes on beads). RT and barcoding can therefore occur in each individual droplet or well. Current methods have at least the following disadvantages: high cost, low efficiency, and low multiplexing capabilities. Due to the number of discrete channels used for cell emulsions and co-encapsulation with mRNA capture beads, the current sample multiplexing capabilities of single-cell RNA sequencing based on commercial droplet microfluidics are limited to eight. Summary of the invention

[0007] The present disclosure relates to compositions comprising oligonucleotides specifically designed to label cells and compositions of pooled cells labeled with different exogenous oligonucleotide barcodes corresponding to different sample preparations (e.g., patients, perturbations, replicates of a single experiment, etc.). By incorporating sample-specific information in the form of lipid-modified exogenous oligonucleotides, sample throughput levels will no longer be limited by the physical dimensions of the microfluidic device. Enhanced sample multiplexing will reduce the cost of single-cell RNA sequencing, limit technical noise caused by batch effects, and make single-cell transcriptome datasets more informative.

[0008] The present disclosure relates to compositions and methods for barcoding single cells using these compositions and for RNA sequencing analysis of tissue fragments taken from subject samples using lipid-modified oligonucleotides. In some embodiments, the present disclosure provides compositions comprising lipid-conjugated DNA oligonucleotides, the lipid-conjugated DNA oligonucleotides comprising a lipid portion, a barcode region, and a capture sequence. In some embodiments, the present invention provides a composition comprising: (a) a first lipid-conjugated DNA oligonucleotide comprising a lipid portion and a first primer region; and (b) a second DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region. In some embodiments, the present disclosure provides a composition comprising: (a) a first lipid-conjugated DNA oligonucleotide comprising a first lipid portion, a first hybridization region, and a first primer region; (b) a second lipid-conjugated DNA oligonucleotide comprising a second hybridization region and a second lipid portion, wherein the second hybridization region is the reverse complement of the first hybridization region; and (c) a third DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region.

[0009] In some embodiments, the present disclosure provides a method for labeling a cell sample, a method for isolating endogenous DNA from a cell sample, or a method for sequencing a nucleic acid sequence from a cell sample, the method comprising: (a) exposing the cell sample to one or more anchor-lipid modified oligonucleotides disclosed herein or any disclosed composition for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell; (b) exposing the cell sample to one or more marker oligonucleotides complementary to the anchor-lipid modified oligonucleotide for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the one or more marker oligonucleotides; (c) ligating the one or more marker oligonucleotides to the one or more anchor-lipid modified oligonucleotides; and optionally (d) detecting the presence of the one or more marker oligonucleotides by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides; and / or (e) isolating the cell based on the presence of the one or more marker oligonucleotides, wherein the presence of the one or more marker oligonucleotides is determined by detecting one or more unique nucleotide sequences corresponding to the one or more marker oligonucleotides. In some embodiments, the cell sample used in the disclosed methods is a three-dimensional preparation of cells from a tissue sample of a subject, with a thickness of about 0.1 micrometers to about 99 micrometers. In some embodiments, the cell membrane is a plasma membrane that separates the cytoplasm from a point outside the cell, or wherein the cell membrane is a nuclear membrane.

[0010] In some embodiments, the present disclosure provides a method for sequencing nucleic acids of one or more cells from a subject sample, comprising: (a) distributing the one or more cells in a three-dimensional preparation or slice having a thickness of about 0.1 microns to about 99 microns corresponding to an area of ​​the sample into a container; (b) labeling the one or more cells corresponding to an area of ​​the sample with an oligonucleotide disclosed herein; (c) isolating the nucleic acid from the one or more cells; and (d) sequencing the nucleic acid from the one or more cells. In some embodiments, the disclosed method further comprises: (e) compiling sequence information from each of the one or more cells. In some embodiments, the disclosed method further comprises associating the sequence information and / or expression profile of the nucleic acid with the spatial location of the one or more cells within the sample or within the subject.

[0011] In some embodiments, the compiling step in the disclosed method includes generating an expression profile for each of the one or more cells corresponding to the region of the sample. In some embodiments, the labeling step in the disclosed method includes: (w) exposing the one or more cells to one or more anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell; and / or (x) exposing the one or more cells to one or more marker oligonucleotides complementary to the anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the one or more marker oligonucleotides; and / or (y) connecting the one or more marker oligonucleotides to the one or more anchor-lipid modified oligonucleotides; and optionally (z) detecting the presence of the one or more marker oligonucleotides by detecting one or more unique nucleotide sequences corresponding to the one or more marker oligonucleotides. In some embodiments, the step of separating cells in the disclosed method includes separating the cells based on the presence of one or more marker oligonucleotides, wherein the presence of the one or more marker oligonucleotides is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides. In some embodiments, the one or more anchor-lipid modified oligonucleotides used in the disclosed methods include: (a) a first lipid-conjugated DNA oligonucleotide comprising a first lipid portion, a first hybridization region, and a first primer region; (b) a second lipid-conjugated DNA oligonucleotide comprising a second hybridization region and a second lipid portion, wherein the second hybridization region is the reverse complement of the first hybridization region; and (c) a third DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region.

[0012] In some embodiments, the present disclosure provides a method for confirming the spatial location of a nucleic acid expression pattern within a sample or tissue of a subject, the method comprising: (a) distributing one or more cells from the sample or a tissue corresponding to an area of ​​the sample into one of a plurality of containers; (b) exposing the one or more cells corresponding to the area of ​​the sample with a known oligonucleotide disclosed herein for a time sufficient to allow the known oligonucleotide to be incorporated into the one or more cells, each oligonucleotide being unique to and corresponding to one of the plurality of containers to which the one or more cells are exposed; (c) isolating nucleic acids from the one or more cells based on the known oligonucleotides; (d) quantifying the expression of nucleic acids from the one or more cells and / or sequencing the nucleic acids; (e) normalizing the expression of nucleic acids in the expression profile; and (f) f) associating the expression profile from the one or more cells with the spatial location of the cells within the sample, relative to the tissue, or within the tissue, wherein the known oligonucleotides disclosed herein in each of the plurality of containers are independently selected from one or a combination of: (x) a first lipid-conjugated DNA oligonucleotide comprising a first lipid portion, a first hybridization region, and a first primer region; and / or (y) a second lipid-conjugated DNA oligonucleotide comprising a second hybridization region and a second lipid portion, wherein the second hybridization region is the reverse complement of the first hybridization region; and / or (z) a third DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region; wherein the dispensing step comprises placing a slice or three-dimensional preparation of the sample having a thickness of about 0.1 to about 99 microns into one of the plurality of containers. In some embodiments, the disclosed method further comprises: (g) exposing the cells to flow cytometry. In some embodiments, the step of separating cells in the disclosed method comprises exposing the cells to flow cytometry.

[0013] In some embodiments, the present disclosure provides a method for sequencing nucleic acids from one or more cells of a subject sample, comprising: (a) distributing the one or more cells corresponding to an area of ​​the sample into a container; (b) labeling the one or more cells corresponding to an area of ​​the sample with an oligonucleotide disclosed herein; (c) isolating the nucleic acid from the one or more cells; and (d) sequencing the nucleic acid from the one or more cells, wherein the distributing step comprises placing a slice or three-dimensional preparation of the sample having a thickness of about 0.1 to about 99 microns into one of a plurality of containers. In some embodiments, the disclosed method further comprises (e) compiling sequence information from each of the one or more cells. In some embodiments, the disclosed method further comprises associating the sequence information and / or expression profile of the nucleic acid with the spatial location of the one or more cells within the sample or within the subject.

[0014] In some embodiments, the compiling step of the disclosed method includes generating an expression profile for each of the one or more cells corresponding to the region of the sample. In some embodiments, the labeling step of the disclosed method includes: (w) exposing the one or more cells to one or more anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell; and / or (x) exposing the one or more cells to one or more marker oligonucleotides complementary to the anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the one or more marker oligonucleotides; and / or (y) connecting the one or more marker oligonucleotides to the one or more anchor-lipid modified oligonucleotides; and optionally (z) detecting the presence of the one or more marker oligonucleotides by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides. In some embodiments, the step of separating the nucleic acid of one or more cells of the disclosed method includes separating the one or more cells based on the presence of one or more marker oligonucleotides, wherein the presence of the one or more marker oligonucleotides is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides.

[0015] In some embodiments, the present disclosure provides a method for confirming the spatial expression pattern of a nucleic acid within a tissue of a subject, the method comprising: (a) distributing one or more cells from a sample corresponding to a region of the tissue into one of a plurality of containers; (b) exposing the one or more cells to a lipid-conjugated DNA oligonucleotide comprising a lipid portion, a barcode region, and a capture sequence, for a period of time sufficient for the lipid portion to embed itself within a cell membrane of the one or more cells, wherein the barcode region of the lipid-conjugated DNA oligonucleotide is unique to each of the plurality of containers to which the one or more cells are exposed; (c) sequencing the nucleic acids captured by the capture sequence of the lipid-conjugated DNA oligonucleotide in the one or more cells; and (d) associating the sequenced nucleic acids from the one or more cells with the spatial position of the one or more cells within and / or relative to the tissue based on the barcode region contained in each of the sequenced nucleic acids. In some embodiments, the lipid-conjugated DNA oligonucleotide used in the disclosed method includes: (i) a first lipid-conjugated DNA oligonucleotide comprising the lipid portion and a first primer region; and (ii) a second DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region. In some embodiments, the first lipid-conjugated DNA oligonucleotide also comprises a first hybridization region. In some embodiments, the disclosed method further comprises exposing the one or more cells to a second lipid-conjugated DNA oligonucleotide prior to the step of sequencing, wherein the second lipid-conjugated DNA oligonucleotide comprises a second hybridization region and a second lipid portion, wherein the second hybridization region is the reverse complement of the first hybridization region. In some embodiments, the disclosed method further comprises (e) exposing the cells to flow cytometry. In some embodiments, the dispensing step of the disclosed method comprises placing a tissue section or a three-dimensional preparation of the sample having a thickness of about 0.1 to about 99 microns into one of a plurality of containers. In some embodiments, the one or more containers used in the disclosed method are porous. In some embodiments, the sample used in the disclosed method is a tissue section.

[0016] In some embodiments, the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the first lipid portion, the first hybridization region, and the first primer region from 5' to 3' orientation. In other embodiments, the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the first lipid portion, the first hybridization region, and the first primer region from 3' to 5' orientation.

[0017] In some embodiments, the second lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the second hybridization region and the second lipid moiety from a 5' to 3' orientation. In some embodiments, the second lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the second hybridization region and the second lipid moiety from a 3' to 5' orientation.

[0018] In some embodiments, the third DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the second primer region, the barcode region, and the capture sequence from a 5' to 3' orientation. In some embodiments, the third DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises the second primer region, the barcode region, and the capture sequence from a 3' to 5' orientation.

[0019] In some embodiments, the first lipid moiety used in the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a fatty acid having about 12 to about 28 carbons. In some embodiments, the second lipid moiety used in the second lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a fatty acid having about 12 to about 28 carbons. In some embodiments, both the first lipid moiety and the second lipid moiety used in the lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprise a fatty acid having about 12 to about 28 carbons.

[0020] In some embodiments, the first lipid moiety used in the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a compound of Formula I:

[0021]

[0022] or a physiologically acceptable salt thereof,

[0023] where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from NH, CH 2 In some embodiments, the first lipid portion comprises a lipid selected from the group consisting of lignoceric acid and cholesterol. In some embodiments, the cholesterol is cholesterol-triethylene glycol (TEG).

[0024] In some embodiments, the second lipid moiety used in the second lipid-conjugated DNA oligonucleotides of the present disclosure (including the disclosed compositions and methods) comprises a compound of Formula II:

[0025]

[0026] or a physiologically acceptable salt thereof,

[0027] where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from NH, CH 2 In some embodiments, the second lipid portion comprises a lipid selected from the group consisting of palmitic acid and cholesterol. In some embodiments, the cholesterol is cholesterol-triethylene glycol (TEG).

[0028] In some embodiments, the capture sequence used in the third DNA oligonucleotide of the present disclosure, including the disclosed compositions and methods, is a polyadenylation region.

[0029] In some embodiments, the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a nucleic acid sequence having at least about 70% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 (GTAACGATCCAGCTGTCACTTGGAATTCTCGGGTGCCAAGG). In some embodiments, the second lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a nucleic acid sequence having at least about 70% sequence identity to the nucleic acid sequence of SEQ ID NO: 2 (AGTGACAGCTGGATCGTTAC). In some embodiments, the third DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence of SEQ ID NO: 3 (CCTTGGCACCCGAGAATTCCANNNN NNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA).

[0030] In some embodiments, the first lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) is bound to a solid support. In some embodiments, the second lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) is bound to a solid support. In some embodiments, the third lipid-conjugated DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) is bound to a solid support. In some embodiments, one or more of the first lipid-conjugated DNA oligonucleotide, the second lipid-conjugated DNA oligonucleotide, and the third lipid-conjugated DNA oligonucleotide is bound to a solid support. In some embodiments, the solid support is a bead. In some embodiments, the capture sequence used in the third DNA oligonucleotide of the present disclosure (including the disclosed compositions and methods) comprises a polyadenylation region, and the bead comprises a poly (T) region hybridized with the polyadenylation region of the third DNA oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic and example results showing an adult intestinal experiment used as a representative example of a barcode classification workflow. Note that the data were taken from samples of tissue with a thickness of more than 1 cm and are merely examples of data that can be collected using the predictive collection methods provided in the Examples.

[0032] Figure 2 Results from a developing gut experiment used as a representative example of a barcode classification workflow are shown. Note that the data were taken from samples of tissue over 1 cm thick and are merely examples of data that can be collected using the predicted collection methods provided in the Examples. DETAILED DESCRIPTION

[0033] Before describing the exemplary embodiments, it is to be understood that the present disclosure is not limited to the particular embodiments described, as such embodiments may, of course, vary. It is also to be understood that the terminology used herein is only for the purpose of describing particular embodiments and is not intended to be limiting, as the scope of the present disclosure will be limited only by the appended claims.

[0034] Where a numerical range is provided, it is to be understood that, unless the context clearly specifies otherwise, each intermediate value (to one tenth of the unit of the lower limit) between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any specified value or intermediate value in a specified range and any other specified or intermediate value in the specified range is encompassed in the present disclosure. The upper and lower limits of these smaller ranges may be independently included or excluded in the range, and each range in which any limit is included in the smaller range, any limit is not included in the smaller range, or both limits are included in the smaller range is also encompassed in the present disclosure, subject to any specifically excluded limits in the specified range. Where a specified range includes one or both of the limits, ranges excluding either or both of those included limits are also encompassed in the present disclosure.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the disclosed embodiments, some potential and exemplary methods and materials may now be described. Any and all publications mentioned herein are incorporated herein by reference in their entirety to disclose and describe methods and / or materials associated with the cited publications. To the extent there is a conflict, the present disclosure replaces any disclosure of the incorporated publications.

[0036] It is further noted that the claim design may exclude any element that may be optional. Therefore, this statement is intended to serve as antecedent basis for the use of exclusive terminology such as "solely," "only" and the like in connection with the recitation of claim elements, or the use of a "negative" limitation.

[0037] The publications discussed herein are provided solely because their disclosures precede the filing date of the present application. Nothing herein should be construed as an admission that the present disclosure is not entitled to preempt such publications. Further, the publication dates provided may differ from the actual publication dates that may require independent confirmation. To the extent that definitions of terms that may be provided in such publications conflict with explicit or implicit definitions of the present disclosure, the definitions of the present disclosure shall prevail.

[0038] It will be apparent to those skilled in the art after reading this disclosure that each individual embodiment described and illustrated herein has discrete components and features that can be easily separated or combined with any of the other several embodiments without departing from the scope or essence of the present disclosure. Any recited method can be performed in the order of events recited or in any other order that is logically possible.

[0039] definition

[0040] Before describing the compositions and methods of the present invention, it is to be understood that the present disclosure is not limited to the specific molecules, compositions, methods or protocols described, as these may vary. It is also to be understood that the terms used in the specification are only for the purpose of describing a specific form or embodiment and are not intended to limit the scope of the present disclosure, which will be limited only by the appended claims. It is to be understood that these embodiments are not limited to the specific methods, protocols, cell lines, vectors and reagents described, as these may vary. It is also to be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the embodiments of the present invention or the claims.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. Although any method and material similar or equivalent to those described herein may be used in the practice or testing of the embodiments of the present disclosure, methods, devices and materials are now described. All publications mentioned herein are incorporated herein by reference. Nothing herein should be construed as admitting that the present disclosure is not entitled to be disclosed prior to such disclosure by virtue of prior disclosure.

[0042] As used herein in the specification and claims, the indefinite article "a" or "an" should be understood to mean "at least one" unless explicitly stated to the contrary.

[0043] The phrase "and / or" as used herein in the specification and claims should be understood to mean "either or both" of the elements so combined, i.e., elements that are present in combination in some cases and separately in other cases. In addition to the elements specifically identified by the "and / or" clause, other elements may optionally be present, whether related or not to those elements specifically identified, unless expressly stated to the contrary. Thus, as a non-limiting example, reference to "A and / or B" when used in conjunction with open-ended language such as "comprising" may refer to A without B (optionally including elements other than B) in one embodiment; to B without A (optionally including elements other than A) in another embodiment; to both A and B (optionally including other elements) in yet another embodiment; and so on.

[0044] As used herein in the specification and claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., including multiple elements or at least one element in a list of elements, but also including more than one element, and optionally including additional unlisted items. Only terms that clearly indicate the opposite meaning, such as "only one of them" or "exactly one of them", or when used in the claims, "consisting of..." will refer to including multiple elements or exactly one element in a list of elements. In general, the term "or" as used herein can only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when it is preceded by an exclusive wording, "either of the two", "one of them", "only one of them" or "exactly one of them", and "essentially consisting of..." when used in the claims should have the general meaning used in the field of patent law.

[0045] As used herein, the term "about" when referring to a measurable value such as an amount, duration, etc., is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are suitable for practicing the disclosed methods.

[0046] As used herein, the phrase "an integer from X to Y" means any integer including the endpoints. That is, where a range is disclosed, each integer in the range including the endpoints is disclosed. For example, the phrase "an integer from X to Y" discloses 1, 2, 3, 4, or 5, as well as a range of 1 to 5.

[0047] As used herein, the term "endogenous" refers to a substance originating from an organism. Thus, an "endogenous" nucleic acid refers to a nucleic acid that originates or is produced within an organism, tissue, or cell.

[0048] As used herein, the term "normalization" or "normalized" refers to the expression level of a nucleic acid relative to the average expression level of one or a group of reference nucleic acids. Reference nucleic acids are based on their minimal variation across tissues or cells.

[0049] The term "labeling oligonucleotide" refers to an oligonucleotide comprising a sequence complementary to at least a portion of an anchor-lipid-modified oligonucleotide as defined herein, such that the anchor-lipid-modified oligonucleotide forms a complementary strand of nucleic acid with the labeling oligonucleotide. In some embodiments, the labeling oligonucleotide comprises a primer region as defined herein. In some embodiments, the labeling oligonucleotide comprises a barcode region as defined elsewhere herein. In some embodiments, the labeling oligonucleotide comprises a capture sequence as defined herein.

[0050] The terms "lipid-modified oligonucleotide", "lipid-DNA", "hydrophobic-anchored oligonucleotide" and similar terms should be broadly interpreted to include any oligonucleotide or polynucleotide attached by any means to a hydrophobic, lipophilic or amphiphilic region that can be inserted into a membrane, regardless of whether the "lipid-modified oligonucleotide", "lipid-DNA", "hydrophobic-anchored oligonucleotide" or portion thereof is actually inserted into the membrane.

[0051] The term "membrane" or any similar term is used broadly and generally herein to refer to any lipid-containing membrane, cell membrane, nuclear membrane, monolayer, bilayer, vesicle, liposome, lipid bilayer, etc., and the disclosure is not intended to be limited to any particular membrane.

[0052] As used herein, the terms "subject," "individual," or "patient," which are used interchangeably, mean any animal, including mammals, such as mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or primates, such as humans.

[0053] As used herein, the term "kit" refers to a set of components provided in the case of a system for sequencing nucleotides and / or separating nucleotide sequences and / or diagnosing a subject with a disease or infection based on the presence, absence and / or amount of an expressed nucleotide sequence from a sample or cell. In some embodiments, the term kit refers to a set of components provided in the case of a system for sequencing nucleotides and / or separating nucleotide sequences and / or diagnosing a subject with a disease or infection based on the spatial position of an expressed nucleotide sequence in a sample or cell. Such systems may include, for example, a system that allows storage, confirmation or delivery of an expressed gene from one position to another in one or more cells (e.g., oligonucleotides in appropriate containers, oligonucleotides encoding enzymes, extracellular matrix components, etc.) and / or supporting materials (e.g., buffers, culture media, cells, written instructions for measuring, etc.). For example, in some embodiments, the kit includes one or more shells (e.g., boxes) containing relevant reaction reagents and / or supporting materials. As used herein, the term "fragmentation kit" refers to a diagnostic assay comprising two or more separate containers, each of which contains a sub-portion of the total kit components. The container may be delivered to the intended recipient together or separately. For example, the first container may contain a solid support or polystyrene plate for cell culture assays, and the second container may contain cells, such as control cells. As another example, the kit may include a first container and a second container, wherein the first container comprises a solid support, such as a chip or a slide, having one or more ligands with affinity for one or more biomarkers disclosed herein, and the second container comprises any one or more reagents necessary for detecting and / or quantifying the amount of lipid-modified oligonucleotides in a sample. The term "fragmentation kit" is intended to encompass a kit containing an analyte-specific reagent (ASR) as specified in Article 520 (e) of the Federal Food, Drug, and Cosmetic Act, but is not limited thereto. Any delivery system comprising two or more separate containers is included in the term "fragmentation kit", each container comprising a sub-portion of the total kit components. In contrast, a "combination kit" refers to a delivery system containing all components in a single container (e.g., in a single box containing each required component). The term "kit" includes both fragmented and combined kits.

[0054] As used herein, the term "animal" includes, but is not limited to, humans and non-human vertebrates, such as wild animals, rodents such as rats, ferrets, and domestic and farm animals such as dogs, cats, horses, pigs, cattle, sheep, and goats. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human. In some embodiments, the animal is a non-human mammal.

[0055] As used herein, the term "mammal" means any animal in the class Mammalia, such as rodents (i.e., mice, rats, or guinea pigs), monkeys, cats, dogs, cattle, horses, pigs, or humans. In some embodiments, the mammal is a human. In some embodiments, the mammal refers to any non-human mammal. The disclosure relates to any method or material composition disclosed herein, wherein the sample is taken from a mammal or a non-human mammal. The disclosure relates to any method or material composition disclosed herein, wherein the sample is taken from a human.

[0056] As used herein, the phrase "in need" means that the animal or mammal has been confirmed or suspected of having a need for a particular method or treatment, which is required based on the presence, absence and / or amount of a biomarker. In some embodiments, the confirmation can be performed by any diagnostic or observational means. In any of the methods and treatments described herein, the animal or mammal can be an animal or mammal in need. In some embodiments, the animal or mammal is in or will be traveling to an environment where a particular disease or condition is prevalent or more likely to occur.

[0057] The specific use of the terms "nucleic acid", "oligonucleotide" and "polynucleotide" should never be considered as limiting and are used interchangeably herein. When the relevant nucleic acid molecule generally contains less than about 100 bases, "oligonucleotide" is used. When the relevant nucleic acid molecule generally contains more than about 100 bases, "polynucleotide" is used. Both terms are used to represent DNA, RNA, modified or synthetic DNA or RNA (including but not limited to nucleic acids containing synthetic and naturally occurring base analogs, dideoxy sugars or other sugars, thiols or other non-natural or natural polymer backbones) or other polymers containing nucleobases that can hybridize with DNA and / or RNA. Therefore, the terms should not be interpreted as limiting or restricting the length of the nucleic acids mentioned and used herein, nor should the terms be used to limit the properties of the polymer backbones to which the nucleobases are attached.

[0058] Polynucleotides disclosed herein can be single-stranded, double-stranded, triple-stranded, or include a combination of these conformations.Usually polynucleotides contain phosphodiester bonds, although in some cases as outlined below include nucleic acid analogs that may have alternative main chains, including phosphoramide, phosphorothioate, phosphorodithioate, O-methylphosphoramidite bonding and peptide nucleic acid main chains and bonding.Other analog nucleic acids include morpholino, locked nucleic acid (LNA) and those with positive main chains, nonionic main chains and non-ribose main chains.Nucleic acids containing one or more carbocyclic sugars are also included in the definition of nucleic acids.These modifications can be carried out to the ribose-phosphate main chain, so that other parts such as labels are added, or the stability and the half-life of this type of molecule in a physiological environment are increased.

[0059] The term "nucleic acid sequence" or "polynucleotide sequence" refers to a contiguous string of nucleotide bases and, in certain contexts, also refers to the specific arrangement of the nucleotide bases relative to each other as they occur in a polynucleotide.

[0060] As used herein, the terms "comprising / comprise / comprises / comprised", "having / have / has", "including / includes / include", or "containing / contains / contain" are inclusive or open-ended and do not exclude additional unrecited elements or method steps.

[0061] As used herein, the term "fluorescent probe" refers to any molecule (dye, peptide or fluorescent marker) that emits a known and / or detectable wavelength of light when exposed to light of a known wavelength. In some embodiments, a substrate or peptide with a known cleavage site can be recognized by any enzyme expressed by one or more animals or unicellular organisms. In some embodiments, a fluorescent probe is attached to any one of one or more oligonucleotide sequences disclosed herein. In some embodiments, the attachment of a fluorescent probe to an oligonucleotide disclosed herein produces a chimeric molecule that can emit fluorescence when the substrate is exposed to an enzyme and light of a known wavelength, so that exposure to the enzyme produces a reaction product that can be quantified in the presence of a fluorometer or spectrophotometer. In some embodiments, before the enzymatic cleavage of the substrate, the fluorescent probe is completely quenched when exposed to light of a known wavelength, and the fluorescent probe emits light of a known wavelength, the intensity of which can be quantified by the absorbance reading or intensity level after the probe is cut from the oligonucleotide bound thereto in the presence of a fluorometer and optionally after the probe is cut. In some embodiments, the fluorescent probe is a coumarin-based dye or a rhodamine-based dye, which has a measurable or quantifiable fluorescence emission spectrum in the presence of a predetermined wavelength of light or when exposed to a predetermined wavelength of light. In some embodiments, the fluorescent probe comprises rhodamine. In some embodiments, the fluorescent probe comprises rhodamine-100. Coumarin-based fluorescent probes are known in the art, such as U.S. Patent Nos. 7625758 and 7863048, which are incorporated herein by reference in their entirety. In some embodiments, the fluorescent probe is a component that is covalently bound, non-covalently bound, and inserted into one or more substrates with any enzyme disclosed herein. In some embodiments, the fluorescent probe is selected from ACC or AMC. In some embodiments, the fluorescent probe is a fluorescein molecule. In some embodiments, the fluorescent probe can be exposed to one or more enzymes that catalyze the cutting of one or more lipid-modified oligonucleotides disclosed herein and emit a resonance wave that can be detected and / or quantified by a fluorometer.

[0062] As used herein, the term "score" refers to a single value or range of values ​​that can be used as a component in a predictive model for diagnosis, prognosis, or clinical treatment plan of a subject, wherein a single value is calculated by combining the raw data value with a control value based on a feature or metric measured in the system and / or normalizing the raw data value for a control value based on a feature or metric measured in the system. In some embodiments, the score is calculated by an interpretation function or algorithm. In some embodiments, the subject is suspected of having the expression of a gene that promotes or contributes to the possibility of obtaining a disease state or its expression is associated with the presence of a pathogen. The calculation of the score can be completed using a known algorithm executable in a computer program product in a device used in sequencing or analyzing a sample. For example, in the case of using a BioRAD ddSEQ single-cell isolator, the algorithm required for detecting, quantifying, or visualizing a probe and / or a barcode labeled with a probe is described in BioRad publication 7139 entitled "Implementing the Drop-Seq Protocol on Bio-Rad's ddSEQ Single-Cell Isolator", the website is https: / / www.bio-rad.com / en-us / product / ddseq-single-cell-isolator? ID=OKNWBSE8Z, the contents of which are incorporated by reference in their entirety. In some embodiments, the methods disclosed herein include the substeps of detecting the presence or absence or amount of a given barcode oligonucleotide by calculating the amount of the probe in a control sample, calculating the amount of the probe in a cell sample, and normalizing the signal obtained from the cell sample by subtracting the signal obtained from the control sample.

[0063] In order to facilitate the detection of lipid-modified oligonucleotides disclosed herein, a surface including one or more reaction vessels, such as a plate, a hole, a bead or other solid support, such as a detectable substance can be pre-applied. In some embodiments, the sample can be pre-mixed with a diluent or a reagent before it is applied to the surface. Detectable substances can serve as lipid-oligonucleotides that can be detected visually or by an instrument. Any substance that can generally produce a signal that can be detected visually or by an instrument can be used as a detection probe. Suitable detectable substances may include, for example, luminescent compounds (e.g., fluorescence, phosphorescence, etc.); radioactive compounds; visual compounds (e.g., colored dyes or metal substances, such as gold); liposomes or other vesicles containing substances that generate signals; enzymes and / or substrates, etc. Other suitable detectable substances can be found in U.S. Patent No. 5,670,381 to Jou et al. and U.S. Patent No. 5,252,459 to Tarcha et al., which are incorporated herein by reference in their entirety for all purposes. If the detectable substance is colored, the ideal electromagnetic radiation is light of a complementary wavelength. For example, a blue detection probe strongly absorbs red light. In some embodiments, the lipid-modified oligonucleotide comprises a probe. In some embodiments, the detectable probe comprises or is composed of a luminescent compound that produces an optically detectable signal corresponding to the level or amount of the lipid-oligonucleotide in the sample. For example, suitable fluorescent molecules may include, but are not limited to, fluorescein, europium chelates, phycobiliproteins, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, fluorescamine, rhodamine, and their derivatives and analogs. Other suitable fluorescent compounds have semiconductor nanocrystals commonly referred to as "quantum dots". For example, such nanocrystals may contain a core of formula CdX, wherein X is Se, Te, S, etc. Nanocrystals may also be passivated with an upper shell of formula YZ, wherein Y is Cd or Zn, and Z is S or Se. Other examples of suitable semiconductor nanocrystals may also be found in U.S. Patent No. 6,261,779 to Barbera-Guillem et al. and U.S. Patent No. 6,585,939 to Dapprich, which are incorporated herein by reference in their entirety for all purposes.

[0064] Further, suitable phosphorescent compounds may include metal complexes of one or more metals such as ruthenium, osmium, rhenium, iridium, rhodium, platinum, indium, palladium, molybdenum, technetium, copper, iron, chromium, tungsten, zinc, etc. Particularly preferred are ruthenium, rhenium, osmium, platinum and palladium. The metal complex may contain one or more ligands that promote the dissolution of the complex in an aqueous or non-aqueous environment. For example, some suitable examples of ligands include, but are not limited to, pyridine; pyrazine; isonicotinamide; imidazole; bipyridine; terpyridine; phenanthroline; bipyridophenazine; porphyrin; porphine; and derivatives thereof. Such ligands may be, for example, substituted alkyl, substituted alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate, formaldehyde, carboxamide, cyano, amino, hydroxyl, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidine salt, urea, sulfur-containing groups, phosphorus-containing groups, and carboxylate esters of N-hydroxysuccinimide.

[0065] Porphyrin and porphyrin metal complex have pyrrole groups coupled with methylene bridges to form a ring structure with a metal chelate inner cavity. Many of these molecules show strong phosphorescence properties at room temperature in suitable solvents (e.g., water) and oxygen-free environments. Some suitable porphyrin complexes that can show phosphorescence properties include but are not limited to platinum (II) coproporphyrin-I and III, palladium (II) coproporphyrin, ruthenium coproporphyrin, zinc (II)-coproporphyrin-I, its derivatives, etc. Similarly, some suitable porphyrin complexes that can show phosphorescence properties include but are not limited to platinum (II) tetra-meso-fluorophenylporphyrin and palladium (II) tetra-meso-fluorophenylporphyrin. Still other suitable porphyrins and / or porphine complexes are described in U.S. Pat. Nos. 4,614,723 to Schmidt et al.; 5,464,741 to Hendrix; 5,518,883 to Soini; 5,922,537 to Ewart et al.; 6,004,530 to Sagner et al.; and 6,582,930 to Ponomarev et al., which are incorporated herein by reference in their entirety for all purposes.

[0066] As used herein, "sequence identity" is determined by using an independently executable BLAST engine program for two sequences (bl2seq), which can be downloaded from the National Center for Biotechnology Information (NCBI) ftp site, using default parameters (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; which is incorporated herein by reference in its entirety). The term "homologous to" is used synonymously with the measured "sequence identity".

[0067] As used herein, the term "sample" generally refers to a limited amount of something that is intended to be similar to and represent a larger amount of that thing. In the present disclosure, a sample is a collection, swab, brush, scraping, biopsy, removed tissue or surgical resection to be tested for the assay or method disclosed herein. In some embodiments, the sample is taken from a patient or subject who is considered to contain hyperproliferative cells. In some embodiments, a sample that is considered to contain an infection is compared with a "control sample" known to not contain one or more cells. In some embodiments, a sample that is considered to contain pathogen cells is compared with a control sample known to not contain pathogen cells. In some embodiments, a sample that is considered to contain hyperproliferative cells is compared with a control sample known to not contain hyperproliferative cells. In some embodiments, a sample that is considered to contain hyperproliferative cells is compared with a control sample known to not contain hyperproliferative cells. In some embodiments, a sample is an environmental place or location such as a brush on a laboratory bench or medical device. The present disclosure contemplates using any one or more methods disclosed herein to confirm, detect and / or quantify the amount of potentially harmful gene expression or harmful pathogens or harmful cells on a specific item or location based on the expression of harmful genes or nucleotide sequences.

[0068] The terms "complementary" or "complementarity" refer to polynucleotides (i.e., sequences of nucleotides) that are related by the base pairing rules, e.g., the sequence "5'-AGT-3'" is complementary to the sequence "5'-ACT-3'". Complementarity can be "partial", in which only some of the bases of the nucleic acids are matched according to the base pairing rules, or there can be "complete" or "complete" complementarity between the nucleic acids. Under certain conditions, the degree of complementarity between nucleic acid strands can have a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important for methods that rely on binding between nucleic acid bases.

[0069] Any probe disclosed herein can be an antibody. As used herein, the term "antibody" refers to a polypeptide or group of polypeptides consisting of at least one binding domain, which is formed by the folding of a polypeptide chain having a three-dimensional binding space, and the binding space has an internal surface shape and charge distribution that are complementary to the characteristics of the antigenic determinant of the antigen. Antibodies usually have a tetrameric form, containing two pairs of identical polypeptide chains, each pair having one "light" chain and one "heavy" chain. The variable region of each light chain / heavy chain pair forms an antibody binding site. As used herein, a "targeted binding agent" is an antibody or binding fragment thereof that preferentially binds to a target site. In one embodiment, the targeted binding agent is specific for only one target site. In other embodiments, the targeted binding agent is specific for more than one target site. In one embodiment, the targeted binding agent can be a monoclonal antibody, and the target site can be an epitope or antigen on the cell surface comprising one or more modified oligonucleotides disclosed herein. The "binding fragment" of an antibody is produced by recombinant DNA technology or by enzymatic or chemical cleavage of an intact antibody. Binding fragments include Fab, Fab', F(ab')2, Fv and single-chain antibodies. Antibodies other than "bispecific" or "bifunctional" antibodies are understood to have each of their binding sites identical. An antibody substantially inhibits the adhesion of a receptor to a counter-receptor when an excess of the antibody reduces the amount of receptor bound to the counter-receptor by at least about 20%, 40%, 60% or 80%, and more usually by more than about 85%, as measured in an in vitro competitive binding assay. The antibody may be an oligoclonal antibody, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a multispecific antibody, a bispecific antibody, a catalytic antibody, a chimeric antibody, a humanized antibody, a fully human antibody, an anti-idiotypic antibody, and antibodies that may be labeled in soluble or binding form, as well as fragments, variants or derivatives thereof, alone or in combination with other amino acid sequences provided by known techniques. The antibody may be from any species. The term antibody also includes binding fragments of the antibodies of the invention; exemplary fragments include Fv, Fab, Fab', single chain antibodies (svFC), dimeric variable regions (diabodies), and disulfide stabilized variable regions (dsFv). As discussed herein, the present invention contemplates minor changes in the amino acid sequence of an antibody or immunoglobulin molecule, provided that the change in the amino acid sequence maintains at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99% sequence identity to the antibody or immunoglobulin molecule described herein. In particular, conservative amino acid substitutions are contemplated. Conservative substitutions are those that occur within a family of amino acids with related side chains. Genetically encoded amino acids are generally divided into the following families: (1) acidic = aspartic acid, glutamic acid; (2) basic = lysine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine.More preferred families are: serine and threonine are aliphatic-hydroxyl families; asparagine and glutamine are amide-containing families; alanine, valine, leucine and isoleucine are aliphatic families; and phenylalanine, tryptophan and tyrosine are aromatic families. For example, it is reasonable to expect that the substitution of leucine alone with isoleucine or valine, the substitution of aspartic acid alone with glutamic acid, the substitution of threonine alone with serine, or similar amino acid substitutions with structurally related amino acids will not have a significant effect on the binding function or properties of the resulting molecule, especially if the substitution does not involve amino acids within framework sites. Whether an amino acid change will produce a functional peptide can be easily determined by measuring the specific activity of a polypeptide derivative. The assay is described in detail herein. Fragments or analogs of antibodies or immunoglobulin molecules can be easily prepared by one of ordinary skill in the art. The preferred amino and carboxyl termini of the fragments or analogs occur near the boundaries of the functional domains. The structure and functional domains can be confirmed by comparing the nucleotide and / or amino acid sequence data with public or proprietary sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformational domains that appear in other proteins of known structure and / or function. Methods for identifying protein sequences that fold into known three-dimensional structures are known, see, for example, Bowie et al., Science 253:164 (1991), which is incorporated by reference in its entirety. Antibodies can be fragmented using conventional techniques and the fragments can be screened for utility in the same manner as described above for intact antibodies. For example, F(ab')2 fragments can be produced by treating antibodies with pepsin. The resulting F(ab')2 fragments can be treated to reduce disulfide bridges to produce Fab' fragments.

[0070] The present disclosure also contemplates the use of one or more chimeric antibody derivatives, i.e., antibody molecules that combine non-human animal variable regions and human constant regions. Chimeric antibody molecules may include, for example, antigen binding domains of antibodies from mice, rats, or other species with human constant regions. A variety of methods for preparing chimeric antibodies have been described, and can be used to prepare chimeric antibodies containing immunoglobulin variable regions that recognize selected antigens on the surface of differentiated cells or tumor cells. See, for example, Morrison et al., 1985; Proc. Natl. Acad. Sci. USA 81, 6851; Takeda et al., 1985, Nature 314: 452; Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, British Patent GB 2177096B. In any of the disclosed methods, the method may include exposing any antibody having affinity for any reaction product produced by cleavage of a known substrate following exposure of the substrate to any one or more of the enzymes listed in Table 1.

[0071] Chemical conjugation is based on the use of homo- and hetero-bifunctional reagents with E-amino groups or hinge region thiol groups. Homo-bifunctional reagents such as 5,5′-dithiobis(2-nitrobenzoic acid) (DNTB) generate disulfide bonds between two Fabs, and o-phenylenedimaleimide (O-PDM) generates thioether bonds between two Fabs (Brenner et al., 1985, Glennie et al., 1987). Hetero-bifunctional reagents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) bind to exposed amino groups of antibodies and Fab fragments, regardless of class or isotype (Van Dijk et al., 1989).

[0072] Various formats can be used to test the presence or absence of lipid-modified oligonucleotides or nucleic acid sequences or functional fragments thereof in samples or cells isolated from subjects using the assay device disclosed herein. For example, a "sandwich" format typically involves mixing a test sample with a lipid-modified nucleic acid sequence conjugated to a specific binding member (e.g., an antibody) of an analyte to form a complex between the analyte and the conjugated probe. These complexes are then contacted with a receptive substance (e.g., an antibody) fixed in a detection zone. Binding occurs between the analyte / probe conjugated complex and the fixed receptive substance, thereby locating a detectable "sandwich" complex to indicate that the analyte or antigen is present on any of the cells disclosed herein. This technique can be used to obtain quantitative or semi-quantitative results. U.S. Pat. No. 4,168,146 describes some examples of such sandwich-type assays.

[0073] As used herein, the term "hybridization" is used to refer to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between nucleic acids) are affected by factors such as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, and the T of the hybrid formed. m The "hybridization" method involves the annealing of one nucleic acid to another complementary nucleic acid (i.e., a nucleic acid having a complementary nucleotide sequence).

[0074] Hybridization is performed under conditions that allow specific hybridization. The length, secondary structure, and GC content of the complementary sequence affect the thermal melting point T required to obtain the hybridization conditions required for specific hybridization of the target site to the target nucleic acid. m . Hybridization can be carried out under stringent conditions. The phrase "stringent hybridization conditions" refers to conditions under which the probe will hybridize to its target subsequence (usually in a complex mixture of nucleic acids), but not to other sequences at a detectable or significant level. Stringent conditions are sequence-dependent and are different in different situations. Stringent conditions are conditions in which the salt concentration is less than about 1.0 M sodium ions, such as less than about 0.01 M, including about 0.001 M to about 1.0 M sodium ion concentration (or other salts) at a pH between about 6 and about 8, and the temperature is in the range of about 20°C to about 65°C. Stringent conditions can also be achieved by adding a destabilizing agent (such as, but not limited to, formamide).

[0075] Oligonucleotide sequences, nucleic acid sequences or other reagents disclosed herein can be used as pharmaceutically acceptable salts, esters or amides in particular. The term "salt" refers to inorganic and organic salts of compounds disclosed herein. Salts can be prepared in situ during the final separation and purification of compounds, or by reacting the purified compounds in their free alkali or acid form with suitable organic or inorganic bases or acids alone and separating the salts thus formed. Representative salts include hydrobromate, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthoate, mesylate, glucoheptonate, lactobionate and lauryl sulfonate etc. Salts can include cations based on alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, etc., and non-toxic ammonium, quaternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc. See, for example, SM Berge et al., "Pharmaceutical Salts," J Pharm Sci, 66: 1-19 (1977). In some embodiments, the compositions disclosed herein comprise one or more salts of the oligonucleotide sequences disclosed herein.

[0076] The term "thermal melting point", "melting temperature" or "T m"" in this context refers to the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, at T m In some cases, the term “T d " is used to define the temperature at which at least half of the probes are dissociated from a perfectly matched target nucleic acid.

[0077] The formation of duplex molecules with all fully formed hydrogen bonds between corresponding nucleotides is referred to as "matched" or "fully matched", and duplexes with single or several pairs of non-corresponding nucleotides are referred to as "mismatched". Under appropriate experimental conditions, any combination of single-stranded RNA or DNA molecules can form duplex molecules (DNA:DNA, DNA:RNA, RNA:DNA, or RNA:RNA). Similarly, synthetic analogs can form duplex molecules with each other or with RNA and DNA under appropriate conditions.

[0078] The phrase "selective (or specific) hybridization" refers to the binding, duplexing or hybridization of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when the sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA). One of ordinary skill in the art will readily recognize that alternative hybridization and washing conditions can be utilized to provide conditions of similar stringency, and will recognize that the combination of parameters is much more important than the measurement of any single parameter.

[0079] "Binding" refers to sequence-specific non-covalent interactions between macromolecules (e.g., between proteins and nucleic acids). Not all components of a binding interaction need to be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are typically characterized by a dissociation constant (K d ) is 10 -6 M -1 or lower. “Affinity” refers to the strength of binding: increased binding affinity is associated with a lower K d Related.

[0080] The term "substantially similar" as used in the context of nucleic acid or amino acid sequence identity refers to sequences having at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about , at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0081] As used herein, "% sequence identity" is determined using the EMBOSS pairwise alignment algorithm tool available from the European Bioinformatics Institute (EMBL-EBI), part of the European Molecular Biology Laboratory (EMBL). This tool can be accessed by placing the "www" address in front of "ebi.ac.uk / Tools / emboss / align / ". This tool utilizes the Needleman-Wunsch global alignment algorithm (Needleman, SB and Wunsch, CD (1970) J. Mol. Biol. 48, 443-453; Kruskal, JB (1983) An overview of sequence comparison In D. Sankoff and B. Kruskal, (eds.), Time warps, string edits and macromolecules: the theory and practice of sequence comparison, pp. 1-44 Addison Wesley. Default settings are used, which include Gap Open: 10.0 and Gap Extend 0.5. The default matrix "Blosum62" is used for amino acid sequences, and the default matrix "DNAfull" is used for nucleic acid sequences.

[0082] The term "operably linked" refers to the juxtaposition of two or more components (such as sequence elements) wherein the arrangement of the components allows both components to function normally and allows the possibility that at least one of the components can mediate the function exerted on at least one of the other components.

[0083] As used herein, "barcode" refers to a sequence, a label or a combination of labels associated with a polynucleotide, and its characteristics (e.g., a label DNA sequence) can be used to distinguish polynucleotides in a sample. In certain embodiments, the barcode on the polynucleotide is used to confirm the source of the polynucleotide. For example, a nucleic acid sample can be a polynucleotide pool derived from different sources (e.g., polynucleotides derived from different individuals, different tissues or cells, or polynucleotides separated at different time points), wherein the polynucleotides from each different source are marked with a unique barcode. Therefore, the barcode provides the correlation between the polynucleotide and its source. In certain embodiments, a barcode is used to uniquely mark each individual polynucleotide in a sample. The confirmation of the number of unique barcodes in the sample can provide a reading of how many individual polynucleotides there are in the sample (or how many original polynucleotides are used to obtain a manipulated polynucleotide sample; see, for example, U.S. Patent No. 7,537,897, which is incorporated herein by reference in its entirety). The length of the barcode can range from about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or about 100 nucleotide bases or longer, and can include multiple subunits, wherein each different barcode has a different identity and / or subunit order. Exemplary nucleic acid tags that can be used as barcodes are described in U.S. Pat. No. 7,544,473 and U.S. Pat. No. 7,393,665, both of which are incorporated herein by reference in their entirety for describing nucleic acid tags and their use in confirmatory oligonucleotides. In certain embodiments, a set of barcodes used to label multiple samples need not have any particular common characteristics (e.g., T m, length, base composition, etc.), because the methods described herein can accommodate a wide variety of unique barcode groups. It is emphasized here that the barcode only needs to be unique within a given experiment. Therefore, the same barcode can be used to label different samples processed in different experiments. In addition, in some experiments, the user can use the same barcode to label a subset of different samples within the same experiment. For example, all samples derived from individuals with a specific phenotype can be labeled with the same barcode, for example, all samples derived from control (or wild-type) subjects can be labeled with a first barcode, while subjects with a disease condition can be labeled with a second barcode (different from the first barcode). As another example, it may be desirable to label different samples derived from the same source (e.g., samples obtained over time or derived from different parts of an organization) with different barcodes. Further, barcodes can be generated in a variety of different ways, such as by a combinatorial labeling method, in which one barcode is attached by ligation and the second barcode is attached by primer extension. In some embodiments, multiple unique barcodes can be attached to the same sample to increase its uniqueness relative to other samples. Alternatively, one barcode may represent a class of samples (e.g., a well plate), and a second or third barcode may represent a specific well within the plate. In some embodiments, samples may be labeled with multiple barcodes by hybridizing more than one barcode oligonucleotide with a lipid-modified or hydrophobic anchored oligonucleotide, or samples may be labeled with a plurality of barcoded lipid-modified or hydrophobic anchored oligonucleotides. In some embodiments, individual cells may be barcoded via split pool tags to generate a unique barcode spectrum different from each other cell in the pool. Therefore, barcodes may be designed and implemented in a variety of different ways to track polynucleotide fragments during processing and analysis, and are therefore not intended to be limited in this regard.

[0084] "Polymerase chain reaction" or "PCR" means the reaction of amplifying a specific DNA sequence in vitro by simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for producing multiple copies or replicas of a target nucleic acid flanking primer sites, and the reaction comprises one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing the primer to the primer site, and (iii) extending the primer by a nucleic acid polymerase in the presence of nucleoside triphosphates. Typically, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. The specific temperature of each step, the duration, and the rate of change between the steps depend on many factors well known to those of ordinary skill in the art, as exemplified by the following references: McPherson et al., eds., PCR: A Practical Approach and PCR2: A Practical Approach (IRLPress, Oxford, 1991 and 1995, respectively). For example, in conventional PCR using Taq DNA polymerase, the double-stranded target nucleic acid can be denatured at a temperature of >90°C, the primers annealed at a temperature in the range of 50-75°C, and the primers extended at a temperature in the range of 72-78°C. The term "PCR" encompasses derivative forms of the reaction, including but not limited to RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplex PCR, etc. The reaction volume ranges from hundreds of nanoliters (e.g., 200 nL) to hundreds of μL (e.g., 200 μL). "Reverse transcription PCR" or "RT-PCR" means a PCR that is preceded by a reverse transcription reaction to convert the target RNA into complementary single-stranded DNA, which is then amplified, such as U.S. Pat. No. 5,168,038 to Tecott et al., which is incorporated herein by reference. "Real-time PCR" means a PCR that monitors the amount of the reaction product, i.e., the amplicon, as the reaction proceeds. There are many forms of real-time PCR, the main difference being the detection chemistry used to monitor the reaction products, such as Gelfand et al., U.S. Pat. No. 5,210,015 Wittwer et al., U.S. Pat. Nos. 6,174,670 and 6,569,627 (intercalating dyes); Tyagi et al., U.S. Pat. No. 5,925,517 (molecular beacons); these patents are incorporated herein by reference. Detection chemistry for real-time PCR is reviewed in Mackay et al., Nucleic Acids Research, 30:1292-1305 (2002), which is also incorporated herein by reference. "Nested PCR" means a two-stage PCR in which the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an internal position of the first amplicon. As used herein, "primary primers" with respect to a nested amplification reaction means the primers used to produce the first amplicon, and "secondary primers" means one or more primers used to produce the second or nested amplicon. "Multiplex PCR" means PCR in which multiple target sequences (or a single target sequence and one or more reference sequences) are performed simultaneously in the same reaction mixture, e.g., Bernard et al., Anal. Biochem. 273: 221-28 (1999) (two-color real-time PCR). Typically, a different primer set is used for each amplified sequence.

[0085] The term "hyperproliferative cell" means a cell that is cancerous, precancerous, hyperplastic, or senescent and cannot normally undergo mitosis. In some embodiments, the hyperproliferative cell is a tumor cell. In some embodiments, the hyperproliferative cell comprises a dysfunctional cell cycle that causes it to lack apoptosis or metabolic instability that causes the cell to proliferate faster than a cell of the same type that is metabolically stable.

[0086] As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcripts) and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products." If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

[0087] The term "functional fragment" means any portion of a polypeptide or nucleic acid sequence that is related to the corresponding full-length polypeptide or nucleic acid, which is long enough and has sufficient structure to confer a biological effect that is at least similar or substantially similar to the full-length polypeptide or nucleic acid on which the fragment is based. In some embodiments, a functional fragment is a portion of a full-length or wild-type nucleic acid sequence that encodes any of the nucleic acid sequences disclosed herein, and the portion encodes a polypeptide of a certain length and / or structure that is less than the full length, but encodes a domain that still has a biological function compared to the full-length or wild-type protein. In some embodiments, a functional fragment may have reduced biological activity,

[0088] In some embodiments, the functional fragments are derived from organisms such as human sequences. In such embodiments, the functional fragments can retain 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% sequence identity with the wild-type human sequence derived from the sequence. In some embodiments, the functional fragments can retain 85%, 80%, 75%, 70%, 65% or 60% sequence homology with the wild-type sequence or oligonucleotide portion of the nucleotide derived from the sequence.

[0089] Lipid-modified oligonucleotides

[0090] The present disclosure relates to compositions and methods of using the compositions for cell barcoding methods that use recently developed specific sets of lipid-conjugated or hydrophobic-anchored oligonucleotides to efficiently label single cells derived from different patients or test conditions. Oligonucleotide barcodes (engineered with PCR handles, unique identifiers, and capture sequences) can then be introduced into cells and cell subpopulations that are processed for droplet microfluidics-based RNA sequencing library preparation.

[0091] Selden et al., J. Am. Chem. Soc. 134: 765-68 (2012); Weber et al., BioMacromolecules 15: 4621-26 (2014); and published U.S. Patent Application No. 2017 / 0305955 disclose the stable embedding of lipid-modified oligonucleotides within the plasma membrane via a two-component system, each of which is incorporated herein by reference in its entirety.

[0092] A general and non-limiting example of a lipid-modified oligonucleotide as disclosed herein is given in the claims. This lipid-modified oligonucleotide includes three oligonucleotides: a first oligonucleotide, which comprises a first lipid portion, a first hybridization region and a first primer region from 5' to 3' orientation; a second oligonucleotide, which comprises a second hybridization region and a second lipid portion from 5' to 3' orientation, wherein the second hybridization region is the reverse complement of the first hybridization region; and a third oligonucleotide, which comprises a second primer region, a barcode region and a capture sequence from 5' to 3' orientation, wherein the second primer region is the reverse complement of the first primer region.

[0093] The present disclosure also relates to microfluidics and labeled nucleic acids. For example, some aspects generally relate to systems and methods for labeling nucleic acids in microfluidic droplets or other compartments (e.g., from cells). In one group of embodiments, particles containing oligonucleotides that can be used to measure target nucleic acids can be prepared, such as attached to the surface of particles. Oligonucleotides can include a "barcode" or unique sequence that can be used to distinguish nucleic acids in a droplet from nucleic acids in another droplet, such as even after nucleic acids are brought together or removed from the droplet. Certain embodiments of the present invention generally relate to systems and methods for attaching additional or any sequence to nucleic acids in microfluidic droplets or other compartments, such as can be used to selectively determine or amplify identification sequences suspected of being present in a desired sequence in a droplet. Such systems can, for example, be used for selective amplification in various applications, such as high-throughput sequencing applications.

[0094] Some aspects of the present disclosure generally relate to systems and methods for containing or encapsulating nucleic acids with lipid-modified or hydrophobically anchored oligonucleotides in microfluidic droplets or other suitable compartments (e.g., microwells of microplates, single spots on slides or other surfaces, etc.). In some cases, nucleic acids and oligonucleotides may be connected or attached together. Nucleic acids may come from dissolved cells, organelles, or other substances in droplets. Oligonucleotides in droplets can be distinguished from oligonucleotides in other droplets (e.g., in multiple droplets or droplet groups). For example, oligonucleotides may contain one or more unique sequences or "barcodes" that are different between droplets. Therefore, nucleic acids in each droplet can be uniquely identified by determining a barcode associated with the nucleic acid. This may be important, for example, if the droplets are "broken" or ruptured, and nucleic acids from different droplets are subsequently merged or pooled together, for example, for sequencing or other analysis.

[0095] The present disclosure relates to cells comprising one or more lipid-modified oligonucleotides, wherein the lipid-modified oligonucleotide comprises a lipid moiety region and optionally a capture region. In some embodiments, the cell is a hyperproliferative cell, a transformed cell from a cell line, or a primary cell isolated from a subject or patient.

[0096] The present disclosure also relates to systems comprising a plate, dish or other solid support comprising one or more containers into which a sample, biopsy, cell or tissue is fixed or absorbed to a surface of the container and exposing one or more barcodes, each container comprising a unique barcode or multiple barcodes corresponding to a cell and / or nucleic acid expression location in the sample, biopsy, cell or tissue.

[0097] Lipid region

[0098] In some embodiments, the lipid moiety comprises an alkyl chain and an alkenyl, alkyl, aryl, or aralkyl chain. The alkenyl, alkyl, aryl, or aralkyl chain may comprise about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 200, 201, 202, 203, 204, 205 In some embodiments, the alkyl chain comprises about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 5, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 carbon atoms or more, and 44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108 98, 99, or 100 carbon atoms or more. In some embodiments, the chains share the same number of carbon atoms. In other embodiments, one chain has about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms less than the other chain.The lipid portion region may comprise more than one alkenyl, aryl or aralkyl chain, each chain comprising 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135

[0099] In some embodiments, the lipid portion region may include one or more unsaturated carbon bonds. In some embodiments, the unsaturated bonds are all contained within the same chain. In other embodiments, the unsaturated bonds may be contained in more than one chain.

[0100] In certain embodiments, the lipid portion comprises a dialkylphosphoglyceride and the polynucleotide is conjugated to the dialkylphosphoglyceride. In some embodiments, each chain of the dialkylphosphoglyceride has the same number of carbon atoms as the other chain. In other embodiments, the number of carbon atoms between the two alkyl chains of the dialkylphosphoglyceride is different. In some embodiments, each chain has 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 5, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 carbon atoms or more. In some embodiments, each chain has about 12 carbon atoms or about 14 carbon atoms, about 16 carbon atoms, about 18 carbon atoms, about 20 carbon atoms, or about 22 carbon atoms. In some embodiments, at least one chain has about 12 carbon atoms, about 14 carbon atoms, about 16 carbon atoms, about 18 carbon atoms, about 20 carbon atoms, or about 22 carbon atoms.

[0101] The lipid portion region may comprise a monoalkylamide and the polynucleotide may be conjugated to the monoalkylamide. In some embodiments, the monoalkylamide chain has about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or about 100 carbon atoms or more. In some embodiments, the monoalkylamide chain has about 12 carbon atoms or about 14 carbon atoms, about 16 carbon atoms, about 18 carbon atoms, about 20 carbon atoms or about 22 carbon atoms. In certain embodiments, the monoalkylamide contains about 16 or 18 carbon atoms.

[0102] In other embodiments, the lipid portion region and the polynucleotide are connected by a compound comprising a phosphate group. In other embodiments, the lipid portion region and the polynucleotide are connected by a compound comprising a urea group. Still in other embodiments, the lipid portion region and the polynucleotide are connected by a compound comprising a sulfonyl group. In another embodiment, the lipid portion region and the polynucleotide are connected by a compound comprising a sulfonamide, ether, thioether, carbamate or carbonate group.

[0103] In other embodiments, the lipid moiety may include a sterol group. In some embodiments, the sterol group may be natural or synthetic or derived from a sterol compound with (or modified to have) a functional group for attachment to a polynucleotide. For example, sterols from biological sources are usually present in the form of free sterols, acylated (sterol esters), alkylated (steryl alkyl ethers), sulfated (cholesterol sulfate) or connected to a glycoside moiety (steryl glycoside) that can itself be acylated (acylated sterol glycosides) (see, for example, Fahy et al., J. Lipid Res. 46: 839-61 (2005), which is incorporated in its entirety). Examples include (1) sterols available from animal sources, referred to herein as "animal sterols", such as animal sterol cholesterol and certain steroid hormones; and (2) sterols available from plants, fungi and marine sources, referred to herein as "plant sterols", such as plant sterols campesterol, sitosterol, stigmasterol and ergosterol. These sterols typically carry at least one free hydroxyl group, usually at the 3-position of ring A, at another position, or a combination thereof, or may be modified to add suitable hydroxyl or other functional groups as desired.

[0104] Of particular interest are simple sterols with a unique functional group for attachment to a polynucleotide. Of particular interest are simple sterols in which the unique functional group is a hydroxyl group, and in particular simple sterols with a hydroxyl group located at position 3 of ring A (e.g., cholesterol, β-sitosterol, stigmasterol, campesterol and brassicasterol, ergosterol, and the like and derivatives thereof).

[0105] Cholesterol is of particular interest for inclusion in the lipid portion in certain embodiments. Representative sterols of the cholesterol classes of interest (including substituted cholesterols) include, for example, the following: (1) natural and synthetic sterols, such as cholesterol (sheep wool), cholesterol (plant-derived), streptosterols, stigmasterols, β-sitosterols, thiocholesterols, 3-cholesterol acrylate; (2) A-ring substituted oxysterols, such as cholestanol and cholestenone; (3) B-ring substituted oxysterols, such as 7-ketocholesterol, 5α,6α-epoxycholestanol, 5β,6β-epoxycholestanol, and 7-dehydrocholesterol; (4) D-ring substituted oxysterols, such as 25-ketocholesterol and 15 -ketocholestane; (5) side chain substituted oxysterols, such as 25-hydroxycholesterol, 27-hydroxycholesterol, 24 (R / S) -hydroxycholesterol, 24 (R / S), 25-epoxycholesterol and 24 (S), 25-epoxycholesterol; (6) lanosterols, such as 24-dihydrolanosterol and lanosterol; (7) fluorinated sterols, such as F7-cholesterol, F7-5α, 6α-epoxycholestane, F7-5β, 6β-epoxycholestane and F7-7-ketocholesterol; (8) fluorescent cholesterols, such as 25-NBD cholesterol, dehydroergosterol and cholesterol triene. These compounds may also include deuterated and non-deuterated forms and are commercially available, such as from AvantiPolar Lipids, Inc.

[0106] In certain embodiments, the lipid moiety may comprise a saturated or unsaturated, straight or branched, substituted or unsubstituted aliphatic chain. Of particular interest are saturated or unsaturated, straight or branched, substituted or unsubstituted hydrocarbon chains having 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 carbons.

[0107] Further embodiments may comprise elements based on or derivable from various lipids, such as aliphatic acids, glycerolipids, glycerophospholipids, sphingolipids, prenol lipids, polyprenol lipids, and glycolipids, such as those described in Fahy et al., J. Lipid Res. 46:839-61 (2005).

[0108] The "anchor" lipid-modified or hydrophobic anchored oligonucleotide (e.g., a lipid-modified oligonucleotide comprising a first lipid moiety, a first hybridization region, and a first primer region from a 5' to 3' direction or from a 3' to 5' direction) and the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide (e.g., a lipid-modified oligonucleotide comprising a second hybridization region and a second lipid moiety from a 5' to 3' direction or from a 3' to 5' orientation, wherein the second hybridization region is the reverse complement of the first hybridization region) can comprise the same lipid moiety or different lipid moieties (e.g., different carbon chain lengths, different compositions, or different modifications). In some embodiments, the "anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid moiety that contains the same number of carbons as the lipid moiety of the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide. In some embodiments, the "anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid portion containing about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more carbons compared to the lipid portion of the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide. In some embodiments, the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid portion containing about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more carbons compared to the lipid portion of the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide. In some embodiments, the "anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid portion containing about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more carbons compared to the lipid portion of the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide. In some embodiments, only an anchor lipid-modified or hydrophobic-anchored oligonucleotide is used without a corresponding co-anchor lipid-modified or hydrophobic-anchored oligonucleotide.

[0109] In some embodiments, the lipid moiety (i.e., the lipid moiety in embodiments having only an anchor lipid-modified or hydrophobically anchored oligonucleotide, or the first or second lipid moiety in embodiments having both an anchor lipid-modified or hydrophobically anchored oligonucleotide and a co-anchor lipid-modified or hydrophobically anchored oligonucleotide) comprises a compound of Formula I:

[0110]

[0111] or a physiologically acceptable salt thereof,

[0112] Where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from NH, CH 2 , O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl.

[0113] In some embodiments, the lipid moiety (i.e., the lipid moiety in embodiments having only an anchor lipid-modified or hydrophobically anchored oligonucleotide, or the first or second lipid moiety in embodiments having both an anchor lipid-modified or hydrophobically anchored oligonucleotide and a co-anchor lipid-modified or hydrophobically anchored oligonucleotide) comprises a compound of Formula II:

[0114]

[0115] or a physiologically acceptable salt thereof,

[0116] where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from NH, CH 2 , O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl. In some embodiments, the lipid portion, the first lipid portion, the second lipid portion or both lipid portions comprise a compound of formula III:

[0117]

[0118] In some embodiments, the "anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a sterol moiety and the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid moiety. In some embodiments, the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a sterol moiety and the "anchor" lipid-modified or hydrophobic anchored oligonucleotide comprises a lipid moiety. In some embodiments, both the "anchor" lipid-modified or hydrophobic anchored oligonucleotide and the "co-anchor" lipid-modified or hydrophobic anchored oligonucleotide comprise a sterol moiety.

[0119] Hybrid Zone

[0120] The anchor lipid modified or hydrophobic anchored oligonucleotide and the co-anchor lipid modified or hydrophobic anchored oligonucleotide comprise hybridization regions that are complementary to each other. The anchor lipid modified or hydrophobic anchored oligonucleotide comprises a lipid portion operably linked (e.g., covalently linked) to a first hybridization region, wherein the first hybridization region comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 98, 99, or 100 or more nucleotide bases.

[0121] The co-anchor lipid-modified or hydrophobically anchored oligonucleotide comprises a lipid portion operably linked (e.g., covalently linked) to a second hybridization region comprising 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 98, 99, or 100 or more nucleotide bases. In some embodiments, the second hybridization zone is the same type of nucleic acid as the first hybridization zone (e.g., if the first hybridization zone is DNA, the second hybridization zone is DNA), or the second hybridization zone can be a different type of nucleic acid than the first hybridization zone (e.g., if the first hybridization zone is DNA, the second hybridization zone can be RNA or a modified or synthetic DNA or RNA).

[0122] The second hybridization region is the reverse complement of the first hybridization region. In some embodiments, the complementarity can be complete complementarity (i.e., the second hybridization region is the same length as the first hybridization region, and each base of the second hybridization region is completely complementary to its base pair on the first hybridization region). In some embodiments, the first hybridization region contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 74, 75, 76, 77, 78, 79, or 80 or more additional bases. In some embodiments, the second hybridization zone contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 74, 75, 76, 77, 78, 79, or 80 or more additional bases. In some embodiments, the first hybridization zone has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about %, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115%, at least about 116%, at least about 117%, at least about 118%, at least about 119%, at least about 120%, at least about 121%, at least about 122%, at least about 123%, at least about 124%, at least about 125%, at least about 126%, at least about 127%, at least about 128%, at least about 129%,

[0123] In some embodiments, the first hybridization region has a homology to SEQ ID NO:4 (GTAACGATCCAGCTGTCACT) of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115%, , at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0124] In some embodiments, the second hybridization region has a homology to SEQ ID NO:2 (AGTGACAGCTGGATCGTTAC) of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115 , at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0125] Primer region

[0126] The anchor lipid modified or hydrophobically anchored oligonucleotide and the barcode oligonucleotide comprise primer regions that are complementary to each other. The anchor lipid modified or hydrophobically anchored oligonucleotide comprises a lipid portion that is operably connected (e.g., covalently linked) to a first hybridization region that is operably connected (e.g., covalently linked) to a first primer region of an oligonucleotide comprising 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more nucleotide bases. The oligonucleotide can be a DNA, RNA, or a modified or synthetic DNA or RNA.

[0127] The barcode oligonucleotide comprises a second primer region operably linked (e.g., covalently linked) to a barcode region (described below), which in turn is operably linked (e.g., covalently linked) to a capture sequence (described below), the second primer region comprising an oligonucleotide of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more nucleotide bases. The oligonucleotide can be DNA, RNA, or a modified or synthetic DNA or RNA. In some embodiments, the second primer region is a nucleic acid of the same type as the first primer region (e.g., if the first primer region is DNA, the second primer region is DNA), or the second primer region can be a different type of nucleic acid compared to the first primer region (e.g., if the first primer region is DNA, the second primer region can be RNA or a modified or synthetic DNA or RNA).

[0128] The second primer district is the reverse complement of the first primer district. In some embodiments, complementarity can be complete complementarity (that is, the second primer district is the same length as the first primer district, and each base in the second primer district is completely complementary to its base pair on the first primer district). In some embodiments, the first primer district contains 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 or more additional bases compared to the second primer district. In some embodiments, the second primer district contains 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 or more additional bases compared to the first primer district. In some embodiments, the first primer region has a difference of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about %, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115%, at least about 116%, at least about 117%, at least about 118%, at least about 119%, at least about 120%, at least about 121%, at least about 122%, at least about 123%, at least about 124%, at least about 125%, at least about 126%, at least about 127%, at least about 128%, at least about 129%,

[0129] In some embodiments, the first primer region has a sequence that is at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, , at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0130] In some embodiments, the second primer region has a sequence that is at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, , at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0131] Barcode area

[0132] The barcode oligonucleotide comprises a second primer region operably linked (e.g., covalently linked) to a barcode region, which in turn is operably linked (e.g., covalently linked) to a capture sequence (described below), the barcode region comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 or more nucleotide bases. The oligonucleotide can be DNA, RNA, or a modified or synthetic DNA or RNA. Methods for designing barcode sequence sets are described, for example, in U.S. Pat. No. 6,235,475, the contents of which are incorporated herein by reference in their entirety. Attaching barcode sequences to nucleic acid templates is shown in U.S. Publication Nos. 2008 / 0081330 and 2011 / 0301042, the contents of each of which are incorporated herein by reference in their entirety. Methods for designing sets of barcode sequences and other methods for attaching barcode sequences are shown in U.S. Pat. Nos. 6,138,077; 6,352,828; 5,636,400; 6,172,214; 6,235,475; 7,393,665; 7,544,473; 5,846,719; 5,695,934; 5,604,097; 6,150,516; RE39,793; 7,537,897; 6,172,218; and 5,863,722, the contents of each of which are incorporated herein by reference in their entirety. Barcodes for sequencing and copy number estimation are described in U.S. Publication No. 2016 / 0046986, which is incorporated herein by reference in its entirety.

[0133] Barcodes can be completely random, or they can be engineered with certain predetermined sequences. They can have random or semi-random regions and other fixed regions. Barcodes can include other regions, such as priming sites, adapters, or other complementary regions that will facilitate further processing and analysis. The specific barcode itself can be generated relative to the idiosyncrasies of its second primer region before hybridization binding or capture of an anchor lipid-modified or hydrophobic anchored oligonucleotide by the first and second primer regions. Therefore, in some embodiments, a database of all barcodes is generated and stored on a computer storage medium in some embodiments.

[0134] In some embodiments, the last nucleotide of the barcode region will not be the same as the first nucleotide of the capture sequence. For example, if the capture sequence is a polyadenylation tail, in some embodiments, the last nucleotide of the barcode region will not be adenine.

[0135] Barcodes enable labeling or tracking of cells or membranes containing lipid-modified or hydrophobically anchored oligonucleotides to allow subsequent identification and origin of specific cells or membranes. Assigning barcodes to individual oligonucleotides or oligonucleotide subsets can allow unique traits to be assigned to individual sequences, fragments of sequences, or cells. This can allow data to be acquired from individual samples and is not limited to the average of the samples.

[0136] In some embodiments, oligonucleotides may share a common barcode and thus may subsequently be identified as originating from the same target cell. Multiple cells (of the same or different types) may be identified by using multiple barcodes, each barcode identifying a specific cell type or multiple cells within a specific cell type.

[0137] A single cell or membrane may contain more than one lipid-modified or hydrophobic-anchored oligonucleotide, each having a different first primer region. Such cells or membranes may thus be isolated and / or identified by different barcode oligonucleotides, each barcode oligonucleotide comprising a second primer region complementary to a different first primer region, and a single barcode is used for each barcode oligonucleotide, or different barcodes are used for some or all of the barcode oligonucleotides.

[0138] Capture sequence

[0139] In some embodiments, the barcode oligonucleotide comprises a second primer region operably linked (e.g., covalently linked) to a barcode region, which in turn is operably linked (e.g., covalently linked) to a capture sequence (described below), the capture sequence comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 98, 99, or 100 or more nucleotide bases.

[0140] In some embodiments, the capture sequence is a polyadenylated tail ("poly (A) tail"), i.e., the entire capture sequence consists of adenine bases. In some embodiments, the capture sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about In some embodiments, the capture sequence has a sequence of SEQ ID NO: 7 (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA).

[0141] In some embodiments, the capture sequence is a poly-thymine tail ("poly (T) tail"), i.e., the entire capture sequence consists of thymine bases. In some embodiments, the capture sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about At least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0142] In some embodiments, the capture sequence is a polyuracil tail ("poly (U) tail"), i.e., the entire capture sequence consists of uracil bases. In some embodiments, the capture sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about At least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity.

[0143] In some embodiments, the capture sequence is a variant of a poly(A), poly(T) or poly(U) tail. Such variants include bases other than pure poly(A), poly(T) or poly(U) tails. For example, a variant may include a capture sequence such as a poly(A) variant such as AAUAAA, AUUAAA AACAAG, AACAAA, AAUAAU, AAUAAG, UAUAAA, AGUAAA, AAUACA, CAUAAA, AAUAUA, GAUAAA, AAUGAA, AAGAAA, ACUAAA, AAUAGA, AAUAAU, AACAAA, AUUACA, AUUAUA, AACAAG or AAUAAG, each containing additional nucleotide bases, such as 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215

[0144] In some embodiments, instead of a capture sequence, a member of a coupled pair (e.g., an antibody / antigen, receptor / ligand, or avidin-biotin pair, as described in U.S. Patent Application No. 2006 / 0252077, incorporated herein by reference) can be attached to each fragment to be captured on a surface coated with the corresponding second member of the coupled pair. Following capture, the sequence can be analyzed, for example, by single molecule detection / sequencing, as described, for example, in U.S. Patent No. 7,283,337, incorporated herein by reference.

[0145] Methods for synthesizing lipid-modified or hydrophobic-anchored oligonucleotides

[0146] Oligonucleotides can be synthesized using protocols known in the art, such as those described in Caruthers et al., Meth. Enzymol. 211:3 (1992); WO 99 / 54459; Wincott et al., Nucleic Acids Res. 23:2677 (1995); Wincott et al., Meth. Mol. Bio. 74:59 (1997); Brennan et al., Biotechnol. Bioeng. 61:33 (1998); and U.S. Pat. No. 6,001,311. All of these references are incorporated herein by reference. The synthesis of oligonucleotides utilizes common nucleic acid protection and coupling groups, such as dimethoxytrityl at the 5'-end and phosphoramidite at the 3'-end.

[0147] Oligonucleotide disclosed herein encompasses natural and synthetic or modified oligonucleotides. Modified nucleic acids have one or more modifications, such as base modifications, backbone modifications, etc., to provide nucleic acids with new or enhanced features (e.g., improved stability). Nucleoside can be a base-sugar combination, and its base moiety is a heterocyclic base. Heterocyclic bases include purines and pyrimidines. Nucleotide is a nucleoside that also includes a phosphate group covalently linked to the sugar moiety of a nucleoside. For those nucleosides including pentofuranosyl sugars, the phosphate group can be connected to the 2', 3' or 5' hydroxyl moiety of the sugar. When forming an oligonucleotide, the phosphate group covalently links adjacent nucleosides to each other to form a linear polymer compound. In some cases, each end of this linear polymer compound can be further connected to form a cyclic compound. In addition, the linear compound can have internal nucleotide base complementarity, and therefore can be folded in a manner that produces a completely or partially double-stranded compound. In an oligonucleotide, a phosphate group can be referred to as forming the internucleoside backbone of an oligonucleotide. The linkage or backbone of the RNA and DNA may be a 3' to 5' phosphodiester linkage.

[0148] Examples of suitable nucleic acids containing modifications include nucleic acids having modified backbones or unnatural internucleoside linkages. Nucleic acids having modified backbones include nucleic acids that retain a phosphorus atom in the backbone and nucleic acids that do not have a phosphorus atom in the backbone. Suitable modified oligonucleotide backbones containing a phosphorus atom include, for example, phosphorothioates, chiral phosphorothioates, dithiophosphates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates (including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates), phosphinates, amino phosphates (including 3'-aminoamino phosphates and aminoalkylamino phosphates), diamino phosphates, thiocarbonylamino phosphates, thiocarbonylalkyl phosphonates, thiocarbonylalkyl phosphotriesters, selenophosphates and boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs thereof and those with inverted polarity, where one or more internucleotide linkages are 3' to 3', 5' to 5' or 2' to 2' linkages. Suitable oligonucleotides with inverted polarity include a single 3' to 3' linkage at the most 3'-internucleotide linkage, i.e., a single inverted nucleoside residue (nucleobase absent or replaced with a hydroxyl group) that can be basic. Also included are various salts (e.g., potassium or sodium), mixed salts and free acid forms.

[0149] In some embodiments, the subject nucleic acids have one or more phosphorothioates and / or heteroatom internucleoside linkages, particularly --CH 2 --NH--O--CH 2 --, --CH 2 --N(CH 3 )--O--CH 2 -(referred to as methylene(methylimino) or MMI backbone), --CH 2 --O--N(CH 3 )--CH 2 --, --CH 2 --N(CH 3 )--N(CH 3 )--CH 2 -- and --O--N(CH 3 )--CH 2 --CH 2 --(wherein the natural phosphodiester internucleotide linkage is represented as --O--P(=O)(OH)--O--CH 2 --). The MMI type internucleoside linkage is disclosed in U.S. Patent No. 5,489,677 cited above. Suitable amide internucleoside linkages are disclosed in U.S. Patent No. 5,602,240.

[0150] Nucleic acids with morpholino backbone structures are also suitable, such as described in U.S. Patent No. 5,034,506. For example, in some embodiments, the subject nucleic acid includes a 6-membered morpholino ring replacing a ribose ring. In some of these embodiments, phosphorodiamidate or other non-phosphodiester internucleoside linkages replace phosphodiester linkages.

[0151] Suitable modified polynucleotide backbones that do not include phosphorus atoms have backbones formed by short-chain alkyl or cycloalkyl nucleoside linkages, mixed heteroatom and alkyl or cycloalkyl nucleoside linkages, or one or more short-chain heteroatom or heterocyclic nucleoside linkages. These include backbones with morpholino linkages (formed in part by the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formyl acetyl and thioformyl acetyl backbones; methylene formyl acetyl and thioformyl acetyl backbones; ribose acetyl backbones; olefin-containing backbones; sulfamic acid ester backbones; methylene imino and methylene hydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S and CH 2 Those that are components.

[0152] Also include nucleic acid mimics.Term " mimics " covers polynucleotides in which only furanose ring or furanose ring and internucleotide bonding are replaced by non-furanose groups when being applied to polynucleotide, and only replaces furanose ring and is also referred to as sugar substitute.The heterocyclic base part of keeping heterocyclic base part or modification is used for hybridization with suitable target nucleic acid.A kind of such nucleic acid (polynucleotide mimics having shown excellent hybridization characteristics) is referred to as peptide nucleic acid (PNA).In PNA, the sugar backbone of polynucleotide is replaced by the main chain particularly aminoethylglycine main chain containing amides.Nucleotide is retained, and is directly or indirectly combined with the aza nitrogen atom of the amide part of the main chain.

[0153] One polynucleotide mimetic with excellent hybridization properties is peptide nucleic acid (PNA). The backbone in a PNA compound is two or more linked aminoethylglycine units, which give the PNA an amide-containing backbone. The heterocyclic base moiety is directly or indirectly bound to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents describing the preparation of PNA compounds include, but are not limited to: U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.

[0154] Another class of suitable polynucleotide mimics is based on the morpholino unit (morpholino nucleic acid) connected, which has a heterocyclic base attached to the morpholino ring. Many linking groups have been reported, and they can connect the morpholino monomer units in morpholino nucleic acids. A class of linking groups has been selected to obtain non-ionic oligomeric compounds. Oligomeric compounds based on non-ionic morpholinos are unlikely to interact undesirably with cell proteins. Morpholino-based polynucleotides are non-ionic mimics of oligonucleotides, which are unlikely to form undesirable interactions with cell proteins (Braasch et al., Biochemistry, 41 (14): 4503-10 (2002)). Morpholino-based polynucleotides are disclosed in U.S. Patent No. 5,034,506. A variety of compounds in morpholino-based polynucleotides have been prepared, which have a variety of different linking groups connecting monomer subunits.

[0155] Another suitable class of polynucleotide mimics is referred to as cyclohexenyl nucleic acid (CeNA). The furanose ring usually present in DNA / RNA molecules is replaced by a cyclohexenyl ring. CeNADMT protected phosphoramidite monomers have been prepared according to classical phosphoramidite chemistry and used for oligomeric compound synthesis. Fully modified CeNA oligomeric compounds and oligonucleotides modified with CeNA at specific positions have been prepared and studied (see Wang et al., J.Am.Chem.Soc., 122:8595-8602 (2000)). The incorporation of CeNA monomers into DNA chains increases the stability of DNA / RNA hybrids. CeNA oligoadenylates form complexes with RNA and DNA complements, and their stability is similar to that of natural complexes. NMR and circular dichroism show that CeNA structures are incorporated into natural nucleic acid structures for conformational adaptation.

[0156] Locked nucleic acids (LNA) and / or LNA analogs are also suitable as modified nucleic acids. In LNA, the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring, thereby forming a 2'-C, 4'-C-oxymethylene linkage and thereby forming a bicyclic sugar moiety. The linkage can be a methylene (--CH 2 --), a group bridging the 2' oxygen atom and the 4' carbon atom, wherein n is 1 or 2 (Singh et al., Chem. Commun., 4:455-456 (1998)). LNA and LNA analogs show very high duplex thermal stability with complementary DNA and RNA (Tm = +3 to +10°C), stability to 3'-exonucleolytic degradation and good solubility properties. Effective and non-toxic oligonucleotides containing LNA have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 97:5633-38 (2000)).

[0157] The synthesis and preparation of LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil as well as their oligomerization and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 54:3607-30 (1998)). LNA and its preparation are also described in WO98 / 39352 and WO99 / 14226, which are hereby incorporated by reference in their entirety. Exemplary LNA analogs are described in U.S. Pat. Nos. 7,399,845 and 7,569,686, which are hereby incorporated by reference in their entirety.

[0158] The nucleic acid may also include one or more substituted sugar moieties. Suitable polynucleotides include sugar substituents selected from the group consisting of OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Also suitable is O((CH 2 ) n O) m CH 3 、O(CH 2 ) n OCH 3 、O(CH 2 ) n NH 2 、O(CH 2 ) n CH 3 ,O(CH 2 ) n ONH 2 and O(CH 2 ) n ON((CH 2 ) n CH 3 ) 2 , wherein n and m are 1 to about 10. Other suitable polynucleotides include sugar substituents selected from the group consisting of C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 、OCN、Cl、Br、CN、CF 3 、OCF 3 、SOCH 3 、SO 2 CH 3 、ONO 2 、NO 2 、N 3 NH 2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator and other substituents with similar properties. Suitable modifications may include 2'-methoxyethoxy (2'-O--CH 2 C H2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 78:486-504 (1995)), i.e., alkoxyalkoxy. Suitable modifications may include 2'-dimethylaminooxyethoxy, i.e., O(CH 2 ) 2 ON(CH 3 ) 2 The group is also known as 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O--CH 2 --O--CH 2 --N(CH 3 ) 2 .

[0159] Other suitable sugar substituents include methoxy (--O-CH 3 ), aminopropyloxy (--OCH 2 CH 2 CH 2 NH 2 ), allyl (--CH 2 —CH=CH 2 ), --O-allyl (--O--CH 2 —CH=CH 2 ) and fluorine (F). The 2'-sugar substituent may be in the arabinose (upper) position or the ribose (lower) position. A suitable 2'-arabinose modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in a 2'-5' linked oligonucleotide and the 5' position of the 5' terminal nucleotide. The oligomeric compound may also have a sugar mimetic, such as a cyclobutyl moiety in place of the pentofuranosyl sugar.

[0160] Nucleic acids may also include modifications or substitutions of nucleobases (also referred to as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (--C=C--CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Modified nucleobases also include tricyclic pyrimidines such as phenoxazine cytidine (1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one), G-clamps such as substituted phenoxazine cytidines (e.g., 9-(2-aminoethoxy)-H-pyrimido(5,4-(b)(1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), and pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).

[0161] Heterocyclic base moieties may also include those in which purine or pyrimidine bases are replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz, JI, ed., John Wiley & Sons, 1990, those disclosed, by Englisch et al., Angewandte Chemie, International Edition, 1991, 30,613 disclosed, and by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., CRC Press, 1993 disclosed. Some of these nucleobases may be used to increase the binding affinity of oligomeric compounds. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi et al., ed., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are suitable base substitutions, for example when combined with 2'-O-methoxyethyl sugar modifications.

[0162] The lipids (e.g., lipids, lipids, lipid precursors, lipid precursors, oleochemicals, or oleochemicals) can be produced by any chemical or biochemical method (e.g., see U.S. Pat. No. 9,896,691, U.S. Pat. No. 9,598,710, U.S. Pat. No. 9,499,829, U.S. Pat. No. 9,428,779, U.S. Pat. No. 9,127,288, which are incorporated herein by reference in their entireties; and Kinney, 1997, Genetic Engineering, ed.: JK Setlow, 19:149-166; Ohlrogge and Browse, 1995, Plant Cell 7:957-970; Shanklin and Cahoon, 1998, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:611-641; Voelker, 1996, Genetic Engineering, ed.: JK Setlow, 18:111-13; Gerhardt, 1992, Prog. Lipid R. 31: 397-417; Guhnemann-Schafer & Kindl, 1995, Biochim. Biophys Acta 1256: 181-186; Kunau et al., 1995, Prog. Lipid Res.34:267-342; Stymne et al., 1993, in Biochemistry and Molecular Biology of Membrane and Storage Lipids of Plants, editors: Murata and Somerville, Rockville, American Society of PlantPhysiologists, 150-158, Murphy & Ross 1998, Plant Journal. 13(1): 1-16), and collected by any convenient method (e.g., centrifugation of extracellular secreted lipids, exposure to solvents, whole cell extraction (e.g., cell disruption and collection), hydrophobic solvent extraction (e.g., hexane), liquefaction, supercritical carbon dioxide extraction, freeze drying, mechanical pulverization, secretion (e.g., by adding effective export proteins), or a combination thereof). In some embodiments, lipids can be extracted and purified from, for example, plants, bacteria, or oleaginous yeast or fungi.

[0163] In some embodiments, lipid is covalently linked to oligonucleotide disclosed herein. In some embodiments, lipid is cross-linked to oligonucleotide disclosed herein. The mode of lipid and oligonucleotide combination is not particularly limited. Lipid and oligonucleotide can be directly combined or combined via a joint (joining region). In some embodiments, the joint for combining lipid with oligonucleotide comprises nucleic acid. In some embodiments, the joint for combining lipid with oligonucleotide does not comprise nucleic acid.

[0164] The linker that can be used is not particularly limited as long as the lipid and the oligonucleotide are covalently linked to each other. Examples of usable linkers include those having the following structures: --OP(=O)(OH)-O--, --O--CO--O--, --NH--CO--O--, --NH--CO--NH--, --NH--(CH 2 ) n1 --、--S--(CH 2 ) n1 --、--CO--(CH 2 ) n1 --CO--、--CO--(CH 2 ) n1 --NH--、--NH--(CH 2 ) n1 --NH--、--CO--NH--(CH 2 ) n1 --NH--CO--,--C(=S)--NH--(CH 2 ) n1 --NH--CO--,--C(=S)--NH--(CH 2 ) n1 --NH--C--(=S)--,--CO--O--(CH 2 ) n1 --O--CO--,--C(.=S)--O--(CH 2 ) n1 --O--CO--、--C(=S)--O--(CH 2 ) n1 --O--C--(=S)--、--CO--NH--(CH 2 ) n1 --O--CO--,--C(=S)--NH--(CH 2 ) n1 --O--CO--,--C(=S)--NH--(CH 2 ) n1 --O--C--(=S)--、--CO--NH--(CH2 ) n1 --O--CO--,--C(=S)--NH--(CH 2 ) n1 --CO--、--C(=S)--O--(CH 2 ) n1 --NH--CO--,--C(=S)--NH--(CH 2 ) n1 --O--C--(=S)--、--NH--(CH 2 CH 2 O) n2 --CH(CH 2 OH)--、--NH--(CH 2 CH 2 O) n2 --CH 2 --、--NH--(CH 2 CH 2 O) n2 --CH 2 --CO--、--O--(CH 2 ) n3 --S--S--(CH 2 ) n4 --O--P(=O) 2 --、--CO--(CH 2 ) n3 --O--CO--NH--(CH 2 ) n4 --、--CO--(CH 2 ) n3 --CO--NH--(CH 2 ) n4 --, wherein n1 is an integer from about 1 to about 40, n2 is an integer from about 1 to about 20, and n3 and n4 may be the same or different and are integers from about 1 to about 20. In some embodiments, the linker is a phosphate group (--OP(=O)(OH)-O--).

[0165] How to use

[0166] Lipid-modified or hydrophobically anchored oligonucleotide compounds and compositions containing lipid-modified or hydrophobically anchored oligonucleotides can be used for a variety of different pharmaceutical, cosmeceutical, diagnostic and biomedical applications. For example, lipid-modified or hydrophobically anchored oligonucleotide compounds and compositions containing lipid-modified or hydrophobically anchored oligonucleotide compounds can be used for research and therapeutic applications, including the study of cell-cell interactions, membrane mechanics, bottom-up assembly of tissues, quantitative imaging of non-adherent cells, or the study of biological processes occurring near the cell surface. Lipid-modified or hydrophobically anchored oligonucleotide compounds and compositions containing lipid-modified or hydrophobically anchored oligonucleotides can also be used to study the spatial expression profiles of genes in samples or tissues from subjects.

[0167] In implementing such methods, a composition comprising a lipid-modified or hydrophobically anchored oligonucleotide may first be contacted with a membrane, such as a cell membrane, a plasma membrane or a nuclear membrane that separates the cytoplasm from a point outside the cell, under conditions that allow the composition to be inserted into the membrane. In some embodiments, the method includes contacting the membrane with a composition comprising a lipid-modified or hydrophobically anchored oligonucleotide, and incubating the composition with the membrane under conditions that allow the composition to be inserted into the membrane. In some embodiments, the method includes contacting the membrane with a composition comprising a lipid-modified or hydrophobically anchored oligonucleotide, and incubating the composition with the membrane for a period of time sufficient for the anchor-lipid modified oligonucleotide to embed itself within the membrane.

[0168] In some embodiments, the oligonucleotide modified by anchor lipid or hydrophobic anchor and the oligonucleotide modified by co-anchor lipid or hydrophobic anchor are added to the cell or membrane at the same time. In some embodiments, the oligonucleotide modified by anchor lipid or hydrophobic anchor and the oligonucleotide modified by co-anchor lipid or hydrophobic anchor are added to the cell or membrane in sequence. In some embodiments, the oligonucleotide modified by anchor lipid or hydrophobic anchor is first added to the cell or membrane, and then the oligonucleotide modified by co-anchor lipid or hydrophobic anchor is added to the cell or membrane. In some embodiments, the oligonucleotide modified by co-anchor lipid or hydrophobic anchor is first added to the cell or membrane, and then the oligonucleotide modified by anchor lipid or hydrophobic anchor is added to the cell or membrane. In some embodiments, the oligonucleotide modified by anchor lipid or hydrophobic anchor is pre-hybridized with the barcode oligonucleotide before it is added to the cell or membrane. In such embodiments, the oligonucleotide modified by anchor lipid or hydrophobic anchor is hybridized with the barcode oligonucleotide by their respective primer regions.

[0169] In some embodiments, the disclosure relates to a method of labeling a cell or a cell sample, a method of isolating endogenous DNA from a cell sample, or a method of sequencing a nucleic acid sequence from a cell sample, comprising exposing the cell sample to one or more anchor-lipid modified oligonucleotides disclosed herein, and then adding at least a first labeling oligonucleotide sequence complementary to the anchor-lipid modified oligonucleotide, the first labeling oligonucleotide sequence comprising a known nucleic acid sequence portion on its 3' region. In some embodiments, the sample is from a human.

[0170] In some embodiments, the first marker oligonucleotide is complementary to the 3' region of the oligonucleotide modified by the anchor-lipid, so that at least a portion of the known nucleic acid sequence at the 3' end is single-stranded. In some embodiments, the method also includes exposing the single-stranded 3' end of the first marker oligonucleotide to a ligase buffer and a ligase to covalently connect the first marker oligonucleotide to the oligonucleotide modified by the anchor lipid. The oligonucleotide modified by the anchor-lipid can be exposed to at least the second, third or fourth or more marker oligonucleotides in sequence, each of which contains a unique recognition nucleic acid sequence in their respective molecule 3' regions. In some embodiments, the method also includes exposing the oligonucleotide modified by the anchor lipid and the first or more marker oligonucleotides to a first joint, such oligonucleotide sequence is complementary to a portion of the first marker oligonucleotide and the second marker oligonucleotide, so that when exposed to a ligase and free dNTPs, the first joint is used as a template nucleic acid chain for connecting and forming a complementary nucleic acid sequence along the nucleic acid chain of the single-stranded region at the 3' end of each marker oligonucleotide. In some embodiments, the present disclosure relates to a method of labeling a cell sample, a method of isolating endogenous DNA from a cell sample, or a method of sequencing a nucleic acid sequence from a cell sample, the method comprising:

[0171] (a) exposing the cell sample to one or more anchor-lipid modified oligonucleotides disclosed herein, or a composition comprising the same, for a period of time sufficient for the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell;

[0172] (b) exposing the cell sample to one or more labeled oligonucleotides complementary to the anchor-lipid modified oligonucleotide for a period of time sufficient for the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the one or more labeled oligonucleotides;

[0173] (c) linking the one or more labeling oligonucleotides to the one or more anchor-lipid modified oligonucleotides; and optionally

[0174] (d) detecting the presence of the one or more marker oligonucleotides by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides; and / or

[0175] (e) separating the cells based on the presence of one or more marker oligonucleotides, wherein the presence of the one or more marker oligonucleotides is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the one or more marker oligonucleotides.

[0176] In some embodiments, a method of labeling a cell sample, a method of isolating endogenous DNA from a cell sample, or a method of sequencing a nucleic acid sequence from a cell sample comprises:

[0177] (a) exposing a cell to one or more anchor-lipid modified oligonucleotides for a period of time sufficient for the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell;

[0178] (b) exposing the cell to a first labeled oligonucleotide complementary to the anchor-lipid modified oligonucleotide for a period of time sufficient for the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the one or more labeled oligonucleotides;

[0179] (c) connecting the first labeling oligonucleotide to the one or more anchor-lipid modified oligonucleotides; and optionally

[0180] (d) detecting the presence of the first marker oligonucleotide by detecting one of a plurality of unique nucleotide sequences corresponding to the first marker oligonucleotide; and / or

[0181] (e) separating the cells based on the presence of the first marker oligonucleotide, wherein the presence of the first marker oligonucleotide is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the first marker oligonucleotide.

[0182] In some embodiments, a method of labeling a cell sample, a method of isolating endogenous DNA from a cell sample, or a method of sequencing a nucleic acid sequence from a cell sample comprises:

[0183] (a) exposing a cell to one or more anchor-lipid modified oligonucleotides for a period of time sufficient for the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell;

[0184] (b) exposing the cell to a first, second, third, fourth or more marker oligonucleotides, wherein the first marker oligonucleotide is complementary to the one or more anchor-lipid modified oligonucleotides and is exposed to the one or more anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the first marker oligonucleotide, and wherein the second, third and / or fourth or more marker oligonucleotides are sequentially exposed to the 3' portion of the marker oligonucleotide exposed to the cell immediately prior to exposing the second, third and / or fourth or more marker oligonucleotides to the cell, and for a period of time sufficient to allow the second, third and / or fourth or more marker oligonucleotides to covalently or non-covalently bind to the previously exposed marker oligonucleotide;

[0185] (c) linking the one or more labeling oligonucleotides to the first anchor-lipid-modified oligonucleotide, and in the case of the second, third, fourth or more labeling oligonucleotides, linking the labeling oligonucleotides to each other simultaneously; and optionally

[0186] (d) detecting the presence of the first, second, third, fourth and / or more marker oligonucleotides by detecting one of a plurality of unique nucleotide sequences corresponding to each of the first, second, third and fourth marker oligonucleotides; and / or

[0187] (e) separating the cells based on the presence of the first, second, third, fourth and / or more marker oligonucleotides or based on a sequential combination of unique nucleotide sequences of each of the first, second, third, fourth and / or more marker oligonucleotides, wherein the presence of the first, second, third, fourth and / or more marker oligonucleotides is determined by detecting one of a plurality of unique nucleotide sequences corresponding to one or a combination of each of the marker oligonucleotides.

[0188] In some embodiments, the present disclosure relates to methods for confirming the spatial location of endogenous nucleic acid expression in a cell sample, methods for isolating endogenous DNA from a cell sample, and / or methods for sequencing endogenously expressed nucleic acid sequences from a cell sample, comprising:

[0189] (a) exposing a cell to one or more anchor-lipid modified oligonucleotides for a period of time sufficient for the anchor-lipid modified oligonucleotide to embed itself within the cell membrane of the cell;

[0190] (b) exposing the cell to a first, second, third, fourth or more marker oligonucleotides, wherein the first marker oligonucleotide is complementary to the one or more anchor-lipid modified oligonucleotides and is exposed to the one or more anchor-lipid modified oligonucleotides for a period of time sufficient to allow the anchor-lipid modified oligonucleotide to form a complementary strand of nucleic acid with the first marker oligonucleotide, and wherein the second, third and / or fourth or more marker oligonucleotides are sequentially exposed to the 3' portion of the marker oligonucleotide exposed to the cell immediately prior to exposing the second, third and / or fourth or more marker oligonucleotides to the cell, and for a period of time sufficient to allow the second, third and / or fourth or more marker oligonucleotides to covalently or non-covalently bind to the previously exposed marker oligonucleotide;

[0191] (c) linking the one or more labeling oligonucleotides to the first anchor-lipid-modified oligonucleotide, and in the case of the second, third, fourth or more labeling oligonucleotides, linking the labeling oligonucleotides to each other simultaneously; and optionally

[0192] (d) detecting the presence of the first, second, third, fourth and / or more marker oligonucleotides by detecting one of a plurality of unique nucleotide sequences corresponding to each of the first, second, third and fourth marker oligonucleotides; and / or

[0193] (e) analyzing the regional expression of the cells based on the spatial position of the first, second, third, fourth and / or more marker oligonucleotides or based on the sequential combination of the unique nucleotide sequences of each of the first, second, third, fourth and / or more marker oligonucleotides, wherein the spatial position of the cells affected by the endogenous expression of the nucleic acid is determined by detecting the spatial position of the first, second, third, fourth and / or more marker oligonucleotides corresponding to one or a combination of each of the marker oligonucleotides.

[0194] In some embodiments, the cells or cell samples used for the disclosed methods of labeling cell samples, methods of separating endogenous DNA from cell samples, or methods of sequencing nucleic acid sequences from cell samples are obtained by distributing cells corresponding to the region of the sample into a container. In some embodiments, the distribution of cells is performed by placing a slice or three-dimensional preparation of a tissue sample on top of a container and positioning cells corresponding to the region of the sample into the container. In some embodiments, the container is a well. In some embodiments, the container is a microwell.

[0195] In some embodiments, the present disclosure provides a method for confirming the spatial location of a nucleic acid expression pattern within a sample or tissue of a subject, the method comprising:

[0196] (a) distributing one or more cells from the sample or a tissue corresponding to a region of the sample into one of a plurality of containers by placing a section or a three-dimensional preparation of the sample into one of a plurality of containers;

[0197] (b) exposing one or more cells corresponding to the area of ​​the sample with a known oligonucleotide disclosed herein for a time sufficient to allow the known oligonucleotide to be incorporated into the one or more cells, each oligonucleotide being unique to and corresponding to one of the plurality of containers to which the one or more cells are exposed;

[0198] (c) isolating and / or sequencing nucleic acids from the one or more cells based on known oligonucleotides; and

[0199] (d) correlating the expression profile from the one or more cells to the spatial location of the cells within the sample, relative to the tissue, or within the tissue.

[0200] In such embodiments, the known oligonucleotides in each of the plurality of containers are independently selected from one or a combination of the following:

[0201] (x) a first lipid-conjugated DNA oligonucleotide comprising a first lipid moiety, a first hybridization region and a first primer region; and / or

[0202] (y) a second lipid-conjugated DNA oligonucleotide comprising a second hybridization region and a second lipid moiety, wherein the second hybridization region is the reverse complement of the first hybridization region; and / or

[0203] (z) a third DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence, wherein the second primer region is the reverse complement of the first primer region.

[0204] In some embodiments, the present disclosure provides a method of confirming the spatial expression pattern of a nucleic acid within a tissue of a subject, the method comprising:

[0205] (a) distributing one or more cells from a sample corresponding to a region of the tissue into one of a plurality of containers;

[0206] (b) exposing one or more cells with a lipid-conjugated DNA oligonucleotide comprising a lipid moiety as defined elsewhere herein, a barcode region as defined elsewhere herein, and a capture sequence as defined elsewhere herein, for a period of time sufficient for said lipid moiety to embed itself within a cell membrane of said one or more cells, wherein said barcode region of said lipid-conjugated DNA oligonucleotide is unique for each of said plurality of containers to which said one or more cells are exposed;

[0207] (c) sequencing nucleic acids captured by the capture sequence of the lipid-conjugated DNA oligonucleotide in the one or more cells; and

[0208] (d) associating the sequenced nucleic acids from the one or more cells with the spatial location of the one or more cells within and / or relative to the tissue based on the barcode region contained in each of the sequenced nucleic acids.

[0209] In some embodiments, the lipid-conjugated DNA oligonucleotide used in such methods comprises: (i) a first lipid-conjugated DNA oligonucleotide comprising a lipid portion and a first primer region as defined elsewhere herein; and (ii) a second DNA oligonucleotide comprising a second primer region, a barcode region, and a capture sequence as defined elsewhere herein, wherein the second primer region is the reverse complement of the first primer region. In some embodiments, the first lipid-conjugated DNA oligonucleotide further comprises a first hybridization region as defined elsewhere herein. In some embodiments, such methods further comprise exposing the one or more cells to a second lipid-conjugated DNA oligonucleotide prior to the sequencing step, wherein the second lipid-conjugated DNA oligonucleotide comprises a second hybridization region as defined elsewhere herein and a second lipid portion as defined elsewhere herein, wherein the second hybridization region is the reverse complement of the first hybridization region.

[0210] In some embodiments, cell distribution is performed by placing a tissue slice or a three-dimensional preparation of the tissue with appropriate thickness as described elsewhere herein into one of a plurality of containers. In some embodiments, cell distribution is performed by placing a tissue slice or a three-dimensional preparation of the tissue on the top of one of a plurality of containers and forcing one or more cells corresponding to the defined area of ​​the tissue sample into the one of a plurality of containers. In some embodiments, one of a plurality of containers is a microwell. Microwell arrays can be directly produced into substrates such as SU-8 using soft lithography. The SU-8 mold made by lithography can also be used to make microwells in PDMS. The PDMS stamp can also be used as a mold for other polymers such as TPE, NOA81 and PUMA. Alternatively, an array can be made using a 3D printing method such as Nanoscribe. Any other selection known in the art for producing microwell arrays can also be used, including but not limited to injection molding or hot embossing.

[0211] Depending on the size of the micropores, the spatial resolution of the pores used in the disclosed methods can be about 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 microns. In some embodiments, the spatial resolution of the pores is less than about 10 microns. In some embodiments, the spatial resolution of the pores is about 10 microns. In some embodiments, the spatial resolution of the pores is about 20 microns. In some embodiments, the spatial resolution of the pores is about 30 microns. In some embodiments, the spatial resolution of the pores is about 40 microns. In some embodiments, the spatial resolution of the pores is about 50 microns. In some embodiments, the spatial resolution of the pores is about 60 microns. In some embodiments, the spatial resolution of the pores is about 70 microns. In some embodiments, the spatial resolution of the pores is about 80 microns. In some embodiments, the spatial resolution of the pores is about 90 microns. In some embodiments, the spatial resolution of the pores is about 100 microns. In some embodiments, the spatial resolution of the pores is greater than about 100 microns.

[0212] In some embodiments, detection and / or analysis of barcode oligonucleotides is performed by detection or quantification of one or more probes or labeled oligonucleotides. For example, devices such as Biorad ddSEQ readers can be used to detect and analyze single cells or multicellular samples in multiple formats. For example, Nature Biotechnology, Vol. 37, pp. 916-924 (2019) discloses known methods for quantifying, detecting, and analyzing the presence or absence of barcoded samples. Such techniques are incorporated by reference in their entirety.

[0213] In some embodiments, the cell sample is a three-dimensional preparation of cells from a tissue sample of a subject. In some embodiments, the cell sample is a tissue section. In some embodiments, the thickness of the cell sample is about 0.05 microns to about 150 microns. In some embodiments, the thickness of the cell sample is about 0.1 microns to about 99 microns. In some embodiments, the thickness of the cell sample is about 0.5 microns to about 80 microns. In some embodiments, the thickness of the cell sample is about 1 micron to about 50 microns. In some embodiments, the thickness of the cell sample is about 2 microns to about 40 microns. In some embodiments, the thickness of the cell sample is about 3 microns to about 30 microns. In some embodiments, the thickness of the cell sample is about 4 microns to about 20 microns. In some embodiments, the thickness of the cell sample is about 0.05 microns. In some embodiments, the thickness of the cell sample is about 0.1 microns. In some embodiments, the thickness of the cell sample is about 0.5 microns. In some embodiments, the thickness of the cell sample is about 1 micron. In some embodiments, the thickness of the cell sample is about 5 microns. In some embodiments, the thickness of the cell sample is about 10 microns. In some embodiments, the thickness of the cell sample is about 20 microns. In some embodiments, the thickness of the cell sample is about 30 microns. In some embodiments, the thickness of the cell sample is about 40 microns. In some embodiments, the thickness of the cell sample is about 50 microns. In some embodiments, the thickness of the cell sample is about 60 microns. In some embodiments, the thickness of the cell sample is about 70 microns. In some embodiments, the thickness of the cell sample is about 80 microns. In some embodiments, the thickness of the cell sample is about 90 microns. In some embodiments, the thickness of the cell sample is about 100 microns. In some embodiments, the thickness of the cell sample is about 150 microns. In some embodiments, the thickness of the cell sample is greater than about 150 microns.

[0214] In some embodiments, the disclosure relates to a method of labeling a plurality of cells from a sample, and if the method comprises exposing the cells to a plurality of labeling oligonucleotides, the method further comprises the step of pooling the cells in a single container before exposing the cell pair to each successive step of a second, third, fourth, or more labeling oligonucleotides. In some embodiments, the method further comprises the step of pooling the cells in a single container after exposing the cell pair to each successive step of a second, third, fourth, or more labeling oligonucleotides.

[0215] In one aspect, microfluidic droplets are used, for example, to contain cells. Microfluidic droplets can be used to keep cells in a plurality of cells separate and identifiable, for example, so that differences between different cells can be identified. Multiple cells, some or all of which may contain individual differences, can be studied at resolutions as low as single cell levels, for example, by using lipid-modified or hydrophobic-anchored oligonucleotides disclosed herein.

[0216] The cell sample can be from any subject, such as a human, or from a non-human animal, such as an invertebrate cell (e.g., a cell from a fruit fly), a fish cell (e.g., a zebrafish cell), an amphibian cell (e.g., a frog cell), a reptile cell, a bird cell, or a mammalian cell, such as a monkey, ape, cow, sheep, goat, horse, donkey, camel, llama, alpaca, rabbit, pig, mouse, rat, guinea pig, hamster, dog, cat, etc. If the cell sample is from a multicellular organism, the cell sample can be from any part of the organism. In some embodiments, tissues can be studied. For example, tissues from an organism can be processed to produce a cell sample (e.g., by slicing the tissue) so that differences within the tissue can be determined, as discussed herein.

[0217] The cell sample or tissue can be from a healthy subject or a subject that is ill or suspected of being ill. For example, a cell sample or tissue can be taken from a subject and studied to determine differences or changes in the characteristics of those cell samples or tissues, such as to determine whether the subject is healthy or has a disease, such as whether an animal has cancer (e.g., by determining a cancer-specific expression profile within a cell sample or tissue). In some cases, a tumor can be studied (e.g., using a biopsy), and the characteristics of the tumor can be determined.

[0218] Droplet can be contained in microfluidic channel.For example, in certain embodiments, the average size or diameter of droplet can be less than about 1mm, less than about 500 microns, less than about 300 microns, less than about 200 microns, less than about 100 microns, less than about 75 microns, less than about 50 microns, less than about 30 microns, less than about 25 microns, less than about 10 microns, less than about 5 microns, less than about 3 microns, or less than about 1 micron in some cases.In some cases, average diameter can also be at least about 1 micron, at least about 2 microns, at least about 3 microns, at least about 5 microns, at least about 10 microns, at least about 15 microns or at least about 20 microns. Droplet can be spherical or non-spherical.If droplet is non-spherical, then the average diameter or size of droplet can be regarded as the diameter of the perfect sphere identical with the non-spherical droplet volume.

[0219] Any suitable technique can be used to produce droplets. For example, the confluence of a channel can be used to produce droplets. The confluence can be, for example, a T-type confluence, a Y-type confluence, a channel-in-channel type confluence (e.g., arranged coaxially, or including an inner channel and an outer channel around at least a portion of the inner channel), a cross (or "X") type confluence, a flow focusing type confluence, or any other suitable confluence for producing droplets. See, for example, WO 2004 / 091763 and WO2004 / 002627, each of which is incorporated herein by reference in its entirety. In some embodiments, the confluence can be constructed and arranged to produce substantially monodisperse droplets.

[0220] In some cases, cells can be encapsulated within the droplets at a relatively high rate. For example, the rate of cell encapsulation in the droplets can be at least about 10 cells / s, at least about 30 cells / s, at least about 100 cells / s, at least about 300 cells / s, at least about 1,000 cells / s, at least about 3,000 cells / s, at least about 10,000 cells / s, at least about 30,000 cells / s, at least about 100,000 cells / s, at least about 300,000 cells / s, or at least about 10 6 cells / s.

[0221] PCR reactions (including, for example, reverse transcription PCR and primer extension PCR using lipid-modified or hydrophobic-anchored oligonucleotides disclosed herein) can be performed using, for example, any microfluidic device (including, for example, a microfluidic device coupled to a multi-sample nanodispenser). A microfluidic device is a fluidic system in which the volume of the fluid is very small, typically in the order of microliters to nanoliters. In some embodiments, microfluidics can process tens to thousands of samples in a small volume. Microfluidics can be active or passive. By using active elements such as valves in a microfluidic device, a microfluidic circuit can be created. This allows not only the use of small reagent volumes, but also high task parallelization, because multiple programs can be processed and physically installed on the same chip.

[0222] In microfluidic channels, the flow of liquid can be completely laminar, that is, all fluids move in the same direction and at the same speed. Unlike turbulent flow, this makes it very easy to predict the molecular transport in the fluid. Microfluidic devices can be made of glass or plastic. In some embodiments, polydimethylsiloxane (PDMS) can be used, which is a type of silicone. Some advantages of PDMS include low price, optical transparency, and can be permeable to a variety of substances, including gases. In some embodiments, soft lithography or micromolding can be used to produce microfluidic devices based on PDMS. The device can use pressure-driven flow, electric flow or wet-driven flow.

[0223] In some embodiments, microfluidic device has multiple chambers, each chamber has real-time microarray.In some embodiments, array is incorporated into microfluidic device.In some embodiments, microfluidic device is formed by adding features to the planar surface with multiple real-time microarrays so as to produce chambers, wherein the chambers correspond to the real-time microarrays.In some embodiments, substrates with three-dimensional features (e.g., PDMS surfaces with holes, micropores or channels) are placed in contact with surfaces with multiple real-time microarrays to form microfluidic devices with multiple arrays in multiple chambers.

[0224] In order to analyze multiple samples simultaneously, a device with multiple chambers can be used, each chamber having a real-time microarray. In some embodiments, multiple chambers have sample fluids derived from the same sample. Sample fluids having from the same sample in multiple chambers can be used for example to measure each with different arrays, for analyzing the different aspects of the same sample, or for example to improve accuracy by parallel measurements on the same array. In some cases, different amplicons in the same sample will have different optimal temperature distribution conditions. Therefore, in some embodiments, the same sample is divided into different fluid volumes, and different fluid volumes are in different chambers with real-time microarrays; and at least some of the different fluid volumes are given different temperature cycles.

[0225] In some embodiments, multiple chambers have sample fluids from different sources. It can be useful to have sample fluids from different sources, so as to increase throughput by measuring more samples in a given time period on a given instrument. In some embodiments, the microfluids with multiple chambers including real-time microarrays can be used for diagnostic applications. The device can have about 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, 15-20, 20-30, 30-50, 50-75, 75-100 or more than 100 chambers, and each chamber has a real-time microarray.

[0226] Some embodiments relate to the use of lipid-modified or hydrophobically anchored oligonucleotides bound to a solid support. "Solid support" refers to any substrate having a surface to which molecules can be attached directly or indirectly by covalent or non-covalent bonds. A solid support may include any substrate material capable of providing physical support for probes attached to a surface. The material is generally capable of withstanding conditions associated with attachment of the barcode oligonucleotide to the surface and any subsequent treatment, manipulation or processing encountered during the determination. The material may be a modification of a naturally occurring, synthetic or naturally occurring material. Suitable solid support materials may include silicon, graphite, mirrored surfaces, laminates, ceramics, plastics (including polymers such as poly(vinyl chloride), cycloolefin copolymers, polyacrylamide, polyacrylates, polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene terephthalate), polytetrafluoroethylene (PTFE or ), nylon, poly (vinyl butyrate)), germanium, gallium arsenide, gold, silver, etc., used independently or in combination with other materials. Other rigid materials can be considered, such as glass, which includes silicon dioxide, and also includes glass that can be used as bioglass, for example. Other materials that can be used include porous materials, such as glass beads with controlled pore size. Any other material known in the art that can have one or more functional groups bound to its surface, such as any amino, carboxyl, thiol or hydroxyl functional groups, is also covered.

[0227] The material for the solid support can adopt any of a variety of structures from simple to complex. The solid carrier can have any of a variety of shapes, including strips, plates, disks, rods, particles, including beads, tubes, holes, etc. Usually, the material is relatively flat, such as a glass slide, although it can be spherical, such as beads, or cylindrical (e.g., columns). In many embodiments, the material is generally shaped as a rectangular solid. A plurality of predetermined arrangements, such as probe arrays, can be synthesized on a sheet and then cut into a single array substrate, i.e., cut by breaking along the score line. Exemplary solid supports that can be used include microtiter wells, microscope slides, membranes, magnetic beads, charged paper, Langmuir-Blodgett film, silicon wafer chips, flow chips, and microbeads. In some embodiments, beads are plastic or polystyrene. In some embodiments, beads are magnetic. After the beads are exposed to magnetic force, nucleic acid molecules or sequences from cells can be separated. Single DNA and RNA

[0228] In some embodiments, it is possible to directly conjugate the barcode oligonucleotide to the solid support via its capture sequence, such as a poly(A) tail. In such embodiments, cells or membranes comprising an anchor and optionally a co-anchored lipid-modified or hydrophobically anchored oligonucleotide can be exposed to a solid support under hybridization conditions, such that the cells or membranes comprising an anchor and optionally a co-anchored lipid-modified or hydrophobically anchored oligonucleotide bind to the barcode oligonucleotide. The non-bound material on the solid support can then be washed and the remaining solid support, including the bound cells and membranes, can be further analyzed by sequencing or other recognition schemes.

[0229] In some embodiments, the solid support is initially unbound and is bound to the barcode oligonucleotide via the capture sequence of the barcode oligonucleotide. In such embodiments, the cell or membrane comprising the anchor and optionally the co-anchored lipid-modified or hydrophobically anchored oligonucleotide has been hybridized to the barcode oligonucleotide via the first and second primer regions. The non-bound material on the solid support can then be washed and the remaining solid support, including the bound cells and membrane, can be further analyzed by sequencing or other recognition schemes.

[0230] In some embodiments, the disclosure relates to a method for labeling cells with a barcode or lipid-modified oligonucleotide disclosed herein. In some embodiments, the method includes contacting one or more homogeneous mixtures or heterogeneous mixtures of the disclosed oligonucleotides with one or more cells from a sample or tissue. In some embodiments, the cell is contacted with at least the first and second lipid-modified oligonucleotides so that the lipid-oligonucleotides are hybridized with RNA, DNA, or RNA / DNA hybrids present in the cell. In some embodiments, the capture zone of the oligonucleotide is used to separate the oligonucleotides onto a solid support or another fixed oligonucleotide so that unhybridized elements or components can be removed from the cell, and the retentate of the RNA / DNA captured from the cell is retained. In some embodiments, the RNA / DNA captured from a single cell can be separated in a culture container. In some embodiments, a plurality of captured DNA / RNA sequences can be maintained in a library corresponding to the cell from which it is separated. In some embodiments, the multiple captured DNA / RNA sequences are sequenced so that the sequenced DNA or RNA corresponds to the expression pattern of the cell.

[0231] The present disclosure relates to a method for preparing a library of oligonucleotides expressed by a single cell or isolated multiple cells, the method of generating the library comprising sequencing RNA or DNA from the one or more cells after exposing the one or more cells to one or more lipid-modified oligonucleotides disclosed herein. In some embodiments, endogenous nucleotides from one or more cells can be isolated and / or confirmed by associating the known signal or frequency of the probe bound to the lipid-modified oligonucleotide with the cell to which the oligonucleotide is bound. The signal or frequency of the probe can be paired with the source of endogenous DNA and / or RNA. In some embodiments, the endogenous nucleotide is mRNA expressed by one or more cells or cDNA formed by a library of complementary chains of the mRNA by, for example, PCR or other known techniques for generating a cDNA library from isolated mRNA. In some embodiments, cDNA or mRNA is isolated from the cell by contacting a single cell with one or more lipid-modified oligonucleotides disclosed herein, so that each captured cell can be associated with the confirmation, number or detection of the probe bound to the one or more lipid-modified oligonucleotides. The different distribution of one or more lipid-modified oligonucleotides on one or more cells can be used to associate the cell with the endogenous expression pattern of its specific group. Cells carrying one or two or more lipid-modified oligonucleotides can be isolated using antibodies specific for antigens or other proteins on the cell surface. The expression pattern of the cell (generated by sequencing one or more endogenous sequences expressed by the cell) can be correlated with the corresponding characteristics of cells with known antigens confirmed by the adhesion of antibodies known to bind to the antibody's target sequence.

[0232] Example

[0233] General space information

[0234] LMO can also be used to barcode cells according to relative spatial orientation. In general, there are two methods to achieve spatial barcoding: (1) physical separation of cell / tissue regions, followed by barcoding as described above, and (2) adding lipid-modified oligonucleotide anchors to cells, followed by adding spatially defined barcode oligonucleotides. In the first case, physical separation can be achieved over a range of length scales by dissection with a scalpel, micropore isolation, or laser capture microdissection. Once the cells are separated, barcodes can be introduced into each unique sample, indicating the relative position of the cells in the sample. In the second case, all cells receive anchors and co-anchors before adding barcode oligonucleotides. Barcodes are specific to position and diffuse from the introduction position to be captured on cells via hybridization with anchor chains. The relative position of cells is determined by the number and relative ratio of spatial barcodes. The introduction of spatial barcodes can be achieved by several methods including microarray spotters, inkjet printers, acoustic liquid processors, and cutting from solid supports (e.g., arrays or beads).

[0235] Spatial barcoding of the developing gut (PROPHETIC)

[0236] To apply MULTI-seq to mesoscale spatial barcoding of scRNA-seq samples, we first surgically removed the small intestine from freshly euthanized and dissected mice or from dissected embryos. The small intestine was then stretched along the surface before the connective tissue and fat were removed with a scalpel. The small intestine was then sliced ​​before washing 4x with ice-cold PBS. After washing, each intestine was cut into segments of equal size (i.e., about 1 to about 100 microns along the proximal-distal axis for adult intestines; about 1 to about 100 microns for developing intestines). Each segment was then dissociated in 2 mL of dissociation medium (RPMI1640 with 3% FBS, 1% pen / strep, 1% sodium pyruvate, 1% MEM non-essential amino acids, 1% L-glutamine, 2.5% HEPES, 5mM EDTA, and 10mM DTT) at room temperature with shaking for 20 minutes.

[0237] After dissociation and manual stirring with p1000 pipette, the dissociation solution is filtered into 15mL conical bottle on ice by 100mM filter.Then the tissue block staying on the filter top is transferred to the independent 15mL conical bottle containing 4mL EDTA and further digested (for example, vigorously shaken 30 seconds), and then refiltered.This process is repeated twice, produces the cell suspension of rough filtration.Then this roughly filtered suspension is filtered into new 15mL conical bottle by 70mM filter, and then centrifuged for 8 minutes with 1500rpm.

[0238] Each cell suspension was then washed once with 10 mL of ice-cold PBS before being resuspended into 160 mL of single cell suspension in ice-cold PBS. The single cell suspension was then transferred to individual wells of a 48-well plate before adding 20 mL of 2.5 mM anchor LMO pre-hybridized with a single MULTI-seq sample barcode. The cell suspension was then manually stirred and incubated on ice for 5 minutes before adding 20 mL of 2.5 mM co-anchor LMO and subsequently incubating on ice for 5 minutes. After MULTI-seq labeling, the labeling solution was diluted with 300 mL of 5% BSA to quench the ambient LMO before pooling, antibody staining, and FACS enrichment of live cells. The standard 10x genome scRNA-seq workflow was then performed on live cells using droplet microfluidics.

[0239] Physical separation using micropores

[0240] Microwell arrays can be produced directly into substrates such as SU-8 using soft lithography. SU-8 molds made by photolithography can also be used to make microwells in PDMS. In addition, PDMS stamps can be used as molds for other polymers such as TPE, NOA81, and PUMA. Alternatively, 3D printing methods such as Nanoscribe can be used to make arrays. Other options for producing arrays are injection molding or hot embossing. The spatial resolution of the wells can be 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 microns.

[0241] Once made, tissue dissociation reagents can be deposited into the wells. Additionally, 20 to 500 nM anchors with different and defined barcodes or barcode combinations are added to each well, providing spatial information. Tissue sections are placed on the array and clamped down with a seal. This forces the tissue into the wells. After dissociation, the seal is removed and the array is placed in a solution containing a quenching reagent and a non-quenching co-anchor. The cells are washed and filtered through a cell strainer, and intact cells are sorted.

[0242] The cells can be further processed using any number of commercial single-cell sequencing platforms such as 10X Genomics, Bio-Rad ddSEQ, CelSee Genesis, etc. The MULTI-seq barcode or combination of barcodes associated with each cell reveals the spatial location of that cell in the original array and can be linked to transcriptional information from that cell.

[0243] Diffusion-based approach using oligonucleotide barcode arrays

[0244] The tissue sections are placed on a microarray of oligonucleotide barcodes with a resolution of <10 μM. Anchors (100 nM to 2 μM) are washed on the tissue sections and diffused through the tissue, followed by addition of equal molar co-anchors. The spatial barcodes are then released (e.g., cutting disulfide joints) and diffused through the tissue. The tissue is then dissociated, and any number of commercial single cell sequencing platforms such as 10X Genomics, Bio-Rad ddSEQ, CelSee Genesis, etc. can be used for further processing. Cell location information can be determined by the relative amount of each spatial barcode.

[0245] Introducing an alternative to barcoding for diffusion-based methods

[0246] Instead of using an oligonucleotide array, barcoded reagents can be delivered directly to the tissue solution containing the tissue through an array of printed needles using an acoustic liquid handler such as the Labcyte Echo or EDC ATS. Barcoded reagents can also be delivered to the tissue by flowing different barcodes to different areas of the tissue along different axes into a microfluidic device. Sequence Listing <110> Regents of the University of California Z. Gartner D. Patterson Eric Zhou R. Weber C. McGinnis <120> Lipid-modified oligonucleotides and methods of use thereof <130> 37944.0014P1 <150> US 62 / 871,702 <151> 2019-07-08 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA oligonucleotides <400> 1 gtaacgatcc agctgtcact tggaattctc gggtgccaag g 41 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Second hybridization zone <400> 2 agtgacagct ggatcgttac 20 <210> 3 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> DNA oligonucleotides <220> <221> misc_feature <222> (22)..(27) <223> n is a, c, g, or t <400> 3 ccttggcacc cgagaattcc annnnnnaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 59 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> First hybridization zone <400> 4 gtaacgatcc agctgtcact 20 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> First primer region <400> 5 tggaattctc gggtgccaag g 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Second primer region <400> 6 ccttggcacc cgagaattcc a 21 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Capture sequence <400> 7 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 32

Claims

1. A method for confirming the spatial expression pattern of a nucleic acid in a tissue of a subject, the method comprising: (a) distributing one or more cells from a sample corresponding to a region of the tissue into one of a plurality of containers; (b) exposing the one or more cells to: a first lipid-conjugated DNA oligonucleotide comprising a first lipid moiety, a first hybridization region, and a first primer region, a second lipid-conjugated DNA oligonucleotide comprising a second lipid moiety and a second hybridization region, wherein the second hybridization region is the reverse complement of the first hybridization region, and a third DNA oligonucleotide comprising a barcode region, a capture sequence, and a second primer region, wherein the second primer region is the reverse complement of the first primer region, for a period of time sufficient to allow the first lipid moiety and the second lipid moiety to be embedded within a cell membrane of the one or more cells, wherein the barcode region is unique to each of the plurality of containers to which the one or more cells are exposed; (c) sequencing the nucleic acid captured by the capture sequence in the one or more cells; as well as (d) correlating the sequenced nucleic acids from the one or more cells with the spatial location of the one or more cells within and / or relative to the tissue based on the barcode region contained in each of the sequenced nucleic acids, wherein the nucleic acid sequence of the first lipid-conjugated DNA oligonucleotide is SEQ ID NO: 1-GTAACGATCCAGCTGTCACTTGGAATTCTCG GGTGCCAAGG, the nucleic acid sequence of the second lipid-conjugated DNA oligonucleotide is SEQ ID NO: 2-AGTGACAGCTGGATCGTTAC, and the nucleic acid sequence of the third DNA oligonucleotide is SEQ ID NO: 3-CCTTGGCACCCGAGAATTCCANNNNNNAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA, wherein N is any nucleic acid; Wherein the first lipid portion comprises a lipid selected from lignoceric acid and cholesterol or a compound of formula I: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl, and The second lipid portion comprises a lipid selected from palmitic acid and cholesterol or a compound of formula II: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl.

2. The method of claim 1, wherein the exposing comprises exposing the one or more cells to the second lipid-conjugated DNA oligonucleotide prior to the sequencing step, wherein the second lipid-conjugated DNA oligonucleotide comprises a second hybridization region and a second lipid portion, wherein the second hybridization region is the reverse complement of the first hybridization region.

3. The method of claim 1, wherein the cholesterol is cholesterol-triethylene glycol (TEG).

4. The method of any one of claims 1 to 3, wherein the capture sequence is a polyadenylation region.

5. The method according to any one of claims 1 to 3, further comprising: (e) exposing the cells to flow cytometry.

6. The method of any one of claims 1 to 3, wherein the dispensing step comprises placing a tissue section or a three-dimensional preparation of the sample having a thickness of 0.1 to 99 microns into the one of a plurality of containers.

7. The method of any one of claims 1 to 3, wherein the one or more containers are porous.

8. The method of any one of claims 1 to 3, wherein the sample is a tissue section.

9. A method for sequencing nucleic acid from one or more cells of a subject sample, comprising: (a) dispensing the one or more cells in a three-dimensional preparation or slice having a thickness of 0.1 micrometer to 99 micrometers corresponding to an area of ​​the sample into a container; (b) labeling the one or more cells corresponding to the region of the sample with the following oligonucleotides: a first lipid-conjugated DNA oligonucleotide comprising a first lipid moiety, a first hybridization region, and a first primer region, a second lipid-conjugated DNA oligonucleotide comprising a second lipid moiety and a second hybridization region, wherein the second hybridization region is the reverse complement of the first hybridization region, and a third DNA oligonucleotide comprising a barcode region, a capture sequence, and a second primer region, wherein the second primer region is the reverse complement of the first primer region; (c) isolating the nucleic acid from the one or more cells; and (d) sequencing said nucleic acid from said one or more cells, wherein the nucleic acid sequence of the first lipid-conjugated DNA oligonucleotide is SEQ ID NO: 1-GTAACGATCCAGCTGTCACTTGGAATTCTCG GGTGCCAAGG, the nucleic acid sequence of the second lipid-conjugated DNA oligonucleotide is SEQ ID NO: 2-AGTGACAGCTGGATCGTTAC, and the nucleic acid sequence of the third DNA oligonucleotide is SEQ ID NO: 3-CCTTGGCACCCGAGAATTCCANNNNNNAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA, wherein N is any nucleic acid; Wherein the first lipid portion comprises a lipid selected from lignoceric acid and cholesterol or a compound of formula I: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl, and The second lipid portion comprises a lipid selected from palmitic acid and cholesterol or a compound of formula II: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl.

10. The method of claim 9, further comprising: (e) compiling sequence information from each of the one or more cells.

11. The method of claim 10, wherein the compiling step comprises generating an expression profile for each of the one or more cells corresponding to a region of the sample.

12. The method of claim 11, further comprising correlating the sequence information and / or the expression profile of the nucleic acid with the spatial location of the one or more cells within the sample or within the subject.

13. The method of any one of claims 9 to 12, wherein the marking step comprises: (w) exposing the one or more cells to one or both of the first lipid-conjugated DNA oligonucleotide and the second lipid-conjugated DNA oligonucleotide for a period of time sufficient for one or both of the first lipid-conjugated DNA oligonucleotide and the second lipid-conjugated DNA oligonucleotide to embed themselves within the cell membrane of the cell; and / or (x) exposing the one or more cells to the third DNA oligonucleotide for a period of time sufficient for the first lipid-conjugated DNA oligonucleotide to form a complementary strand of nucleic acid with the third oligonucleotide; and / or (y) connecting the third DNA oligonucleotide to one or both of the first lipid-conjugated DNA oligonucleotide and the second lipid-conjugated DNA oligonucleotide; and optionally (z) detecting the presence of the third DNA oligonucleotide by detecting one or more unique nucleotide sequences corresponding to the third DNA oligonucleotide.

14. The method of claim 13, wherein the step of isolating cells comprises isolating the cells based on the presence of the third DNA oligonucleotide, wherein the presence of the third DNA oligonucleotide is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the third DNA oligonucleotide.

15. The method of any one of claims 9 to 12, wherein the first lipid-conjugated DNA oligonucleotide comprises the first lipid moiety, the first hybridization region, and the first primer region from 5' to 3' orientation.

16. The method of any one of claims 9 to 12, wherein the first lipid-conjugated DNA oligonucleotide comprises the first lipid moiety, the first hybridization region, and the first primer region from 3' to 5' orientation.

17. The method of any one of claims 9 to 12, wherein the second lipid-conjugated DNA oligonucleotide comprises the second hybridization region and the second lipid moiety from a 5' to 3' orientation.

18. The method of any one of claims 9 to 12, wherein the second lipid-conjugated DNA oligonucleotide comprises the second hybridization region and the second lipid moiety from a 3' to 5' orientation.

19. The method of any one of claims 9 to 12, wherein the third DNA oligonucleotide comprises the second primer region, the barcode region, and the capture sequence from 5' to 3' orientation.

20. The method of any one of claims 9 to 12, wherein the third DNA oligonucleotide comprises the second primer region, the barcode region, and the capture sequence from 3' to 5' orientation.

21. The method of any one of claims 9 to 12, wherein the cholesterol is cholesterol-triethylene glycol (TEG).

22. The method of any one of claims 9 to 12, wherein the capture sequence is a polyadenylation region.

23. The method of any one of claims 9 to 12, wherein one or more of the first lipid-conjugated DNA oligonucleotide, the second lipid-conjugated DNA oligonucleotide, and the third lipid-conjugated DNA oligonucleotide are bound to a solid support.

24. The method of claim 23, wherein the solid support is a bead.

25. The method of claim 24, wherein the capture sequence comprises a polyadenylation region and the beads comprise a poly (T) region that hybridizes to the polyadenylation region of the third DNA oligonucleotide.

26. A method for confirming the spatial location of a nucleic acid expression pattern in a sample or tissue of a subject, the method comprising: (a) distributing one or more cells from the sample or a tissue corresponding to a region of the sample into one of a plurality of containers; (b) exposing one or more cells corresponding to the region of the sample with the following oligonucleotides: a first lipid-conjugated DNA oligonucleotide comprising a first lipid moiety, a first hybridization region, and a first primer region, a second lipid-conjugated DNA oligonucleotide comprising a second lipid moiety and a second hybridization region, wherein the second hybridization region is the reverse complement of the first hybridization region, and a third DNA oligonucleotide comprising a barcode region, a capture sequence, and a second primer region, wherein the second primer region is the reverse complement of the first primer region, for a time sufficient to allow one or both of the first lipid-conjugated DNA oligonucleotide or the second lipid-conjugated DNA oligonucleotide to be incorporated into the one or more cells, the barcode region being unique to and corresponding to one of the plurality of containers to which the one or more cells are exposed; (c) isolating nucleic acid from the one or more cells based on the barcode region; (d) quantifying the expression of nucleic acid from the one or more cells and / or sequencing the nucleic acid; (e) normalizing nucleic acid expression in the expression profile; as well as (f) correlating the expression profile from the one or more cells with the spatial location of the cells within the sample, relative to the tissue or within the tissue, wherein the dispensing step comprises placing a slice or three-dimensional preparation of the sample having a thickness of 0.1 to 99 microns into one of a plurality of containers, wherein the nucleic acid sequence of the first lipid-conjugated DNA oligonucleotide is SEQ ID NO: 1-GTAACGATCCAGCTGTCACTTGGAATTCTCG GGTGCCAAGG, the nucleic acid sequence of the second lipid-conjugated DNA oligonucleotide is SEQ ID NO: 2-AGTGACAGCTGGATCGTTAC, and the nucleic acid sequence of the third DNA oligonucleotide is SEQ ID NO: 3-CCTTGGCACCCGAGAATTCCANNNNNNAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA, wherein N is any nucleic acid; Wherein the first lipid portion comprises a lipid selected from lignoceric acid and cholesterol or a compound of formula I: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl, and The second lipid portion comprises a lipid selected from palmitic acid and cholesterol or a compound of formula II: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl.

27. The method of claim 26, further comprising: (g) exposing the cells to flow cytometry.

28. The method of claim 26 or 27, wherein the step of isolating cells comprises exposing the cells to flow cytometry.

29. A method for sequencing nucleic acid from one or more cells of a subject sample, comprising: (a) distributing the one or more cells corresponding to the area of ​​the sample into containers; (b) labeling the one or more cells corresponding to the region of the sample with the following oligonucleotides: a first lipid-conjugated DNA oligonucleotide comprising a first lipid moiety, a first hybridization region, and a first primer region, a second lipid-conjugated DNA oligonucleotide comprising a second lipid moiety and a second hybridization region, wherein the second hybridization region is the reverse complement of the first hybridization region, and a third DNA oligonucleotide comprising a barcode region, a capture sequence, and a second primer region, wherein the second primer region is the reverse complement of the first primer region; (c) isolating the nucleic acid from the one or more cells; and (d) sequencing said nucleic acid from said one or more cells, wherein the dispensing step comprises placing a slice or three-dimensional preparation of the sample having a thickness of 0.1 to 99 microns into one of a plurality of containers, wherein the nucleic acid sequence of the first lipid-conjugated DNA oligonucleotide is SEQ ID NO: 1-GTAACGATCCAGCTGTCACTTGGAATTCTCG GGTGCCAAGG, the nucleic acid sequence of the second lipid-conjugated DNA oligonucleotide is SEQ ID NO: 2-AGTGACAGCTGGATCGTTAC, and the nucleic acid sequence of the third DNA oligonucleotide is SEQ ID NO: 3-CCTTGGCACCCGAGAATTCCANNNNNNAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA, wherein N is any nucleic acid; Wherein the first lipid portion comprises a lipid selected from lignoceric acid and cholesterol or a compound of formula I: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 1 to 25, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl, and The second lipid portion comprises a lipid selected from palmitic acid and cholesterol or a compound of formula II: or a physiologically acceptable salt thereof, Where n 1 is 5 to 25, n 2 is 0 to 24, and X is selected from the group consisting of NH, CH2, O and CH-R, wherein R is a C12 to C28 glycerol monoester, alkenyl, alkyl, aryl or aralkyl.

30. The method of claim 29, further comprising: (e) compiling sequence information from each of the one or more cells.

31. The method of claim 30, wherein the compiling step comprises generating an expression profile for each of the one or more cells corresponding to a region of the sample.

32. The method of any one of claims 29 to 31, further comprising associating the sequence information and / or the expression profile of the nucleic acid with the spatial location of the one or more cells within the sample or within the subject.

33. The method of any one of claims 29 to 31, wherein the marking step comprises: (w) exposing the one or more cells to one or both of the first lipid-conjugated DNA oligonucleotide or the second lipid-conjugated DNA oligonucleotide for a period of time sufficient for one or both of the first lipid-conjugated DNA oligonucleotide or the second lipid-conjugated DNA oligonucleotide to embed itself within the cell membrane of the cell; and / or (x) exposing the one or more cells to the third DNA oligonucleotide for a period of time sufficient for the first lipid-conjugated DNA oligonucleotide to form a complementary strand of nucleic acid with the third DNA oligonucleotide; and / or (y) linking the third DNA oligonucleotide to one or both of the first lipid-conjugated DNA oligonucleotide or the second lipid-conjugated DNA oligonucleotide; and optionally (z) detecting the presence of the third DNA oligonucleotide by detecting the barcode region.

34. The method of claim 33, wherein the step of isolating nucleic acid of one or more cells comprises isolating the one or more cells based on the presence of the third DNA oligonucleotide, wherein the presence of the third DNA oligonucleotide is determined by detecting one of a plurality of unique nucleotide sequences corresponding to the third DNA oligonucleotide.

35. The method of any one of claims 26, 27, or 29 to 31, wherein the first lipid-conjugated DNA oligonucleotide comprises the first lipid moiety, the first hybridization region, and the first primer region from 5' to 3' orientation.

36. The method of any one of claims 26, 27, or 29 to 31, wherein the first lipid-conjugated DNA oligonucleotide comprises the first lipid moiety, the first hybridization region, and the first primer region in a 3' to 5' orientation.

37. The method of any one of claims 26, 27, or 29 to 31, wherein the second lipid-conjugated DNA oligonucleotide comprises the second hybridization region and the second lipid moiety in a 5' to 3' orientation.

38. The method of any one of claims 26, 27, or 29 to 31, wherein the second lipid-conjugated DNA oligonucleotide comprises the second hybridization region and the second lipid moiety in a 3' to 5' orientation.

39. The method of any one of claims 26, 27, or 29 to 31, wherein the third DNA oligonucleotide comprises the second primer region, the barcode region, and the capture sequence from a 5' to 3' orientation.

40. The method of any one of claims 26, 27, or 29 to 31, wherein the third DNA oligonucleotide comprises the second primer region, the barcode region, and the capture sequence from a 3' to 5' orientation.

41. The method of any one of claims 26, 27, or 29 to 31, wherein the cholesterol is cholesterol-triethylene glycol (TEG).

42. The method of any one of claims 26, 27, or 29 to 31, wherein the capture sequence is a polyadenylation region.

43. The method of any one of claims 26, 27, or 29 to 31, wherein the step of sequencing the nucleic acid expression of one or more cells or the step of quantifying the expression of nucleic acid of one or more cells comprises droplet microfluidization in a sequencing device.

Images