Kits for genotyping

Abstract

The present invention relates to an example of a kit, which includes a circulation pool and a genotyping probe fluid. The circulation pool includes a substrate, and a first capture primer and a second capture primer attached to the substrate. The genotyping probe fluid includes a liquid carrier and a genotyping oligonucleotide in the liquid carrier. The genotyping oligonucleotide includes a first primer sequence; a probe sequence representing a target genotyping locus; a restriction endonuclease site; and a second primer sequence, wherein the second primer sequence is at least partially complementary to the second capture primer.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 981,866, filed on February 26, 2020, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted through EFS-Web is hereby incorporated by reference in its entirety. The file name is ILI184BPCT_IP-1897-PCT_Sequence_Listing_ST25.txt, the file size is 788 bytes, and the file creation date is December 29, 2020. Background Art

[0005] Detection of specific nucleic acids can be used in diagnostic medicine and molecular biology research. Gene probe assays can be used, for example, to identify infectious organisms, such as bacteria and viruses; to detect the expression of normal and mutant genes and identify mutant genes, such as oncogenes; to type tissues for compatibility prior to tissue transplantation; to match tissue or blood samples for forensics; and to explore homology between genes from different species. Summary of the invention

[0006] Disclosed herein are genotyping oligonucleotides comprising specific nucleotide sequence segments designed to have a specified function in cluster formation, linearization, target locus identification and / or sequencing. The genotyping oligonucleotides can be used for genotyping on a non-patterned or patterned flow cell and do not involve additional fixed components.

[0007] The first aspect disclosed herein is a kit comprising a flow cell comprising a substrate; and a first capture primer and a second capture primer connected to the substrate; and a genotyping probe fluid, the genotyping probe fluid comprising: a liquid carrier; and a genotyping oligonucleotide in the liquid carrier, the genotyping oligonucleotide comprising: a first primer sequence; a probe sequence representing a target genotyping locus; a restriction endonuclease site; and a second primer sequence, the second primer sequence being at least partially complementary to the second capture primer.

[0008] It should be understood that any features of the kits disclosed herein may be combined together in any desired manner and / or configuration to achieve the benefits described in the present disclosure, including, for example, achieving genotyping of a flow cell.

[0009] The second aspect disclosed herein is a method comprising: introducing a genotyping probe fluid into a flow cell comprising a first capture primer and a second capture primer, the genotyping probe fluid comprising a plurality of genotyping oligonucleotides, each of the genotyping oligonucleotides comprising: a first primer sequence; a probe sequence representing a corresponding target genotyping locus; a restriction endonuclease site; and a second primer sequence, the second primer sequence being at least partially complementary to the second capture primer; whereby the corresponding genotyping oligonucleotides react to produce corresponding clonal populations of amplicons from the corresponding genotyping oligonucleotides; linearizing the amplicons to produce probe templates; sequencing at least one probe recognition segment of the probe templates to identify each probe sequence in the probe sequences; removing at least the corresponding nascent chain from the probe templates, whereby the 3'OH group at the end of the probe template is exposed; hybridizing a corresponding sample to the probe template; and performing a corresponding genotyping reaction of the sample at the exposed 3'OH group.

[0010] It should be understood that any features of the method can be combined in any desired manner. In addition, it should be understood that any combination of features of the method and / or the kit can be used together, and / or combined with any examples disclosed herein to achieve benefits as described in the present disclosure, including, for example, genotyping of a flow cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly different parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0012] Figure 1A is a schematic diagram of an example of a genotyping oligonucleotide disclosed herein;

[0013] Figure 1B is a schematic diagram of another example of a genotyping oligonucleotide disclosed herein;

[0014] Figure 2A is a top view of an embodiment of a flow cell;

[0015] Figure 2B is an enlarged partial cross-sectional view of an example of a flow channel of a flow cell including a recessed portion formed along the flow channel;

[0016] 3A to 3H schematically depicts an example of the method disclosed herein; and

[0017] 4A to 4H Another example of the method disclosed herein is schematically depicted. DETAILED DESCRIPTION

[0018] Disclosed herein are genotyping oligonucleotides comprising specific nucleotide sequence segments. Each nucleotide sequence segment of the genotyping oligonucleotide is designed to have a specified function in cluster formation, linearization, target locus identification and / or sequencing.

[0019] Genotyping oligonucleotide can be used in the non-patterned flow cell with capture primer on its surface, or for the patterned flow cell including the recessed portion with capture primer. On the non-patterned flow cell surface or in the different regions of the corresponding recessed portion of the patterned flow cell, the monoclonal colony (cluster) of amplicon can be produced from the corresponding genotyping oligonucleotide. The amplicon in the specific region or the recessed portion can be different from the amplicon in each of other regions or the recessed portion, and therefore each monoclonal colony of the amplicon can represent the unique target locus for genotyping.

[0020] The genotyping oligonucleotides disclosed herein can be used for genotyping on non-patterned flow cells or patterned flow cells, and do not involve additional fixed components, such as solid phase beads. In addition, the genotyping oligonucleotides disclosed herein can be suitable for use with any flow cell surface that utilizes clonal amplification of clusters.

[0021] Also disclosed herein are methods for preparing target genotyping loci that can be used with genotyping oligonucleotides.These methods are amplification methods that generate genomic DNA (gDNA) fragments without having to introduce cleavage sites and perform fragmentation.

[0022] definition

[0023] Unless otherwise indicated, the terms used herein should be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0024] As used herein, the singular forms "a", "an", and "the" include both the singular and the plural, unless the context clearly dictates otherwise. As used herein, the term "comprising" is synonymous with "including", "containing", or "characterized by", and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0025] The references to "one example", "another example", "example", etc. throughout this specification mean that the specific elements (e.g., features, structures, compositions, configurations, and / or characteristics) described in conjunction with the example are included in at least one example described herein and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0026] The terms "substantially" and "approximately" used throughout this disclosure (including claims) are used to describe and illustrate small fluctuations, such as those caused by changes in processing. For example, these terms can refer to less than or equal to ±10% of a specified value, such as less than or equal to ±5% of a specified value, such as less than or equal to ±2% of a specified value, such as less than or equal to ±1% of a specified value, such as less than or equal to ±0.5% of a specified value, such as less than or equal to ±0.2% of a specified value, such as less than or equal to ±0.1% of a specified value, such as less than or equal to ±0.05% of a specified value.

[0027] In addition, it should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if they were explicitly listed. For example, a range expressed by about 2 mm to about 300 mm should be interpreted as including not only the explicitly listed limit values ​​of about 2 mm to about 300 mm, but also single values ​​such as about 15 mm, 22.5 mm, 245 mm, etc., and sub-ranges such as about 20 mm to about 225 mm, etc.

[0028] Attachment: refers to the state in which two things are directly or indirectly joined, fastened, adhered, connected or combined with each other. For example, nucleic acids can be attached to functionalized polymers by covalent bonds or non-covalent bonds. Covalent bonds are characterized by sharing electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing electron pairs, and may include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions. When two things are directly attached, there are no intermediate components. For example, in some examples of genotyping oligonucleotides, the first capture primer and the probe sequence are directly covalently bonded to each other. When two things are indirectly attached, there are some intermediate components. For example, in some examples of genotyping oligonucleotides, the first capture primer and the probe sequence are indirectly bound to each other through the index sequence portion and the priming site portion.

[0029] Deposition: Any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0030] Recess: refers to a discrete concave feature in a substrate or patterned resin having a surface opening at least partially surrounded by a gap region of the substrate or patterned resin. The recess may have any of a variety of shapes at the opening in its surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. The cross-section of the recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc. For example, a recess may be a hole or two interconnected holes. The recess may also have more complex structures, such as ridges, step features, etc.

[0031] Each: When used in reference to a collection of items, each identifies a single item in the collection but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0032] Flow cell: A container having a chamber (e.g., a flow channel) in which a reaction can be performed, an inlet for delivering reagents to the chamber, and an outlet for removing reagents from the chamber. In some examples, the chamber enables detection of reactions occurring in the chamber. For example, the chamber may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc.

[0033] Genomic DNA (gDNA): One or more chromosomal polymerized deoxyribonucleotide molecules that naturally exist in the nucleus of a eukaryotic cell or in a prokaryotic organism, virus, mitochondria, or chloroplast, and contain sequences that are naturally transcribed into RNA by the cell and sequences that are not naturally transcribed into RNA. The gDNA of a eukaryotic cell contains at least one centromere, two telomeres, a replication origin, and a sequence that is not transcribed into RNA by a eukaryotic cell, including, for example, introns or transcriptional promoters. The gDNA of a prokaryotic cell contains at least one replication origin and a sequence that is not transcribed into RNA by a prokaryotic cell, including, for example, a transcriptional promoter. Eukaryotic genomic DNA can be distinguished from prokaryotic, viral, or organellar genomic DNA, for example, based on the presence of introns in eukaryotic genomic DNA and the absence of introns in other gDNAs.

[0034] Genotyping oligonucleotide: A single-stranded deoxyribonucleic acid sequence that includes specific nucleotide sequence segments, one of which is a probe sequence that represents a target locus for genotyping. Genotyping oligonucleotides can be used as templates for cluster generation.

[0035] Index sequence portion: In some examples of genotyping oligonucleotides, a short stretch of the identifying probe sequence ranging from 10 to 30 nucleobases.

[0036] Locus or Loci: sequence-specific position in a nucleic acid sample. The term can include a predetermined or predicted nucleic acid sequence that is expected to be present in an isolated nucleic acid molecule. These predetermined or predicted nucleic acid sequences can be referred to as "target genotyping loci" herein, and they can be regions of interest for analysis. The term is intended to encompass single nucleotide polymorphisms (SNPs), mutations, variable number of tandem repeats (VNTRs) and single tandem repeats (STRs), other polymorphisms, insertions, deletions, splice variants, or any other known genetic markers.

[0037] Nucleic acid: An oligomeric or polymeric form of nucleotides of any length and may include deoxyribonucleotides, their analogs, or mixtures thereof. The term may refer to a single- or double-stranded oligonucleotide or polynucleotide.

[0038] Nucleotide: a nitrogenous heterocyclic base (nucleobase), a sugar and one or more phosphate groups. Nucleotide is the monomeric unit of a nucleic acid sequence. In ribonucleotides (RNA), the sugar is ribose, and in deoxyribonucleotides (DNA), the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group present at the 2' position in the ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) may be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Naturally occurring nucleotides typically have a backbone containing a phosphodiester bond. Nucleic acid analogs may have any of an altered phosphate backbone, sugar or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs such as peptide nucleic acids (PNAs).

[0039] Nucleotide sequence segment: A portion of a genotyping oligonucleotide. Each portion of a genotyping oligonucleotide can be designed such that it participates in a specific method among the methods disclosed herein.

[0040] Primer: A single-stranded deoxyribonucleic acid sequence that can hybridize with a specific sequence. An example of a primer is a "capture primer". The capture primer can be present in the recessed portion of the circulation pool and can hybridize with the primer sequence of the genotyping oligonucleotide or its amplicon. The capture primer can be used as a starting point for amplification and cluster generation. Another example of a primer is a "sequencing primer". The sequencing primer can hybridize with a portion of the single-stranded probe template to initiate the synthesis of at least a portion of the single-stranded probe template. Other primers, such as random primers, can be used in random primer amplification reactions to generate gDNA fragments (such as target genotyping loci). Any primer can include any combination of nucleotides or their analogs. The primer length can be any number of base lengths and can include a variety of non-natural nucleotides. In one example, the capture primer or sequencing primer is a short chain ranging from 10 to 60 nucleobases, or 20 to 40 nucleobases.

[0041] Priming sequence portion: A priming site for sequencing an index sequence portion, both of which are included in some examples of genotyping oligonucleotides.

[0042] Probe sequence: A specific segment of a genotyping oligonucleotide that includes a nucleotide sequence representing a target locus for genotyping. The probe sequence or its amplicon includes 25 to 50 nucleobases with a specific order that is complementary to the target locus sequence and can therefore hybridize to the target locus sequence.

[0043] ssProbe Template: A single-stranded DNA sequence generated during clustering. The genotyping oligonucleotide is used as a template for cluster generation, and thus the ssProbe Template is an amplicon, or a portion of an amplicon, of the genotyping oligonucleotide.

[0044] Genotyping Oligonucleotides

[0045] Figure 1A and Figure 1B Two different examples of genotyping oligonucleotides 10, 10' are schematically depicted. Each genotyping oligonucleotide 10, 10' comprises a specific nucleotide sequence segment including a first primer sequence 12, a probe sequence 14, a restriction endonuclease site 16 or 16' and a second primer sequence 18 or 18'.

[0046] Figure 1A The exemplary genotyping oligonucleotide 10 shown in comprises a first primer sequence 12 directly and covalently attached to a probe sequence 14, which is directly and covalently attached to a restriction endonuclease site 16, which is directly and covalently attached to a second primer sequence 18. 3A to 3H Examples of methods involving these genotyping oligonucleotides 10 are shown and described.

[0047] The first primer sequence 12 of the genotyping oligonucleotide 10 may have a sequence similar to that present in the flow cell 20 (see Figure 2A and Figure 2B ) on the surface of the first capture primer 22 (see Figure 2B ) the same polarity and the same sequence. Thus, the number, order and type of nucleobases in at least a portion of the first primer sequence 12 depends on the number, order and type of nucleobases in the first capture primer 22. During clustering, an amplicon of the genotyping oligonucleotide 10 is generated that includes a sequence complementary to the first primer sequence 12 (e.g., P5'). This complementary portion (in Figure 3B Displayed as C 12 ) can hybridize with the first capture primer 22.

[0048] In one example, the first capture primer 22 has a universal sequence for capture and / or amplification purposes. An example of the first capture primer 22 includes a P5 primer, an example of which is used on the surface of a commercially available flow cell for sequencing sold by Illumina Inc., for example, in the HiSeq TM 、HiSeqX TM 、MiSeq TM 、MiSeqDX TM 、MiNISeq TM 、NextSeq TM 、NextSeqDX TM 、NovaSeq TM 、iSEQ TM 、Genome Analyzer TM and other instrument platforms. In another example, the first capture primer 22 includes the following:

[0049] First capture primer: 5'→3'

[0050] AATGATACGGCGACCACCGA(SEQ.ID.NO.1)

[0051] The first primer sequence 12 can have the same sequence as the first capture primer 22. Although examples have been provided, it should be understood that other sequences can be used for the first primer sequence 12 and the first capture primer 22. The first primer sequence 12 can also be at least partially identical to the first capture primer 22. "At least partially identical" means that a sufficient number of nucleobases in the first primer sequence 12 and the first capture primer 22 are the same so that hybridization can occur between the two 12, 22. The first primer sequence 12 of the genotyping oligonucleotide 10 is directly attached to the probe sequence 14. The probe sequence 14 represents the target genotyping locus. Therefore, the probe sequence 14 is able to hybridize with the target locus sequence during genotyping.

[0052] The restriction endonuclease site 16 of the genotyping oligonucleotide 10 is directly attached to the probe sequence 14. This restriction endonuclease site 16 provides the genotyping oligonucleotide 10 with a digestion site. In one example, the restriction endonuclease site 16 is sensitive to a restriction enzyme selected from the group consisting of: a 4-base cutter restriction endonuclease, a 5-base cutter restriction endonuclease, and a 6-base cutter restriction endonuclease. Some exemplary 4-base cutters include DpnII, FatI, MluCI, BfuCI, MboI, Sau3AI, Bfal, BstUI, PmII, Kasl, and other commercially available, for example, purchased from New England BioLabs Inc., ThermoFisher Scientific, etc. Some exemplary 5-base cutters include BssKI, StyD41, MaeIII, PspGI, Ddel, Fmul, PspGI, Tfil, and others commercially available, e.g., from New England BioLabs Inc., ThermoFisher Scientific, etc. Some exemplary 6-base cutters include AcII, Afel, Nspl, HaeII, Tatl, and others commercially available, e.g., from New England BioLabs Inc., ThermoFisher Scientific, etc. The restriction endonuclease site 16 is positioned so that after cleavage / digestion with the restriction endonuclease, the last base of the probe sequence 14 is the last 3'OH, which is exposed for sequencing / genotyping reactions.

[0053] The second primer sequence 18 of the genotyping oligonucleotide 10 is coupled to the second capture primer 24 present on the surface of the flow cell 20 (see Figure 2B ) are at least partially complementary. "At least partially complementary" means that a sufficient number of nucleobases in the second primer sequence 18 and the second capture primer 24 are complementary so that hybridization can occur between the two 18, 24. Therefore, the number, order and type of nucleobases in the second primer sequence 18 depends on the number, order and type of nucleobases in the second capture primer 24.

[0054] In one example, the second capture primer 24 has a universal sequence for capture and / or amplification purposes. Examples of the second capture primer 24 include a P7 primer, which is used for sequencing on the surface of a commercial flow cell sold by Illumina Inc., e.g., in a HiSeq TM 、HiSeqX TM 、MiSeqTM 、MiSeqDX TM 、MiNISeq TM 、NextSeq TM 、NextSeqDX TM 、NovaSeq TM 、iSEQTM、Genome Analyzer TM and other instrument platforms. In another example, the second capture primer 24 includes the following:

[0055] Second capture primer: 5'→3'

[0056] CAAGCAGAAGACGGCATACGA(SEQ.ID.NO.2)

[0057] The second primer sequence 18 is at least partially complementary to the sequence of the second capture primer 24. In this example, the second primer sequence 18 may include the following:

[0058] Second primer sequence: 5'→3'

[0059] GTTCGTCTCTGCCGTATGCT(SEQ.ID.NO.3)

[0060] Although examples have been provided, it should be understood that other sequences may be used for the second primer sequence 18 and the second capture primer 24 .

[0061] The second capture primer 24 on the flow cell 20 also includes a cleavage site (see Figure 3A The cleavage site can be used to linearize the bridge probe template after cluster formation (refer to Figure 3EDescribed in more detail). The chemical substance of the cleavage site of the second capture primer 24 can be different from the chemical substance of the restriction endonuclease site 16 of the genotyping nucleotide 10, so that the premature digestion of the restriction endonuclease site 16 does not occur. The cleavage site and the restriction endonuclease site 16 have separate and specific cleavage reactions. These reactions can be considered to be orthogonal because one reaction does not trigger, affect or otherwise interfere with other reactions. Examples of suitable cleavage sites for the second capture primer 24 include enzyme-cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases or linkers (e.g., attached between nucleobases). Enzyme-cleavable nucleobases can be easily cleaved by utilizing a glycosylase and an endonuclease or utilizing an exonuclease reaction. A specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted by a USER enzyme. In one example, a uracil base can be incorporated at the 7th base at the 3' end of the second capture primer 24. Other abasic sites can also be used. Examples of chemically cleavable nucleobases, modified nucleobases or linkers include 8-oxoguanine, vicinal diols, disulfides, silanes, azobenzenes, photocleavable groups, allyl T (a thymine nucleotide analog with an allyl functional group), allyl ethers or azido functional ethers.

[0062] Reference now Figure 1B , schematically depicts another example of a genotyping oligonucleotide 10'. Figure 1B The exemplary genotyping oligonucleotide 10′ shown in FIG. Figure 1A The genotyping oligonucleotide 10 shown in has more nucleotide sequence segments. Specifically, the genotyping oligonucleotide 10' also includes an index sequence portion 26 and a priming site portion 28. In this example, the genotyping oligonucleotide 10' includes a first primer sequence 12 directly and covalently attached to the index sequence portion 26, the index sequence portion 26 is directly and covalently attached to the priming site portion 28, the priming site portion 28 is directly and covalently attached to the probe sequence 14, and the probe sequence 14 is attached to the second primer sequence 18'. In this example, the restriction endonuclease site 16' can be positioned between the probe sequence 14 and the second primer sequence 18', or can be integrated into the second primer sequence 18'. Reference FIG. 4A to FIG. 4H Examples of methods involving these genotyping oligonucleotides 10' are shown and described.

[0063] The first primer sequence 12 of the genotyping oligonucleotide 10' can be any of the examples for the genotyping oligonucleotide 10 set forth herein.

[0064] The first primer sequence 12 of the genotyping oligonucleotide 10' is directly attached to the index sequence portion 26. The index sequence portion 26 is unique to the probe sequence 14 in the genotyping oligonucleotide 10'. Thus, the index sequence portion 26 provides an identifier or unique barcode that can be used to identify the target locus sequence represented by the probe sequence 14.

[0065] The index sequence portion 26 is directly attached to the priming site portion 28. The priming site portion 28 can hybridize to a sequencing primer that primes the incorporation of nucleotides along the index sequence portion 26 one nucleobase at a time in a template-dependent manner.

[0066] The priming site portion 28 of the genotyping oligonucleotide 10' is directly attached to the probe sequence 14. As described herein, the probe sequence 14 is capable of hybridizing to a target locus sequence during genotyping.

[0067] In genotyping oligonucleotide 10 ', probe sequence 14 is attached to second primer sequence 18 '. In some examples, probe sequence 14 is indirectly attached to second primer sequence 18 ', and restriction endonuclease site 16 ' is located between two sections 14, 18 '. In other examples, probe sequence 14 is directly attached to second primer sequence 18 ', and restriction endonuclease site 16 ' is integrated into second primer sequence 18 '. In any one of these examples, restriction endonuclease site 16 ' can be sensitive to IIS type restriction enzymes. IIS type restriction enzymes can be methyl sensitive or may not be methyl sensitive. IIS type restriction enzymes are specific enzyme groups that recognize asymmetric DNA sequences (e.g., restriction endonuclease site 16 ') and crack with a limited distance (e.g., 1 nucleotide to about 20 nucleotides) outside the recognition sequence. Some examples of IIS type restriction enzymes that are not methyl sensitive are selected from the group consisting of: BbvI (BseXI), BmrI, Bvel (BspMI) etc. Some IIS restriction enzymes that are methyl-sensitive are selected from the group consisting of SfaNI, FoKI, HGAI, etc. Although some examples have been provided, any suitable IIS type restriction enzyme can be used depending on the recognition sequence of the restriction endonuclease site 16'. Methyl and non-methyl sensitive enzymes are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc.

[0068] When restriction endonuclease site 16 'is attached to the end of second primer sequence 18 ', any example of second primer sequence 18 can be used. When restriction endonuclease site 16 'is integrated into second primer sequence 18 ', restriction endonuclease site 16 'can be introduced at any desired position along the length of second primer sequence 18 '. Position can depend on the second restriction endonuclease site along the position of second capture primer 24 ', the cleavage distance of the limit of IIS type restriction enzyme to be used and the desired cleavage place along genotyping oligonucleotide 10 '(or its amplicon). This cleavage occurs before genotyping reaction (during linearization as further discussed herein), and makes genotyping oligonucleotide 10 'or its amplicon ready for analyzing target genotyping locus at interested core base. As an example, during genotyping reaction, single-stranded DNA sample (for example, target genotyping locus) hybridizes, for example, hybridizes with amplicon, and performs single synthesis sequencing reaction to identify interested core base. For this analysis to occur, the amplicon should be cleaved at a defined position where the next nucleobase to be sequenced is complementary to the nucleobase of interest. Thus, the restriction endonuclease site 16' is positioned such that after cleavage / digestion with a restriction enzyme, the last base of the probe sequence 14 is the final 3'OH exposed for sequencing / genotyping reactions. In one example, the restriction endonuclease site 16' can be integrated anywhere from the 7th base position to the 15th base position at the 3' end of the second primer sequence 18'.

[0069] Using the genotyping oligonucleotide 10', the second primer sequence 18' is coupled to the second capture primer 24' present on the surface of the flow cell 20 (see Figure 2B ). Therefore, the genotyping oligonucleotide 10′ can hybridize with the second capture primer 24′ on the flow cell 20.

[0070] The second capture primer 24' may also include a second restriction endonuclease site (see Figure 4A The second restriction endonuclease site is complementary to the restriction endonuclease site 16' of the genotyping oligonucleotide 10'. The asymmetric sequence may be sensitive to a type IIS restriction endonuclease. During linearization, cleavage within some predetermined distance of the hybridized restriction endonuclease sites 16', 46' is performed (as mentioned above and with reference to Figure 4F Further described). This removes the strand that is not genotyped. The location of the second restriction endonuclease site 46' can be located at the end of the second capture primer 24' or integrated into the second capture primer 24', as long as the two restriction endonuclease sites 16', 46' can hybridize and form a recognition site for a type IIS restriction endonuclease.

[0071] Any of the examples of genotyping oligonucleotides 10, 10' can be prepared using oligonucleotide synthesis methods.

[0072] Flow cell

[0073] The genotyping oligonucleotides 10, 10' can be used with any patterned flow cell 20. Although not shown, it should be understood that other non-patterned flow cells (e.g., not containing recesses) utilizing the clustering chemistry disclosed herein can alternatively be used in the examples disclosed herein. Using a non-patterned flow cell, software can be used to identify clusters.

[0074] Figure 2A An example of a patterned flow cell 20 is depicted in Figure 2B An example of a patterned architecture within a flow cell 20 is shown in FIG. The flow cell 20 includes a substrate 30 that at least partially defines a lane or flow channel 32.

[0075] Substrate 30 may be a single layer / single material. Examples of suitable single layer substrates include epoxysilicone, glass, modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours), polytetrafluoroethylene (such as polytetrafluoroethylene ... ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxide, silicon dioxide, fused silicon dioxide or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si 3 N 4 ), silicon oxide (SiO 2 ), Tantalum pentoxide (Ta 2 O 5 ) or other tantalum oxides (TaO x ), hafnium oxide (HfO 2 ), carbon, metal, inorganic glass, etc.

[0076] When the substrate 30 is a single layer, the recessed portion 38 (see Figure 2B ) is limited to a single layer.

[0077] like Figure 2B As shown, substrate 30 may also be a multilayer substrate 30'. Some examples of multilayer substrate 30' include glass or silicon with a coating of tantalum oxide or another ceramic oxide at the surface. Other examples of multilayer substrate 30' may include a silicon-on-insulator (SOI) substrate. Figure 2BIn the example shown, multilayer substrate 30 ′ includes an underlying support 34 (eg, glass or silicon) and a patterned material 36 positioned on support 34 .

[0078] The patterned material 36 defines recessed portions 38 separated by gap regions 40. The recessed portions 38 are located within each of the flow channels 32.

[0079] It should be understood that any material that can be selectively deposited or can be deposited and patterned to form recessed portions 38 and interstitial regions 40 can be used as patterned material 36 .

[0080] For example, the inorganic oxide may be selectively applied to the support 34 via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta 2 O 5 ), aluminum oxide (such as Al 2 O 3 ), silicon oxide (such as SiO 2 ), hafnium oxide (such as HfO 2 )wait.

[0081] As another example, the resin may be applied to the support 34 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, bubble coating, spin coating, spray coating, whipping dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), imprinting techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins (e.g., from Hybrid Plastics). ), epoxy resins not based on polyhedral oligomeric silsesquioxanes, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxides), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., ) and their combinations.

[0082] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a 2 ) and silicone (R 2 SiO) hybrid intermediates (such as RSiO 1.5 ). Examples of polyhedral oligomeric silsesquioxanes may be as described by Kehagias et al. in Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition is a composition having the formula [RSiO 3 / 2 ]n The organosilicon compound of the present invention can be the same or different in which the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxane include epoxy, azide / azide, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or other groups such as alkyl, aryl, alkoxy and / or haloalkyl. The resin composition disclosed herein can include one or more different cage or core structures as monomer units.

[0083] In one example, substrate 30, 30' can use circular wafers with a diameter in the range of about 2mm to about 300mm, or be a rectangular sheet or panel with a maximum size of up to about 10 feet (about 3 meters). In one example, substrate 30, 30' uses a circular wafer with a diameter range of about 200mm to about 300mm to make. In another example, a panel that is a rectangular support can be used, which has a larger surface area than a 300mm circular wafer. Wafers, panels and other large substrate materials can be cut into separate circulation cell substrates 30, 30'. For example, substrate 30, 30' is a grain with a width in the range of about 0.1mm to about 10mm. Although exemplary dimensions have been provided, it should be understood that substrates 30, 30' can be made using substrate materials with any suitable size.

[0084] The flow cell 20 also includes a flow channel 32. Figure 2A Several flow channels 32 are shown, but it should be understood that any number of channels 32 (e.g., a single channel 32, four channels 32, etc.) may be included in the flow cell 20. Each flow channel 32 is an area defined between two bonding components (e.g., between a substrate 30, 30' and a cover or between two substrates 30, 30') that may have fluid introduced therein and removed therefrom. Each flow channel 32 may be separated from each other flow channel 32 so that fluid introduced into any particular flow channel 32 does not flow into any adjacent flow channel 32. Some examples of fluids introduced into a flow channel 32 may introduce reaction components (e.g., target genotyping locus library fragments, polymerase, etc.), wash solutions, etc.

[0085] As mentioned, flow channels 32 are defined between the substrate 30, 30' and a cover (not shown) or between the substrate 30, 30' and another substrate (not shown, but similar to the substrate 30, 30').

[0086] In one example, the cover or additional substrate may be bonded to at least a portion of the substrate 30, 30', for example, at some of the gap regions 40. The bond formed between the cover or additional substrate and the substrate 30, 30' may be a chemical bond or a mechanical bond (e.g., using fasteners, etc.).

[0087] The cover can be any material that is transparent to the excitation light directed to the substrate 30, 30'. For example, the cover can be glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable plastic materials (ie, cycloolefin polymers) are available from Zeon Chemicals LP. product.

[0088] The cover or additional substrate may be bonded to the substrate 30, 30' using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art. In one example, a spacer layer may be used to bond the cover or additional substrate to the substrate 30, 30'. The spacer layer may be any material that seals at least some of the substrate 30, 30' and the cover or additional substrate together. In some examples, the spacer layer may be a radiation absorbing material that facilitates bonding.

[0089] In one example, the flow channel 32 has a rectangular configuration. The length and width of the flow channel 32 may be smaller than the length and width of the substrate 30, 30', respectively, so that the portion of the substrate surface surrounding the flow channel 32 can be used to attach to a cover (not shown) or another substrate 30, 30'. In some cases, the width of each flow channel 32 can be at least about 1mm, at least about 2.5mm, at least about 5mm, at least about 7mm, at least about 10mm or more. In some cases, the length of each channel / flow channel 32 can be at least about 10mm, at least about 25mm, at least about 50mm, at least about 100mm or more. The width and / or length of each flow channel 32 may be greater than, less than, or between the values ​​specified above. In another example, the flow channel 32 is a square (e.g., 10mm×10mm).

[0090] For example, when micro-contact, aerosol or inkjet printing is used to deposit the spacer defining the flow channel wall, the depth of each flow channel 32 can be as small as a single layer thick. For example, when the flow channel 32 is partially defined in the substrate 30, 30' (e.g., by etching, photolithography, etc.), the depth of the flow channel 32 can be larger, so that a portion of the substrate and the spacer define the flow channel wall. For other examples, the depth of each flow channel 32 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm or more. In one example, the depth may be in the range of about 10 μm to about 100 μm. In another example, the depth may be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of each flow channel 32 may be greater than, less than, or between the values ​​specified above.

[0091] Now specific reference Figure 2B , depicting an example of an architecture within one of the flow channels 32 of the flow cell 20 .

[0092] like Figure 2B As shown, the patterned material 36 includes recessed portions 38 defined therein and gap regions 40 separating adjacent recessed portions 38. Many different layouts of recessed portions 38 can be envisioned, including regular, repeated and irregular patterns. In one example, the recessed portions 38 are arranged in a hexagonal grid so as to be closely packed and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format of recessed portions 38 in the form of rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recessed portions 38 and / or gap regions 40. In other examples, the layout or pattern may be a random arrangement of recessed portions 38 and / or gap regions 40. The pattern may include strips, swirls, lines, triangles, rectangles, circles, arcs, checkered patterns, diagonal lines, arrows, squares and / or cross hatches.

[0093] The layout or pattern of the recesses 38 can be characterized with respect to the density (number of recesses 38) of the recesses 38 in a defined area. For example, the recesses 38 can be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 0.1 million / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2Or a greater or lesser density. It should also be understood that the density of the recesses 38 in the patterned material 36 can be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. For example, a high-density array can be characterized as having recesses 38 spaced less than about 100 nm, a medium-density array can be characterized as having recesses 38 spaced from about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 38 spaced greater than about 1 μm. Although exemplary densities have been provided, it should be understood that any suitable density can be used. The density of the recesses 38 can depend in part on the depth of the recesses 38. In some cases, it may be desirable that the spacing between the recesses 38 is even greater than the examples listed herein.

[0094] The layout or pattern of the recessed portion 38 may also be characterized according to or alternatively according to the average pitch or spacing (center-to-center spacing) from the center of the recessed portion 38 to the center of the adjacent recessed portion 38 or the average pitch or spacing (edge-to-edge spacing) from the left edge of one recessed portion 38 to the right edge of the adjacent recessed portion 38. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch of a particular pattern of the recessed portion 38 may be between one of the lower limit values ​​and one of the upper limit values ​​selected from the above range. In one example, the recessed portion 38 has a pitch (center-to-center spacing) of about 1.5 μm. Although exemplary average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0095] The size of each recess 38 may be characterized by its volume, open area, depth, and / or diameter.

[0096] Each recess 38 can have any volume capable of confining a fluid. The minimum or maximum volume can be selected, for example, to accommodate the desired throughput (e.g., multiplexing), resolution, nucleotide or analyte reactivity for downstream use of the flow cell 20. For example, the volume can be at least about 1×10 -3 μm 3 , at least about 1×10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively or in addition, the volume may be at most about 1×10 4 μm 3 , at most about 1×10 3 μm3 , up to about 100μm 3 , up to about 10μm 3 , up to about 1μm 3 , up to about 0.1μm 3 or smaller.

[0097] The area occupied by each recess opening can be selected based on criteria similar to those described above for volume. For example, the area of ​​each recess opening can be at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or in addition, the area may be at most about 1×10 3 μm 2 , up to about 100μm 2 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , at most about 1×10 -2 μm 2 The area occupied by each recess opening may be greater than, less than, or in between the values ​​specified above.

[0098] The depth of each recess 38 can be large enough to accommodate some of the polymer hydrogel 42. In one example, the depth can be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the depth can be at most about 1×10 3 um, at most about 100 μm, at most about 10 μm or less. In some examples, the depth is about 0.4 μm. The depth of each recess 38 can be greater than, less than, or between the values ​​specified above.

[0099] In some cases, the diameter or length and width of each recess 38 can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the diameter or length and width can be at most about 1×10 3In some examples, the diameter or length and width is about 0.4 μm. The diameter or length and width of each recess 38 can be greater than, less than, or between the values ​​specified above.

[0100] exist Figure 2B In the example shown, a polymer hydrogel 42 is positioned within each of the recesses 38. Examples of polymer hydrogels 42 include acrylamide copolymers, such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide)—PAZAM. Some other forms of PAZAM and acrylamide copolymers are represented by the following structure (I):

[0101]

[0102] in:

[0103] R A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;

[0104] R B is H or optionally substituted alkyl;

[0105] R C , R D and R E are each independently selected from H and optionally substituted alkyl;

[0106] -(CH 2 ) p - each of which may be optionally substituted;

[0107] p is an integer ranging from 1 to 50;

[0108] n is an integer in the range of 1 to 50,000; and

[0109] m is an integer in the range of 1 to 100,000.

[0110] One of ordinary skill in the art will recognize that the arrangement of recurring "n" and "m" features in structure (I) is representative and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0111] Other forms of acrylamide copolymers and PAZAM may have a molecular weight in the range of about 5 kDa to about 1500 kDa, or about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0112] In some examples, PAZAM and other forms of acrylamide copolymers are linear polymers. In some other examples, PAZAM and other forms of acrylamide copolymers are lightly cross-linked polymers.

[0113] In other examples, the polymer hydrogel 42 can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Replace, where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group (rather than H, as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0114] As another example of a polymer hydrogel 42, the recurring "n" features in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):

[0115]

[0116] Where R 1 is H or C1-C6 alkyl; R 2is H or C1-C6 alkyl; L is a linker comprising a straight chain having 2 to 20 atoms selected from carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0117] As another example, polymer hydrogel 42 may include recurring units of each of structures (III) and (IV):

[0118]

[0119] Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b Each of L is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-C14 aralkyl; and each L 1 and L 2 are independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0120] It should be understood that other molecules can be used to form the polymer hydrogel 42, as long as they are functionalized to capture primers 22, 24 or 22, 24' grafted thereto. Other examples of suitable polymer layers include those with colloidal structures, such as agarose; or those with polymer mesh structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA) or azidated versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form a [2+2] photocycloaddition reaction. Other examples of suitable polymer hydrogels 42 include mixed copolymers of acrylamide and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylates, etc.) can be used in the examples disclosed herein, such as branched polymers, including star polymers, star or star block polymers, dendrimers, etc. For example, monomers (e.g., acrylamide, etc.) can be incorporated into the branches (arms) of star polymers in a random or block manner.

[0121] In order to introduce the polymer hydrogel 42 into the flow channel 32, a mixture of the polymer hydrogel 42 can be generated and then applied to the substrate 30, 30' (including the recessed portion 38). In one example, the polymer hydrogel 42 may be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture can then be applied to the substrate surface (including in the recessed portion 38) using spin coating, dipping or dip coating, spraying, a material flow under positive or negative pressure, or another suitable technique. These types of techniques blanket deposit the polymer hydrogel 42 on the substrate 30, 30' (e.g., deposited in the recessed portion 38 and deposited on the gap region 40 surrounding the recessed portion 38). Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 42 in the recessed portion 38 rather than on the gap region 40.

[0122] In some examples, the substrate surface (including the portion exposed in recess 38) can be activated and then the mixture (including polymer hydrogel 42) can be applied thereto. In one example, silane or silane derivatives (e.g., norbornene silane) can be deposited on the substrate surface using vapor deposition, spin coating, or other deposition methods. In another example, the substrate surface can be exposed to plasma ashing to produce a surfactant (e.g., -OH groups) that can attach to polymer hydrogel 42.

[0123] The applied mixture may be exposed to a curing process depending on the polymer hydrogel 42. In one example, curing may be performed at a temperature ranging from room temperature (eg, about 18°C ​​to about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days.

[0124] In some examples, polishing may then be performed to remove the polymer hydrogel 42 from the void region 40 at the perimeter of the recess 38 while leaving the polymer hydrogel 42 on the surface at least substantially intact in the recess 38 .

[0125] The flow cell 20 also includes a first capture primer and a second capture primer 22, 24 or 22, 24'. Any of the examples of capture primers 22, 24 or 22, 24' described herein may be used. The set of capture primers 22, 24 or 22, 24' selected for a particular flow cell 20 may depend in part on which genotyping oligonucleotides 10, 10' will be used therewith.

[0126] A grafting process may be performed to graft the first and second capture primers 22, 24, or 22, 24' to the polymer hydrogel 42 in the recess 38. In one example, the first and second capture primers 22, 24, or 22, 24' may be immobilized to the polymer hydrogel 42 by single-point covalent attachment at or near the 5' end of each of the first and second capture primers 22, 24, or 22, 24'. This attachment allows i) the primer sequence-specific portion of the capture primer 22, 24, or 22, 24' to anneal to its cognate primer sequence 12 or to replicate the primer sequence C; 18 , C 18' and ii) the 3' hydroxyl (OH) group is free for capture primer extension. Any suitable covalent attachment can be used to attach the first capture primer and the second capture primer 22, 24 or 22, 24' to the polymer hydrogel 42. Examples of end-capped primers that can be used include alkyne-terminated primers that can be attached to the azide portion of the polymer hydrogel 42. As mentioned, specific examples of suitable capture primers 22, 24 include P5 and P7 primers, and a specific example of a suitable capture primer 24' is P7 modified to include a second restriction endonuclease site.

[0127] In one example, grafting may involve flow-through deposition (e.g., using a temporarily bonded or permanently bonded cover or additional substrate), bubble coating, spray coating, whipped dispensing, or by another suitable method of attaching the capture primer 22, 24, or 22, 24' to the polymer hydrogel 42. Each of these exemplary techniques may utilize a primer solution or mixture that may include the capture primer 22, 24, or 22, 24'; water; a buffer; and a catalyst. With any of the grafting methods, the capture primer 22, 24, or 22, 24' reacts with the reactive groups of the polymer hydrogel 42 in the recess 38 and has no affinity for the surrounding interstitial region 40. Thus, the capture primer 22, 24, or 22, 24' is selectively grafted to the polymer hydrogel 42 in the recess 38.

[0128] Methods involving genotyping oligonucleotides

[0129] Examples of the methods disclosed herein generally include introducing a genotyping probe fluid into a circulation pool 20, the circulation pool including separate recesses 38 and first and second capture primers 22, 24 or 22, 24' in each separate recess 38, the genotyping probe fluid including a plurality of genotyping oligonucleotides 10 or 10', whereby corresponding genotyping oligonucleotides 10 or 10' react in at least some of the separate recesses 38 to produce corresponding clonal populations of amplicons from corresponding genotyping oligonucleotides 10 or 10'; linearizing the amplicons to produce probe templates; sequencing at least one probe recognition segment of the probe templates to identify each probe sequence in the probe sequences; removing at least corresponding nascent chains from the probe templates, whereby the 3'OH group at the end of the probe template is exposed; hybridizing a corresponding sample with the probe template; and performing a corresponding genotyping reaction of the sample at the exposed 3'OH group.

[0130] In an example of the method, the flow cell 20 can be introduced into a system (not shown) where it is in fluid communication with a fluid control system (eg, pumps, valves, etc.) and in optical communication with an illumination system and a detection system.

[0131] 3A to 3H An example of a method involving the genotyping oligonucleotide 10 is described together.

[0132] Figure 3A One well 38 of the flow cell 20 is depicted, comprising a polymer hydrogel 42 having attached thereto first and second capture primers 22, 24. The second capture primer 24 includes a cleavage site 46, as described herein.

[0133] exist Figure 3B In the example, a genotyping probe fluid (not shown) is introduced into the circulation pool 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and a genotyping oligonucleotide 10 in the liquid carrier. The liquid carrier of the genotyping probe fluid can be any suitable hybridization buffer, such as Tris-HCl buffer or 0.5× sodium citrate saline (SSC) buffer. In some examples, the genotyping probe fluid includes a plurality of genotyping oligonucleotides 10, wherein each genotyping oligonucleotide 10 includes a probe sequence 14 different from each other genotyping oligonucleotide 10. Using this fluid, different genotyping oligonucleotides 10 (each having a unique probe sequence 14) can be delivered to different recesses 38.

[0134] like Figure 3BAs shown, one genotyping oligonucleotide 10 is seeded in the recess 38. More specifically, the second primer sequence 18 of one genotyping oligonucleotide 10 hybridizes with one of the second capture primers 24 in the recess 38.

[0135] When one genotyping oligonucleotide 10 is seeded, cluster generation can be initiated immediately. In other examples, separate hybridization (seeding) and cluster generation can be performed. Figure 3B , Figure 3C , Figure 3D and Figure 3E The processes involved in cluster generation are shown in .

[0136] like Figure 3B As indicated by the arrow in , the genotyping oligonucleotide 10 is replicated from the hybridization primer by 3' extension using a DNA polymerase. This generates an amplicon 44A, which is attached to the flow cell surface via the second capture primer 24. The amplicon 44A is labeled C 16 , C 14 , C 12 The segments are the restriction endonuclease site 16, the probe sequence 14 and the complementary copy of the first primer sequence 12 respectively.

[0137] The original genotyping oligonucleotide 10 is denatured, so that the amplicon 44A is fixed in the recess 38 via the second capture primer 24. The single-stranded amplicon 44A is flipped and copied, for example, by the first primer sequence C. 12 The hybridization with the adjacent complementary first capture primer 22 forms a bridge. Figure 3C As shown in Figure 3C As indicated by the arrow in FIG. , the hybridized primer (first capture primer 22) is then extended by a polymerase to form another amplicon 44B. Segment CC of amplicon 44B 16 、CC 14 It is segment C 16 , C 14 and thus have the same sequence as the original restriction endonuclease site 16 and probe sequence 14, respectively. Segment C of amplicon 44B 24 is a complementary copy of the second capture primer 24 and therefore has the same sequence as the second primer sequence 18. Figure 3C As depicted in , the formation of amplicon 44B generates a double-stranded bridge including amplicons 44A and 44B.

[0138] The double-stranded bridge is then denatured, e.g. Figure 3DAs shown. This results in two copies (amplicons 44A and 44B) covalently bonded to the circulation pool 20. Isothermal bridge amplification or some other forms of amplification can be used to amplify fixed copies. For example, the copied template loops back to hybridize with adjacent complementary capture primers 22, 24, and the polymerase replicates the copied template to form a double-stranded bridge, denaturing these double-stranded bridges to form two single strands. These two chains loop back and hybridize with adjacent complementary capture primers 22, 24, and extend again to form two new double-stranded loops. Repeat the process for each template copy by isothermal denaturation and amplification cycles to produce a dense clonal cluster of double-stranded bridges. Figure 3E A simplified cluster is shown in , including two double-stranded bridges.

[0139] It will be appreciated that the inoculation of the corresponding genotyping oligonucleotides 10 in the corresponding recesses 38 and the amplification of such genotyping oligonucleotides 10 in the corresponding recesses 38 can occur under conditions where the amplification rate exceeds the inoculation rate. Thus, the relatively rapid rate at which copies (amplicons 44A, 44B) are made in a recess 38 that has been inoculated with one genotyping oligonucleotide 10 will effectively exclude the inoculation of a second genotyping oligonucleotide 10 in that recess 38 for amplification. Thus, different genotyping oligonucleotides 10 (having unique probe sequences 14) can be captured and amplified in each recess 38, which enables simultaneous analysis of multiple different target genotyping loci on the flow cell 20.

[0140] Linearization of the bridged amplicons 44A, 44B can be performed by: cleaving the amplicon attached to the second capture primer (e.g., amplicon 44A) at the corresponding cleavage site 46 of the second capture primer 24; and denaturing the cleaved portion of the amplicon attached to the second capture primer 24 (e.g., amplicon 44A) to generate a probe template 48 ( Figure 3F ).

[0141] To initiate cleavage, a cleavage agent may be introduced into the flow cell 20, for example, via an input port (not shown). The cleavage agent selected will depend on the cleavage site 46 of the second capture primer 24. The cleavage agent may be a chemical cleavage agent or an enzymatic cleavage agent, depending on the cleavage site 46. Cleavage at the cleavage site 46 separates the amplicon 44A from the second capture primer 24 and the rest of the amplicon sequence (including segment C). 16 , C 14 , and C 12 or Segment C 16 , C 14 , and C 22 (which is a complementary copy of capture primer 22)).

[0142] Due to cleavage, segment C 16 , C 14 , and C12 and Segment C 16 , C 14 , and C 22 is no longer attached to the flow cell surface via primer 24 and can therefore be removed by denaturation. Denaturation can be performed using any suitable conditions. Removal of segment C 16 , C 14 , and C 12 and Segment C 16 , C 14 , and C 22 Amplicon 44B is attached to the flow cell surface via the first capture primer 22 and is coupled to the second capture primer 24 (via segment C). 24 ) hybridization. In this example, the exposed single-stranded portion of amplicon 44B, specifically segment CC 16 and CC 14 , forming a probe template 48. Segment CC 14 It is segment C 14 and thus has the same sequence as probe sequence 14. For this segment CC 14 Sequencing enables identification / decoding of the original probe sequence 14. In some cases, segment CC 14 A portion of can be sequenced to identify or decode the original probe sequence. 16 It is segment C 16 and thus have the same sequence as restriction enzyme site 16. When sequencing, including CC 16 and N 16 The double-stranded segment ( Figure 3G ) provides a substrate for restriction enzyme cleavage.

[0143] After cleavage and denaturation, each second capture primer 24 may have a 3' phosphate at its end, which should be removed before additional processing. The 3' phosphate can be removed by introducing a kinase that deprotects the second capture primer 24, making it suitable for use as a sequencing primer (see reference). Figure 3G described).

[0144] Figure 3G Description of the sequencing of probe template 48, including segment CC 16 and CC 14 , the latter being at least one probe recognition segment.

[0145] In the example shown, sequencing the probe template 48 involves using the second capture primer 24 as a sequencing primer and performing a base extension reaction along the probe template 48 (one base at a time).

[0146] In another example, segment C may be 24The second capture primer 24 is denatured and a separate sequencing primer can be added (ie, in solution). The separate sequencing primer can be coupled to segment C. 24 Hybridization and base extension reactions will be performed along the probe template 48 (one base at a time).

[0147] The underlying chemical process for sequencing can be polymerization (e.g., catalyzed by a polymerase). In a specific polymerase-based process, fluorescently labeled nucleotides are added to the second capture primer 24 in a template-dependent manner, so that the order and type of nucleotides added to the second capture primer 24 can be detected. This enables the determination of the probe recognition segment, for example, segment CC 14 sequence, which can be used to decode the original probe sequence14.

[0148] To initiate the first sequencing cycle, one or more labeled nucleotides, a DNA polymerase, etc. may be delivered into / through the flow cell 20, etc., where sequencing primer extension causes the labeled nucleotides to be incorporated into the probe template 48. This incorporation may be detected by an imaging event. During the imaging event, an illumination system may provide excitation light to the flow cell 20.

[0149] In some examples, the fluorescently labeled nucleotides may also include a reversible termination property that terminates further primer extension once the nucleotides are added to the template 48. For example, a nucleotide analog having a reversible terminator portion may be added to the template 48 such that subsequent extension does not occur until a deblocking agent is delivered to remove the portion. Thus, for examples using reversible termination, a deblocking agent may be delivered to the flow cell 20, etc. (after detection occurs).

[0150] Washing may occur between the various fluid delivery steps. The sequencing cycle may then be repeated n times to extend the template 48 by n nucleotides to generate a sequence comprising a nascent segment N. 16 (It is related to segment CC 16 complementary) and the new segment N 14 (It is related to segment CC 14 complementary) new chain.

[0151] For section CC 14 Sequencing provides new chain segment N 14 , which can be used to decode the original probe sequence 14 of the genotyping oligonucleotide 10. This information allows the user to identify the target genotyping locus to be analyzed in a particular recess 38 (because all templates 48 in a recess 38 have the same probe recognition segment, e.g., CC 14 ).

[0152] For section CC 16 Sequencing provides new chain segment N 16Thus, this example of sequencing also generates a CC 16 and N 16 Both double-stranded segments provide substrates for restriction enzyme cleavage.

[0153] After sequencing the probe recognition segment, the method further includes removing at least the corresponding nascent strand (which includes segment N) from the probe template 48. 14 and N 16 ), thereby exposing the 3'OH group at the end of the probe template 48. In this example, the removal involves more than removing the nascent chain N 14 and N 16 In this example, removal involves digestion of restriction endonuclease sites, e.g., segment CC 16 and N 16 ; and the remaining nascent chain from the probe template 48, including segment N 14 transsexual.

[0154] Probe template 48 includes segment CC 16 (which has the same sequence as restriction endonuclease site 16) and the nascent chain includes segment N 16 (which is complementary to restriction endonuclease site 16). This double-stranded portion (segment CC 16 and N 16 ) produces a substrate for an appropriate restriction endonuclease (restriction enzyme). Thus, by introducing a restriction endonuclease, a restriction endonuclease site, in this example, segment CC 16 and Segment N 16 , can be digested. As mentioned herein, the restriction enzyme can be a 4-base cutter restriction endonuclease, a 5-base cutter restriction endonuclease, a 6-base cutter restriction endonuclease, etc. The restriction enzyme cleaves the segment CC at a specific nucleotide. 16 、N 16 , the specific nucleotide is Figure 3G In this example, the restriction endonuclease site is digested to leave the second capture primer 24 and the segment CC 14 The first capture primer 22 attached thereto, and the segment CC 14 Hybridized nascent chain N 14 . New chain N 14 Then from the section CC 14 Denaturation. Digestion and denaturation make segment CC 16 and the new chain N 14 、N 16 It can be removed from the recess 38 and the flow cell 20, for example, by a washing step.

[0155] Digestion and denaturation expose the 3'OH at the remaining end of the probe template 48. The remaining probe template Figure 3H The remaining probe template 52 includes the first capture primer 22 and the segment CC 14 , which is identical to the original probe sequence 14 and, therefore, in this example, is complementary to the DNA sample having the target genotyping locus 54.

[0156] The sample of the denatured DNA fragments including the target genotyping locus 54 is introduced into the circulation cell 20. The target genotyping locus 54 can be included in the library fluid including multiple target genotyping loci, wherein at least some have different loci to be genotyped. Any genotyping library preparation technology can be used to prepare the target genotyping locus from a larger DNA sample. Some genotyping library preparation technologies relate to amplification and fragmentation. Others relate to amplification without fragmentation (its example is described below). Therefore, several copies of any type of target genotyping locus 54 can be present in the library fluid.

[0157] Once introduced into the flow cell 20, the target genotyping locus 54 and the corresponding complementary segment CC of the remaining probe template 52 in the recess 38 14 Hybridization.

[0158] A genotyping reaction can then be performed. In this reaction, the remaining probe template 52 is used as a sequencing primer to perform a sequencing cycle as described herein. Figure 3H As shown, a labeled nucleotide 57 complementary to the nucleobase of interest at the target genotyping locus 54 is incorporated into the remaining probe template 52.

[0159] Although the description herein relates to one recess 38 and thus genotyping one target genotyping locus 54, it should be understood that each recess 38 includes a plurality of regions CC having different 14 Different probe templates 52. Thus, using this method, hundreds to thousands to millions (depending on the number of recesses in the flow cell 20) of different loci can be genotyped simultaneously.

[0160] 4A to 4H Another example of a method involving a genotyping oligonucleotide 10' is described together.

[0161] Figure 4A One well 38 of the flow cell 20 is depicted, comprising a polymer hydrogel 42 having first and second capture primers 22, 24' attached thereto. As described herein, the second capture primer 24' includes a second restriction endonuclease site 46'.

[0162] exist Figure 4BIn the example, a genotyping probe fluid (not shown) is introduced into the circulation pool 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and a genotyping oligonucleotide 10' in the liquid carrier. The liquid carrier can be any example disclosed herein. In some examples, the genotyping probe fluid includes a plurality of genotyping oligonucleotides 10', wherein each genotyping oligonucleotide 10' includes a probe sequence 14 different from each other genotyping oligonucleotide 10'. Using this fluid, different genotyping oligonucleotides 10' (each having a unique probe sequence 14) can be delivered to different recesses 38.

[0163] like Figure 4B As shown, a genotyping oligonucleotide 10' is seeded in the recess 38. More specifically, the second primer sequence 18' and the restriction endonuclease site 16' of the genotyping oligonucleotide 10' hybridize with one of the second capture primers 24' and the restriction endonuclease site 46' in the recess 38, respectively.

[0164] When one genotyping oligonucleotide 10' is seeded, cluster generation can be initiated immediately. In other examples, separate hybridization (seeding) and cluster generation can be performed. Figure 4B , Figure 4C , Figure 4D and Figure 4E The processes involved in cluster generation are shown in .

[0165] like Figure 4B As indicated by the arrow in , the genotyping oligonucleotide 10 is replicated from the hybridization primer by 3' extension using a high fidelity DNA polymerase. This generates an amplicon 44C, which is attached to the flow cell surface by the second capture primer 24'. The amplicon 44C is labeled C 14 , C 28 , C 26 and C 12 The segments are respectively the probe sequence 14, the priming site portion 28, the index sequence portion 26 and the complementary copy of the first primer sequence 12.

[0166] The original genotyping oligonucleotide 10' is denatured, leaving the amplicon 44C fixed in the recess 38 via the second capture primer 24' and the second restriction endonuclease site 46'. The single-stranded amplicon 44C is flipped and copied, for example, by the first primer sequence C 12 The hybridization with the adjacent complementary first capture primer 22 forms a bridge. Figure 4C Shown in.

[0167] like Figure 4CAs indicated by the arrow in , the hybridized primer is then extended by a polymerase to form another amplicon 44D. Segment CC of amplicon 44D 14 、CC 26 、CC 28 It is segment C 14 , C 26 , C 28 and thus have the same sequence as the original probe sequence 14, the index sequence portion 26 and the priming site portion 28, respectively. Segment C of amplicon 44D 46' is a complementary copy of the second restriction endonuclease site 46' and therefore has the same sequence as the restriction endonuclease site 16' of the genotyping oligonucleotide 10'. Segment C of amplicon 44D 24' is a complementary copy of the second capture primer 24' and therefore has the same sequence as the second primer sequence 18'. Figure 4C As depicted in , the formation of amplicon 44D generates a double-stranded bridge including amplicons 44C and 44D covalently bonded to flow cell 20.

[0168] The double-stranded bridge is then denatured, e.g. Figure 4D As shown. This results in two copies (amplicons 44C and 44D) covalently bonded to the circulation pool 20. Isothermal bridge amplification or some other forms of amplification can be used to amplify fixed copies. For example, the copied template loops back to hybridize with adjacent complementary capture primers 22, 24', and the polymerase replicates the copied template to form a double-stranded bridge, denaturing these double-stranded bridges to form two single strands. These two chains loop back and hybridize with adjacent complementary capture primers 22, 24', and extend again to form two new double-stranded loops. Repeat this process for each template copy by isothermal denaturation and amplification cycles to produce a dense clonal cluster of double-stranded bridges. Figure 4E A simplified cluster is shown in , including two double-stranded bridges.

[0169] It will be appreciated that the inoculation of the respective genotyping oligonucleotides 10' in the respective recesses 38 and the amplification of such genotyping oligonucleotides 10' in the respective recesses 38 can occur under conditions where the amplification rate exceeds the inoculation rate. Thus, the relatively rapid rate at which copies (amplicons 44C, 44D) are made in a recess 38 that has been inoculated with one genotyping oligonucleotide 10' will effectively preclude the inoculation of a second genotyping oligonucleotide 10' in that recess 38 for amplification. Thus, a different genotyping oligonucleotide 10' (having a unique probe sequence 14) can be captured and amplified in each recess 38, which enables simultaneous analysis of multiple different target genotyping loci on the flow cell 20.

[0170] In this example, amplification can be performed using methylated dCTP (deoxycytidine triphosphate) to protect the complementary copy of restriction endonuclease site 16' and the second restriction endonuclease site 46'. 46' This modification will render amplicons 44C, 44D fully methylated and leave capture primers 22, 24' (including the second restriction endonuclease site 46') hemimethylated.

[0171] The double-stranded bridge is then linearized. Figure 4E and Figure 4F Description of Linearization. In this example method, linearization of the bridged amplicons 44C, 44D can be performed by: digesting the restriction endonuclease portion 56 of the amplicons 44C, 44D to leave the second capture primer 24' in the recess 38; and denaturing the remaining portion of the amplicons 44C, 44D to generate a single-stranded probe template 49, which includes the first capture primer 22 and at least one probe recognition segment in the recess 38. Figure 4F The results of the linearization process are shown in .

[0172] In this example, each of the second capture primers 24' also includes a second restriction endonuclease site 46', wherein the second restriction endonuclease site 46' is complementary to the restriction endonuclease site 16' of the genotyping oligonucleotide 10', and thus also binds to segment C. 46' Complementary. Figure 4E As shown, the double-stranded bridge includes hybridization segment 46', C 46' , which provides the corresponding substrate for restriction enzyme cleavage. More specifically, the hybridization segment C of the bridged amplicons 44C and 44D 46' and 46' constitute a restriction endonuclease portion 56 that can be recognized by a Type IIS restriction enzyme. In this example, digestion of the restriction endonuclease portion 56 is achieved by introducing a Type IIS restriction enzyme. Type IIS restriction enzymes may or may not be methyl-sensitive. The methylation protocol will protect the probe sequence copy C 14 , C.C. 14 The internal site and / or symmetrical cut can be protected. The IIS type restriction enzyme will recognize the asymmetric DNA sequence of portion 56 and cleave at a defined distance (e.g., 1 nucleotide to about 20 nucleotides) outside portion 56. The digestion leaves the second capture primer 24' attached to the flow cell 20 and also cleaves the amplicon 44C at the desired position for genotyping.

[0173] The remainder of the amplicons 44C, 44D can then be denatured, leaving the single-stranded probe template 49 attached to the flow cell 20. Figure 4FAs shown, the single-stranded probe template 49 includes a first capture primer 22 and at least one probe recognition segment, which in this example includes segment CC 14 and section CC 28 and CC 26 some or all of .

[0174] The method may further include blocking the second capture primers 24' prior to sequencing along at least one probe recognition segment of each of the first single-stranded probe templates 49. A blocking group (e.g., 3' phosphate) may be added that is attached to the exposed 3' end of the second capture primers 24' to prevent undesired extension at these primers 24'.

[0175] Reference now Figure 4F , depicting the sequencing of at least one probe recognition segment of a single-stranded probe template 49. In this example, at least one probe recognition segment is segment CC 26 , which is the same as the index sequencing part 26.

[0176] Sequencing at least one probe recognition segment involves introducing 28 Hybridized sequencing primer 50, segment CC 28 The same as the priming site portion 28. This sequencing primer 50 allows at least one probe recognition segment of the single-stranded probe template 49, such as CC 26 Ready for sequencing. Then along the CC 26 Perform a base extension reaction.

[0177] The underlying chemistry for sequencing can be polymeric (e.g., catalyzed by a polymerase), as described herein with reference to Figure 3G described.

[0178] To initiate the first sequencing cycle, one or more labeled nucleotides, a DNA polymerase, etc. may be delivered into / through a flow cell 20, etc., where sequencing primer extension causes incorporation of labeled nucleotides into segment CC along the single-stranded probe template 49. 26 The newly formed chain N 26 This incorporation can be detected by imaging events.

[0179] In some examples, the fluorescently labeled nucleotides may also include a reversible termination property, which allows the nucleotide to be added to the nascent chain N once it has been added. 26 Thus, for examples using reversible termination, the deblocking agent may be delivered to the flow cell 20 etc. (after detection has occurred).

[0180] Washing may occur between the various fluid delivery steps. The sequencing cycle may then be repeated n times to extend the single-stranded probe template 49n nucleotides to generate a sequence comprising the nascent segment N 26 (It is related to segment CC 26 Complementary, Segment CC 26 A nascent chain having the same sequence as the index sequencing portion 26).

[0181] For the new chain N 26 Sequencing can be used to identify the CC segment 26 , and thus identifies the original index sequence portion 26, which is for the probe sequence 14 (and its complementary copy C 14 ) is unique. This information allows the user to identify the target genotyping locus to be analyzed in a particular recess 38 (because all templates 49 in a recess 38 have the same probe recognition segment, e.g., CC 26 and probe sequence segments, such as CC 14 ).

[0182] After sequencing the probe recognition segment, the method further comprises removing at least the corresponding nascent strand (which includes segment N) from the single-stranded probe template 49. 26 ). In this example, removal involves making the sequencing primer 50 and the nascent chain N 26 transsexual.

[0183] A sample including single-stranded DNA fragments of the target genotyping locus 54 is introduced into the flow cell 20, as Figure 4H As shown. The target genotyping locus 54 can be contained in a library fluid comprising a plurality of target genotyping loci, at least some of which have different loci to be genotyped. Any genotyping library preparation technology can be used to prepare the target genotyping locus from a larger DNA sample. Some genotyping library preparation technologies involve amplification and fragmentation. Others involve amplification without fragmentation, as described below. Therefore, several copies of any type of target genotyping locus 54 can be present in the library fluid.

[0184] Once introduced into the flow cell 20, the target genotyping locus 54 and the corresponding complementary segment CC of the single-stranded probe template 49 in the recess 38 14 Hybridization.

[0185] A genotyping reaction can then be performed. In this reaction, the single-stranded probe template 49 is used as a sequencing primer to perform a sequencing cycle as described herein. Figure 4H As shown, a labeled nucleotide 57 complementary to a nucleobase of interest at a target genotyping locus 54 is incorporated into the single-stranded probe template 49.

[0186] Although the description herein relates to one recess 38 and thus genotyping one target genotyping locus 54, it should be understood that each recess 38 includes a plurality of regions CC having different 14 Different single-stranded probe templates 49. Thus, using this method, hundreds to thousands to millions (depending on the number of recesses in the flow cell 20) of different loci can be genotyped simultaneously.

[0187] In the examples disclosed herein, instead of blocking the second capture primers 24 or 24' during sequencing and / or genotyping, these primers 24 or 24' can be cleaved after the decoding reaction using a cleavage process that will not deleteriously affect the template 48 or 49 to be genotyped.

[0188] Genotyping library preparation technology

[0189] The target genotyping loci 54 can be prepared using any suitable genotyping library preparation technique.

[0190] The target genotyping locus 54 can be prepared from genomic DNA. Genomic DNA can be isolated from one or more cells, body fluids or tissues. Any suitable method can be used to obtain body fluids (e.g., blood, sweat, tears, lymph, urine, saliva, semen, cerebrospinal fluid, feces or amniotic fluid). Some specific examples include cheek swabs, mouthwashes, surgical removal, biopsy aspiration, etc. Genomic DNA can also be obtained from one or more cells or tissues in primary cultures, in propagated cell lines, fixed archived samples, forensic samples or archaeal samples.

[0191] gDNA can be prepared by lysing cells containing DNA. Cells can be lysed under conditions that substantially maintain the integrity of the cell gDNA. In a specific example, thermal lysis can be used to lyse cells. In another specific example, cells exposed to alkaline pH can be used to lyse cells while causing relatively less damage to gDNA. Any of a variety of alkaline compounds can be used for lysis, including, for example, potassium hydroxide, sodium hydroxide, etc. In addition, relatively undamaged gDNA can be obtained from cells lysed by enzymes that degrade cell walls. Cells lacking cell walls naturally or due to enzyme removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse cells include exposure to detergents, mechanical destruction, ultrasonic treatment heat, pressure differences, such as French presses or Dounce homogenization. Reagents that stabilize gDNA can be included in cell lysates or separated gDNA samples, including, for example, nuclease inhibitors, chelating agents, salts, buffers, etc.

[0192] In some examples, a crude cell lysate containing gDNA can be directly amplified without further separation of gDNA. For example, a blood sample can be exposed to thermal lysis, and then the crude cell lysate can be amplified using any suitable method (including those described herein). Alternatively, gDNA can be further separated from other cellular components before amplification. Therefore, purified or partially purified gDNA can be amplified. Genomic DNA can be separated using known methods, including, for example, liquid extraction, precipitation, solid phase extraction, chromatography, etc.

[0193] The amplified representative genomic fragment population (target genotyping locus 54) can be provided by amplifying a natural genome under conditions where a genomic DNA (gDNA) template is replicated to produce one or more copies, wherein the relative proportion of each replicated sequence is substantially the same as that in the original gDNA. Any of a variety of methods for replicating genomic DNA in a sequence-independent manner can be used to prepare the target genotyping locus 54. In the examples disclosed herein, double-stranded genomic DNA can be denatured to generate a single-stranded genomic DNA template that can be used in the amplification process.

[0194] In one specific example, the amplification method involves contacting a single-stranded genomic DNA template with a low processivity polymerase, a plurality of primers, and free nucleotides, thereby generating complementary fragments of the single-stranded genomic DNA template; and shifting the complementary fragments from the single-stranded genomic DNA template, thereby generating at least some of the corresponding samples.

[0195] Low processivity polymerases can synthesize short chains because they naturally fall off from the single-stranded genomic DNA template before the entire chain is replicated. Some examples of low processivity polymerases can synthesize less than 100 bases / polymerization events. Shorter fragments can be obtained by using a polymerase that synthesizes less than 50, 40, 30, 20, 10 or 5 bases / polymerization events under amplification conditions. Low processivity polymerases are selected from the group consisting of: T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment (fragment of Taq DNA polymerase), Klenow fragment (large fragment of E. coli DNA polymerase I), Bsu DNA polymerase, Bst DNA polymerase and engineered polymerase. In this exemplary method, the term "engineered polymerase" is any synthetic polymerase that is designed to synthesize less than 100 bases / polymerization events. Other suitable low processivity polymerases include monomeric E. coli Pol III (lacking β subunit) or E. coli Pol I.

[0196] The processivity of some polymerases can be altered by the processing conditions used. For example, the temperature of the reaction, the salts in the reaction (e.g., Mg 2+ ) level (e.g., ionic strength), pH, buffer composition (e.g., creatine kinase or cAMP (cyclic adenosine monophosphate)), or a combination thereof, changes processivity. As an example, T7 DNA polymerase has low processivity at temperatures below 37°C, and also has low processivity at high ionic strength, such as greater than about 100 mM NaCl; but has high processivity at others. As another example, Taq polymerase has high processivity at a temperature of about 70°C when reacted with a 10-fold molar excess of DNA sample and random primers. In another example, the polymerization of the Klenow fragment of Escherichia coli DNA polymerase can be slowed down by lowering the pH to below pH 6.2. In yet another example, the efficiency of BST DNA polymerase (BST pol), A family DNA pol, can be manipulated several fold by replacing metal cofactors (such as Mg++ and Cd++).

[0197] Primer can be random primer.Can synthesize random primer population to include guanine (G) and / or cytosine (C) nucleotides with higher content compared with adenine (A) and thymidine (T) nucleotide.Gained random primer population will be GC-enriched, and therefore have higher hybridization probability with high GC region (for example gene coding region of human genome, it usually has higher GC content than non-coding gDNA region) of genome.Primer in random primer population can also have region of same sequence, for example universal tail.Universal tail can include universal priming site for amplification.

[0198] In this exemplary method, the free nucleotides can include any natural nucleotides, such as deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate.

[0199] Contacting the single-stranded genomic DNA template with a low processivity polymerase, a plurality of primers and free nucleotides can involve mixing various components together, and exposing them to the amplification conditions suitable for the low processivity polymerase used. During amplification, primers are attached to the different parts of the single-stranded genomic DNA template, and the low processivity polymerase introduces complementary free nucleotides into the template strand according to the sequence of the template strand. The low processivity polymerase naturally falls off from the template strand, usually after 100 bases or less have been copied. The complementary fragments of the replication can be shifted using, for example, denaturation. The method can include repeating the contact and the shifting predetermined number of cycles to generate additional complementary fragments in each cycle in the predetermined number of cycles.

[0200] Here are some examples of this approach.

[0201] T4 DNA polymerase can be used to amplify single-stranded or denatured gDNA, for example, in about 50 mM N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES) (pH 7.5), about 50 mM Tris-HCl (pH 8.6), or about 50 mM glycine (pH 9.7). Example reaction mixtures can also include about 50 mM KCl, about 5 mM MgCl 2 About 5 mM dithiothreitol (DTT), about 40 μg / ml gDNA, about 0.2 mM of each dNTP, about 50 μg / ml bovine serum albumin (BSA), about 100 μM random primers (n=6), and about 10 units of T4 DNA polymerase were incubated at 37° C. for at least one hour. Temperature cycling can be used to shift the replication strands for multiple rounds of amplification.

[0202] Taq polymerase has low processivity at temperatures below 70°C. Therefore, small fragments of gDNA can be obtained by using Taq polymerase at low temperatures or under another condition where Taq has low processivity. In another example, Stoffel fragments that lack the N-terminal 289 amino acid residues of Taq polymerase and have low processivity at 70°C can be used to generate relatively small gDNA fragments. Taq or Stoffel fragments can be used to amplify single-stranded or denatured DNA templates, and temperature cycling can be used to shift the replicated strands for multiple rounds of amplification.

[0203] Klenow fragments can be used for isothermal amplification of the genome to generate small genomic DNA fragments, for example, in a reaction in low salt (I=0.085) and incubated at a temperature between about 5°C and 37°C. Exemplary buffers and pH conditions that can be used to amplify gDNA with Klenow fragments include, for example, about 50 mM Tris HCl (pH 7.5), about 5 mM MgCl 2 , about 50mM NaCl, about 50μg / ml bovine serum albumin (BSA), about 0.2mM of each dNTP, about 2μg of random primers (n=6), about 10ng gDNA template and about 5 units of Klenow fragment, incubated at 37°C for about 16 hours. Similar reactions can be run with one or more reaction components omitted or substituted. For example, the buffer can be replaced with about 50mM phosphate (pH 7.4), or other pH values ​​in the range of about 7.0 to 7.8 can be used. In another example, the conditions for amplification using Klenow fragment can include, for example, about 10ng gDNA template, about 2mM dNTP, about 10mM MgCl 2, about 0.5 U / μl (microliter) polymerase, about 50 uM (micromolar) random primers (n=6) and incubated isothermally at 37°C for 16 hours.

[0204] Another example of the amplification method disclosed herein involves contacting a single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides, wherein the mixture of free nucleotides includes natural nucleotides and dideoxythymidine triphosphate (ddTTP), thereby generating truncated complementary fragments of the single-stranded genomic DNA template; and shifting the truncated complementary fragments from the single-stranded genomic DNA template, thereby generating at least some of the corresponding samples.

[0205] In this example, any suitable polymerase can be used.ddTTP serves as a truncation agent, and therefore a high continuous synthesis ability polymerase can be used.In this example method, any of the polymerases described herein can be used, as long as the processing conditions can be changed so that the polymerase shows higher continuous synthesis ability (for example, more than 100 bases / polymerization events can be synthesized). In one example, the high continuous synthesis ability polymerase is selected from the group consisting of: T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase and engineered polymerase.In this example method, the term "engineered polymerase" is any synthetic polymerase, which is designed to synthesize more than 100 bases / polymerization events.High continuous synthesis ability polymerase can produce a fragment of 10kb (kilobase) to 20kb in length.Other suitable high continuous synthesis ability polymerases include Φ29 polymerase.

[0206] In this example, any of the random primers described herein can be used.

[0207] In this example method, the free nucleotides in the mixture include natural nucleotides and dideoxythymidine triphosphate (ddTTP). Dideoxythymidine triphosphate is used as a synthetic terminator nucleotide or truncation agent. In one example, natural nucleotides include deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate and deoxycytosine triphosphate. In one example, the mixture of free nucleotides includes a range of about 10:5 to about 10:0.01 deoxythymidine triphosphate (dTTP) and dideoxythymidine triphosphate (ddTTP) ratio. Ratios within this range help ensure that before dideoxythymidine triphosphate truncation amplification, the desired number of deoxythymidine triphosphates are incorporated into the generated fragments. In a specific example, the ratio of dTTP to ddTTP is about 10:1.

[0208] Contacting the single-stranded genomic DNA template with a polymerase, a plurality of primers and a free nucleotide mixture can involve mixing various components together and exposing them to amplification conditions suitable for the polymerase used. During amplification, primers are attached to different parts of the single-stranded genomic DNA template, and the polymerase introduces complementary natural nucleotides into the template strand according to the sequence of the template strand. When dideoxythymidine triphosphate (ddTTP) is introduced instead of deoxythymidine triphosphate (dTTP), the amplification of a specific strand is terminated. Therefore, ddTTP has shortened the DNA fragments of replication. The ratio of dTTP to ddTTP in the mixture helps to ensure that the fragments generated are long enough for subsequent analysis.

[0209] The replicated truncated complementary fragments can be displaced using, for example, denaturation.The method can include repeating the contacting and displacing for a predetermined number of cycles to generate additional truncated complementary fragments in each of the predetermined number of cycles.

[0210] Buffers (e.g., HEPES, Tris-HCl, glycine, etc.), salts (e.g., KCl, MgCl 2 Any of the above (eg, iodine, iodine, etc.), redox reagents (eg, dithiothreitol), and / or stabilizers (eg, bovine serum albumin (BSA)) can be used in the exemplary method in an amount suitable for high processivity.

[0211] In one specific example, T7 DNA polymerase has high processivity under the following reaction conditions: about 40 mM Tris-HCl, pH 7.5, about 15 mM MgCl 2 , about 25 mM NaCl, about 5 mM DTT, about 0.25 mM of each dNTP, about 0.00025 mM to about 0.125 mM ddTTP, 50 μg / ml single-stranded gDNA, about 100 μM random primers (n=6), about 0.5 to about 1 unit of T7 DNA polymerase, and a reaction temperature greater than 37°C.

[0212] In another specific example, Taq polymerase has high processivity at a temperature of about 70° C. when reacted with a 10-fold molar excess of a DNA sample and random primers (n=6). Amplification reactions run under these conditions may also include a buffer such as about 20 mM Tris-HCl, pH about 7, about 1 mM to 2 mM MgCl 2 , about 0.2 mM of each dNTP and about 0.0002 mM to about 0.1 mM of ddTTP. In addition, stabilizers such as glycerol, gelatin, BSA or non-ionic detergents may be added.

[0213] In yet another specific embodiment, the Klenow fragment has high processivity under the following reaction conditions: about 10 mM Tris-HCl, pH 7.9, about 10 mM MgCl 2 , about 50 mM NaCl, about 1 mM DTT, and about 100 g / mol BSA.

[0214] In yet another specific example, Bst DNA polymerase has high processivity under the following reaction conditions: about 20 mM Tris-HCl, pH 8.8, about 10 mM (NH 4 ) 2 SO 4 , about 10 mM KCl, about 2 mM MgSO 4 and about 0.1% of a nonionic surfactant (e.g., triton from The Dow Chemical Co. TM X-100).

[0215] Both of the amplification processes disclosed herein generate multiple gDNA fragments without having to use a fragmentation process. Single-stranded gDNA is used as a template for several target genotyping loci 54, and several amplicons for each target genotyping locus 54 are generated. When the template 48 or 49 to be genotyped is introduced onto the flow cell 20, the amplified gDNA fragments (target genotyping loci 54) hybridize with the corresponding complementary segments of the template 48 or 49 to be genotyped.

[0216] Reagent test kit

[0217] The genotyping nucleotides 10 or 10' and the flow cell 20 may be part of a genotyping kit.

[0218] In one example, the kit includes: a flow cell 20, the flow cell 20 including a substrate 30, 30' having recesses 38 separated by gap regions 40 and a first capture primer and a second capture primer 22, 24 or 22, 24' attached within each of the recesses 38; and a genotyping probe fluid comprising a liquid carrier and a genotyping oligonucleotide 10 or 10' in the liquid carrier, the genotyping oligonucleotide 10 or 10' including a first primer sequence 12, a probe sequence 14 representing a target genotyping locus 54, a restriction endonuclease site 16, 16' and a second primer sequence 18, 18' that is at least partially complementary to the second capture primer 24, 24'.

[0219] The kit may also include genotyping library preparation components, such as a whole genome sample, a polymerase (which may be a low processivity polymerase as defined herein), a plurality of primers, and free nucleotides (including natural nucleotides in some examples, and including a mixture of natural nucleotides and dideoxythymidine triphosphate (ddTTP) in other examples).

[0220] Any example of the genotyping oligonucleotide 10 or 10' may be used in the kit, and any example of the flow cell 20 may be used in the kit.

[0221] The kit may alternatively include a non-patterned flow cell having primers over the entire surface of the flow channel.

[0222] Additional Notes

[0223] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given the meaning most consistent with the specific concepts disclosed herein.

[0224] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting. Sequence Listing <110> Illumina Cambridge Ltd. Illumina Corporation <120> Kits for genotyping <130> FIC21210103P <150> 62 / 981866 <151> 2020-02-26 <160> 3 <170> PatentIn Version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 1 aatgatacgg cgaccaccga 20 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 2 caagcagaag acggcatacg a 21 <210> 3 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 3 gttcgtcttc tgccgtatgc t 21

Claims

1. A kit comprising: A circulation cell, the circulation cell comprising: substrate; and a first capture primer and a second capture primer attached to the substrate; and A genotyping probe fluid, the genotyping probe fluid comprising: a liquid carrier; and The genotyping oligonucleotide in the liquid carrier comprises: first primer sequence; a probe sequence representing a target genotyping locus having a nucleobase of interest, wherein the last base of the probe sequence represents a nucleobase of the target genotyping locus positioned immediately adjacent to the nucleobase of interest; Restriction endonuclease sites; and a second primer sequence that is at least partially complementary to the second capture primer; Among them, one of the following: The restriction endonuclease site of the genotyping oligonucleotide is located between the probe sequence and the second primer sequence; or The probe sequence is directly attached to the second primer sequence and the restriction endonuclease site is incorporated into the second primer sequence at a cleavage distance from the last base of the probe sequence.

2. The kit of claim 1, wherein the genotyping probe fluid comprises a plurality of genotyping oligonucleotides, and wherein each genotyping oligonucleotide comprises a probe sequence that is different from every other genotyping oligonucleotide.

3. The kit according to one of claims 1 or 2, wherein the second capture primer comprises a cleavage site.

4. The kit of claim 3, wherein the restriction endonuclease site is sensitive to a restriction endonuclease selected from the group consisting of a 4-base cutter restriction endonuclease, a 5-base cutter restriction endonuclease, and a 6-base cutter restriction endonuclease.

5. The kit according to claim 1 , wherein The genotyping oligonucleotide further comprises an index sequence portion directly attached to the first primer sequence and a priming site portion directly attached to the index sequence portion; The second capture primer further comprises a second restriction endonuclease site, wherein the second restriction endonuclease site is complementary to the restriction endonuclease site of the genotyping oligonucleotide.

6. The kit according to claim 5, wherein the restriction endonuclease site and the second restriction endonuclease site are sensitive to a Type IIS methyl-sensitive restriction endonuclease.

7. The kit according to claim 1 or 2, wherein: The substrate has recessed portions separated by gap regions; and The first capture primer and the second capture primer are attached within each of the recesses.

8. A method for genotyping, comprising: A genotyping probe fluid is introduced into a flow cell including a first capture primer and a second capture primer, the genotyping probe fluid including a plurality of genotyping oligonucleotides, each of the genotyping oligonucleotides including: first primer sequence; a probe sequence representing a corresponding target genotyping locus having a nucleobase of interest, wherein the last base of the probe sequence represents a nucleobase of the target genotyping locus positioned immediately adjacent to the nucleobase of interest; Restriction endonuclease sites; and a second primer sequence that is at least partially complementary to the second capture primer; Among them, one of the following: The restriction endonuclease site of the genotyping oligonucleotide is located between the probe sequence and the second primer sequence; or said probe sequence is directly attached to said second primer sequence and said restriction endonuclease site is incorporated into said second primer sequence at a cleavage distance from said last base of said probe sequence; whereby the corresponding genotyping oligonucleotides are reacted to produce corresponding clonal populations of amplicons derived from the corresponding genotyping oligonucleotides; linearizing the amplicon to generate a probe template having a sequence identical to the probe sequence; sequencing at least one probe identification segment of the probe template to identify each of the probe sequences; removing at least the corresponding nascent strand from the probe template, whereby the 3'OH group at the end of the probe template is exposed; and hybridizing a corresponding sample to the probe template; and performing a corresponding genotyping reaction of the sample at the exposed 3' OH group.

9. The method of claim 8, wherein linearizing the amplicon involves: cleaving the amplicon attached to the second capture primer at a corresponding cleavage site of the second capture primer; and The cleaved portion of the amplicon attached to the second capture primer is denatured to generate the probe template.

10. The method of claim 9, wherein sequencing the at least one probe recognition segment of the probe template involves performing a base extension reaction along the at least one probe recognition segment using the second capture primer as a sequencing primer.

11. The method of claim 10, wherein removing at least the corresponding nascent strand from the probe template involves: digesting the restriction endonuclease site; and The remaining nascent strands from the probe template are denatured.

12. The method of claim 8, wherein each of the second capture primers further comprises a second restriction endonuclease site, wherein the second restriction endonuclease site is complementary to the restriction endonuclease site of the genotyping oligonucleotide, and wherein linearizing the amplicon involves: digesting the restriction endonuclease portion of the amplicon to leave the second capture primer; and The remainder of the amplicon is denatured to generate a single-stranded probe template comprising the first capture primer and the at least one probe recognition segment.

13. The method of claim 12, wherein sequencing the at least one probe recognition segment portion of the single-stranded probe template involves: introducing sequencing primers; and A base extension reaction is performed along the at least one probe recognition segment of each of the single-stranded probe templates.

14. The method of claim 13, wherein removing at least the corresponding nascent strand from the single-stranded probe template involves denaturing the nascent strand from the at least one probe recognition segment.

15. The method according to one of claims 12 to 14, further comprising blocking the second capture primer prior to sequencing along the at least one probe recognition segment of each of the single-stranded probe templates.

16. The method of claim 8, further comprising associating each identified probe sequence with a corresponding clonal population of amplicons.

17. The method according to claim 8, wherein before hybridizing the corresponding sample with the probe template, the method further comprises preparing the corresponding sample by: contacting the single-stranded genomic DNA template with a low processivity polymerase, a plurality of primers, and free nucleotides, thereby generating complementary fragments of the single-stranded genomic DNA template; and The complementary fragments are displaced from the single-stranded genomic DNA template, thereby generating at least some of the corresponding samples.

18. The method of claim 17, further comprising denaturing double-stranded genomic deoxyribonucleic acid (DNA) to generate the single-stranded genomic DNA template.

19. The method of claim 17, further comprising repeating the contacting and the shifting for a predetermined number of cycles to generate additional complementary fragments in each of the predetermined number of cycles.

20. The method of claim 17, wherein the low processivity polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and an engineered polymerase.

21. The method according to claim 8, wherein before hybridizing the corresponding sample with the probe template, the method further comprises preparing the corresponding sample by: contacting the single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides, the mixture of free nucleotides comprising natural nucleotides and dideoxythymidine triphosphate, thereby generating truncated complementary fragments of the single-stranded genomic DNA template; and The truncated complementary fragments are displaced from the single-stranded genomic DNA template, thereby generating at least some of the corresponding samples.

22. The method of claim 21, wherein the natural nucleotides include deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate, and wherein the mixture of free nucleotides includes a ratio of deoxythymine triphosphate to dideoxythymidine triphosphate in the range of 10:5 to 10:0.

01.

23. The method of claim 21, further comprising denaturing double-stranded genomic deoxyribonucleic acid (DNA) to generate the single-stranded genomic DNA template.

24. The method of claim 21, further comprising repeating the contacting and the shifting for a predetermined number of cycles to generate additional truncated complementary fragments in each of the predetermined number of cycles.

25. The method of claim 21, wherein the polymerase is selected from the group consisting of: T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and an engineered polymerase.

Images