Counterselection by repression of conditionally essential genes

Abstract

The present invention relates to a method for counter-selection by suppressing conditionally essential genes.

Description

[0001] References to sequence listings

[0002] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. Technical Field

[0003] The present invention relates to a method for counter-selection by suppressing conditionally essential genes. Background Art

[0004] The so-called CRISPR genome editing system has been widely used as a tool to modify the genomes of a variety of organisms. The power of the CRISPR system lies in its simplicity and its ability to target and edit single base pairs in specific target genes. The system relies on CRISPR-associated proteins (Cas), which are RNA-guided endonucleases, and so-called guide RNA (gRNA) molecules, which can form a complex with the endonuclease and guide the nuclease activity to a specific DNA sequence. The DNA target sequence is selected by changing the nucleotide sequence of the gRNA to match the target DNA sequence. When complexed with the gRNA molecule, the endonuclease can recognize and bind to its target DNA sequence, forming an endonuclease-gRNA-DNA complex and using one or more of its catalytic domains to produce double-strand breaks.

[0005] For the purpose of genome editing, the most widely used CRISPR-associated proteins are those of class 2, which include Cas9 derived from Streptococcus pyogenes (Type II Cas) and Cpf1 derived from Acidaminococcus or Lachnospiraceae (Type V Cas). Another example of an RNA-guided endonuclease is Mad7 isolated from Eubacterium rectale. Although there are some structural similarities between Mad7 and Cpf1, Mad7 is only 31% conserved with Cpf1 from Acidaminococcus species at the amino acid level.

[0006] In addition to its use in genome editing, the CRISPR system can also be used to control gene expression. This application, commonly referred to as CRISPR interference or CRISPRi, allows sequence-specific inhibition or activation of genes. CRISPR interference utilizes a catalytically inactive ("dead") endonuclease variant (e.g., Mad7d) that can be obtained by introducing amino acid mutations in the catalytic domain responsible for endonuclease activity. When associating with gRNA, the resulting complex retains the ability to bind to the target DNA sequence, but does not introduce any breaks in the DNA chain. As long as the catalytically inactive endonuclease binds to the target DNA sequence, the expression of the target sequence is suppressed. By changing the gRNA sequence, the target DNA sequence can be controlled, and the expression of almost any gene in any organism can be regulated.

[0007] In industrial biotechnology, there is a continuing need for a strong and efficient selection system suitable for developing optimized production hosts. Given the versatility and precision of CRISPR technology, it is speculated that this system can be used for counter-selection purposes. However, attempts to use CRISPR technology for direct selection have been difficult to date. This is particularly true for bacterial host cells, since many prokaryotes are very sensitive to the endonuclease activity of RNA-guided endonuclease-gRNA complexes due to the inefficient repair mechanism of double-strand (DS) breaks known from the non-homologous end joining (NHEJ) system of eukaryotes (see, e.g., Su et al., Scientific Reports 2016, 6, 37895; Altenbuchner, Applied and Environmental Microbiology 2016, 82, pp. 5421-5427; Peters et al., Current Opinion in Microbiology 2015, 27, pp. 121-126; Aravind and Koonin, Genome Research 2001, 11, pp. 1365-1374). In addition, in many cases it is necessary to introduce multiple copies of a gene or operon (expression cassette) to maximize the yield of a given polypeptide of interest. However, direct selection using CRISPR technology becomes increasingly difficult if more than one site is targeted for DS breaks in order to introduce multiple expression cassettes in one process.

[0008] The researchers reported the successful integration of the gene of interest (GOI) into the gRNA target site on the chromosome by homologous recombination (HR), and then introduced endonuclease activity to perform DS breakage to kill cells that retain the original gRNA target sequence. In this way, it is possible to effectively enrich cells that have accepted the GOI. However, the timing of these events of HR and DS activity is very important. RNA-guided endonucleases are typically very active in generating DS breaks and should not be expressed until homologous recombination occurs and the target site is removed. Summary of the invention

[0009] The present invention provides means and methods to exploit the versatility and precision of CRISPR technology in selection systems suitable for microbial host cells.

[0010] Therefore, in a first aspect, the present invention relates to a method for inserting at least one polynucleotide of interest into the genome of a host cell, the method comprising the following steps:

[0011] a) providing a host cell comprising in its genome:

[0012] i. a polynucleotide encoding a selectable marker comprising a target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease;

[0013] ii. at least one polynucleotide encoding a gRNA that is at least 80% complementary to the target sequence and capable of hybridizing to the target sequence; and

[0014] iii. a polynucleotide encoding an inactive nuclease variant of an RNA-guided endonuclease that is capable of interacting with the gRNA and binding to the target sequence, thereby inhibiting the expression of the selectable marker;

[0015] b) transforming the host cell with at least one polynucleotide of interest, wherein the at least one polynucleotide of interest is capable of inactivating the at least one polynucleotide encoding the gRNA;

[0016] c) selecting for the trait conferred by the selectable marker; and

[0017] d) identifying a transformed host cell, wherein the at least one polynucleotide encoding the gRNA has been inactivated by the at least one polynucleotide of interest.

[0018] In a second aspect, the present invention relates to a method for inserting at least two different polynucleotides of interest into the genome of a host cell, the method comprising the following steps:

[0019] a) providing a host cell comprising in its genome:

[0020] i. at least two polynucleotides encoding at least two different selectable markers, each selectable marker comprising a different target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease;

[0021] ii. at least two polynucleotides encoding at least two gRNAs that are at least 80% complementary to the at least two different target sequences and capable of hybridizing to the at least two different target sequences;

[0022] iii. a polynucleotide encoding an ineffective nuclease variant of an RNA-guided endonuclease protein, the RNA-guided endonuclease protein being capable of interacting with the at least two gRNAs and binding to the at least two different target sequences, thereby inhibiting the expression of the two different selectable markers;

[0023] b) transforming the host cell with at least two different polynucleotides of interest, which are capable of inactivating the at least two polynucleotides encoding at least two gRNAs; and

[0024] c) selecting for the traits conferred by the at least two different selectable markers; and

[0025] d) identifying a transformed host cell, wherein the at least two polynucleotides encoding at least two gRNAs have been inactivated by the at least two different polynucleotides of interest. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The bglC-Mad7d locus in the PP3811-Mad7d strain is shown.

[0027] Figure 2 The gnt-dsRED-Mad7gDNA(cat) locus in the PP3811-Mad7gDNA1 strain is shown.

[0028] Figure 3 The amyL-dsRED-Mad7gDNA (cat) locus in the PP3811-Mad7gDNA2 strain is shown.

[0029] Figure 4 The lacA2-dsRED-Mad7gDNA (cat) locus in the PP3811-Mad7gDNA3 strain is shown.

[0030] Figure 5 The gnt locus in MOL7800-amyL3 after integration of amyL is shown.

[0031] Figure 6The amyL locus in MOL7800-amyL3 after reintegration of amyL is shown.

[0032] Figure 7 The lacA2 locus in MOL7800-amyL3 after integration of amyL is shown.

[0033] Figure 8 A schematic diagram of the PP3811-gDNA3 strain is shown.

[0034] Fig. 9 The pPPamyL-attP plasmid is shown.

[0035] Sequence Listing

[0036]

[0037] definition

[0038] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced ​​mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature, spliced ​​mRNA.

[0039] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are usually determined by an open reading frame, which begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). The coding sequence may be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0040] Conditional essential genes: Conditional essential genes or loci can function as selective markers. Examples of bacterial conditional essential selective markers are dal genes from Bacillus subtilis or Bacillus licheniformis, which are essential only when bacteria are cultured in the presence of D-alanine; or genes encoding enzymes that participate in the removal of UDP galactose from bacterial cells when cells grow in the presence of galactose. Non-limiting examples of such genes are those from Bacillus subtilis or Bacillus licheniformis encoding UTP-dependent phosphorylases (EC 2.7.7.10), UDP-glucose-dependent uridyltransferases (EC 2.7.7.12), or UDP-galactose epimerases (EC 5.1.3.2). If essential genes or loci are inactivated, the resulting strains will be defective (e.g., unable to metabolize a specific carbon source), or growth requirements (e.g., becoming amino acid auxotrophs, or becoming sensitive to a given pressure). Non-limiting examples of conditionally essential genes are genes encoding D-alanine racemase, genes encoding xylose isomerase, and genes of the gluconate operon. Preferably, the conditionally essential gene is selected from the group consisting of dal, lysA, araA, galE, antK, metC, xylA, gntP, gntK, glpD, glpF, glpK, glpP, lacA2, hisC, gapA, and aspB.

[0041] Control sequences: The term "control sequences" means nucleic acid sequences necessary for the expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or native or exogenous to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters, and transcription and translation termination signals. For the purpose of introducing specific restriction sites that are conducive to connecting the control sequences to the coding region of the polynucleotide encoding the polypeptide, these control sequences may be provided with multiple linkers.

[0042] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0043] Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0044] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0045] Isolated: The term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor that is at least partially removed from one or more or all naturally occurring components associated with its properties; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of a substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). The isolated substance may be present in a fermentation broth sample; for example, a host cell may be genetically modified to express a polypeptide of the invention. The fermentation broth from the host cell will contain the isolated polypeptide.

[0046] Ineffective nuclease: The term "ineffective nuclease" is used to describe an RNA-guided endonuclease whose endonuclease activity is impaired. Ineffective nuclease variants of RNA-guided endonucleases can bind to their target DNA sequence, but will not introduce any breaks in the target DNA sequence. The terms "ineffective nuclease", "catalytically inactive" and "dead" (abbreviated as "d", e.g., Mad7d) are used interchangeably herein.

[0047] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or modified to contain a nucleic acid segment in a manner not originally found in nature, or is synthetic, and that contains one or more control sequences.

[0048] Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0049] RNA-guided endonuclease: The term "RNA-guided endonuclease" means a polypeptide having endonuclease activity, wherein the endonuclease activity is controlled by one or more gRNAs, which form a complex with the RNA-guided endonuclease and direct the endonuclease activity to a target DNA sequence that is complementary to and capable of hybridizing to the one or more gRNAs.

[0050] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".

[0051] For purposes of the present invention, use the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [J.Molecular Biology] 48:443-453) implemented in the Needle program of EMBOSS package (EMBOSS:The European Molecular Biology Open Software Suite [EMBOSS:European Molecular Biology Open Software Suite], Rice et al., 2000, Trends Genet. [Genetics Trend] 16:276-277) (preferred 5.0.0 version or updated version) to determine the sequence identity between two amino acid sequences. The parameters used are gap opening penalty 10, gap extension penalty 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output (obtained using non-simplified options) of Needle, which is labeled as "longest identity", is used as identity percentage and is calculated as follows:

[0052] (number of identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0053] For the purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) implemented in the Needle program of the EMBOSS package (EMBOSS:The European Molecular Biology Open Software Suite [EMBOSS:European Molecular Biology Open Software Suite], Rice et al., 2000, supra) (preferably 5.0.0 version or updated version). The parameters used are gap opening penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle, labeled as "longest identity" (obtained using the non-simplified option), is used as identity percentage and is calculated as follows:

[0054] (number of identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment)

[0055] Sequence complementarity: The relatedness between two complementary nucleotide sequences is described by the parameter "sequence complementarity" and is determined using the same algorithm as for sequence identity, where the antisense complementary sequence is converted to its sense sequence before alignment and calculation. DETAILED DESCRIPTION

[0056] The present invention provides means and methods to exploit the versatility and precision of CRISPR technology in a selection system suitable for microbial host cells. By using the DNA sequence encoding the gRNA in CRISPRi (denoted as 'gDNA') as an indirect reverse selectable marker, the inventors have shown that multiple gene copies can be inserted into the host cell genome by selecting for the absence of the gDNA encoding the gRNA.

[0057] As shown in the examples herein, suitable selection systems can be based on antibiotic resistance genes, such as the cat gene that confers resistance to chloramphenicol. A host cell comprising a polynucleotide encoding a cat gene and a polynucleotide encoding an invalid nuclease variant of an RNA-guided endonuclease and a polynucleotide encoding a gRNA for a cat gene will therefore only be able to grow in the absence of chloramphenicol because the endonuclease-gRNA complex will inhibit the expression of the cat gene. As long as the host cell expresses an invalid nuclease variant of an RNA-guided endonuclease and gRNA, the host cell remains sensitive to chloramphenicol.

[0058] In the next step, the host cell is transformed with the polynucleotide, which allows the gDNA to be replaced with the target gene. By subsequent selection for chloramphenicol resistance, only cells with the gDNA replaced by the target gene can survive, since the gRNA is no longer expressed, which makes the correctly transformed host cells resistant to chloramphenicol.

[0059] As shown in the examples attached hereto, the method of the present invention is particularly suitable for one-step multiple insertion of one or more specific expression cassettes on a single locus on a host cell chromosome. The method of the present invention provides a host cell containing multiple expression cassettes, i.e., a multi-copy host cell, which is highly stable due to the insertion of the expression cassettes into a single locus on the chromosome. Such cells are highly reliable as a powerful workhorse for producing a polypeptide of interest in industrial biotechnology.

[0060] Therefore, in a first aspect, the present invention relates to a method for inserting at least one polynucleotide of interest into the genome of a host cell, the method comprising the following steps:

[0061] a) providing a host cell comprising in its genome:

[0062] i. a polynucleotide encoding a selectable marker comprising a target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease;

[0063] ii. at least one polynucleotide encoding a gRNA that is at least 80% complementary to the target sequence and capable of hybridizing to the target sequence; and

[0064] iii. a polynucleotide encoding an inactive nuclease variant of an RNA-guided endonuclease that is capable of interacting with the gRNA and binding to the target sequence, thereby inhibiting the expression of the selectable marker;

[0065] b) transforming the host cell with at least one polynucleotide of interest, wherein the at least one polynucleotide of interest is capable of inactivating the at least one polynucleotide encoding the gRNA;

[0066] c) selecting for the trait conferred by the selectable marker; and

[0067] d) identifying a transformed host cell, wherein the at least one polynucleotide encoding the gRNA has been inactivated by the at least one polynucleotide of interest.

[0068] The host cell provided in step (a) of the method of the first aspect comprises at least one polynucleotide encoding a gRNA. Preferably, the number of polynucleotides encoding a gRNA is at least one, such as at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 15, at least 20, at least 25 or more.

[0069] In step (b) of the method of the first aspect, the host cell is transformed with at least one target polynucleotide. Preferably, the number of the target polynucleotide is at least one, such as at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 15, at least 20, at least 25 or more.

[0070] In a preferred embodiment of the first aspect, the at least one polynucleotide of interest encodes a polypeptide; preferably the polypeptide comprises an enzyme; more preferably, the enzyme is selected from the group consisting of: a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is selected from the group consisting of: an aminopeptidase, an amylase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phosphodiesterase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, a xylanase and a β-xylosidase.

[0071] Preferably, the selectable marker is a positive selection marker, a negative selection marker, a bidirectional marker or a conditionally essential gene.

[0072] Preferably, the selectable marker is an antibiotic resistance gene that confers resistance to chloramphenicol, tetracycline, ampicillin, spectinomycin, kanamycin or neomycin; more preferably, the selectable marker is an antibiotic resistance gene that confers resistance to chloramphenicol.

[0073] Also preferably, the selectable marker is an antibiotic resistance gene selected from the group consisting of cat, erm, tet, amp, spec, kana and neo; more preferably, the selectable marker is the cat gene.

[0074] Alternatively, and also preferably, the selectable marker is a gene that confers auxotrophy to the host cell. Preferably, the selectable marker is a conditionally essential gene selected from the group consisting of: dal, lysA, araA, galE, antKmetC, xylA, gntP, glpD, glpF, glpK, glpP, lacA2, hisC, gapA and aspB genes. More preferably, the selectable marker is the dal gene.

[0075] There are many well-known methods for inactivating a gene, for example, by mutating the gene by introducing a non-sense mutation or a frameshift mutation, or by deleting part or all of the open reading frame, or by manipulating one or more control sequences.

[0076] Accordingly, in a preferred embodiment of the first aspect, the at least one polynucleotide encoding the gRNA is inactivated by partial or complete deletion of the polynucleotide.

[0077] In a preferred embodiment of the first aspect, the at least one polynucleotide encoding the gRNA has been partially or completely replaced in the host cell genome by the at least one target polynucleotide in step (d), thereby inactivating the at least one polynucleotide encoding the gRNA.

[0078] In a second aspect, the present invention relates to a method for inserting at least two different polynucleotides of interest into the genome of a host cell, the method comprising the following steps:

[0079] a) providing a host cell comprising in its genome:

[0080] i. at least two polynucleotides encoding at least two different selectable markers, each selectable marker comprising a different target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease;

[0081] ii. at least two polynucleotides encoding at least two gRNAs that are at least 80% complementary to the at least two different target sequences and capable of hybridizing to the at least two different target sequences;

[0082] iii. a polynucleotide encoding an ineffective nuclease variant of an RNA-guided endonuclease capable of interacting with the at least two gRNAs and binding to the at least two different target sequences, thereby inhibiting the expression of the two different selectable markers;

[0083] b) transforming the host cell with at least two different polynucleotides of interest, which are capable of inactivating the at least two polynucleotides encoding at least two gRNAs; and

[0084] c) selecting for the traits conferred by the at least two different selectable markers; and

[0085] d) identifying a transformed host cell, wherein the at least two polynucleotides encoding at least two gRNAs have been inactivated by the at least two different polynucleotides of interest.

[0086] The host cell provided in step (a) of the method of the second aspect comprises at least two polynucleotides encoding at least two different selective markers and at least two polynucleotides encoding at least two gRNAs. Preferably, the number of polynucleotides encoding at least two different selective markers and at least two gRNAs is independently at least two, such as at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 15, at least 20, at least 25 or more.

[0087] In step (b) of the method for the second aspect, the host cell is transformed with at least two different target polynucleotides. Preferably, the number of different target polynucleotides is at least two, such as at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 15, at least 20, at least 25 or more.

[0088] In a preferred embodiment of the second aspect, the at least two different polynucleotides of interest encode at least two polypeptides; preferably the at least two polypeptides comprise at least two enzymes; more preferably, the at least two enzymes are independently selected from the group consisting of: hydrolases, isomerases, ligases, lyases, oxidoreductases or transferases; most preferably, the at least two enzymes are independently selected from the group consisting of: aminopeptidases, amylases, carbohydrases, carboxypeptidases, catalases, cellobiohydrolases, cellulase enzymes, chitinases, cutinases, cyclodextrin glycosyltransferases, deoxyribonucleases, endoglucanases, esterases, α-galactosidases, β-galactosidases, glucoamylases, α-glucosidases, β-glucosidases, invertases, laccases, lipases, mannosidases, mutanases, oxidases, pectinolytic enzymes, peroxidases, phosphodiesterases, phytases, polyphenol oxidases, proteolytic enzymes, ribonucleases, transglutaminases, xylanases, and β-xylosidases.

[0089] Preferably, the at least two different selectable markers are independently positive selection markers, negative selection markers, bidirectional markers or conditionally essential genes.

[0090] Preferably, the at least two different selectable markers are antibiotic resistance genes selected from the group consisting of cat, erm, tet, amp, spec, kana and neo.

[0091] Preferably, the at least two different selectable markers are genes that confer auxotrophy to the host cell. Preferably, the selectable marker is a conditionally essential gene selected from the group consisting of: dal, lysA, araA, galE, antKmetC, xylA, gntP, glpD, glpF, glpK, glpP, lacA2, hisC, gapA and aspB genes.

[0092] Preferably, the at least two different selectable markers are independently selected from the group consisting of: antibiotic resistance genes and genes that confer auxotrophy to the host cell; preferably, the at least two different selectable markers are independently selected from the genes of the group consisting of: cat, erm, tet, amp, spec, kana, neo, dal, lysA, araA, galE, antK metC, xylA, gntP, glpD, glpF, glpK, glpP, lacA2, hisC, gapA and aspB.

[0093] Preferably, the at least two polynucleotides encoding at least two gRNAs are inactivated by partial or complete deletion of said polynucleotides.

[0094] Preferably, the at least two polynucleotides encoding at least two gRNAs have been partially or completely replaced in the host cell genome by at least two different polynucleotides of interest in step (d), thereby inactivating the at least two polynucleotides encoding at least two gRNAs.

[0095] Polynucleotide

[0096] The present invention also relates to polynucleotides of the present invention, including polynucleotides of interest and polynucleotides encoding null nuclease variants of selective markers, gRNAs and RNA-guided endonucleases. In one embodiment, such polynucleotides have been isolated.

[0097] Techniques for isolating or cloning polynucleotides are known in the art and include isolation from genomic DNA or cDNA or a combination thereof. Cloning of polynucleotides from genomic DNA can be achieved, for example, by using the well-known polymerase chain reaction (PCR) or expression library antibody screening to detect cloned DNA fragments with shared structural features. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application [PCR: Methods and Application Guide], Academic Press [Academic Press], New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation-activated transcription (LAT) and polynucleotide-based amplification (NASBA) can be used.

[0098] Nucleic acid construct

[0099] The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0100] These polynucleotides can be manipulated in many ways to provide for their expression. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to its insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0101] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by the host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains a transcriptional control sequence that mediates the expression of the polypeptide. The promoter may be any polynucleotide that exhibits transcriptional activity in the host cell, including variants, truncated and hybrid promoters, and may be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell.

[0102] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the invention in bacterial host cells are promoters obtained from the following genes: Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular Microbiology 13:97-107), Escherichia coli lac operon, Escherichia coli trc promoter (Egon et al., 1988, Gene 69:301-315), Streptomyces coelicolor gene (Streptomyces cerevisiae) ...Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisiae) gene (Streptomyces cerevisia coelicolor) agar hydrolase gene (dagA), and prokaryotic β-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 75:3727-3731), and tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 80:21-25). Other promoters are described in Gilbert et al., 1980, "Useful proteins from recombinant bacteria", Scientific American 242:74-94; and Sambrook et al., 1989, supra. Examples of tandem promoters are disclosed in WO 99 / 43835.

[0103] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid-stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amyloglucosidase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 00 / 56900), Rhizomucor miehei (WO 00 / 56900), and Aspergillus oryzae TAKA amylase. miehei) lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase and Trichoderma reesei translation elongation factor , and NA2-tpi promoter (a modified promoter from an Aspergillus neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from an Aspergillus triose phosphate isomerase gene; non-limiting examples include a modified promoter from an Aspergillus niger neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and variants, truncations, and hybrid promoters thereof. Other promoters are described in U.S. Pat. No. 6,011,147.

[0104] In yeast hosts, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triosephosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.

[0105] The control sequence may also be a transcription terminator that is recognized by the host cell to terminate transcription. The terminator may be operably linked to the 3'-end of the polynucleotide. Any terminator that is functional in the host cell may be used in the present invention.

[0106] Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0107] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor.

[0108] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al. (1992, supra).

[0109] The control sequence may also be an mRNA stabilizer region downstream of the promoter and upstream of the coding sequence of a gene, which increases the expression of the gene.

[0110] Examples of suitable mRNA stabilizer regions are obtained from the Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177:3465-3471).

[0111] The control sequence may also be a leader sequence, i.e., a non-translated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5'-end of the polynucleotide. Any leader sequence that is functional in the host cell may be used.

[0112] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0113] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0114] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, recognized by the host cell as a signal to add polyadenylic acid residues to transcribed mRNA. Any polyadenylation sequence functional in the host cell may be used.

[0115] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0116] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

[0117] The control sequence can also be a signal peptide coding region that encodes a signal peptide connected to the N-terminus of the polypeptide and directs the polypeptide to enter the secretory pathway of the cell. The 5' end of the coding sequence of the polynucleotide itself can contain a signal peptide coding sequence that is naturally connected to the coding sequence segment of the coded polypeptide in the translation reading frame. Alternatively, the 5' end of the coding sequence can contain a signal peptide coding sequence that is exogenous to the coding sequence. In the case where the coding sequence does not naturally contain a signal peptide coding sequence, an exogenous signal peptide coding sequence may be required. Alternatively, an exogenous signal peptide coding sequence can simply replace the natural signal peptide coding sequence to enhance the secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide to enter the secretory pathway of the host cell can be used.

[0118] Effective signal peptide coding sequences for bacterial host cells are those obtained from the genes for maltogenic amylase from Bacillus NCIB 11837, Bacillus licheniformis subtilisin, Bacillus licheniformis β-lactamase, Bacillus stearothermophilus α-amylase, Bacillus stearothermophilus neutral protease (nprT, nprS, nprM), and Bacillus subtilis prsA. Other signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

[0119] Effective signal peptide coding sequences for filamentous fungal host cells are those obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

[0120] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al. (1992, supra).

[0121] The control sequence can also be a propeptide coding sequence encoding a propeptide at the N-terminus of a polypeptide. The resulting polypeptide is referred to as a proenzyme or propolypeptide (or in some cases as a zymogen). Propolypeptides are generally inactive and can be converted into active polypeptides by catalytic cleavage or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence can be obtained from the following genes: Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease, and Saccharomyces cerevisiae α-factor.

[0122] Where both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately adjacent to the N-terminus of the polypeptide and the signal peptide sequence is located immediately adjacent to the N-terminus of the propeptide sequence.

[0123] It may also be desirable to add regulatory sequences that regulate the expression of polynucleotides associated with host cell growth. Examples of regulatory sequences are those that cause polynucleotide expression to open or close in response to chemical or physical stimuli (including the presence of regulatory compounds). Regulatory sequences in prokaryotic systems include lac, tac, and trp operon systems. In yeast, the ADH2 system or the GAL1 system may be used. In filamentous fungi, Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA α-amylase promoter and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals. In these cases, the polynucleotides will be operably connected to the regulatory sequences.

[0124] Expression vector

[0125] The present invention further relates to a recombinant expression vector comprising a polynucleotide of the present invention, a promoter, and transcription and translation termination signals. Various nucleotides and control sequences can be linked together to produce a recombinant expression vector, which can include one or more suitable restriction sites to allow insertion or replacement of polynucleotides at such sites. Alternatively, the polynucleotides can be expressed by inserting a polynucleotide or a nucleic acid construct comprising the polynucleotide into a suitable vector for expression. When producing an expression vector, the encoding sequence is located in the vector so that the encoding sequence is operably connected to the suitable control sequence for expression.

[0126] The recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be easily subjected to recombinant DNA procedures and can cause expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0127] The vector can be an autonomously replicating vector, i.e. a vector existing as an extrachromosomal entity, which replicates independently of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that is integrated into the genome and replicates with one or more chromosomes into which it has been integrated when it is introduced into the host cell. In addition, a single vector or plasmid or two or more vectors or plasmids can be used, which contain the total DNA to be introduced into the host cell genome together, or a transposon can be used.

[0128] The vector preferably contains one or more selectable markers that permit easy selection of transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, etc.

[0129] Examples of bacterial selectable markers are the dal genes of Bacillus licheniformis or Bacillus subtilis, markers that confer auxotrophy for amino acids or other metabolites, or markers that confer antibiotic resistance (e.g., ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance). Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in filamentous fungal host cells include, but are not limited to, adeA (phosphoribosylamidoimidazole-succinylcarboxamide synthase), adeB (phosphoribosylamidoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenosyltransferase), and trpC (anthranilate synthase), along with their equivalents. Preferred for use in Aspergillus cells are the Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and the Streptomyces hygroscopicus bar gene. Preferred for use in Trichoderma cells are the adeA, adeB, amdS, hph and pyrG genes.

[0130] The selectable marker may be a dual selectable marker system as described in WO 2010 / 039889. In one aspect, the dual selectable marker is the hph-tk dual selectable marker system.

[0131] The vector preferably contains one or more elements that permit integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0132] For being integrated into the host cell genome, the vector can rely on a polynucleotide sequence or any other element of the vector for being integrated into the genome by homologous or non-homologous recombination. Alternatively, the vector can contain other polynucleotides at one or more precise positions for guiding the integration of one or more chromosomes in the host cell genome by homologous recombination. In order to improve the possibility of integration at the precise position, the integration element should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, and these nucleic acids have a high degree of sequence identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration element can be any sequence homologous to the target sequence in the host cell genome. In addition, the integration element can be a non-coding or coded polynucleotide. On the other hand, the vector can be integrated into the genome of the host cell by non-homologous recombination.

[0133] For autonomous replication, the vector may further comprise an origin of replication, which enables autonomous replication of the vector in the host cell in question. The origin of replication may be any plasmid replicon mediating autonomous replication that functions in the cell. The term "origin of replication" or "plasmid replicon" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0134] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli and pUB110, pE194, pTA1060, and pAMβ1 permitting replication in Bacillus.

[0135] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[0136] Examples of origins of replication useful in filamentous fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00 / 24883). Isolation of the AMA1 gene and construction of a plasmid or vector containing the gene can be accomplished according to the method disclosed in WO 00 / 24883.

[0137] More than one copy of the polynucleotide of the present invention can be inserted into the host cell to increase the production of the polypeptide. The increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotide, wherein cells containing amplified copies of the selectable marker gene and thus additional copies of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective agent.

[0138] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to those skilled in the art (see, eg, Sambrook et al., 1989, supra).

[0139] Host cells

[0140] The present invention also relates to recombinant host cells comprising polynucleotides of the present invention operably linked to one or more control sequences that direct the expression of the polynucleotides of the present invention. A construct or vector comprising the polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector, as described earlier. The term "host cell" encompasses any parent cell progeny that is not identical to the parent cell due to mutations that occur during replication.

[0141] The host cell can be any useful cell, such as a prokaryotic cell or a eukaryotic cell.

[0142] Prokaryotic host cells can be any Gram-positive or Gram-negative bacteria. Gram-positive bacteria include but are not limited to: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus and Streptomyces. Gram-negative bacteria include but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella and Ureaplasma.

[0143] The prokaryotic host cell can be any Bacillus cell, including, but not limited to, Bacillus alkalophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus methylotrophicus, Bacillus pumilus, Bacillus sabdariffa ... Preferably, the prokaryotic host cell is a Bacillus licheniformis cell.

[0144] The prokaryotic host cell may also be any Streptococcus cell, including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp. Zooepidemicus cells.

[0145] The prokaryotic host cell can also be any Streptomyces cell, including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0146] Introduction of DNA into Bacillus cells can be achieved by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), transformation of competent cells (see, e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829; or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 5271-5278). Introduction of DNA into E. coli cells can be achieved by protoplast transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic Acids Res. 16:6127-6145). Introduction of DNA into Streptomyces cells can be achieved by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Microbiol. (Praha) 49:399-405), conjugation (see, e.g., Mazodier et al., 1989, J. Bacteriol. 171:3583-3585), or transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98:6289-6294). Introduction of DNA into Pseudomonas cells can be achieved by electroporation (see, e.g., Choi et al., 2006, J. Microbiol. Methods 64:391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71:51-57).Introduction of DNA into Streptococcus cells can be achieved by natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. [infection and immunity] 32: 1295-1297), protoplast transformation (see, e.g., Catt and Jollick, 1991, Microbios [microbiology] 68: 189-207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. [application and environmental microbiology] 65: 3800-3804), or conjugation (see, e.g., Clewell, 1981, Microbiol. Rev. [microbiology review] 45: 409-436). However, any method known in the art for introducing DNA into a host cell may be used.

[0147] The host cell may also be a eukaryotic organism, such as a mammalian, insect, plant, or fungal cell.

[0148] The host cell may be a fungal cell. "Fungi" as used herein includes Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, as well as Oomycota and all mitotic spore fungi (as defined by Hawksworth et al. in Ainsworth and Bisby's Dictionary of The Fungi, 8th ed., 1995, CAB International, University Press, Cambridge, UK).

[0149] The fungal host cell can be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of the present invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, Passmore and Davenport, eds., Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0150] The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

[0151] The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subphylum Eumycota and Oomycota (as defined by Hawksworth et al., 1995 (supra)). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is carried out by hyphal extension, and carbon catabolism is obligate aerobic. In contrast, the vegetative growth of yeast (such as Saccharomyces cerevisiae) is carried out by budding of a unicellular thallus, and carbon catabolism can be fermentative.

[0152] The filamentous fungal host cell can be a member of the genera Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, and the like. phthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cells.

[0153] For example, the filamentous fungal host cell can be Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinosa, Ceriporiopsis spp. keratinophilum), Chrysosporium lucknowense, Chrysosporiummerdarium, Chrysosporium pannicola, Chrysosporiumqueenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolushirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusariumgraminearum, Fusariumgraminum, Fusariumheterosporum, Fusarium negundi), Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium serrata, Fusarium oxysporum ...sarcochroum), Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium embellishment, Humicola insolens, Humicola lanuginosus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, koningii), Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

[0154] Fungal cells can be transformed in a manner known per se by methods involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 81: 1470-1474 and Christensen et al., 1988, Bio / Technology [Biology / Technology] 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene [Gene] 78: 147-156 and WO 96 / 00787. Yeast can be transformed using the procedures described by Becker and Guarente, in Abelson, JN and Simon, MI, eds., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, pp. 182-187, Academic Press, Inc., New York); Ito et al., 1983, J. Bacteriol. 153:163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75:1920.

[0155] Ineffective nuclease variants of RNA-guided endonucleases

[0156] Several RNA-guided endonucleases are known, and more have been discovered as scientific interest has increased in recent years; a review is provided in Makarova et al. (2015, An updated evolutionary classification of CRISPR–Cas systems, Nature 13:722-736).

[0157] An ineffective nuclease variant of the RNA-guided endonuclease of Eubacterium rectum (SEQ ID NO: 2, referred to as Mad7) can be prepared by disrupting its endonuclease activity (eg, by introducing a loss-of-function mutation in the catalytic domain responsible for the endonuclease activity).

[0158] In one embodiment, the RNA-guided endonuclease has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2; preferably, the RNA-guided endonuclease comprises, or consists of, SEQ ID NO: 2.

[0159] In one embodiment, the polynucleotide encoding the RNA-guided endonuclease has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1; preferably, the polynucleotide comprises, or consists of, SEQ ID NO: 1.

[0160] In one embodiment, the null nuclease variant of the RNA-guided endonuclease has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% but less than 100% sequence identity to SEQ ID NO: 2, and comprises an amino acid change at a position corresponding to position 877 of SEQ ID NO: 2. In a preferred embodiment, the amino acid at a position corresponding to position 877 of SEQ ID NO: 2 is substituted by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val (preferably by Ala). In a preferred embodiment, the null nuclease variant comprises, or consists of, the substitution D877A of SEQ ID NO: 2.

[0161] Guide RNA

[0162] The gRNA in CRISPR genome editing constitutes a reproducible part, making the system so universal. In the natural Streptococcus pyogenes system, gRNA is actually a complex of two RNA polynucleotides, and the first crRNA contains about 20 nucleotides, which determines the specificity of the RNA-guided endonuclease (called Cas9) and hybridizes with crRNA to form the tracr RNA of the RNA complex interacting with Cas9 (see Jinek et al., 2012, A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity [programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity], Science [science] 337: 816-821). The terms crRNA and tracrRNA are used interchangeably with the terms tracr paired RNA and tracr RNA in this article.

[0163] Since the discovery of the CRISPR-Cas9 system, single polynucleotide gRNAs have been developed and successfully used, and are as effective as the natural two-part gRNA complexes.

[0164] In a preferred embodiment, the gRNA or the at least two gRNAs comprise a first RNA comprising 20 or more nucleotides (e.g., 21, 22, 23, 24 or 25 nucleotides) that are at least 85% complementary to the one or more polynucleotides encoding one or more selective markers and capable of hybridizing with the one or more polynucleotides encoding one or more selective markers; preferably, the 20 or more nucleotides (e.g., 21, 22, 23, 24 or 25 nucleotides) are at least 90%, 95%, 97%, 98%, 99% or even 100% complementary to the one or more polynucleotides encoding one or more selective markers and capable of hybridizing with the one or more polynucleotides encoding one or more selective markers.

[0165] In a particularly preferred embodiment, the gRNA or the at least two gRNAs comprise a first RNA comprising 21 nucleotides that are at least 85% complementary to the one or more polynucleotides encoding one or more selective markers and capable of hybridizing with the one or more polynucleotides encoding one or more selective markers; preferably, the 21 nucleotides are at least 90%, 95%, 97%, 98%, 99% or even 100% complementary to the one or more polynucleotides encoding one or more selective markers and capable of hybridizing with the one or more polynucleotides encoding one or more selective markers.

[0166] In a preferred embodiment, the host cell of the invention comprises a single gRNA comprising the first and second RNAs in the form of a single polynucleotide, and wherein the tracr mate sequence and the tracr sequence form a stem-loop structure when hybridized to each other.

[0167] In order for the RNA-guided endonuclease-gRNA complex to hybridize to a target sequence (e.g., one or more polynucleotides encoding one or more selectable markers), the target sequence should be flanked by a functional protospacer adjacent motif (PAM sequence) for a specific RNA-guided endonuclease. For a review of PAM sequences, see, e.g., Shah et al., 2013, Protospacer recognition motifs, RNA Biol. 10(5): 891–899.

[0168] In a preferred embodiment, the PAM sequence is TTTN; more preferably, the PAM sequence is selected from the group consisting of: TTTA, TTTT, TTTG and TTTC; most preferably, the PAM sequence is TTTC.

[0169] The present invention is further described by the following examples, which should not be construed as limiting the scope of the present invention.

[0170] Examples

[0171] Materials and Methods

[0172] Chemicals used as buffers and substrates were commercial products of at least reagent grade.

[0173] PCR amplification was performed using standard textbook procedures using a commercial thermocycler and Ready-To-Go PCR beads from commercial suppliers, Phusion polymerase or RED-TAQ polymerase.

[0174] LB agar: see EP 0 506 780.

[0175] LBPSG agar plates contain LB agar supplemented with phosphate (0.01 M K3PO4), glucose (0.4%) and starch (0.5%); see EP 0 805 867 B1.

[0176] TY (liquid broth) medium: see WO 1994 / 14968, page 16.

[0177] Oligonucleotide primers were obtained from DNA technology (Aarhus, Denmark). DNA manipulations (plasmid and genomic DNA preparation, restriction enzyme digestion, purification, ligation, DNA sequencing) were performed using standard textbook procedures with commercially available kits and reagents.

[0178] TSS medium: 450 ml Millipore purified water containing 10 g of bacto agar was autoclaved for 20 minutes. After cooling to about 60°C, the following components were added: 25 ml 1M Tris (pH 7.5), 1 ml 2% FeCl3 6H2O, 1 ml 2% trisodium citrate dihydrate, 1.25 ml 1M K2HPO4, 1 ml 10% MgSO4 7H2O, 10 ml 10% L-glutamine (L-glutamine only dissolved during heating and autoclaving), 1.9 ml 87% glycerol (gain 0.4%, in 430 ml).

[0179] In some cases, the ligation mixture was amplified in an isothermal rolling circle amplification reaction using the TempliPhi kit from GE Healthcare.

[0180] DNA was introduced into Bacillus subtilis refined naturally competent cells using either a two-step procedure (Yasbin et al., 1975, J. Bacteriol. 121:296-304) or a one-step procedure in which the cell material from the agar plates was resuspended in Spizisen 1 medium (12 ml) (WO 2014 / 052630), shaken at 200 rpm at 37°C for approximately 4 hours, the DNA was added to 400 microliter aliquots, and these aliquots were shaken at 150 rpm for an additional hour at the desired temperature before plating on selective agar plates.

[0181] DNA was introduced into Bacillus licheniformis by conjugation from Bacillus subtilis using a modified Bacillus subtilis donor strain PP3724 containing pLS20, essentially as described previously (EP 2 029 732 B1), in which the methylase gene M. bli1904II (US 2013 / 0177942) was expressed from a triple promoter at the amyE locus, the pBC16-derived orfβ and the Bacillus subtilis comS gene (and a kanamycin resistance gene) were expressed from a triple promoter at the alr locus (making a D-alanine strain required), and the Bacillus subtilis comS gene (and the cat gene) were expressed from a triple promoter at the pel locus.

[0182] Bacillus subtilis JA1343: JA1343 is a sporulation-negative derivative of PL1801 (WO2005 / 042750). Part of the spollAC gene has been deleted to obtain a sporulation-negative phenotype.

[0183] All constructions described in the Examples were assembled from synthetic DNA fragments ordered from GeneArt-ThermoFisher Scientific. As described in the Examples, the fragments were assembled by sequence overlap extension (SOE).

[0184] According to previously described method (U.S. Patent number 5,843,720), the temperature-sensitive plasmid used in this patent is incorporated into the genome of Bacillus licheniformis by chromosome integration and cutting. The Bacillus licheniformis transformant containing plasmid grows on LBPG selective medium with erythromycin at 50 ℃, to force the vector to be integrated into the same sequence of chromosome. Based on its ability to grow on LBPG+ erythromycin selective medium at 50 ℃, select the desired integrant. Then, make the integrant grow in LBPG medium at 37 ℃ without selectivity, to allow the plasmid of integration to be cut. Cells are laid on LBPG plates and screened for erythromycin-sensitivity. Check whether the sensitivity clone has correctly integrated the required construct.

[0185] strains

[0186] PP3724: A Bacillus subtilis strain containing pLS20 in which the methylase gene M. bli1904II (US2013 / 0177942) is expressed from a triple promoter at the amyE locus, the pBC16-derived orfβ and the Bacillus subtilis comS gene (and a kanamycin resistance gene) are expressed from a triple promoter at the alr locus (making a D-alanine strain required), and the Bacillus subtilis comS gene (and cat gene) are expressed from a triple promoter at the pel locus.

[0187] JA1622: This strain is a Bacillus subtilis 168 derivative JA578 with a disrupted spoIIAC gene (sigF) described in WO 2002 / 00907. The genotype is: amyE::repF(pE194), spoIIAC.

[0188] SJ1904: This strain is a Bacillus licheniformis strain described in WO 2008 / 066931. The gene encoding alkaline protease (aprL) is inactivated.

[0189] PP3811: A derivative of Bacillus licheniformis strain SJ1904, in which the alkaline protease gene aprL, the metalloprotease mprL and the spoIIAC gene are inactivated.

[0190] PP3811-Mad7d: This strain is Bacillus licheniformis strain PP3811 in which the mad7d gene was inserted at the bglC locus. The final insert has the mad7d gene transcribed from the PamyL promoter variant described in WO 1993 / 010249. The final sequence on the chromosome after integration is at Figure 1 and described in SEQ ID NO:3.

[0191] PP3811-Mad7gDNA1: This strain is the Bacillus licheniformis strain PP3811-Mad7d, in which the dsRED gene and a gDNA (cat) transcribing a gRNA (cat) against the catL gene in Bacillus licheniformis were inserted into the gnt locus. Further downstream of the gDNA, the attB site from bacteriophage TP901-1 was located (WO 2006 / 042548). The dsRED gene is expressed from the triple promoter described in WO1999 / 043835. The final sequence on the chromosome after integration is at Figure 2 and described in SEQ ID NO:4.

[0192] PP3811-Mad7gDNA2: This strain is the B. licheniformis strain PP3811-Mad7gDNA1, in which the dsRED gene and a gDNA (cat) transcribing a gRNA (cat) against the catL gene in B. licheniformis were inserted into the amyL locus. Further downstream of the gDNA, an attB site was located (see above). The final sequence on the chromosome after integration is Figure 3 and described in SEQ ID NO:5.

[0193] PP3811-Mad7gDNA3: This strain is B. licheniformis PP3811-Mad7gDNA2, in which the dsRED gene and a gDNA (cat) transcribing a gRNA (cat) against the catL gene in B. licheniformis were inserted into the lacA2 locus. Further downstream of the gDNA, an attB site was located (see above). The final sequence on the chromosome after integration is Figure 4 and described in SEQ ID NO:6.

[0194] MOL7800-amyL3: This is B. licheniformis strain PP3811-Mad7gDNA3, in which the dsRED gene and three copies of gDNA (cat) were replaced by three copies of the amyL gene encoding B. licheniformis alpha-amylase. Figure 5-7 The final sequences of the three loci of the chromosome after replacement are described in SEQ ID NOs: 7-9.

[0195] PP3724-pPPamyL-attP: This strain is the conjugative donor strain PP3724 containing the plasmid pPPamyL-attP.

[0196] Plasmids

[0197] pC194: a plasmid isolated from Staphylococcus aureus (Horinouchi and Weisblum, 1982).

[0198] pE194: a plasmid isolated from Staphylococcus aureus (Horinouchi and Weisblum, 1982).

[0199] pUB110: Plasmid isolated from Staphylococcus aureus (McKenzie et al., 1986)

[0200] pPPamyL-attP: A plasmid constructed in Example 6 of the present invention. This plasmid was prepared by synthetic sequence assembly to generate a vector containing: (1) the amyL gene encoding Bacillus licheniformis α-amylase, which is preceded by a cry3A stabilizer for integration (2) attP and integrase (int) from TP901-1 described in WO 2006 / 042548. The integrase promotes integration of the attP site on the Bacillus licheniformis host plasmid and the attB site on the chromosome.

[0201] Example 1. Chromosomal integration of mad7d into the bglC locus of Bacillus licheniformis

[0202] An expression cassette was inserted into the bglC locus, wherein the mad7d gene encoding the null nuclease variant of SEQ ID NO: 2 (Mad7d comprising a D877A substitution) was expressed from the amyL promoter (P4199) described in WO 1993 / 010249.

[0203] DNA for integration was ordered as synthetic DNA (Gene Arts - Thermo Fisher Scientific) and cloned into the integration vector as previously described in WO 2006 / 042548. Figure 1 The final map of the bglC locus is shown in . The nucleotide sequence of this locus is provided as SEQ ID NO:3.

[0204] The conditions for PCR amplification are as follows: the corresponding DNA fragments were amplified by PCR using the Phusion hot start DNA polymerase system (Thermo Fisher Scientific). The PCR amplification reaction mixture contained 1 ul (about 0,1 ug) of template DNA, 2 ul of sense primer (20 pmol / ul), 2 ul of antisense primer (20 pmol / ul), 10 ul of 5X PCR buffer (with 7,5 mM MgCl2), 8 ul of dNTP mixture (each 1.25 mM), 37 ul of water, and 0.5 ul (2 U / ul) DNA polymerase mixture. A thermal cycler was used to amplify the fragments. The PCR products were purified from 1.2% agarose gels using a Qiagen QIAquick gel extraction kit (Qiagen, Inc., Valencia, CA) according to the manufacturer's instructions.

[0205] The PCR product is used in the subsequent PCR reaction, and a single plasmid is produced using the Phusion hot start DNA polymerase system (Thermo Scientific) using splicing overlap PCR (SOE). The PCR amplification reaction mixture contains two kinds of gel-purified PCR products and each 50ng of the synthetic fragment, and is assembled and amplified plasmids with a thermal cycler. The SOE product gained is directly used in the transformation of Bacillus subtilis host JA1622 to set up plasmids. The plasmid is transferred to the donor strain PP3724 by competence.

[0206] The recipient Bacillus licheniformis strain was transformed with the above plasmid and integrated and excised according to the above procedure. By this procedure, the bglC locus on the chromosome was replaced by the cloned construct delivered by the plasmid ( Figure 1 ). The plasmid was lost at the restrictive temperature of 50° C. The final strain construct contained the mad7d gene expressed from the bglC locus on the chromosome and was named PP3811-Mad7d.

[0207] Example 2. Chromosomal integration of dsRED-ma7gDNA (cat) into the gnt locus of Bacillus licheniformis

[0208] An expression cassette is inserted into the gnt locus, where the dsRED marker gene encoding a red fluorescent protein is expressed from the P3 promoter described in WO2005 / 098016. Downstream of the dsRED marker gene, the Mad7gDNA sequence is expressed from the amyQ promoter of Bacillus amyloliquefaciens. The gDNA transcribes the gRNA for the cat marker gene. The cat marker gene encodes the acetyltransferase of Bacillus licheniformis, which confers resistance to chloramphenicol. The integration of DNA chromosomes into Bacillus licheniformis has been described in WO 2007 / 138049. The DNA for integration was ordered as synthetic DNA (Gene Art - Thermo Fisher Scientific), assembled by SOE-PCR and cloned into a temperature-sensitive integration vector based on pE194 as previously described. In Figure 2 The final map of the gnt locus is shown in . The nucleotide sequence of this locus is provided as SEQ ID NO:4.

[0209] PCR products are prepared as described in Example 1 and used in subsequent PCR reactions to generate single plasmids using Phusion hot start DNA polymerase system (Thermo Scientific) using splicing overlap PCR (SOE). PCR amplification reaction mixture contains two kinds of gel-purified PCR products and each 50ng of synthetic fragments, and is assembled and amplified with a thermal cycler to integrate plasmids. The SOE product gained is directly used for the transformation of Bacillus subtilis host JA1622 to set up an integrated plasmid. The plasmid is transferred to the donor strain PP3724 and used for conjugation. This plasmid is used to insert the dsRED gene and Mad7gDNA (cat) at the gnt locus of Bacillus licheniformis according to the procedure described in Example 1. The final strain is named PP3811-Mad7gDNA1.

[0210] Example 3. Chromosomal integration of dsRED-gDNA (cat) into the amyL locus of Bacillus licheniformis

[0211] At the amyL locus an expression cassette identical to that described in Example 2 was inserted. DNA for integration was ordered as synthetic DNA (Gene Arts - Thermo Fisher Scientific), assembled by SOE-PCR and cloned into a temperature-sensitive integration vector based on pE194 as previously described in WO2006 / 042548. Figure 3 The final map of the amyL locus is shown in . The nucleotide sequence of this locus is provided as SEQ ID NO:5.

[0212] PCR products are prepared as described in Example 1 and used in subsequent PCR reactions to generate single plasmids using Phusion hot start DNA polymerase system (Thermo Scientific) using splicing overlap PCR (SOE). PCR amplification reaction mixture contains two kinds of gel-purified PCR products and each 50ng of synthetic fragments, and is assembled and amplified with a thermal cycler. The resulting SOE product is directly used for the transformation of Bacillus subtilis host JA1622 to set up an integrated plasmid. This plasmid is used to insert dsRED gene and Mad7gDNA (cat) at the amyL locus of Bacillus licheniformis strain PP3811-Mad7gDNA1 as described above in Example 2. The final strain is named as PP3811-Mad7gDNA2. This strain has two copies of Mad7gDNA (cat) encoding the gRNA for the catL gene in the Bacillus licheniformis host.

[0213] Example 4. Chromosomal integration of dsRED-Mad7gDNA (cat) into the lacA2 locus of Bacillus licheniformis

[0214] An expression cassette almost identical to that described in Examples 2 and 3 was inserted at the lacA2 locus. The only difference was an alternative synthetic sequence for the dsRED gene (dsREDsyn). This gene variant still encodes the same fluorescent protein. The DNA for integration was ordered as synthetic DNA (Gene Arts - Thermo Fisher Scientific) and cloned into an integration vector as described in WO 2006 / 042548. Figure 4 The final map of the lacA2 locus is shown in . The nucleotide sequence of this locus is provided as SEQ ID NO:6.

[0215] PCR products were prepared as described in Example 1 and used in subsequent PCR reactions to generate a single plasmid using splicing overlap PCR (SOE) using the Phusion hot start DNA polymerase system (Thermo Scientific). The PCR amplification reaction mixture contained 50 ng of each of the two gel-purified PCR products and the synthetic fragments, and the integration plasmid was assembled and amplified using a thermal cycler. The resulting SOE product was directly used for transformation of the Bacillus subtilis host JA1622 to establish an integration plasmid. This plasmid was used to insert the dsRED gene (dsREDsyn) and Mad7gDNA (cat) at the lacA2 locus of Bacillus licheniformis PP3811-Mad7gDNA2 as described above in Example 3. The final strain was named PP3811-Mad7gDNA3 and had three copies of the dsRED gene and three copies of the Mad7gDNA (cat) cassette as well as Mad7d (expressed from the bglC locus). Figure 8 ).

[0216] Example 5. Construction of plasmid pPPamyL-attP

[0217] Plasmid pPPamyL-attP was assembled from DNA sequences ordered from GeneArt. Fig. 9 The complete plasmid and its annotations are depicted in. The nucleotide sequence of this plasmid is provided as SEQ ID NO:10.

[0218] The conditions used for PCR amplification were as described in Example 1. The purified PCR products were used in subsequent PCR reactions to generate a single plasmid using splicing overlap PCR (SOE) using the Phusion Hot Start DNA Polymerase System (Thermo Scientific). The PCR amplification reaction mixture contained 50 ng of each of the six gel-purified PCR products and was assembled and amplified using a thermal cycler to produce a 9550 bp plasmid ( Fig. 9 ). The resulting SOE product was used directly to transform the Bacillus subtilis host JA1622 to create the plasmid pPPamyL-attP. This plasmid was used in Example 6 to transform the host strain PP3811-Mad7gDNA3 described in Example 4.

[0219] This plasmid encodes the amylase gene amyL from Bacillus licheniformis, flanked by the cry3A stabilizer region and upstream of the attP phage integration site.

[0220] Integration of amyL into the chromosome will occur between the cry3A stabilizer region present in the host strain PP3811-Mad7gDNA3 and on the plasmid and between the attB and attP sites on the chromosome and plasmid, respectively.

[0221] Example 6. Selection for integration of three copies of the amylase gene amyL

[0222] The plasmid pPPamyL-attP described in Example 5 was transformed into Bacillus licheniformis strain PP3811-Mad7gDNA3 for selection for stepwise integration of the amyL expression cassette in three different loci (gnt: dsRED-Mad7gDNA(cat), amyL: dsRED-Mad7gDNA(cat), and lacA2: dsRED-Mad7gDNA(cat)). In this step, the gDNA(cat) and dsRED genes were replaced by the amyL expression cassette. The replacement was mediated by recombination between the flanking regions on the gDNA locus on the chromosome and the introduced plasmid; upstream through the same cry3A stabilizer region present on the chromosome of the host strain PP3811-Mad7gDNA3 and on the plasmid pPPamyL-attP, and downstream through the attB and attP sites on the chromosome and plasmid, respectively.

[0223] After plasmid transformation of PP3811-Mad7gDNA3, cells were plated on LBPG plates at 34°C with 1 ug / ml erythromycin for three days to allow amplification and recombination events to occur between chromosome and plasmid at a permissive temperature. The colonies were washed in 200ul TY, and 50ul was transferred to 5ml TY liquid culture and incubated at 34°C at 200rpm for 24 hours. The culture was streaked on LBPG plates with 6ug / ml chloramphenicol (cam) to select strains in which all three gDNA (cat) loci were replaced by the amyL expression cassette.

[0224] Approximately ten different colonies from the cam plate were restreaked and tested for amyL integration in all three loci. All colonies showed the expected bands on the agarose gel.

[0225] Figure 5-7 The three loci after replacement are shown and their DNA sequences are provided as SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The strain was named MOL7800-amyL3.

[0226] Chloramphenicol resistant clones had amylase activity, which was shown by plating on LBPG plates supplemented with starch. All colonies showed a distinct halo on the plates supplemented with starch, confirming the expression of amylase.

[0227] This example shows that the present invention can be used very effectively as a tool for selecting for the integration of at least three copies of an expression cassette on the chromosome of B. licheniformis.

[0228] Example 7. Construction of host cells using flp / FRT technology to select for three-copy integration of DNA.

[0229] Examples 7 and 8 of PCT / EP2018 / 084463 describe the construction and utilization of host strains that select for genomic integration of three copies of the target gene. The present invention discloses an alternative and improved system for selecting the integration of the target gene. Here, a host strain containing a strong promoter (triplet promoter, P3) is constructed, and the strong promoter reads in a fragment consisting of a FRT-F site, Mad7d, and a gDNA encoding a gRNA targeting the glpD gene, optionally a marker gene, and a FRT-F3 site. Mad7d is expressed together with the glpD directional gRNA to ensure the inhibition of the glpD gene, which causes the host strain to be unable to grow on a minimal medium containing glycerol as the sole carbon source. Other genes involved in sugar metabolism can be used as targets, some examples of which are disclosed in WO 2003 / 055967.

[0230] The Mad7d-gRNA_glpD marker fragment was subsequently replaced with the gene of interest using the flp / FRT system (WO 2018 / 077796), which resulted in a strain now able to grow in minimal medium containing glycerol as the sole carbon source and in this way the gene replacement could be selected.

[0231] If the Mad7d-gRNA_glpD fragment has been inserted into more than one chromosomal site, selection for growth in minimal medium containing glycerol will produce strains with integration of the gene of interest at all such sites.

[0232] As the first step in the construction, a DNA sequence consisting of a FRT-F site, a Mad7d fragment encoding a preceding ribosome binding site, a fragment encoding green fluorescent protein (GFP), a PamyQsc promoter and a Mad7 scaffold and a gDNA targeting amyL promoter PamyL4199 variant, and a FRT-F3 site was provided as a full gene synthesis from an E. coli plasmid from Gene Arts, and the plasmid was introduced into and stored in E. coli TOP10 cells as SJ14411 (E. coli TOP10 / pSJ14411). The full DNA sequence of plasmid pSJ14411 is provided herein as SEQ ID NO: 11.

[0233] In the second step, three DNA sequences corresponding to the gfp gene part, the PamyQsc promoter and the Mad7 scaffold, as well as gDNA targeting each of the three glpD gene fragments, followed by the FRT-F3 site were synthesized as a whole gene from an E. coli plasmid obtained from Gene Arts, Inc. These plasmids were introduced and maintained into E. coli TOP10 cells as SJ14412 (E. coli TOP10 / pSJ14412), SJ14413 (E. coli TOP10 / pSJ14413) and SJ14414 (E. coli TOP10 / pSJ14414).

[0234] The complete DNA sequences of plasmids pSJ14412, pSJ14413, and pSJ14414 are provided herein as SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, respectively.

[0235] In the third step, in order to obtain the final integration construct for the construction of a host strain selecting for flp / FRT-mediated chromosomal insertion, three different 3-fragment ligations were performed:

[0236] pSJ13461 (described in Example 19 of WO 2018 / 077796) was cut with SbfI and MluI, and the 5785 bp SbfI-MluI fragment was gel purified.

[0237] pSJ14411 was digested with MluI and MfeI, and the 4465 bp MluI-MfeI fragment was gel purified.

[0238] Each of pSJ14412, pSJ14413 and pSJ14414 was digested with MfeI and SbfI, and a 373 bp MfeI-SbfI fragment was purified therefrom.

[0239] Each of the pSJ14412, pSJ14413, and pSJ14414 fragments was combined with the pSJ13461 and pSJ14411 fragments, ligated, and the ligation mixture treated with TempliPhi prior to introduction into Bacillus subtilis PP3724 competent cells. The resulting transformants from each transformation were combined separately, and these transformant pools were saved as SJ14438 (PP3724 / pSJ14438), SJ14439 (PP3724 / pSJ14439), and SJ14440 (PP3724 / pSJ14440).

[0240] The complete DNA sequences of plasmids pSJ14438, pSJ14439, and pSJ14440 are provided herein as SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, respectively.

[0241] In the fourth step, the final integration construct used to construct a host strain that selects for gene integration was introduced into the single copy flp / FRT host strain SJ13872 (which has a gene encoding yellow fluorescent protein (YFP) between the FRT-F and FRT-F3 sites), or into a derivative that will have the YFP encoding gene exchanged with the gene encoding red fluorescent protein (RFP). To achieve this color gene exchange, a temperature sensitive vector expressing the flippase and carrying the fragment FRT-F-RFP-FRT-F3 was constructed, introduced into Bacillus subtilis PP3724 and stored as SJ14491 (pSJ14491 / PP3724) for subsequent conjugation with Bacillus licheniformis SJ13872. The full DNA sequence of pSJ14491 is provided as SEQ ID NO: 18 herein.

[0242] pSJ14491 was introduced into SJ13872 by conjugation, and the transconjugants were selected on LBPSG agar plates containing erythromycin (2 μg / ml). These transconjugants were further plated into single colonies on plates without erythromycin, and those that appeared to have lost the plasmid (sensitive to erythromycin) and showed red fluorescence (indicating that RFP replaced YFP) were retained.

[0243] The single copy flp / FRT host strain SJ13872 used herein was developed from SJ1904 (a Bacillus licheniformis strain described in WO2008 / 066931) and contains a P3 promoter at the chromosomal lacA2 locus, which reads in a fragment consisting of FRT-F, a gene encoding YFP, and FRT-F3. Strain SJ13872 is wild type with respect to the glpD locus, but contains a number of other modifications not relevant to its use as described in this application.

[0244] The three different plasmids pSJ14438, pSJ14439 and pSJ14440 (carrying three separate gDNAs encoding gRNAs targeting different Bacillus licheniformis glpD gene fragments) were introduced into SJ13872 or into its red derivatives by conjugation. Transconjugants were selected on LBPSG agar plates containing erythromycin (2 micrograms / ml) at 30°C. These transconjugants were further plated into single colonies on plates without erythromycin, and those transconjugants that seemed to have lost the plasmid (sensitive to erythromycin) and showed green fluorescence were retained.

[0245] These transconjugant colonies were further plated on TSS minimal medium plates containing glycerol as the sole carbon source to verify their inability to grow on such plates (due to the expression of Mad7d and gRNA_glpD, which repress glpD expression).

[0246] However, by integration of the Mad7d+gRNA_glpD construct, strains derived from SJ13872 or its red derivatives are used as recipients in conjugation with donor strains carrying the gene of interest, such as, for example, the amyL gene, between the FRT-F and FRT-F3 sites on a vector also expressing the flippase, and the transfer conjugates can be selected on LBPSG agar plates containing erythromycin (2 μg / ml) as before, and strains in which the Mad7d+gRNA_glpD fragment is replaced by the gene of interest (e.g., amyL) can be directly selected by their ability to grow on / in TSS minimal medium containing glycerol as the sole carbon source. Sequence Listing <110> Novozymes A / S <120> Counterselection by repression of conditionally essential genes <130> 15061-WO-PCT <160> 18 <170> PatentIn Version 3.5 <210> 1 <211> 3792 <212> DNA <213> Eubacterium rectale <400> 1 atgaataatg gcacaaataa cttccagaac ttcattggca ttagcagcct gcaaaaaaca 60 ctgagaaatg cactgattcc gacagaaaca acacagcagt ttattgtcaa aaacggcatc 120 atcaaagagg atgaactgag aggcgaaaat cgccaaattc tgaaagatat catggacgac 180 tattaccgtg gctttatttc agaaacactg tccagcattg atgatatcga ttggacaagc 240 ctgttcgaga aaatggaaat ccaactgaaa aacggcgata acaaagacac gctgattaaa 300 gaacaaacgg aatatcgcaa agcgatccac aaaaagtttg caaatgatga ccgctttaaa 360 aacatgttca gcgcgaaact gattagcgat attctgccgg aatttgtcat ccacaataat 420 aactatagcg cgagcgagaa agaagaaaaa acacaggtca ttaaactgtt tagccgcttt 480 gccacaagct tcaaagacta tttcaaaaat cgcgcaaact gctttagcgc agatgatatt 540 tcatcatcaa gctgccatcg gattgtcaat gatatgcgg aaatctttt tagcaacgca 600 ctggtctatc gcagaattgt taaatcattg agcaacgacg acatcacaa aatctcaggc 660 gattgaaag acagcctgaa agaatgtca ctggaagaa tctacagcta cgaaaaatac 720 ggcgaattta tcacacaaga aggcatcagc ttcaacc atatttgcgg caaagtcaac 780 agctttatga atctgtattg ccagaaaac aaagaaaaaaacctgta taaactgcag 840 aaactgcaca agcagattct gtgcattgca gatacatcat atgaagtccc gtacaaattt 900 gagagcgacg aagagtttta tcaagcgtt aatggctttc tggatacat cagcagcaaa 960 catattgttg aacgcctgag aaaaattggc gataactata atggctacaa cctggacaaa 1020 atctacatcg tcagcaatt ttacgaaagc gtcagccaaa aaacatatcg cgattgggaa 1080 acaattaata cagcgctgga aattcattat aacaattc tgcctggca cggcaaagc 1140 aaagcagata aagttaaaaa ggcggtcaa atgacctgc agaaagcat tacagaaatc 1200 aatgaactgg tcagcacta caactgtgc tcagatgata atcaagc ggaaacgtac 1260 atccatgaaa ttagccatat cctgaacaac tttgaagcgc aagaactgaa atataacccg 1320 gaaatccatc tggttgaaag cgaactgaaa gcaagcgagc tgaaaaatgt tctggatgtc 1380 attatgaatg cgttcattg gtgcagcgtc ttatgacag aagaactggt cgataagat 1440 aacaactttt atgcggact ggaagagatt tacgacgaa ttatccggt catcagcctg 1500 tataatctgg ttcgcaatta tgtcacacag aaccgtata gcacgagaa atcaactg 1560 aactttggca ttccgacact ggcagatggc tggtcaaat CAAagaata tagcacac 1620 gcgatcatcc tgatgcgcga taatcttat tatctgggca tttcaacgc gaaaaacaag 1680 ccggacaaa aaatcatcga agcaatacg tcagagaca aaggcgacta taaaagatg 1740 atctataatc tgcttccgggg accgaataa atgatcccga aagttttctct gtcaagcaa 1800 acaggcgtcg aaacatataa accgtcagcg tatattctgg aaggctaca acagaacaa 1860 cacatcaaaa gcagcaagga ctttgacatc acatttgcc atgatctt cgactacttt 1920 aagaactgca ttgcaattca tccggaatgg aaaaacttcg gcttgattt ttcacacacg 1980 agcacgtatg aagatatcag cggcttttat agagaagttg aactgcaggg ctataaaatc 2040 gactggacat atatcagcga aaaggatatt gatctgctgc aagaaaaagg ccaactgtac 2100 ctgtttcaga tctacaacaa agacttcagc aaaaaaaagca cgggcaatga taacctgcat 2160 acgatgtacc tgaaaaacct ttttagcgaa gagaacctga aagacattgt cctgaaactg 2220 aatggcgaag ccgaaatttt ctttcgcaaa tccagcatta aaaacccgat catccataaa 2280 aaaggcagca ttctggttaa ccgcacatat gaagcggaag aaaaagatca gtttggcaac 2340 attcagatcg tccgcaaaaa cattccggaa aacatttatc aagaactgta caaatacttt 2400 aacgataaaa gcgataaaga actgtccgac gaagcagcga aacttaaaaa tgttgttggc 2460 catcatgaag cggcaacaaa cattgttaaa gactatcgct atacgtacga taaatacttt 2520 ctgcatatgc cgatcacgat caacttcaaa gcaataaaaa cgggctttat caacgatcgc 2580 attctgcagt atattgccaa agaaaaggat ctgcatgtca tcggcattgc tagaggcgaa 2640 cgcaatctga tttatgtcag cgttattgat acatgcggca acattgtcga acagaaaagc 2700 tttaacattg tcaacggcta tgactaccag atcaagctga aacagcaaga aggcgcaaga 2760 caaattgctc gcaaagaatg gaaagaaatc ggcaagatca aagaaattaa agagggctat 2820 ctgagcctgg tcattcatga aatttctaaa atggtcatca aataacgc gattatcgcc 2880 atggaagatc tgtcatatgg ctttaagaaa ggccgtttta aagtcgaaag acaggtctac 2940 cagaaattcg aaacaatgct gattaacaaa ctgaattatc tggtgtttaa agacatcagc 3000 atcacggaaa atggcggact gctgaaaggc tatcaactga catatattcc ggataagctt 3060 aaaaacgtcg gccatcaatg cggctgcatc tttatgttc cggcagcgta tacatcaaaa 3120 attgatccga caacaggctt tgtcaacatc ttcaaattca aagatctgac ggtcgatgcg 3180 aaacgcgaat tcattaagaa atttgacagc atccgctacg acagcgagaa aaatctttc 3240 tgctttacgt tcgactacaa caactttatc acgcagaata cggttatgtc aaaaagcagc 3300 tggtcagtct atacatatgg cgttagaatt aaacgcagat ttgtgaacgg cagatttagc 3360 aatgaaagcg atacaatcga catcacgaaa gacatggaaa aaacgcttga aatgacggat 3420 attaactggc gtgatggaca tgatcttcgc caggatatta tcgattatga aatcgtccag 3480 cacatctttg aaatctttag actgacagtc caaatgcgca attcactgtc agaacttgaa 3540 gatagagatt atgatcgcct gatttctccg gtcctgaatg aaaataacat cttttacgat 3600 agcgcaaaag caggcgacgc actgccgaaa gatgcggatg caaatggcgc atattgcatt 3660 gcactgaaag gcctgtatga aatcaaacaa atcaccgaga attggaaaga ggacggcaaa 3720 ttttcacggg ataaactgaa aatcagcaac aaggactggt ttgacttcat ccaaaataag 3780 cgctacctgt aa 3792 <210> 2 <211> 1263 <212> PRT <213> Eubacterium rectale <400> 2 Met Asn Asn Gly Thr Asn Asn Phe Gln Asn Phe Ile Gly Ile Ser Ser 1 5 10 15 Leu Gln Lys Thr Leu Arg Asn Ala Leu Ile Pro Thr Glu Thr Thr Gln 20 25 30 Gln Phe Ile Val Lys Asn Gly Ile Ile Lys Glu Asp Glu Leu Arg Gly 35 40 45 Glu Asn Arg Gln Ile Leu Lys Asp Ile Met Asp Asp Tyr Tyr Arg Gly 50 55 60 Phe Served With Glu Thr Leu Ser Served With Asp With Asp Trp Thr Ser 65 70 75 80 Leu Phe Glu Lys Met Glu Ile Gln Leu Lys Asn Gly Asp Asn Lys Asp 85 90 95 Three Leu Ile Lys Glu Gln Three Glu Tyr Arg Lys Ala Ile His Lys Lys 100 105 110 Phe Ala Asn Asp Asp Arg Phe Lys Asn Met Phe Ser Ala Lys Leu Ile 115 120 125 Ser Asp Ile Leu Pro Glu Phe Val Ile His Asn Asn Asn Tyr Ser Ala 130 135 140 Ser Glu Lys Glu Glu Lys Thr Gln Val Ile Lys Leu Phe Ser Arg Phe 145 150 155 160 Ala Thr Ser Phe Lys Asp Tyr Phe Lys Asn Arg Ala Asn Phe Ser 165 170 175 Only Asp Asp Ile Ser Ser Ser Cys His Arg Ile Val Asn Asn Asn 180 185 190 Ala Glu Ile Phe Phe Ser Asn Ala Leu Val Tyr Arg Arg Ile Val Lys 195 200 205 Ser Leu Ser Asn Asp Asp Ile Asn Lys Ile Ser Gly Asp Met Lys Asp 210 215 220 Ser Leu Lys Glu Met Ser Leu Glu Glu Ile Tyr Ser Tyr Glu Lys Tyr 225 230 235 240 Gly Glu Phe Ile Thr Gln Glu Gly Ile Ser Phe Tyr Asn Asp Ile Cys 245 250 255 Gly Lys Val Asn Ser Phe Met Asn Leu Tyr Cys Gln Lys Asn Lys Glu 260 265 270 Asn Lys Asn Leu Tyr Lys Leu Gln Lys Leu His Lys Gln Ile Leu Cys 275 280 285 Ile Ala Asp Thr Ser Tyr Glu Val Pro Tyr Lys Phe Glu Ser Asp Glu 290 295 300 Glu Val Tyr Gln Ser Val Asn Gly Phe Leu Asp Asn Ile Ser Ser Lys 305 310 315 320 His Ile Val Glu Arg Leu Arg Lys Ile Gly Asp Asn Tyr Asn Gly Tyr 325 330 335 Asn Leu Asp Lys Ile Tyr Ile Val Ser Lys Phe Tyr Glu Ser Val Ser 340 345 350 Gln Lys Thr Tyr Arg Asp Trp Glu Thr Ile Asn Thr Ala Leu Glu Ile 355 360 365 His Tyr Asn Asn Ile Leu Pro Gly Asn Gly Lys Ser Lys Ala Asp Lys 370 375 380 Val Lys Lys Ala Val Lys Asn Asp Leu Gln Lys Ser Ile Thr Glu Ile 385 390 395 400 Asn Glu Leu Val Ser Asn Tyr Lys Leu Cys Ser Asp Asp Asn Ile Lys 405 410 415 Ala Glu Thr Tyr Ile His Glu Ile Ser His Ile Leu Asn Asn Phe Glu 420 425 430 Ala Gln Glu Leu Lys Tyr Asn Pro Glu Ile His Leu Val Glu Ser Glu 435 440 445 Leu Lys Ala Ser Glu Leu Lys Asn Val Leu Asp Val Ile Met Asn Ala 450 455 460 Phe His Trp Cys Ser Val Phe Met Thr Glu Glu Leu Val Asp Lys Asp 465 470 475 480 Asn Asn Phe Tyr Ala Glu Leu Glu Glu Ile Tyr Asp Glu Ile Tyr Pro 485 490 495 Val Ile Ser Leu Tyr Asn Leu Val Arg Asn Tyr Val Thr Gln Lys Pro 500 505 510 Tyr Ser Thr Lys Lys Ile Lys Leu Asn Phe Gly Ile Pro Thr Leu Ala 515 520 525 Asp Gly Trp Ser Lys Ser Lys Glu Tyr Ser Asn Asn Ala Ile Ile Leu 530 535 540 Met Arg Asp Asn Leu Tyr Tyr Leu Gly Ile Phe Asn Ala Lys Asn Lys 545 550 555 560 Pro Asp Lys Lys Ile Ile Glu Gly Asn Thr Ser Glu Asn Lys Gly Asp 565 570 575 Tyr Lys Lys Met Ile Tyr Asn Leu Leu Pro Gly Pro Asn Lys Met Ile 580 585 590 Pro Lys Val Phe Leu Ser Ser Lys Thr Gly Val Glu Thr Tyr Lys Pro 595 600 605 Ser Ala Tyr Ile Leu Glu Gly Tyr Lys Gln Asn Lys His Ile Lys Ser 610 615 620 Ser Lys Asp Phe Asp Ile Thr Phe Cys His Asp Leu Ile Asp Tyr Phe 625 630 635 640 Lys Asn Cys Ile Ala Ile His Pro Glu Trp Lys Asn Phe Gly Phe Asp 645 650 655 Phe Ser Asp Thr Ser Thr Tyr Glu Asp Ile Ser Gly Phe Tyr Arg Glu 660 665 670 Val Glu Leu Gln Gly Tyr Lys Ile Asp Trp Thr Tyr Ile Ser Glu Lys 675 680 685 Asp Ile Asp Leu Leu Gln Glu Lys Gly Gln Leu Tyr Leu Phe Gln Ile 690 695 700 Tyr Asn Lys Asp Phe Ser Lys Lys Ser Thr Gly Asn Asp Asn Leu His 705 710 715 720 Thr Met Tyr Leu Lys Asn Leu Phe Ser Glu Glu Asn Leu Lys Asp Ile 725 730 735 Val Leu Lys Leu Asn Gly Glu Ala Glu Ile Phe Phe Arg Lys Ser Ser 740 745 750 Ile Lys Asn Pro Ile Ile His Lys Lys Gly Ser Ile Leu Val Asn Arg 755 760 765 Thr Tyr Glu Ala Glu Glu Lys Asp Gln Phe Gly Asn Ile Gln Ile Val 770 775 780 Arg Lys Asn Ile Pro Glu Asn Ile Tyr Gln Glu Leu Tyr Lys Tyr Phe 785 790 795 800 Asn Asp Lys Ser Asp Lys Glu Leu Ser Asp Glu Ala Ala Lys Leu Lys 805 810 815 Asn Val Val Gly His His Glu Ala Ala Thr Asn Ile Val Lys Asp Tyr 820 825 830 Arg Tyr Thr Tyr Asp Lys Tyr Phe Leu His Met Pro Ile Thr Ile Asn 835 840 845 Phe Lys Ala Asn Lys Thr Gly Phe Ile Asn Asp Arg Ile Leu Gln Tyr 850 855 860 Ile Ala Lys Glu Lys Asp Leu His Val Ile Gly Ile Ala Arg Gly Glu 865 870 875 880 Arg Asn Leu Ile Tyr Val Ser Val Ile Asp Thr Cys Gly Asn Ile Val 885 890 895 Glu Gln Lys Ser Phe Asn Ile Val Asn Gly Tyr Asp Tyr Gln Ile Lys 900 905 910 Leu Lys Gln Gln Glu Gly Ala Arg Gln Ile Ala Arg Lys Glu Trp Lys 915 920 925 Glu Ile Gly Lys Ile Lys Glu Ile Lys Glu Gly Tyr Leu Ser Leu Val 930 935 940 Ile His Glu Ile Ser Lys Met Val Ile Lys Tyr Asn Ala Ile Ile Ala 945 950 955 960 Met Glu Asp Leu Ser Tyr Gly Phe Lys Lys Gly Arg Phe Lys Val Glu 965 970 975 Arg Gln Val Tyr Gln Lys Phe Glu Thr Met Leu Ile Asn Lys Leu Asn 980 985 990 Tyr Leu Val Phe Lys Asp Ile Ser Ile Thr Glu Asn Gly Gly Leu Leu 995 1000 1005 Lys Gly Tyr Gln Leu Thr Tyr Ile Pro Asp Lys Leu Lys Asn Val 1010 1015 1020 Gly His Gln Cys Gly Cys Ile Phe Tyr Val Pro Ala Ala Tyr Thr 1025 1030 1035 Ser Lys Ile Asp Pro Thr Thr Gly Phe Val Asn Ile Phe Lys Phe 1040 1045 1050 Lys Asp Leu Thr Val Asp Ala Lys Arg Glu Phe Ile Lys Lys Phe 1055 1060 1065 Asp Ser Ile Arg Tyr Asp Ser Glu Lys Asn Leu Phe Cys Phe Thr 1070 1075 1080 Phe Asp Tyr Asn Asn Phe Ile Thr Gln Asn Thr Val Met Ser Lys 1085 1090 1095 Ser Ser Trp Ser Val Tyr Thr Tyr Gly Val Arg Ile Lys Arg Arg 1100 1105 1110 Phe Val Asn Gly Arg Phe Ser Asn Glu Ser Asp Thr Ile Asp Ile 1115 1120 1125 Thr Lys Asp Met Glu Lys Thr Leu Glu Met Thr Asp Ile Asn Trp 1130 1135 1140 Arg Asp Gly His Asp Leu Arg Gln Asp Ile Ile Asp Tyr Glu Ile 1145 1150 1155 Val Gln His Ile Phe Glu Ile Phe Arg Leu Thr Val Gln Met Arg 1160 1165 1170 Asn Ser Leu Ser Glu Leu Glu Asp Arg Asp Tyr Asp Arg Leu Ile 1175 1180 1185 Ser Pro Val Leu Asn Glu Asn Asn Ile Phe Tyr Asp Ser Ala Lys 1190 1195 1200 Ala Gly Asp Ala Leu Pro Lys Asp Ala Asp Ala Asn Gly Ala Tyr 1205 1210 1215 Cys Ile Ala Leu Lys Gly Leu Tyr Glu Ile Lys Gln Ile Thr Glu 1220 1225 1230 Asn Trp Lys Glu Asp Gly Lys Phe Ser Arg Asp Lys Leu Lys Ile 1235 1240 1245 Ser Asn Lys Asp Trp Phe Asp Phe Ile Gln Asn Lys Arg Tyr Leu 1250 1255 1260 <210> 3 <211> 5573 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of bglC-Mad7d locus <400> 3 tgtttttgat aagatcacgg agtttatccg gaaaccgttc atgaagaga agcagacgat tgatgaacaa gggcatgtag aaacgaaaaa agtgccgaaa tcaaacttcg gctatttgct gaattgctat tggtgcgcag ggatatggtg cgcgttgatc attgctgtcg gatatctgat tgccccaaaa gcgatattcc cgttgatttt gattttgtcg gtcgccgggg ggcaggcgat 240 tcttgaaacg tttgtcggtg tcgccacaaa acttgtcggc tttttctccg atttaaaga gtaaaccatt ccaagcggat ggttttattt ttttgtcaat aaagtgatac aaacagcaga gagaacgtgt cagttttatg aacttttcac agcgatttttt cccggatgcg gcattttagg 420 cagagagga gcatctcatt gtaaagattt cagtttttaa aatttaga tgagagaaaa aggatgtgca aagtccccgg agctcggatc cactagtaac ggccgccagt gtgctggaat tcgcccttgc ggccgctcgc tttccaatct gaaggtttca ttgtgggatg ttgatccgga 600. 660. agcaaaagat tgtcaatcat gtcatgagcc atgcgggaga cggaaaaatc gtcttaatgc acgatattta tgcaacgtcc gcagatgctg ctgaagagat tattaaaaag ctgaaagcaa aaggctatca attggtaact gtatctcagc ttgagaagt 780 gagaagcag agaggcttt gataaatga gtagaaagcg ccatatcggc gctttttcttt 840 tggaaaaa tatagggaa atggtacttg ttaaaaatttc ggaatattta tacaatatca 900 tatgtatcac attgaaaggg gaggagaatc atgaataatg gcacaataa cttccagaac 960 ttcattggca ttagcagcct gcaaaaaaca ctgagaatg cactgattcc gagaaaaca 1020 accagcagt ttattgtca aaacggcatc atcaagagg atgactgag aggcgaaat 1080 cgccaaatttc tgaaagatat catggacgac tattaccgtg gctttattc agaacactg 1140 tccagcattg atgatatcga ttggacaagc ctgttcgaga aaatggaaat ccaactgaaa 1200 aaacggcgata aaagacac gctgattaa gaacaacgg atatcgcaa agcgatccac 1260 aaaagtttg caatgatga ccgctttaaa acatgttca gcgcgaaact gattagcgat 1320 attctgccgg aatttgtcat ccacaataat aactatagcg cgagcgagaa agaagaaaaa 1380 acacaggtca ttaaactgtt tagccgcttt gccacaagct tcaagacta ttcaaaaat 1440 cgcgcaact gctttagcgc nationality tcatcatca gctgccatcg gattgtcaat 1500 gataatgcgg aaatctttt tagcaacgca ctggtctatc gcagaattgt taaatcattg 1560 agcaacgacg acatcaaca aatctcaggc gattgaag acagcctgaa agaatgtca 1620 ctggaagaaa tctacagcta cgaaaaatac ggcgaattta tcacacaaga aggcatcagc 1680 ttttacaacg atatttgcgg CAagtcaac agctttatga atctgtattg ccagaaaaac 1740 aaagaaaaaaaacctgta taaactgcag aaactgcaca agcagattct gtgcattgca 1800 gatcatcat atgaagtccc gtacaattt gagagcgacg aagaagtttta tcaagcgtt 1860 aatggctttc tggatacat cagcagcaaa catattgttg aacgcctgag aaaaattggc 1920 gataactata atggctaca cctggacaaa atctacatcg tcagcaatt ttacgaagc 1980 gtcagccaaa aacatatcg cgattgggaa acattaata cagcgctgga aattcattat 2040 aacaacattc tgcctggcaa cggcaaagc aaagcagata aagttaaaaa ggcggtcaaa 2100 aatgacctgc agaaaagcat tacagaaatc aatgaactgg tcagcacta caactgtgc 2160 tcagatgata atcaggc ggaacgtac atccatgaaa ttagccatat cctgaacac 2220 tttgaagcgc agaactgaa ataacccg gaatccatc tggttgaaag cgaactgaaa 2280 gcaagcgagc tgaaaaatgt tctggatgtc attgaatg cgtttcattg gtgcagcgtc 2340 tttatgacag aagactggt cgaataagat aacaactttt atgcggact ggaagagatt 2400 tacgacgaaa tttatccggt catcagcctg tataatctgg ttcgcaatta tgtcacacag 2460 aaaccgtata gcacgaagaa atcaactg aactttggca ttccgacact ggcagatggc 2520 tggtcaaat siaagaata tagcacaac gcgatcatcc tgatgcgcga taatctttat 2580 tatctgggca tttcaacgc gaaaaacaag ccggacaaa aaatcatcga aggcaatacg 2640 tcagagaaca aaggcgacta taaaaagatg atctataatc tgctccggg accgataaa 2700 atgatcccga aagttttct gtcaagcaa acagcgtcg aaacatataa accgtcagcg 2760 tatattctgg aaggctacaa acacaacaaa gcagcaagga ctttgacacatc 2820 acattttgcc atgatctgat cgactacttt aagaactgca ttgcaattca tccggaatgg 2880 aaaaaacttcg gctttgattt ttcagacacg agcacgtatg aagatatcag cggctttttat 2940 agagaagttg aactgcaggg ctataaaatc gactggacat atatcagcga aaaggatatt 3000 gatctgctgc aagaaaaagg ccaactgtac ctgtttcaga tctacaacaa agacttcagc 3060 aaaaaaaagca cgggcaatga taacctgcat acgatgtacc tgaaaaaacct ttttagcgaa 3120 gagaacctga aagacattgt cctgaaactg aatggcgaag ccgaaatttt ctttcgcaaa 3180 tccagcatta aaaacccgat catccataaa aaaggcagca ttctggttaa ccgcacatat 3240 gaagcggaag aaaaagatca gtttggcaac attcagatcg tccgcaaaaa cattccggaa 3300 aacatttatc aagaactgta caaatacttt aacgataaaa gcgataaaga actgtccgac 3360 gaagcagcga aacttaaaaa tgttgttggc catcatgaag cggcaacaaa cattgttaaa 3420 gactatcgct atacgtacga taaatacttt ctgcatatgc cgatcacgat caacttcaaa 3480 gcaaataaa cgggctttat caacgatcgc attctgcagt atattgccaa agaaaaggat 3540 ctgcatgtca tcggcattgc tagaggcgaa cgcaatctga tttatgtcag cgttattgat 3600 acatgcggca acattgtcga acagaaaagc tttaacattg tcaacggcta tgactaccag 3660 atcaagctga aacagcaaga aggcgcaaga caaattgctc gcaaagaatg gaaagaaatc 3720 ggcaagatca aagaaattaa agagggctat ctgagcctgg tcattcatga aatttctaaa 3780 atggtcatca aataacgc gattatcgcc atggaagatc tgtcatatgg ctttaagaaa 3840 ggccgtttta aagtcgaaag acaggtctac cagaaattcg aaacaatgct gattaacaaa 3900 ctgaattatc tggtgtttaa agacatcagc atcacggaaa atggcggact gctgaaaggc 3960 tatcaactga catatattcc ggataagctt aaaaacgtcg gccatcaatg cggctgcatc 4020 tttatgttc cggcagcgta tacatcaaaa attgatccga caacaggctt tgtcaacatc 4080 ttcaaattca aagatctgac ggtcgatgcg aaacgcgaat tcattaagaa atttgacagc 4140 atccgctacg acagcgagaa aaatcttttc tgctttacgt tcgactacaa caactttatc 4200 acgcagaata cggttatgtc aaaaagcagc tggtcagtct atacatatgg cgttagaatt 4260 aaacgcagat ttgtgaacgg cagatttagc aatgaaagcg atacaatcga catcacgaaa 4320 gacatggaaa aaacgcttga aatgacggat attaactggc gtgatggaca tgatcttcgc 4380 caggatatta tcgattatga aatcgtccag cacatctttg aaatctttag actgacagtc 4440 caaatgcgca attcactgtc agaacttgaa gatatagatt atgatcgcct gatttctccg 4500 gtcctgaatg aaaataacat cttttacgat agcgcaaaag caggcgacgc actgccgaaa 4560 4620 atcaccgaga attggaaaga ggacggcaaa ttttcacggg ataaactgaa aatcagcaac 4680 4740 cagaagcggc aacacgctaa tcaataaaaa aacgctgtgc ggttaaaggg cacagcgttt 4800 ttttgtgtat gaatcgaaaa agaacaga tcgcaggtct caaaaatcga gcgtaaaggg 4860 4920 tttttttatt ttgcccgtct tataaatttc gttgtccaac tcgcttaatt gcgagtttt 4980 atttcgttta tttcaatcaa ggtaaatgct agcggccgcg tcgactagaa gagcagagag 5040 gacggatttc ctgaaggaaa tccgtttttt tattttgccc gtcttataaa tttcgttgcc 5100 atgggatccg cggccgcgct gcagccaaca cgatagcagt acaatacaga gcgggggaca 5160 acaatgtaaa cggcaaccaa atccgccctc agctcaacat taaaaacaac agcaaaaaaa 5220 ccgtctcttt aaatcgaatc accgtccgct actggtataa aacgaatcgc aaaggaaaaa 5280 attttgactg cgactatgcc caaatcggct gcagcaaaat cacgcacaaa ttcgtccaat 5340 taaaaaaagc ggtaaacgga gcagacacgt atcttgaagt agggtttaaa aatggtacat 5400 tggcgccggg tgcaagtaca ggtgaaatcc agatccgtct tcacaatgac ggctggagca 5460 attatgccca aagcggcgac tattcatttt taaattcaaa cacgtttaaa aatacgaaaa 5520 aaatcacgtt gtatgagaac ggaaagctga tttggggcac tgaacctaaa taa 5573 <210> 4 <211> 3090 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of the gnt locus of PP3811 - Mad7gDNA3: gnt - dsRED - Mad7gDNA (cat) <400> 4 agcgaagcct tgtgcatagg cgcagatttt gcccatatat aatgcctgtc tgacgcggtc 60 gatccacacg ttttgatcca ggcgccgttc ttctgttgca ggtccggcca atactttttc 120 cgcagctgtc cgttcgtctt ttaatgatga caggtaacgg gcaaacaggg attccgtgat 180 aattgatgat ggaatgccgt tgtcgacggc ctgcaggctc gtccatttgc ccgtgccttt 240 ttggccggtt ttgtcgagga tgacgtcgat gagtggagcg cccgtcttct catccttttt 300 ccgcaggatc tccgccgtga tttcgattaa atagctgttc agctctcctt gattccacgt 360 gtcgaaaatg tcagcgattt catctatcgg caaaagaagc ttttctctta aaaacgtata 420 tgcttcggcg atgagctgca tgtctgcgta ttcgatgccg ttgtgcacca ttttgacaaa 480 atgacccgcg cctttcggac ggccgctcgc tttccaatct gaaggtttca ttgtgggatg 540 ttgatccgga agattggaag tacaaaaata agcaaaagat tgtcaatcat gtcatgagcc 600 atgcgggaga cggaaaaatc gtcttaatgc acgatattta tgcaacgtcc gcagatgctg 660 ctgaagagat tattaaaaag ctgaaagcaa aaggctatca attggtaact gtatctcagc 720 ttgagaagt gagaagcag agaggctatt gaataatga gtagaagcg ccatatcggc 780 gcttttctt tggaagaaa taggaggaaa atggtacttg ttaaaaattc ggaatattta 840 tacaatatca tatgtatcac attgaagga ggggcctgct gtccagactg tccgctgtgt 900 aaaaaaaagg aaaagggg ggttgacatt attttactga tatgtataat ataatttgta 960 taagaaaatg gaggggccct cgaaacgtaa gatgaaacct tagataaag tgcttttttt 1020 gttgcaattg aagaattatt aatgttaagc ttaatttaag attattactt tgaattgtaa 1080 cgcccctcaa agtaagaac tacaaaaaa gatacgtta tatagaata tgtttgaacc 1140 ttcttcagat tacaaata ttcggacgga cttacctca aatgcttatc taactataga 1200 atgacataca agcacaacct tgaaaatttg aaaataac taccaatgaa cttgttcatg 1260 tgaattatcg ctgtatttaa ttttctcaat tcaatatata atatgccaat acatgttac 1320 aagtagaat taagacaccc ttgatagcct tactataccct aacatgatgt agtattaat 1380 gatatgtaa attattatt gatagagc gactttatta taatcattac atattttct 1440 1500 tgcctaaaaa cgaagaacat taaaaacata tatttgcacc gtctaatgga tttatgaaaa 1560 atcattttat cagtttgaaa attatgtatt atggagctct ataaaaatga ggagggaacc 1620 gaatggcttc aactgaagac gtaatcaaag agttcatgcg cttcaaagtg cgaatggaag 1680 gaagtgtaaa cgggcatgag tttgaaattg aaggtgaagg tgaaggaagg ccttatgaag 1740 gaacgcaaac tgcaaaaactt aaagtgacaa aaggaggacc gctgccgttt gcttgggaca 1800 tcttaagtcc gcagtttcag tatgggtcaa aagtttatgt aaagcatcct gctgacattc 1860 ctgattacaa aaagttaagt tttcctgaag gattcaagtg ggagcgcgta atgaactttg 1920 aagatggagg tgtcgtaact gtaacgcaag attcaagtct gcaagacggt tgcttcattt 1980 2040 caatgggttg ggagccgtca actgagaggc tttatccgcg tgatggtgtc ttgaaaggtg 2100 aaattcaaa agccttaaag ttgaaagatg gagggcatta tcttgttgag ttcaagagca 2160 tttacatggc gaaaaagcct gtgcagcttc ctggctacta ctatgttgat tcaaaacttg 2220 acataactag tcacaacgaa gactacacaa ttgttgagca gtatgagcga actgaaggaa 2280 ggcatcatct ttttctttaa tgctgtccag actgtccgct gtgtaaaaaa aaggaataaa 2340 ggggggttga cattatttta ctgatatgta tatataatt tgtataagaa aatggtcaaa 2400 agacctttt aatttctact cttgtagatt ataccaagtg tcaagctcga ctgaaattg 2460 ccaacacaat taacatctca atcaaggtaa atgctagcgg ccgcgtcgac tagaagagca 2520 gagaggacgg atttcctgaa ggaaatccgt ttttttatt tgcccgtctt ataaatttcg 2580 ttgagatctt ttatacaaat aggcttaaca ataaagtaaa tcctaatccg gccaccgcga 2640 taattgtttc aagcagtgtc caggtggcga atgtttcttt catgctcagg ccgaaatact 2700 ctttgaacat ccagaagccc gcgtcgttga catgggaagc gattacactt ccggcccctg 2760 ttgcaagcac aaccagtgca agattgacat cgctttgtcc gagcatcgga agaacgagtc 2820 cggtcgtgct taatgcagca actgtcgcgg aacctaaaga gatgcgcaga atcgcggcga 2880 tgacccaggc gagcaagatc ggcgacatgg ccgttccttt gaataattca gctacatagt 2940 cgcctactcc gccgttgatc aagacttgtt tgaatgcgcc gccgcccccg atgatcaaga 3000 gcatcattcc gatttgagta atggcggttg aacaggaatc catcacttgt ttgatcggga 3060 tctttctggc gatacccatc gtataaatcg 3090 <210> 5 <211> 2770 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the amyL locus of PP3811 - Mad7gDNA3: amyL - dsRED - Mad7gDNA (cat) <400> 5 tacagaagca tgaagggcat gcgaccttct ttgtgcttgg aagcagagcg caatattatc 60 ccgaaacgat aaaacggatg ctgaaggaag gaaacgaagt cggcaaccat tcctgggacc 120 atccgttatt gacaaggctg tcaaacgaaa aagcgtatca ggagattaac gacacgcaag 180 aaatgatcga aaaaatcagc ggacacctgc ctgtacactt gcgtcctcca tacggcggga 240 tcaatgattc cgtccgctcg ctttccaatc tgaaggtttc attgtgggat gttgatccgg 300 aagattggaa gtacaaaaat aagcaaaaga ttgtcaatca tgtcatgagc catgcgggag 360 acggaaaaat cgtcttaatg cacgatattt atgcaacgtc cgcagatgct gctgaagaga 420 ttattaaaaa gctgaaagca aaggctatc aattggtaac tgtatctcag ctgaagaag 480 tgaagaagca gagaggctat tgaataatg agtagaagc gccatatcgg cgctttttctt 540 ttggaagaaa atagggaa aatggtactt gttaaaaatt cggaatatttt atacaatatc 600 atatgtatca cattgaagg aggggctgc tgtccagact gtccgctg taaaaaaaag 660 gataaaggg gggttgacat tattttactg atatgtataa tataatttgt atagaaaat 720 ggaggggccc tcgaaacgta agatgaaacc ttagataaaa gtgcttttt tgttgcaatt 780 gagaattat taatgttag cttaatttaa gatatatct tgaattgta acgccccctca 840 aaagtaagaa ctacaaaaaa agaatacgtt atatagaat atgtttgaac cttcttcaga 900 ttacaaatat attcggacgg acttacctc aaatgcttat ctaactatag atgacatac 960 aagcacaacc ttgaaattt gaaaataata ctaccaatga acttgttcat gtgaattatc 1020 gctgtattta atttctca ttcaatat atatgccaa tacattgtta caagtagaaa 1080 ttaagacacc cttgatagcc ttactatacc taacatgatg tagtattaaa tgaatatgta 1140 aaatatattta tgataagaag cgacttattt ataatcatta catatttttc tattggaatg 1200 attaagattc caatagaata gtgtataaat tatttatctt gaaaggaggg atgcctaaaa 1260 acgaagaaca ttaaaaacat atatttgcac cgtctaatgg atttatgaaa aatcatttta 1320 tcagtttgaa aattatgtat tatggagctc ttataaaaat gaggagggaa ccgaatggct 1380 tcaactgaag acgtaatcaa agagttcatg cgcttcaaag tgcgaatgga aggaagtgta 1440 aacgggcatg agtttgaaat tgaaggtgaa ggtgaaggaa ggccttatga aggaacgcaa 1500 actgcaaaac ttaaagtgac aaaaggagga ccgctgccgt ttgcttggga catcttaagt 1560 ccgcagtttc agtatgggtc aaaagtttat gtaaagcatc ctgctgacat tcctgattac 1620 aaaaagttaa gttttcctga aggattcaag tgggagcgcg taatgaactt tgaagatgga 1680 ggtgtcgtaa ctgtaacgca agattcaagt ctgcaagacg gttgcttcat ttacaaagta 1740 aagttcattg gcgtgaactt tccaagtgat ggtcctgtaa tgcagaaaaa gacaatgggt 1800 tgggagccgt caactgagag gctttatccg cgtgatggtg tcttgaaagg tgaaattcac 1860 aaagccttaa agttgaaaga tggagggcat tatcttgttg agttcaagag catttacatg 1920 gcgaaaaagc ctgtgcagct tcctggctac tactatgttg attcaaaact tgacataact 1980 agtcacaacg aagactacac aattgttgag cagtatgagc gaactgaagg aaggcatcat 2040 cttttcttt aatgctgtcc agactgtccg ctgtgtaaaa aaaaggaata aaggggggtt 2100 gacattattt tactgatatg tataatataa tttgtataag aaaatggtca aaagaccttt 2160 ttaatttcta ctcttgtaga ttataccaag tgtcaagctc gaactgataa ttgccaacac 2220 aattaacatc tcaatcaagg taaatgctag cgcggccgg tcgacaggcc tctttgatta 2280 cattttataa ttaattttaa caaagtgtca tcagccctca ggaaggactt gctgacagtt 2340 tgaatcgcat aggtaaggcg gggatgaaat ggcaacgtta tctgatgtag caaagaaagc 2400 aaatgtgtcg aaaatgacgg tatcgcgggt gatcaatcat cctgagactg tgacggatga 2460 attgaaaaag cttgttcatt ccgcaatgaa ggagctcaat tatataccga actatgcagc 2520 aagagcgctc gttcaaaaca gaacacaggt cgtcaagctg ctcatactgg aagaaatgga 2580 tacaacagaa ccttattata tgaatctgtt aacgggaatc agccgcgagc tggaccgtca 2640 tcattatgct ttgcagcttg tcacaaggaa atctctcaat atcggccagt gcgacggcat 2700 tattgcgacg gggttgagaa aagccgattt tgaagggctc atcaaggttt ttgaaaagcc 2760 tgtcgttgta 2770 <210> 6 <211> 3002 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of the lacA2 locus of PP3811 - Mad7gDNA3: lacA2 - dsRED - Mad7gDNA (cat) <400> 6 tgttgattgg ctttggcctc cagcttttta taaatggatt caccgaagct ggttaagtag 60 atatagtggt tgcggctgtc ctcctcgctt ctctttttat agaccatatt ttctttttca 120 aaccgcttca ggatccggct gacatagccc cggtccaggc cgagcgtatc ttgaatcagt 180 ttggctgtac aatcggccgt attgtgaatt tcaaataata tccgggtttc cgtcaatgaa 240 aaagggctgt cataaatatg ttcattcaga aaaccgagca catttgtata gaatcgattg 300 aactttctga atttaaagt gatagaatga ttgatttctg tcatctcaaa acctctctcc 360 ctgtaaatcg ttgctttaat caattataat aaatagttg atttagtcaa gtgtatggaa 420 atgaagttaa aaatgttaat gatagattat atttacaaa taaagaaaga taaattcaat 480 catacaggaa aattcatcca gcggccgctc gctttccaat ctgaaggttt cattgtggga 540 tgttgatccg gaagattgga agtacaaaaa taagcaaaag attgtcaatc atgtcatgag 600 ccatgcggga gacggaaaaa tcgtcttaat gcacgatatt tatgcaacgt ccgcagatgc 660 tgctgaagag attattaaaa agctgaaagc aaaaggctat caattggtaa ctgtatctca 720 gcttgaagaa gtgaagaagc agagaggcta ttgaataaat gagtagaaag cgccatatcg 780 gcgctttct tttggaagaa aatataggga aaatggtact tgttaaaaat tcggaatatt 840 tatacaatat catatgtatc acattgaaag gaggggcctg ctgtccagac tgtccgctgt 900 gtaaaaaaaa ggaataaagg ggggttgaca ttattttact gatatgtata atataatttg 960 tataagaaaa tggaggggcc ctcgaaacgt aagatgaaac cttagataaa agtgcttttt 1020 ttgttgcaat tgaagaatta ttaatgttaa gcttaattaa agataatatc tttgaattgt 1080 aacgcccctc aaaagtaaga actacaaaaa aagaatacgt tatatatagaaa tatgtttgaa 1140 ccttcttcag attacaaata tattcggacg gactctacct caaatgctta tctaactata 1200 gaatgacata caagcacaac cttgaaaatt tgaaaatata actaccaatg aacttgttca 1260 tgtgaattat cgctgtattt aattttctca attcaatata taatatgcca atacattgtt 1320 acaagtagaa attaagacac ccttgatagc cttactatac ctaacatgat gtagtattaa 1380 atgaatatgt aaatatattt atgataagaa gcgacttatt tataatcatt acatattttt 1440 ctattggaat gattaagatt ccaatagaat agtgtataaa ttatttatct tgaaaggagg 1500 gatggctaaa aacgaagaac attaaaaaaca tatatttgca ccgtctaatg gatttatgaa 1560 aaatcatttt atcagtttga aaattatgta ttatggagct ctataaaaaat gaggagggaa 1620 ccgaatggca tctacagaag atgtgatcaa ggaattcatg cggtttaagg tgagaatgga 1680 aggaagcgtg aacggacatg aatttgaaat cgagggggaa ggcgaaggca gaccctatga 1740 aggtacacag acagcaaagc tgaaggtgac aaagggtgga ccgctgcctt ttgcctggga 1800 catcctgagc ccacagtttc aatatgggag taaggtgtac gtgaagcatc cggctgacat 1860 cccggactat aagaagctgt ccttcccaga gggctttaag tgggaaagag tcatgaattt 1920 cgaagatggc ggtgtggtga cagtgacgca agatagctcc ctgcaagatg gatgctttat 1980 ctacaaggtg aagttcatcg gagtgaattt cccttcggat ggaccggtga tgcaaaagaa 2040 gacaatggga tgggaaccta gtacagaaag gctgtatccg agagatggag tgctgaaggg 2100 agaaatccac aaggcgctga agctgaagga tggcggacac tatctggtgg agtttaagag 2160 catctatatg gccaagaagc cagtgcaact gcctgggtac tactatgtgg actcgaagct 2220 ggatatcact tcacataacg aagactacac aatcgtggaa caatatgaac ggacggaagg 2280 aaggcatcac ctgtttctgt aatgctgtcc agactgtccg ctgtgtaaaa aaaaggaata 2340 aaggggggtt gacattattt tactgatatg tataataa tttgtataag aaaatggtca 2400 aaagaccttt ttaatttcta ctcttgtaga ttataccaag tgtcaagctc gactgataat 2460 tgccaacaca attaacatct caatcaaggt aaatgctagc atcgattaca acccggatca 2520 atggcttaaa tatccggacg tattaaaaga agatatccgc ctgatgaaac tgtcccgctg 2580 caatgtgatg tctgtcggca ttttctcctg ggtttcgctc gagcctgaag aaggaagatt 2640 tacatttgac tggctcgatc aggttcttga tactttcaag gaaaacggaa tttatgcgtt 2700 tttggctaca ccgagcggtg ccagaccggc ttggatgtcc aaaaagtatc cagaggtgct 2760 gagaacggag cgcaacaggg tcagaaacct tcacggaaag cggcacaatc actgctatac 2820 gtcgcctgtc taccgccgga aaacggcgat cataaacgga aagctcgcgg agcgctatgc 2880 gcatcacccg gccgtcatcg gctggcacat ttctaatgaa tacggcggag aatgccattg 2940 tgaactttgc caagacaagt tcagagagtg gctgctggcg aaatacaaaa cgctggaccg 3000 cc 3002 <210> 7 <211> 3915 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the gnt locus in MOL7800 after integration of amyL <400> 7 agcgaagcct tgtgcatagg cgcagatttt gcccatatat aatgcctgtc tgacgcggtc 60 gatccacacg ttttgatcca ggcgccgttc ttctgttgca ggtccggcca atactttttc 120 cgcagctgtc cgttcgtctt ttaatgatga caggtaacgg gcaaacaggg attccgtgat 180 aattgatgat ggaatgccgt tgtcgacggc ctgcaggctc gtccatttgc ccgtgccttt 240 ttggccggtt ttgtcgagga tgacgtcgat gagtggagcg cccgtcttct catccttttt 300 ccgcaggatc tccgccgtga tttcgattaa atagctgttc agctctcctt gattccacgt 360 gtcgaaaatg tcagcgattt catctatcgg caaaagaagc ttttctctta aaaacgtata 420 tgcttcggcg atgagctgca tgtctgcgta ttcgatgccg ttgtgcacca ttttgacaaa 480 atgacccgcg cctttcggac ggccgctcgc tttccaatct gaaggtttca ttgtgggatg 540 ttgatccgga agattggaag tacaaaaata agcaaaagat tgtcaatcat gtcatgagcc 600 atgcgggaga cggaaaaatc gtcttaatgc acgatattta tgcaacgtcc gcagatgctg 660 ctgaagagat tattaaaaag ctgaaagcaa aaggctatca attggtaact gtatctcagc 720 ttgagaagt gagaagcag agaggctatt gaataatga gtagaagcg ccatatcggc 780 gcttttctt tggaagaaa taggaggaaa atggtacttg ttaaaaattc ggaatattta 840 tacaatatca tatgtatcac attgaagga ggggcctgct gtccagactg tccgctgtgt 900 aaaaaaaagg aaaagggg ggttgacatt attttactga tatgtataat ataatttgta 960 taagaaaatg gaggggccct cgaaacgtaa gatgaaacct tagataaag tgcttttttt 1020 gttgcaattg aagaattatt aatgttaagc ttaatttaag attattactt tgaattgtaa 1080 cgcccctcaa agtaagaac tacaaaaaa gatacgtta tatagaata tgtttgaacc 1140 ttcttcagat tacaaata ttcggacgga cttacctca aatgcttatc taactataga 1200 atgacataca agcacaacct tgaaaatttg aaaataac taccaatgaa cttgttcatg 1260 tgaattatcg ctgtatttaa ttttctcaat tcaatatata atatgccaat acatgttac 1320 aagtagaat taagacaccc ttgatagcct tactataccct aacatgatgt agtattaat 1380 gatatgtaa attattatt gatagagc gactttatta taatcattac atattttct 1440 attggaatga ttaagattcc ataagaatag tgtataaatt attatcttg aaaggaggga 1500 tgcctaaaaa cgaagaacat taaaaacata tatttgcacc gtctaatgga tttatgaaaa 1560 atcattttat cagtttgaaa attatgtatt atggccacat tgaaagggga ggagaatcat 1620 gaaacaacaa aaacggcttt acgcccgatt gctgacgctg ttatttgcgc tcatctttct 1680 gctgcctcat tctgcagcag cggcggcaaa tcttaatggg acgctgatgc agtattttga 1740 atggtacatg cccaatgacg gccaacattg gaggcgtttg caaaacgact cggcatattt 1800 ggctgaacac ggtattactg ccgtctggat tcccccggca tataagggaa cgagccaagc 1860 ggatgtgggc tacggtgctt acgaccttta tgatttaggg gagtttcatc aaaaagggac 1920 ggttcggaca aagtacggca caaaaggaga gctgcaatct gcgatcaaaa gtcttcattc 1980 ccgcgacatt aacgtttacg gggatgtggt catcaaccac aaaggcggcg ctgatgcgac 2040 cgaagatgta accgcggttg aagtcgatcc cgctgaccgc aaccgcgtaa tttcaggaga 2100 acacctaatt aaagcctgga cacattttca ttttccgggg cgcggcagca catacagcga 2160 ttttaaatgg cattggtacc attttgacgg aaccgattgg gacgagtccc gaaagctgaa 2220 ccgcatctat aagtttcaag gaaaggcttg ggattgggaa gtttccaatg aaaacggcaa 2280 ctatgattat ttgatgtatg ccgacatcga ttatgaccat cctgatgtcg cagcagaaat 2340 taagagatgg ggcacttggt atgccaatga actgcaattg gacggtttcc gtcttgatgc 2400 tgtcaaacac attaaatttt cttttttgcg ggattgggtt aatcatgtca gggaaaaaac 2460 ggggaaggaa atgtttacgg tagctgaata ttggcagaat gacttgggcg cgctggaaaa 2520 ctatttgaac aaaacaaatt ttaatcattc agtgtttgac gtgccgcttc attatcagtt 2580 ccatgctgca tcgacacagg gaggcggcta tgatatgagg aaattgctga acggtacggt 2640 cgtttccaag catccgttga aatcggttac atttgtcgat aaccatgata cacagccggg 2700 gcaatcgctt gagtcgactg tccaaacatg gtttaagccg cttgcttacg cttttattct 2760 cacaagggaa tctggatacc ctcaggtttt ctacggggat atgtacggga cgaaaggaga 2820 ctcccagcgc gaaattcctg ccttgaaaca caaaattgaa ccgatcttaa aagcgagaaa 2880 acagtatgcg tacggagcac agcatgatta tttcgaccac catgacattg tcggctggac 2940 aagggaaggc gacagctcgg ttgcaaattc aggtttggcg gcattaataa cagacggacc 3000 cggtggggca aagcgaatgt atgtcggccg gcaaaacgcc ggtgagacat ggcatgacat 3060 taccggaaac cgttcggagc cggttgtcat caattcggaa ggctggggag agtttcacgt 3120 aaacggcggg tcggtttcaa tttatgttca aagatagacg cgtagggccc gcggctagcg 3180 gccgcgtcga ctagaagagc agagaggacg gatttcctga aggaaatccg tttttttatt 3240 ttgcccgtct tataaatttc gttgtccaac tcgcttaatt gcgagttttt atttcgttta 3300 tttcaatcaa ggtaaatgct agcggccgcg tcgactagaa gagcagagag gacggatttc 3360 ctgaaggaaa tccgtttttt tattttgccc gtcttataaa tttcgttgag atcttttata 3420 caaataggct taacaataaa gtaaatccta atccggccac cgcgataatt gtttcaagca 3480 gtgtccaggt ggcgaatgtt tctttcatgc tcaggccgaa atactctttg aacatccaga 3540 agcccgcgtc gttgacatgg gaagcgatta cacttccggc ccctgttgca agcacaacca 3600 gtgcaagatt gacatcgctt tgtccgagca tcggaagaac gagtccggtc gtgcttaatg 3660 cagcaactgt cgcggaacct aaagagatgc gcagaatcgc ggcgatgacc caggcgagca 3720 agatcggcga catggccgtt cctttgaata attcagctac atagtcgcct actccgccgt 3780 tgatcaagac ttgtttgaat gcgccgccgc ccccgatgat caagagcatc attccgattt 3840 gagtaatggc ggttgaacag gaatccatca cttgtttgat cgggatcttt ctggcgatac 3900 ccatcgtata aatcg 3915 <210> 8 <211> 3594 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of the amyL locus in MOL7800 after reintegration of amyL <400> 8 tacagaagca tgaagggcat gcgaccttct ttgtgcttgg aagcagagcg caatattatc 60 ccgaaacgat aaaacggatg ctgaaggaag gaaacgaagt cggcaaccat tcctgggacc 120 atccgttatt gacaaggctg tcaaacgaaa aagcgtatca ggagattaac gacacgcaag 180 aaatgatcga aaaaatcagc ggacacctgc ctgtacactt gcgtcctcca tacggcggga 240 tcaatgattc cgtccgctcg ctttccaatc tgaagttttc attgttgat gttgatccgg 300 aagattggaa gtacaaaat aagcaaaga ttgtcaatca tgtcatgagc catgcgggag 360 acggaaaaat cgtcttaatg cacgatattt atgcaacgtc cgcagatgct gctgaagaga 420 ttattaaaaa gctgaaagca aaggctatc aattggtaac tgtatctcag ctgaagaag 480 tgaagaagca gagaggctat tgaataatg agtagaagc gccatatcgg cgctttttctt 540 ttggaagaaa atagggaa aatggtactt gttaaaaatt cggaatatttt atacaatatc 600 atatgtatca cattgaagg aggggctgc tgtccagact gtccgctg taaaaaaaag 660 gataaaggg gggttgacat tattttactg atatgtataa tataatttgt atagaaaat 720 ggaggggccc tcgaaacgta agatgaaacc ttagataaaa gtgcttttt tgttgcaatt 780 gagaattat taatgttag cttaatttaa gatatatct tgaattgta acgccccctca 840 aaagtaagaa ctacaaaaaa agaatacgtt atatagaat atgtttgaac cttcttcaga 900 ttacaaatat attcggacgg acttacctc aaatgcttat ctaactatag atgacatac 960 aagcacaacc ttgaaaattt gaaatataa ctaccaatga acttgttcat gtgaattatc gctgtattta attttctcaa ttcaatatat aatatgccaa tacattgtta caagtagaaa ttaagacacc cttgatagcc ttactatacc taacatgatg tagtattaaa tgaatatgta father tgataagaag cgacttattt fathercatta catatttttc tattggaatg attachment catalyst gtgtataaat tatttatctt gaaaggaggg atgcctaaaa acgaagaaca ttaaaaacat atatttgcac cgtctaatgg atttatgaaa aatcatttta tcagtttgaa aattatgtat tatggccaca ttgaaagggg aggagaatca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg ctcatcttct tgctgcctca 1440 ttctgcagca gcggcggcaa atcttaatgg gacgctgatg cagtattttg aatggtacat gcccaatgac ggccaacatt ggaggcgttt gcaaaacgac tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga acgagccaag cggatgtggg 1620 ctacggtgct tacgaccttt atgatttagg ggagtttcat caaaaaggga cggttcggac 1680 aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa agtcttcatt cccgcgacat 1740 taacgtttac ggggatgtgg tcatcaacca caaaggcggc gctgatgcga ccgaagatgt 1800 aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta atttcaggag aacacctaat 1860 taaagcctgg acacattttc attttccggg gcgcggcagc acatacagcg attttaaatg 1920 gcattggtac cattttgacg gaaccgattg ggacgagtcc cgaaagctga accgcatcta 1980 taagtttcaa ggaaaggctt gggattggga agtttccaat gaaaacggca actatgatta 2040 tttgatgtat gccgacatcg attatgacca tcctgatgtc gcagcagaaa ttaagagatg 2100 gggcacttgg tatgccaatg aactgcaatt ggacggtttc cgtcttgatg ctgtcaaaca 2160 cattaaattt tcttttttgc gggattgggt taatcatgtc agggaaaaaa cggggaagga 2220 aatgtttacg gtagctgaat attggcagaa tgacttgggc gcgctggaaa actatttgaa 2280 caaaacaaat tttaatcatt cagtgtttga cgtgccgctt cattatcagt tccatgctgc 2340 atcgacacag ggaggcggct atgatatgag gaaattgctg aacggtacgg tcgtttccaa 2400 gcatccgttg aaatcggtta catttgtcga taaccatgat acacagccgg ggcaatcgct 2460 tgagtcgact gtccaaacat ggtttaagcc gcttgcttac gcttttattc tcacaaggga 2520 atctggatac cctcaggttt tctacgggga tatgtacggg acgaaaggag actcccagcg 2580 cgaaattcct gccttgaaac acaaaattga accgatctta aaagcgagaa aacagtatgc 2640 gtacggagca cagcatgatt atttcgacca ccatgacatt gtcggctgga cagggaagg 2700 cgacagctcg gttgcaaatt caggtttggc ggcattaata agacggac ccggtggggc 2760 aaagcgaatg tatgtcggcc ggcaaaacgc cggtgagaca tggcatgaca ttaccggaaa 2820 ccgttcggag ccggttgtca tcaattcgga aggctggggga gagtttcacg taaacggcgg 2880 gtcggtttca atttatgttc aaagatagac gcgtagggcc cgcggctagc ggccgcgtcg 2940 actagaagag cagagaggac ggatttcctg aaggaaatcc gtttttttat tttgcccgtc 3000 ttataaattt cgttgtccaa ctcgcttaat tgcgagtttt tatttcgttt atttcaatca 3060 aggtaaatgg ctagcgcggc cgcgtcgaca ggcctctttg attacatttt ataattaatt 3120 ttaacaaagt gtcatcagcc ctcaggaagg acttgctgac agtttgaatc gcataggtaa 3180 ggcggggatg aaatggcaac gttatctgat gtagcaaaga aagcaaatgt gtcgaaaatg 3240 acggtatcgc gggtgatcaa tcatcctgag actgtgacgg atgaattgaa aaagcttgtt 3300 cattccgcaa tgaaggagct caattatata ccgaactatg cagcaagagc gctcgttcaa 3360 aacagaacac aggtcgtcaa gctgctcata ctggaagaaa tggatacaac agaaccttat 3420 tatatgaatc tgttaacggg aatcagccgc gagctggacc gtcatcatta tgctttgcag 3480 cttgtcacaa ggaaatctct caatatcggc cagtgcgacg gcattattgc gacggggttg 3540 agaaaagccg attttgaagg gctcatcaag gtttttgaaa agcctgtcgt tgta 3594 <210> 9 <211> 3852 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the lacA2 locus in MOL7800 after integration of amyL <400> 9 tgttgattgg ctttggcctc cagcttttta taaatggatt caccgaagct ggttaagtag 60 atatagtggt tgcggctgtc ctcctcgctt ctctttttat agaccatatt ttctttttca 120 aaccgcttca gatccggct gacatagccc cggtccaggc cgagcgtatc ttgaatcagt 180 ttggctgtac aatcggccgt attgtgaatt tcaaataata tccgggttc cgtcaatgaa 240 aaagggctgt cataaatatg ttcattcaga aaaccgagca catttgtata gaatcgattg 300 aactttctga atttaaagt gatagaatga ttgatttctg tcatctcaaa acctctctcc 360 ctgtaaatcg ttgctttaat caattataat aaatagttg atttagtcaa gtgtatggaa 420 atgaagttaa aaatgttaat gatagattat atttacaaa taaagaaaga taaattcaat 480 catacaggaa aattcatcca gcggccgctc gctttccaat ctgaaggttt cattgtggga 540 tgttgatccg gaagattgga agtacaaaaa taagcaaaag attgtcaatc atgtcatgag 600 ccatgcggga gacggaaaaa tcgtcttaat gcacgatatt tatgcaacgt ccgcagatgc 660 tgctgaagag attattaaaa agctgaaagc aaaaggctat caattggtaa ctgtatctca 720 gcttgaagaa gtgaagaagc agagaggcta ttgaataaat gagtagaaag cgccatatcg 780 gcgctttct tttggaagaa aatataggga aaatggtact tgttaaaaat tcggaatatt 840 tatacaatat catatgtatc acattgaaag gaggggcctg ctgtccagac tgtccgctgt 900 gtaaaaaaaa ggaataaagg ggggttgaca ttattttact gatatgtata atataatttg 960 tataagaaaa tggaggggcc ctcgaaacgt aagatgaaac cttagataaa agtgcttttt 1020 ttgttgcaat tgaagaatta ttaatgttaa gcttaattaa agataatatc tttgaattgt 1080 aacgcccctc aaaagtaaga actacaaaaa aagaatacgt tatatatagaaa tatgtttgaa 1140 ccttcttcag attacaaata tattcggacg gactctacct caaatgctta tctaactata 1200 gaatgacata caagcacaac cttgaaaatt tgaaaatata actaccaatg aacttgttca 1260 tgtgaattat cgctgtattt aattttctca attcaatata taatatgcca atacattgtt 1320 acaagtagaa attaagacac ccttgatagc cttactatac ctaacatgat gtagtattaa 1380 atgaatatgt aaatatattt atgataagaa gcgacttatt tataatcatt acatattttt 1440 ctattggaat gattaagatt ccaatagaat agtgtataaa ttatttatct tgaaaggagg 1500 gatgcctaaa aacgaagaac attaaaaaaca tatatttgca ccgtctaatg gatagaaagg 1560 aggtgatcca gccgcacctt atgaaaaatc attttatcag tttgaaaatt atgtattatg 1620 gccacattga aaggggagga gaatcatgaa acaacaaaaa cggctttacg cccgattgct 1680 gacgctgtta tttgcgctca tcttcttgct gcctcattct gcagcagcgg cggcaaatct 1740 taatgggacg ctgatgcagt attttgaatg gtacatgccc aatgacggcc aacattggag 1800 gcgtttgcaa aacgactcgg catatttggc tgaacacggt attactgccg tctggattcc 1860 cccggcatat area gccaagcgga tgtgggctac ggtgcttacg acctttatga 1920 tttaggggag tttcatcaaa aagggacggt tcggacaaag tacggcacaa aaggagagct 1980 gcaatctgcg atcaaaagtc ttcattcccg cgacattaac gtttacgggg atgtggtcat 2040 caaccaaa ggcggcgctg atgcgaccga agatgtaacc gcggttgaag tcgatcccgc 2100 tgaccgcaac cgcgtaattt caggagaaca cctaattaaa gcctggacac attttcattt 2160 tccggggcgc ggcagcacat acagcgattt taaatggcat tggtaccatt ttgacggaac 2220 cgattgggac gagtcccgaa agctgaaccg catctataag tttcaaggaa aggcttggga 2280 ttgggaagtt tccaatgaaa acggcaacta tgattatttg atgtatgccg acatcgatta 2340 tgaccatcct gatgtcgcag cagaattaa gagatggggc acttggtatg ccaatgaact 2400 gcaattggac gtttccgtc ttgatgctgt caacacatt aaatttcttt tttgcggga 2460 ttgggttaat catgtcagggg aaaaaacggg gaaggaatg tttacggtag ctgaatattg 2520 gcagaatgac ttggcgcgc tggaaacta tttgacaaaaaatttta atcattcagt 2580 gttgacgtg ccgcttcatt atcagttcca tgctgcatcg accagggag gcggctatga 2640 tatgaggaaa ttgctgaacg gtacggtcgt ttccaagcat ccgttgaat cggttacatt 2700 tgtcgataac catgatacac agccggggca atcgcttg tcgactgtcc aaacatggtt 2760 taagccgctt gcttacgctt ttattctcac aagggaatct ggataccctc aggttttcta 2820 cggggatatg tacgggacga aaggactc ccagcgcgaa attcctgcct tgaaacacaa 2880 aattgaaccg atctttaaag cgagaaaaca gtatgcgtac ggagcacagc atgattttt 2940 cgaccaccat gatatgtcg gctggacaag ggaggcgac agctcggttg caattcagg 3000 tttggcggca ttaatacag acggacccgg tggggcaag cgaatgtatg tcggccggca 3060 aaacgccggt gagacatggc atgacattac cggaaccgt tcggagccgg ttgtcatca 3120 ttcggaaggc tggggagt ttcacgtaaa cggcgggtcg gttcaattt atgttcaaag 3180 atagacgcgt agggcccgcg gctagcggcc gcgtcgacta gagagcaga gaggacggat 3240 ttcctgaagg aaatccgtttt ttttattg cccgtcttat aaatttcgtt gtccaactcg 3300 cttaattgcg agttttatt tcgtttattt caatcaggt aaatgctagc atcgattaca 3360 acccggatca atggcttaaa tatccggacg tattaaaga agatccgc ctgatgaac 3420 tgtcccgctg caatgtgatg tctgtcggca ttttctcctg ggtttcgctc gagcctgaag 3480 aaggagatt tacatttgac tggctcgatc aggttcttga tactttcag gaaaacggaa 3540 tttatgcgtt ttggctaca ccgagcggtg ccagaccggc ttggatgtcc aaaaagtatc 3600 cagaggtgct gagaacggag cgcacaggg tcagaaacct tcacggaag cggcacaatc 3660 actgctatac gtcgcctgtc taccgccgga aaacggcgat cataaacgga aagctcgcgg 3720 agcgctatgc gcatcacccg gccgtcatcg gctggcacat ttctaatgaa tacggcggag 3780 aatgccattg tgaactttgc caagacaagt tcagagagtg gctgctggcg aaatacaaaa 3840 cgctggaccg cc 3852 <210> 10 <211> 9550 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of pPPamyL-attP <400> 10 gagctcgtta ttaatctgtt cagcaatcgg gcgcgattgc tgaataaaag atacgagaga 60 cctctcttgt atctttttta ttttgagtgg ttttgtccgt tacactagaa aaccgaaaga 120 caataaaaat tttattcttg ctgagtctgg ctttcggtaa gctagacaaa acggacaaaa 180 taaaaattgg caagggttta aaggtggaga ttttttgagt gatcttctca aaaaatacta 240 cctgtccctt gctgattttt aaacgagcac gagagcaaaa cccccctttg ctgaggtggc 300 agagggcagg tttttttgtt tcttttttct cgtaaaaaaa agaaaggtct taaaggtttt 360 atggttttgg tcggcactgc cgacagcctc gcagagcaca cactttatga atataaagta 420 tagtgtgtta tactttactt ggaagtggtt gccggaaaga gcgaaaatgc ctcacatttg 480 tgccacctaa aaaggagcga tttacatatg agttatgcag tttgtagaat gcaaaaagtg 540 aaatcagctg gactaaaagg cagagctcgg taccagatct aaagataata tctttgaatt 600 gtaacccccc tcaaaagtaa gaactacaaa aaaagaatac gttatataga aatatgtttg 660 aaccttcttc agattacaaa tatattcgga cggactctac ctcaaatgct tatctacta 720 tagaatgaca tacaagcaca accttgaaaa tttgaaaaata taactaccaa tgaacttgtt 780 catgtgaatt atcgctgtat ttaattttct caattcaata tataatatgc caatacattg 840 ttacaagtag aaattaagac acccttgata gccttactat acctaacatg atgtagtatt 900 aaatgaatat gtaaatatat ttatgataag aagcgactta tttataatca ttacatattt 960 ttctattgga atgattaaga ttccaataga atagtgtata aattatttat cttgaaagga 1020 gggatgccta aaaacgaaga acattaaaaa catatatttg caccgtctaa tggatagaaa 1080 ggaggtgatc cagccgcacc ttatgaaaaa tcattttatc agtttgaaaa ttatgtatta 1140 tggccacatt gaaaggggag gagaatcatg aaacaacaaa aacggcttta cgcccgattg 1200 ctgacgctgt tatttgcgct catcttcttg ctgcctcatt ctgcagcagc ggcggcaaat 1260 cttaatggga cgctgatgca gtattttgaa tggtacatgc ccaatgacgg ccaacattgg 1320 aggcgtttgc aaaacgactc ggcatatttg gctgaacacg gtattactgc cgtctggatt 1380 cccccggcat ataagggaac gagccaagcg gatgtgggct acggtgctta cgacctttat 1440 gatttagggg agtttcatca aaaagggacg gttcggacaa agtacggcac aaaaggagag 1500 ctgcaatctg cgatcaaaag tcttcattcc cgcgacatta acgtttacgg ggatgtggtc 1560 atcaaccaca aaggcggcgc tgatgcgacc gaagatgtaa ccgcggttga agtcgatccc 1620 gctgaccgca accgcgtaat ttcaggagaa cacctaatta aagcctggac acattttcat 1680 tttccggggc gcggcagcac atacagcgat tttaaatggc attggtacca ttttgacgga 1740 accgattggg acgagtcccg aaagctgaac cgcatctata agtttcaagg aaaggcttgg 1800 gattgggaag tttccaatga aaacggcaac tatgattatt tgatgtatgc cgacatcgat 1860 tatgaccatc ctgatgtcgc agcagaaatt aagagatggg gcacttggta tgccaatgaa 1920 ctgcaattgg acggtttccg tcttgatgct gtcaaacaca ttaaattttc ttttttgcgg 1980 gattgggtta atcatgtcag ggaaaaaacg gggaaggaaa tgtttacggt agctgaatat 2040 tggcagaatg acttgggcgc gctggaaaac tatttgaaca aaacaaattt taatcattca 2100 gtgtttgacg tgccgcttca ttatcagttc catgctgcat cgacacaggg aggcggctat 2160 gatatgaga aattgctgaa cggtacggtc gtttccaagc atccgttgaa atcggttaca 2220 tttgtcgata accatgatac acagccgggg caatcgcttg agtcgactgt ccaaacatgg 2280 tttaagccgc ttgcttacgc ttttatctc acaagggaat ctggataccc tcaggttttc 2340 tacggggata tgtacgggac gaaggagac tcccagcgcg aaattcctgc cttgaaacac 2400 aaaattgaac cgatcttaaa agcgagaaaa foottgcgt acggagcaca gcatgattat 2460 ttcgaccacc atgacattgt cgggctggaca agggaaggcg acagctcggt tgcaaattca 2520 ggtttggcgg cattaataac agacggaccc ggtggggcaa agcgaatgta tgtcggccgg 2580 caaaacgccg gtgagacatg gcatgacatt accggaaacc gttcggagcc ggttgtcatc 2640 aattcggaag gctggggaga gtttcacgta aacggcgggt cggtttcaat ttatgttcaa 2700 agatagacgc gtagggcccg cggctagcgg ccgcgtcgac tagaagagca gagaggacgg 2760 atttcctgaa ggaaatccgt ttttttattt tgcccgtctt ataaatttcg ttgtccaact 2820 cgcttaattg cgagttttta tttcgtttat ttcaattaag gtaactaaag atcccttaga 2880 gtcgattatg tcttttgcgc agtcggctta aaccagttt cgctggtgcg aaaaaagagt 2940 gtcttgtgac acctaaattc aaaatctatc ggtcagattt ataccgattt gattttatat 3000 attcttgaat aacatacgcc gagttatcac ataaaagcgg gaaccaatca tcaaatttaa 3060 acttcattgc ataatccatt aaactcttaa attctacgat tccttgttca tcaataaact 3120 caatcatttc tttaattaat ttatatctat ctgttgttgt tttctttaat aattcatcaa 3180 catctacacc gccataaact atcatatctt ctttttgata tttaaattta ttaggatcgt 3240 ccatgtgaag catatatctc acaagacctt tcacattcc tgcaatctgc ggaatagtcg 3300 cattcaattc ttctgtaatt atttttatct gttcataaga tttattaccc tcatacatca 3360 ctagaatatg ataatgctct tttttcatcc taccttctgt atcagtatcc ctatcatgta 3420 atggagacac tacaaattga atgtgtaact cttttaaata ctctaaccac tcggcttttg 3480 ctgattctgg atataaaaca aatgtccaat tacgtcctct tgaatttttc ttgttttcag 3540 tttcttttat tacattttcg ctcatgatat aataacggtg ctaatacact taacaaatt 3600 tagtcataga taggcagcat gccagtgctg tctatctttt tttgtttaaa atgcaccgta 3660 ttcctcctt gcatattttt ttattagaat accggttgca tctgatttgc taatattata 3720 tttttctttg attctattta atatctcatt ttcttctgtt gtaagtctta aagtaacagc 3780 aacttttttc tctttttttc tatctacaac catcactgta cctcccaaca tctgtttttt 3840 tcactttaac ataaaaaaca accttttaac attaaaaacc caatatttat ttattgttt 3900 ggacaatgga caatggacac ctagggggga ggtcgtagta cccccctatg ttttctcccc 3960 taaataaccc caaaaatcta agaaaaaaag acctcaaaaa ggtctttaat taacatctca 4020 aatttcgcat ttattccaat ttcctttttg cgtgtgatgc gctgcgtcca ttaaaaatcc 4080 tagagctttg aaaccgaaag ttaatagctg tcgctactac tttcgcttac gctctaagta 4140 tattttaagg actgtcacac gcaaaaagtt ttctcggcat aaaagtacct ctacatctct 4200 aaatcgtctg tacgctgttt ctcacgcttt ctatcgacct tctggacatt atcctgtaca 4260 acatccataa actgtcccac acgctcaaat ttggaatcat taaagaattt ctctttaagc 4320 ctattaaacc ctttctcaaa cccagggaaa ttcgccctcg cagcacgata taaagtcact 4380 gtactagctt gaaatttctc tgatacattc aactgctcat tcaaactatc attctctcgc 4440 tttaatttat taacctcttt acttttttcg tgatacccct ctttccatgt attcactact 4500 tctttcaaac tctctctacg tttttttaat tcttgatttt ctgtgtaata gtctgtgctc 4560 ttaatatttt cgtaatcatc aacaatccgt tctgcagaag agattgtttc ttgcaggcgt 4620 tcaaattcat cagcagttaa tatctttcta ccagtctctt cacgtccaga gaacaaacct 4680 gtacgctcat tttcataatc aaagggtttc gtagacctca tatgctctat tccactctgt 4740 aactgcttat ttgccttctg taactcatcc ttaacttctt gcagttcctg tttatgaaat 4800 acagtatctt tcttgtactg atccatcgct ttatgttctc gttctgtaac ctctttggac 4860 gtgcctcttt caagttcata acctttctca ttcacatact cattaaatct atcttgtaat 4920 tgagtaaagt ctttcttgtt gcctaactgt tcttttgcag acaatctccc gtcctctgtt 4980 aaagggacaa aaccaaagtg catatgtggg actctttcat ccagatggac agtcgcatac 5040 agcatatttt ccttaccgta ttcattttct agaaactcca agctatcttt aaaaaatcgt 5100 tctatttctt ctccgcttaa atcatcaaag aaatctttat cacttgtaac cagtccgtcc 5160 acatgtcgaa ttgcatctga ccgaatttta cgtttccctg aataattctc atcaatcgtt 5220 tcatcaattt tatctttata ctttatattt tgtgcgttaa tcaaatcata atttttatat 5280 gtttcctcat gatttatgtc tttattatta tagtttttat tctctctttg attatgtctt 5340 tgtatcccgt ttgtattact tgatccttta actctggcaa ccctcaaaat tgaatgagac 5400 atgctacacc tccggataat aaatatatat aaacgtatat agatttcata aagtctaaca 5460 cactagactt atttactcg taattaagtc gttaaaccgt gtgcttacg accaaacta 5520 taaaaccttt aagaactttc tttttaca agaaaaaga aattagaata atctctcata 5580 tctttattc ataatcgca tccgattgca gtataaattt aacgatcact catcatgttc 5640 atattattaca gagctcgtgc tataattata ctattttat aaggaaa aaatatgggc 5700 atttttagta ttttgtaat cagcacagtt cattatcaac CAaaaaaa ataagtggtt 5760 atatgaatc gttaataagc aaattcata taaccaattt aaagaggggtt atatgaacg 5820 agaaaaataat aaaacacagt caaacttta tactcaa acatatata gataaaata 5880 tgacaatat agattaat gacatgata atatctttga aatcggctca ggaaaaggcc 5940 attttaccct tgaattagta aagaggtgta atttcgtaac tgccattgaa atagaccata 6000 aattatgcaa actacagaa aaaacttg ttgatcacga taatttcca gttttaaaca 6060 aggatatatt gcagtttaaa tttcctaaaa accaatccta taaatatat ggtaatatac 6120 cttataacat aagtacggat atatacgca aaattgtttt tgatagtata gctaatgaga 6180 tttatttaat cgtggaatac gggtttgcta aaagattat aaatacaaaa cgctcattgg 6240 cattactttt aatggcagaa gttgatatt ctatattaag tatggttcca agaaatatt 6300 ttcatcctaa acctaaagtg aatagctcac ttatcagatt aagtagaaaa aaatcaagaa 6360 tatcacacaa agataacaa aagtataatt atttcgttat gaaatgggtt aacaaagaat 6420 aaagaaaat atttacaaaa aatcaattta acaattcctt aaaacatgca ggaattgacg 6480 atttaaaaa tattagcttt gaacaattct tatctctttt caatagctat aaattattta 6540 ataagt taagggatgc ataaactgca tcccttaact tgtttttcgt gtgcctattt 6600 tttgtgaatc gacctgcagg catgcaagct taagcgagtt ggaatttaaa tatgatatct 6660 acattatcag cagtaacatc aacctttgat acaaggttgt tgacgatttt ctttttatta 6720 tcatatgata gttcattaat cggaattgag cccaactgag ttttaactaa ctcaaaaaca 6780 tcagtagat cattaaattt attttcgcta atcttagctt taagcagctt tttctcagcc 6840 tgaaggaat footcgatc tttcaactca tccatagtga taaatcatt taggtacaaa 6900 tcagagttct tttgtatttt tttatcgatc tgtgaaattt gctttttaaa tgacgaagta 6960 tcaagaatag gttggttgtt gccattgata attttcaata aggagtcatt attttcttga 7020 aatccaatca ggttgtcaat aacagtattt tctaaattac ttaaatcata agttcctgaa 7080 tcacactttt tattgtcatt atatactgta attccttttg tttttcgagg aaatctattt 7140 gcacagtgat atttcatagt gcggcttcca tcttttcttt tgtggccaag aacaattttt 7200 aaaggtgctc cacagtaacc gcaccttgcc atccctgaca gcatatattt agcttggaaa 7260 ggtctagggt tgttatttct ttcataagtc tgctgttgtc tttcttctag ctctttttga 7320 acttttaaat aagtctcata agggataatt ggtttgtgca taccttcaaa taggctgtcc 7380 ttaaatttga tataaccaca gtaaactgga ttatcaagtg tttgtcttag ggtacgataa 7440 gaccacggta tatctttacc gatgtgtcca gattcattga gtttatctct taattttgta 7500 agtgatattc ctgataaata atcagtgaat atttgttcaa ctattgtagc ttgtaaagga 7560 acaatttcta atatacctgt ctttctgttg tggtaatacc caaaagctgt cttagtccac 7620 atcatagact taccagattt cgctcgccct agtttaccca tagtcatgcg ttcttttata 7680 ttctctcttt caaactcatt aattgcagaa agaatagtga gaaacaagct acccatagca 7740 gaagaagtat caatactttc attaagcgag ataaagtcta tttattttt tgtgaacaca 7800 tccttaacaa gataaagagt atctcttaca ctacgtgaaa ggcggtctag cttatataca 7860 agaactgtat caaaagcttt attctcgata tcgttgatta atctttgcat tgctgggcgt 7920 tcaagtttgg cccctgaaaa accagcatca gtataagtat cagatacttg ccaccccatt 7980 gcttcagcat atttgttaa acggtcaatt tgctcatcaa ttgagaaccc ttcctctgct 8040 tggttagtag tggatactcg tgtatagatt gctactttct tagtcatgag atttccccct 8100 taaaaataaa ttcattcaaa tacagatgca ttttattca tatagtaagt acatcaccta 8160 ttagtttgtt gttaaacaa actaacttat tttcatctta tataacctcg tcagtatttt 8220 caatattttt tttagtttt tatgaacaca ttagatttaa taaagggaag attcgctatg 8280 tactatgttg atacttaatt taaagattaa acaaatggag tggatgaagt ggatatcgct 8340 gatcaaacct ttgtcaaaaa agtaaatcaa agttattat taaaagaaat ccttaaaaat 8400 tcacctattt caagagcaaa attatctgaa atgactggat taaataaatc aactgtctca 8460 tcacaggtaa acacgttaat gaaagaaagt atggtatttg aaataggtca aggacaatca 8520 agtggcggaa gaagacctgt catgcttgtt tttaataaaa aggcaggata ctccgttgga 8580 atagatgttg gtgtggatta tattaatggc atttaacag accttgaagg aacaatcgtt 8640 cttgatcaat accgccattt ggaatccaat tctccagaaa taacgaaaga cattttgatt 8700 gatatgattc atcactttat tacgcaaatg ccccaatctc cgtacgggtt tattggtata 8760 ggtatttgcg tgcctggact cattgataaaa gatcaaaaaa ttgttttcac tccgaactcc 8820 aactggagag atattgactt aaaatcttcg atacaagaga agtacaatgt gtctgttttt 8880 attgaaaatg aggcaaatgc tggcgcatat ggagaaaaac tatttggagc tgcaaaaaat 8940 cacgataaca ttattacgt aagtatcagc acaggaatag ggatcggtgt tattatcaac 9000 aatcatttat atagaggagt aagcggcttc tctggagaaa tgggacatat gacaatagac 9060 tttaatggtc ctaaatgcag ttgcggaaac cgaggatgct gggaattgta tgcttcagag 9120 aaggctttat taaaatctct tcagaccaaa gagaaaaaac tgtcctatca agatatcata 9180 aacctcgccc atctgaatga tatcggaacc ttaaatgcat tacaaaattt tggattctat 9240 ttaggaatag gccttaccaa tattctaaat actttcaacc cacaagccgt aattttaaga 9300 aatagcataa ttgaatcgca tcctatggtt ttaaattcaa tgagaagtga agtatcatca 9360 agggtttatt cccaattagg caatagctat gaattattgc catcttcctt aggacagaat 9420 gcaccggcat taggaatgtc ctccattgtg attgatcatt ttctggacat gattacaatg 9480 taatttttta tggaatggac agctcatctt taaagatgag tttttttatt ctaggagtat 9540 ttctgaattc 9550 <210> 11 <211> 7143 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14411 <400> 11 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt gggaaggggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg agcgcgacgt aatacgactc actatagggc gaattgaagg aaggccgtca aggccgcatt gcacgcgtgc tagcggccgc gtcgacgaag ttcctattcc gaagttccta 420 ttctctagaa agtatagga cttctatcac attgaaaggg gaggagaatc atgaatatg gcacaata cttccagaac ttcattggca ttagcagcct gcaaaaaca ctgagaaatg cactgattcc gacagaaaca acacagcagt ttattgtca aaacggcatc atcaaagagg atgaactgag aggcgaaaat cgccaaattc tgaaagatat catggacgac tattaccgtg gctttatttc agaaacactg tccagcattg atgatatcga ttggacaagc ctgttcgaga 720 aaatggaat ccaactgaaa aacggcgata acaaagacac gctgattaa gaacaaacgg aatatcgcaa agcgatccac aaaaagtttg caaatgatga ccgctttaaa aacatgttca 840 gcgcgaaact gattagcgat attctgccgg aatttgtcat ccacaataat aactatagcg 900 cgagcgagaa agaagaaaaa acacaggtca ttaaactgtt tagccgcttt gccacaagct 960 tcaaagacta tttcaaaaat cgcgcaaact gctttagcgc agatgatatt tcatcatcaa 1020 gctgccatcg gattgtcaat gataatgcgg aaatcttttt tagcaacgca ctggtctatc 1080 gcagaattgt taaatcattg agcaacgacg acatcaacaa aatctcaggc gatatgaaag 1140 acagcctgaa agaaatgtca ctggaagaaa tctacagcta cgaaaaatac ggcgaattta 1200 tcacacaaga aggcatcagc ttttacaacg atattgcgg caaagtcaac agctttatga 1260 atctgtattg ccagaaaaac aaagaaaaca aaaacctgta taaactgcag aaactgcaca 1320 agcagattct gtgcattgca gatacatcat atgaagtccc gtacaaattt gagagcgacg 1380 aagaagttta tcaaagcgtt aatggctttc tggataacat cagcagcaaa catattgttg 1440 aacgcctgag aaaaattggc gataactata atggctacaa cctggacaaa atctacatcg 1500 tcagcaaatt ttacgaaagc gtcagccaaa aaadatacg cgattgggaa acaattaata 1560 cagcgctgga aattcattat aacaacattc tgcctggcaa cggcaaaagc aaagcagata 1620 aagttaaaaa ggcggtcaaa aatgacctgc agaaaagcat tacagaaatc aatgaactgg 1680 tcagcaacta caaactgtgc tcagatgata atatcaaggc ggaaacgtac atccatgaaa 1740 ttagcnote cctgaacaac tttgaagcgc aagaactgaa atataacccg gaaatccatc 1800 tggttgaaag cgaactgaaa gcaagcgagc tgaaaaatgt tctggatgtc attatgaatg 1860 cgtttcattg gtgcagcgtc tttatgacag aagaactggt cgataaagat aacaactttt 1920 atgcggaact ggaagagatt tacgacgaaa tttatccggt catcagcctg tataatctgg 1980 ttcgcaatta tgtcacacag aaaccgtata gcacgaagaa aatcaaactg aactttggca 2040 ttccgacact ggcagatggc tggtcaaaat caaaagaata tagcaacaac gcgatcatcc 2100 tgatgcgcga taatctttat tatctgggca ttttcaacgc gaaaaacaag ccggacaaaa 2160 aaatcatcga aggcaatacg tcagagaaca aaggcgacta taaaaagatg atctataatc 2220 tgcttccggg accgaataaa atgatcccga aagtttttct gtcaagcaaa acaggcgtcg 2280 aaacatataa accgtcagcg tatattctgg aaggctacaa acagaacaaa cacatcaaaa 2340 gcagcaagga ctttgacatc acattttgcc atgatctgat cgactacttt aagaactgca 2400 ttgcaattca tccggaatgg aaaaacttcg gctttgattt ttcagacacg agcacgtatg 2460 aagatatcag cggcttttat agagaagttg aactgcaggg ctataaaatc gactggacat 2520 atatcagcga aaaggatatt gatctgctgc aagaaaaagg ccaactgtac ctgtttcaga 2580 tctacaacaa agacttcagc aaaaaaaagca cgggcaatga taacctgcat acgatgtacc 2640 tgaaaaacct ttttagcgaa gagaacctga aagacattgt cctgaaactg aatggcgaag 2700 ccgaaatttt ctttcgcaaa tccagcatta aaaacccgat catccataaa aaaggcagca 2760 ttctggttaa ccgcacatat gaagcggaag aaaaagatca gtttggcaac attcagatcg 2820 tccgcaaaaa cattccggaa aacatttatc aagaactgta caaatacttt aacgataaaa 2880 gcgataaaga actgtccgac gaagcagcga aacttaaaaa tgttgttggc catcatgaag 2940 cggcaacaaa cattgttaaa gactatcgct atacgtacga taaatacttt ctgdatagc 3000 cgatcacgat caacttcaaa gcaaataaaa cgggctttat caacgatcgc attctgcagt 3060 atattgccaa agaaaaggat ctgcatgtca tcggcattgc tagaggcgaa cgcaatctga 3120 tttatgtcag cgttattgat acatgcggca acattgtcga acagaaaagc tttaacattg 3180 tcaacggcta tgactaccag atcaagctga aacagcaaga aggcgcaaga caaattgctc 3240 gcaaagaatg gaaagaaatc ggcaagatca aagaaattaa agagggctat ctgagcctgg 3300 tcattcatga aatttctaaa atggtcatca aatataacgc gattatcgcc atggaagatc 3360 tgtdatagg ctttaagaaa ggccgtttta aagtcgaaag acaggtctac cagaaattcg 3420 aaacaatgct gattaacaaa ctgaattatc tggtgtttaa agacatcagc atcacggaaa 3480 atggcggact gctgaaaggc tatcaactga catatattcc ggataagctt aaaaacgtcg 3540 gccatcaatg cggctgcatc tttatgttc cggcagcgta tacatcaaaa attgatccga 3600 caacaggctt tgtcaacatc ttcaaattca aagatctgac ggtcgatgcg aaacgcgaat 3660 tcattaagaa atttgacagc atccgctacg acagcgagaa aaatcttttc tgctttacgt 3720 tcgactacaa caactttatc acgcagaata cggttatgtc aaaaagcagc tggtcagtct 3780 atacatatgg cgttagaatt aaacgcagat ttgtgaacgg cagatttagc aatgaaagcg 3840 atacaatcga catcacgaaa gacatggaaa aaacgcttga aatgacggat attaactggc 3900 gtgatggaca tgatcttcgc caggatatta tcgattatga aatcgtccag cacatctttg 3960 aaatctttag actgacagtc caaatgcgca attcactgtc agaacttgaa gatagagatt 4020 atgatcgcct gatttctccg gtcctgaatg aaaataacat cttttacgat agcgcaaaag 4080 caggcgacgc actgccgaaa gatgcggatg caaatggcgc atattgcatt gcactgaaag 4140 gcctgtatga aatcaaacaa atcaccgaga attggaaaga ggacggcaaa ttttcacggg 4200 ataaactgaa aatcagcaac aaggactggt ttgacttcat ccaaaataag cgctacctgt 4260 aaattggagg gaagctttat gagtaaagga gaagaacttt tcactggagt tgtcccaatt 4320 cttgttgaat tagatggcga tgttaatggg caaaaattct ctgttagtgg agagggtgaa 4380 ggtgatgcaa catacggaaa acttaccctt aaatttatttt gcactactgg gaagctacct 4440 gttccatggc caacgcttgt cactactctc acttatggtg ttcaatgctt ttctagatac 4500 ccagatcata tgaaacagca tgactttttc aagagtgcca tgcccgaagg ttatgtacag 4560 gaaagaacta tattttacaa agatgacggg aactacaaga cacgtgctga agtcaagtttt 4620 gaaggtgata cccttgttaa tagaatcgag ttaaaaggta ttgattttaa agaagatgga 4680 aacattcttg gacacaaaat ggaatacaat tataactcac ataatgtata catcatggca 4740 gacaaaccaa agaatggcat caaagttaac ttcaaaatta gacacaacat taaagatgga 4800 agcgttcaat tagcagacca tttcaacaa aatactccaa ttggcgatgg ccctgtcctt 4860 ttaccagaca accattacct gtccacgcaa tctgcccttt ccaaagatcc caacgaaaag 4920 agagatcaca tgatccttct tgagtttgta acagctgctg ggattacaca tggcatggat 4980 gaactataca aataatgctg tccagactgt ccgctgtgta aaaaaaagga ataaaggggg 5040 gttgacatta ttttactgat atgtataata taatttgtat aagaaaatgg tcaaaagacc 5100 tttttaattt ctactcttgt agatacaagt accattttcc ctatagaagt tcctattccg 5160 aagttcctat tcttcaaata gtataggaac ttcgctaagc gtcgacctgc aggcatgcgg 5220 taccaagctt gcatctgggc ctcatgggcc ttcctttcac tgcccgcttt ccagtcggga 5280 aacctgtcgt gccagctgca ttaacatggt catagctgtt tccttgcgta ttgggcgctc 5340 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc gggtaaagcc tggggtgcct 5400 aatgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 5460 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 5520 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 5580 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 5640 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 5700 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 5760 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 5820 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 5880 actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct 5940 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt 6000 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga 6060 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca 6120 tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat 6180 caatctaaag tatatatgag taaacttggt ctgacagtta ttagaaaaaat tcatccagca 6240 gacgataaaa cgcaatacgc tggctatccg gtgccgcaat gccataacagc accagaaaac 6300 gatccgccca ttcgccgcccc agttcttccg caatatcacg ggtggccagc gcaatatcct 6360 gataacgatc cgccacgccc agacggccgc aatcaataaa gccgctaaaa cggcctttt 6420 ccaccataat gttcggcagg cacgcatcac catgggtcac caccagatct tcgccatccg 6480 gcatgctcgc tttcagacgc gcaaacagct ctgccggtgc caggccctga tgttcttcat 6540 ccagatcatc ctgatccacc aggcccgctt ccatacgggt acgcgcacgt tcaatacgat 6600 gtttcgcctg atgatcaaac ggacaggtcg ccgggtccag ggtatgcaga cgacgcatgg 6660 catccgccat aatgctcact ttttctgccg gcgccagatg gctagacagc agatcctgac 6720 ccggcacttc gcccagcagc agccaatcac ggcccgcttc ggtcaccaca tccagcaccg 6780 ccgcacacgg aacaccggtg gtggccagcc agctcagacg cgccgcttca tcctgcagct 6840 cgttcagcgc accgctcaga tcggttttca caaacagcac cggacgaccc tgcgcgctca 6900 gacgaaacac cgccgcatca gagcagccaa tggtctgctg cgcccaatca tagccaaaca 6960 gacgttccac ccacgctgcc gggctacccg catgcaggcc atcctgttca atcatactct 7020 tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 7080 ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 7140 cac 7143 <210> 12 <211> 2778 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14412 <400> 12 ctaaattgta agcgttaata tttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaag atagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggctcttcg ctattacgcc agctggcgaa aggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt atacgactc actatagggc gattggcgg aaggccgtca 360 aggccacgtg tcttgtccag gcgcgccaca attggcgatg gccctgtcct tttaccagac 420 aaccattacc tgtccacgca atctgcctt tccaagatc ccaacgaaaa gagagatcac 480 atgatccttc ttgagttgt aacagctgct gggattacac atggcatgga tgaactatac 540 aaataatgct gtccagactg tccgctgtgt aaaaaaagg aaaagggg ggttgacatt 600 attttactga tatgtataat ataatttgta taagaaatg gtcaaagac ctttttaatt 660 tctactcttg tagataagcc gtaaacggga cgacatgaag ttcctattcc gaagttccta 720 ttcttcaaat agtatagga cttcgctaag cgtcgacctg caggcatgcg gtaccaagct tgcattttta attatggag cacaagactg gcctcatggg ccttccgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaacatg gtcatagctg tttccttgcg tattgggcgc tctccgcttc ctcgctcact gactcgctgc gctcggtcgt tcgggtaaag 960 cctggggtgc ctaatgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gccttttctcc 1200 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 1260 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 1320 1380. tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa aggttggta gctcttgatc cggcaaacaa accccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaac tcacgttaag 1680. ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agaaccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agtagtagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 2160 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 2220 tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 2280 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 2340 agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 2400 cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 2460 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 2520 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 2580 gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 2640 gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 2700 tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 2760 ttccccgaaa agtgccac 2778 <210> 13 <211> 2778 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14413 <400> 13 ctaaattgta agcgttaata tttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaag atagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggctcttcg ctattacgcc agctggcgaa aggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt atacgactc actatagggc gattggcgg aaggccgtca 360 aggccacgtg tcttgtccag gcgcgccaca attggcgatg gccctgtcct tttaccagac 420 aaccattacc tgtccacgca atctgcctt tccaagatc ccaacgaaaa gagagatcac 480 atgatccttc ttgagttgt aacagctgct gggattacac atggcatgga tgaactatac 540 aaataatgct gtccagactg tccgctgtgt aaaaaaagg aaaagggg ggttgacatt 600 attttactga tatgtataat ataatttgta taagaaatg gtcaaagac ctttttaatt 660 tctactcttg tagatcagcc ggaacgtcaa gccgttgaag ttcctattcc gaagttccta ttcttcaaat agtatagga cttcgctaag cgtcgacctg caggcatgcg gtaccaagct tgcattttta attatggag cacaagactg gcctcatggg ccttccgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaacatg gtcatagctg tttccttgcg tattgggcgc tctccgcttc ctcgctcact gactcgctgc gctcggtcgt tcgggtaaag 960 cctggggtgc ctaatgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gccttttctcc 1200 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 1260 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 1320 1380. tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa aggttggta gctcttgatc cggcaaacaa accccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaac tcacgttaag 1680. ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agaaccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agtagtagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 2160 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 2220 tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 2280 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 2340 agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 2400 cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 2460 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 2520 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 2580 gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 2640 gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 2700 tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 2760 ttccccgaaa agtgccac 2778 <210> 14 <211> 2778 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14414 <400> 14 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360 aggccacgtg tcttgtccag gcgcgccaca attggcgatg gccctgtcct tttaccagac 420 aaccattacc tgtccacgca atctgccctt tccaaagatc ccaacgaaaa gagagatcac 480 atgatccttc ttgagtttgt aacagctgct gggattacac atggcatgga tgaactatac 540 aaataatgct gtccagactg tccgctgtgt aaaaaaaagg aataaagggg ggttgacatt 600 attttactga tatgtataat ataatttgta taagaaaatg gtcaaaagac ctttttaatt 660 tctactcttg tagatggcaa attcagcact tcaatcgaag ttcctattcc gaagttccta 720 ttcttcaaat agtataggaa cttcgctaag cgtcgacctg caggcatgcg gtaccaagct 780 tgcattttta attaatggag cacaagactg gcctcatggg ccttccgctc actgcccgct 840 ttccagtcgg gaaacctgtc gtgccagctg cattaacatg gtcatagctg tttccttgcg 900 tattgggcgc tctccgcttc ctcgctcact gactcgctgc gctcggtcgt tcgggtaaag 960 cctggggtgc ctaatgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 1020 tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa 1080 gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct 1140 ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 1200 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 1260 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 1320 tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag 1380 cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga 1440 agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga 1500 agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg 1560 gtagcggtgg ttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 1620 aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag 1680 ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta attaaaaat 1740 gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct 1800 taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac 1860 tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa 1920 tgataccgcg agaaccacgc tcaccggctc cagatttatc agcaataaac cagccagccg 1980 gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt 2040 gttgccggga agtagtagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 2160 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 2280 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 2520 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaac aggaggca aatgccgca aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccac 2778 <210> 15 <211> 10623 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14438 <400> 15 caggtcgatt cacaaaaaat aggcacacga aaaacaagtt aagggatgca gtttatgcat 60 cccttaactt acttattaaa taatttatag ctattgaaaa gagataagaa ttgttcaaag 120 ctaatattgt ttaaatcgtc aattcctgca tgttttaagg aattgttaaa ttgatttttt 180 gtaaatattt tcttgtattc tttgttaacc catttcataa cgaaataatt atacttttgt 240 ttatctttgt gtgatattct tgattttttt ctacttaatc tgataagtga gctattcact 300 ttaggtttag gatgaaaata ttctcttgga accatactta atatagaaat atcaacttct 360 gccattaaaa gtaatgccaa tgagcgtttt gtatttaata atcttttagc aaacccgtat 420 tccacgatta aataaatctc attagctata ctatcaaaaa caattttgcg tattatatcc 480 gtacttatgt tataaggtat attaccatat attttatagg attggttttt aggaaattta 540 aactgcaata tatccttgtt taaaacttgg aaattatcgt gatcaacaag tttattttct 600 gtagttttgc ataatttatg gtctatttca atggcagtta cgaaattaca cctctttact 660 aattcaaggg taaaatggcc ttttcctgag ccgatttcaa agatattatc atgttcattt 720 aatcttatat ttgtcattat tttatctata tttgttttg aagtaataaa gttttgactg 780 tgttttatat ttttctcgtt cattataacc ctctttaatt tggttatatg aatttgctt 840 attaacgatt cattataacc acttatttt tgtttggttg ataatgaact gtgctgatta 900 caaaaatact aaaaatgccc atattttttc ctccttataa aattagtata attatagcac 960 gagctctgat aaatatgaac atgatgagtg atcgttaaat ttatactgca atcggatgcg 1020 attattgaat aaaagatatg agagatttat ctaatttcttt ttttcttgta aaaaaagaaa 1080 gttcttaaag gttttatagt tttggtcgta gagcacacgg tttaacgact taattacgaa 1140 gtaaataagt ctagtgtgtt agactttatg aaatctatat acgtttatat atatttatta 1200 tccggaggtg tagcatgtct cattcaattt tgagggttgc cagagttaaa ggatcaagta 1260 attackaacgg attackaactcaa gagagaata aaacataat attackagaca 1320 taaatcatga ggaacatat aaaatttag atttgatta cgcacaaat aaagtata 1380 aagataaaat tgatgaacg attgatgaga attattcagg gaacgtaaa attcggtcag 1440 atgcaattcg acatgtggac ggactggtta caagtgataa agatttcttt gatgatttaa 1500 gcggagaga atagaacga tttttaaag atagcttgga gtttctagaa atgaatacg 1560 gtaaggaaaa tatgctgtat gcgactgtcc atctggatga aagagtccca catatgcact 1620 ttggttttgt ccctttaaca gaggacggga gattgtctgc aaagaacag ttaggcaaca 1680 agaaagactt tactcatta agaatagat ttatgagta tgtgaatgag aaggttatg 1740 aaacttgaaag aggcacgtcc aaagaggtta cagaacgaga acataagcg atggatcagt 1800 axagaga tactgtattt cataacagg aactgcaga agttaaggat gagttacaga 1860 aggcaaataa gcagttacag agtgaatag agcatatgag gtctacgaaa ccctttgatt 1920 atgaaaatga gcgtacaggt ttgttctctg gacgtgaaga gactggtaga agatattaa 1980 ctgctgatga atttgaacgc ctgcaagaaa caatctctc tgcagaacgg attgttgatg 2040 attacgaaaa tattagagc acagactatt acacagaaa tcagaatta aaaaaacgta 2100 gagagtttt gaaaagta gtgaatacat ggaaagggg gtacacgaa aaagtaag 2160 aggttaata atttaagcga gagaatgata gtttgaatga gcagttgaat gtatcagaga 2220 aatttcaagc tagtacagtg acttatc gtgctgcgag ggcgaatttc cctgggtttg 2280 agaaagggtt taataggctt aaagagaat tctttaatga ttccaattt gagcgtgtgg 2340 caggagtttat ggatgttgta caggataatg tccagaaggt cgatagaaag cgtgagaaac 2400 agcgtacaga cgatttagag atgtagaggt acttttatgc cgagaaaact tttgcgtgt 2460 gagtcctt aaaatact tagcgt gcgaagtag tagcgacc tattacttt 2520 cggtttcaa gctctaggat ttatgga cgcagcgcat cacacgcaa aaggaattg 2580 gataaatgc gaatttgag atgttaatta agacctttt tgaggtcttt tttcttaga 2640 ttttttggggt tattttagggg agaaaacata ggggggtact acgaccccc ccctaggtgt 2700 ccattgtcca ttgtccaac aaaaay atattggtt tttaatgtta aaaggttgtt 2760 ttttatgtta aagtgaaaa aacagatgtt gggaggtaca gtgatggttg tagatagaaa 2820 agagagaa aaagttgctg ttactttaag acttacaca gagaaaatg agatattaaa 2880 taaatcaa gaaaaata atattagcaa atcagatgca accggtattc taaaaaaa 2940 atatgcaag gaggaatacg gtgcatttta aaaaaaaa gatgacagc actggcatgc 3000 tgcctatcta tgactaaatt tgttaagtg tattagcacc gttattatat catgagcgaa 3060 aatgtaata aagaactga aaaaaaaaattcaag gacgtattg gacattgtt 3120 ttatatccag atcagcaa agccgagtgg ttagagtatt taaaagagtt acacattcaa 3180 tttgtagtgt ctccattaca tgattagg actgatacag aaggtaggat gaaaaaagag 3240 cattatcata ttctgtgat gtatgaggggt aaaatctt atgacagat aaaaatatt 3300 acagaagaat tgaatgcgac tattccgcag attgcaggaa gtgtgaaagg tcttgtgaga 3360 tatgcttc acatggacga tcctataaa tttaaataatc aaaaagaga tatgatagtt 3420 tatggcggtg tagatgttga tgaattatta aagaaaacaa caacagatag atataaatta 3480 attaaagaaa tgattgagtt tattgatgaa caaggaatcg tagaatttaa gagtttaatg 3540 gattatgcaa tgaagtttaa atttgatgat tggttcccgc tttatgtga taactcggcg 3600 tatgttattc aagaatatat aaaatcaaat cggtataaat ctgaccgata gattttgaat 3660 ttaggtgtca caagacactc ttttttcgca ccagcgaaaa ctggtttaag ccgactgcgc 3720 aaaagacata atcgactcta gaggatcccc gggtaccgag ctctgccttt tagtccagct 3780 gatttcactt tttgcattct acaaactgca taactcatat gtaaatcgct cctttttagg 3840 tggcacaaat gtgaggcatt ttcgctcttt ccggcaacca cttccaagta aagtataaca 3900 cactatactt tatattcata aagtgtgtgc tctgcgaggc tgtcggcagt gccgaccaaa 3960 accataaaac ctttaagacc tttctttttt ttacgagaaa aaagaaacaa aaaaacctgc 4020 cctctgccac ctcagcaaag gggggttttg ctctcgtgct cgtttaaaaa tcagcaaggg 4080 acaggtagta ttttttgaga agatcactca aaaaatctcc acctttaaac ccttgccaat 4140 ttttattttg tccgttttgt ctagcttacc gaaagccaga ctcagcaaga ataaaatttt 4200 tattgtcttt cggtttcta gtgtaacgga caaaaccact caaaataaa aagatacaag 4260 agaggtctct cgtatctttt attcagcaat cgcgccccgat tgctgaacag attaataatg 4320 agctcgaatt cagatctgaa ttctgctgtc cagactgtcc gctgtgtaaa aaaaaggaat 4380 aaaggggggt tgacattatt ttactgatat gtataatata atttgtataa gaaaatgtgg 4440 ccacattgaa agggaggag aatcatgccg caatttgata tcctgtgcaa gacacctccg 4500 aaggtgctgg tgcggcaatt tgtggaaagg tttgaaagac cgagcggtga aaagatcgcg 4560 ctgtgtgcag cggaactgac ttatctgtgc tggatgatca cacataacgg aactgcgatc 4620 aaaagagcga cattcatgtc atacaacaca atcatctcta acagcctgtc gtttgatatc 4680 gtgaacaagt cgctgcagtt taagtacaag acgcaaaagg cgacaatcct ggaagcgtcc 4740 ctgaagaagc tgatcccagc gtgggagttt acgatcatcc cgtattacgg ccagaagcac 4800 cagagcgaca tcacagatat cgtgtcttca ctgcaactgc aattcgaaag ttcggaagaa 4860 gcggataagg gaaactctca ttcgaagaag atgctgaagg cgctgctgag cgaaggcgaa 4920 tcgatctggg agatcacgga aaagatcctg aactctttcg agtacactag ccggttcact 4980 aagactaaga cactgtatca atttctgttt ctggcgacct ttatcaactg tggaagattc 5040 tcagacatca agaacgtgga cccgaagtcg tttaagctgg tgcagaacaa gtatctggga 5100 gtgatcatcc aatgcctggt gacagaaact aagacgtcgg tgtccaggca tatctacttt 5160 ttctccgcga gaggaagaat cgatccactg gtgtatctgg atgaatttct gcggaactcc 5220 gaaccggtgc tgaagcgtgt gaaccgcaca ggaaacagtt cctcaaacaa gcaggaatat 5280 cagctgctga aggataacct ggtgagatca tacaacaagg cgctgaagaa gaatgcaccg 5340 tacagcatct tcgcgatcaa gaacggacct aagagccata tcggacgcca tctgatgact 5400 tcctttctgt caatgaaggg tctgactgaa ctgacaaacg tggtggggaa ctggtccgac 5460 aaaagagcgt cagcggtggc acggaccact tatacccacc agatcactgc gatcccggat 5520 cactactttg cgctggtgag ccgctactat gcgtatgatc ctatcagcaa ggaaatgatc 5580 gcgctgaagg acgaacaaa cccgatcgag gatggcagc atcgaaca actgaagggc 5640 tcagcggaag gatcgatcag atatcctgcg tcagcggag tcatcaca ggaagtgctg 5700 gattacctgt caagctatat cacacacgc atcgaga gcagagagga cggattttcct 5760 gaaggaaatc cgtttttta tttgcacgc gtgctagcgg ccgcgtcgac gaagttccta 5820 ttccgaagtt cctattctct agaaagtata ggaacttcta tcacattgaa aggggag 5880 aatcatgaat aatggcacaa ataacttcca gaacttcatt ggcattagca gcctgcaaaa 5940 aacactgaga atgcactga ttccgacaga aacacacag cagttattg tcaaaacgg 6000 catcatcaaa gaggatgaac tgagaggcga aaatcgccaa attctgaaag atcatgga 6060 cgactattac cgtggcttta ttcagaac actgtccagc attgatgata tcgattggac 6120 aagcctgttc gagaaatgg aaatccaact gaaaaacggc gatacaag acacgctgat 6180 taaagaaaaacgaatc gcaaagcgat ccaaaaag tttgcaatg atgaccgctt 6240 taaaaacatg ttcagcgcga aactgattag cgatattctg ccggaatttg tcatccacaa 6300 tataactat agcgcgagcg agaaagaaga aaaaacacag gtcattaaac tgtttagccg 6360 ctttgccaca agcttcaaag actatttcaa aaatcgcgca aactgcttta gcgcagatga 6420 tatttcatca tcaagctgcc atcggattgt caatgataat gcggaaatct tttttagcaa 6480 cgcactggtc tatcgcagaa ttgttaaatc attgagcaac gacgacatca acaaaatctc 6540 aggcgatatg aaagacagcc tgaaagaaat gtcactggaa gaaatctaca gctacgaaaa 6600 atacggcgaa tttatcacac aagaaggcat cagcttttac aacgatattt gcggcaaagt 6660 caacagcttt atgaatctgt attgccagaa aaacaaagaa aaaaaacc tgtataaact 6720 gcagaaactg cacaagcaga ttctgtgcat tgcagataca tcatatgaag tcccgtacaa 6780 atttgagagc gacgaagaag tttatcaaag cgttaatggc tttctggata acatcagcag 6840 caaacatatt gttgaacgcc tgagaaaaat tggcgataac tataatggct acaacctgga 6900 caaaatctac atcgtcagca aatttacga aagcgtcagc caaaaaacat atcgcgattg 6960 ggaaacaatt aatacagcgc tggaaattca ttataacaac attctgcctg gcaacggcaa 7020 aaagcaagca gataagtta aaaggcggt haaaaatgac ctgcagaaaa gcattacaga 7080 aatcaatgaa ctggtcagca actacaact gtgctcagat gataatca aggcggaaac 7140 gtacatccat gaaattagcc atatcctgaa caacttgaa gcgcagaac tgaaatataa 7200 cccggaaatc catctggttg aaagcgaact gaagcaagc gagctgaaaa atgttctgga 7260 tgtcattatg aatgcgtttc attggtgcag cgtctttatg acagagaac tggtcgataa 7320 agatacaac tttgcgg aactggaga gatttacgac gaatttatc cggtcatcag 7380 cctgtataat ctggttcgca attatgtcac acagaaaccg tatagcacga agaaaatcaa 7440 actgaacttt ggcattccga cactggcaga tggctggtca aaatcaaag atatagcaa 7500 caacgcgatc atcctgatgc gcgataatct ttattatg ggcattttca acgcgaaaaa 7560 caagccggac aaaaaaatca tcgaggca tacgtcagag aaaaaggcg actataaaaaa 7620 gatgatctat aatctgcttc cgggaccgaa taaaatgatc ccgaagtttt ttctgtcaag 7680 caaaacaggc gtcgaaacat aaaccgtc agcgtatatt ctggaggct aaaacagaa 7740 caaacacatc aaaagcagca aggactttga catcacattt tgccatgatc tgatcgacta 7800 ctttaagaac tgcattgcaa ttcatccgga atggaaaaac ttcggctttg atttttcaga 7860 cacgagcacg tatgaagata tcagcggctt ttatagagaa gttgaactgc agggctataa 7920 aatcgactgg acatatatca gcgaaaagga tattgatctg ctgcaagaaa aaggccaact 7980 gtacctgttt cagatctaca acaaagactt cagcaaaaaa agcacgggca atgataacct 8040 gcatacgatg tacctgaaaa acctttttag cgaagagaac ctgaaagaca ttgtcctgaa 8100 actgaatggc gaagccgaaa ttttctttcg caaatccagc attaaaaacc cgatcatcca 8160 taaaaaaggc agcattctgg ttaaccgcac atatgaagcg gaagaaaaag atcagtttgg 8220 caacattcag atcgtccgca aaaacattcc ggaaaacatt tatcaagaac tgtacaaata 8280 ctttaacgat aaaagcgata aagaactgtc cgacgaagca gcgaaactta aaaatgttgt 8340 tggccatcat gaagcggcaa caaacattgt taaagactat cgctatacgt acgataaata 8400 ctttctgcat atgccgatca cgatcaactt caaagcaaat aaaacgggct ttatcaacga 8460 tcgcattctg foottattg ccaaagaaaa ggatctgcat gtcatcggca ttgctagagg 8520 cgaacgcaat ctgatttatg tcagcgttat tgatacatgc ggcaacattg tcgaacagaa 8580 aagctttaac attgtcaacg gctatgacta ccagatcaag ctgaaacagc aagaaggcgc 8640 aagacaaatt gctcgcaaag aatggaaaga aatcggcaag atcaaagaaa ttaaagaggg 8700 ctatctgagc ctggtcattc atgaaatttc taaaatggtc atcaaatata acgcgattat 8760 cgccatggaa gatctgtcat atggctttaa gaaaggccgt tttaaagtcg aaagacaggt 8820 ctaccagaaa ttcgaaacaa tgctgattaa caaactgaat tatctggtgt ttaaagacat 8880 cagcatcacg gaaaatggcg gactgctgaa aggctatcaa ctgacatata ttccggataa 8940 gcttaaaac gtcggccatc aatgcggctg catcttttat gttccggcag cgtatacatc 9000 aaaaattgat ccgacaacag gctttgtcaa catcttcaaa ttcaaagatc tgacggtcga 9060 tgcgaaacgc gaattcatta agaaatttga cagcatccgc tacgacagcg agaaaaaatct 9120 tttctgcttt acgttcgact acaacaactt tatcacgcag aatacggtta tgtcaaaaag 9180 cagctggtca gtctatacat atggcgttag attaaacgc agatttgtga acggcagatt 9240 tagcaatgaa agcgatacaa tcgacatcac gaaagacatg gaaaaaacgc ttgaaatgac 9300 ggatattaac tggcgtgatg gacatgatct tcgccaggat attatcgatt atgaaatcgt 9360 ccagcacatc tttgaaatct ttagactgac agtccaaatg cgcaattcac tgtcagaact 9420 tgaagataga gattatgatc gcctgatttc tccggtcctg aatgaaaata acatctttta 9480 cgatagcgca aaagcaggcg acgcactgcc gaaagatgcg gatgcaaatg gcgcatattg 9540 cattgcactg aaaggcctgt atgaaatcaa acaaatcacc gagaattgga aagaggacgg 9600 caaatttca cgggataaac tgaaaatcag caacaaggac tggtttgact tcatccaaaa 9660 taagcgctac ctgtaaattg gagggaagct ttatgagtaa aggagaagaa cttttcactg 9720 gagttgtccc aattcttgtt gaattagatg gcgatgttaa tgggcaaaaa ttctctgtta 9780 gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt atttgcacta 9840 ctgggaagct acctgttcca tggccaacgc ttgtcactac tctcacttat ggtgttcaat 9900 gctttctctag atacccagat catatgaaac agcatgactt ttcagagt gccatgcccg 9960 aaggttatgt axaaga actatatttt aaagatga cgggaactac aagacacgtg 10020 ctgaagtcaa gtttgaaggt gataccttg ttaatagaat cgagttaaaa ggtattgatt 10080 ttaagaga tggaacatt cttggacaca aaatgaata caattataac tcacataatg 10140 tatacatcat ggcagacaaa ccaagaatg gcatcaagt taacttcaaa attagacaca 10200 acattaaga tggagcgtt cattagcag accattatca acaaatact ccaattggcg 10260 atggccctgt ccttttaccaccaccatt acctgtccac gcaatctgcc ctttccaag 10320 atcccaacga aaagagagat cacatgatcc ttctgagtt tgtaacagct gctgggatta 10380 cacatggcat ggatgaacta tacaaataat gctgtccaga ctgtccgctg tgtaaaaaaa 10440 aggaataag gggggttgac attattac tgatatgtat attaataattt gtataagaaa 10500 atggtcaaaa gacctttta atttctactc ttgtagataa gccgtaaacg ggacgacatg 10560 aagttcctat tccgaagttc ctattcttca atagtatag gaacttcgct aagcgtcgac 10620 ctg 10623 <210> 16 <211> 10623 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14439 <400> 16 ggtcgattca caaaaaatag gcacacgaaa aacaagttaa gggatgcagt ttatgcatcc 60 cttaacttac ttattaaata atttatagct attgaaaaga gataagaatt gttcaaagct 120 aatattgttt aaatcgtcaa ttcctgcatg ttttaaggaa ttgttaaatt gattttttgt 180 aaatattttc ttgtattctt tgttaaccca tttcataacg aaataattat acttttgttt 240 atctttgtgt gatattcttg atttttttct acttaatctg ataagtgagc tattcacttt 300 aggtttagga tgaaaatatt ctcttggaac catacttaat atagaaatat caacttctgc 360 cattaaaagt aatgccaatg agcgttttgt atttaataat cttttagcaa acccgtattc 420 cacgattaaa taaatctcat tagctatact atcaaaaaca attttgcgta ttatatccgt 480 acttatgtta taaggtatat taccatatat tttataggat tggtttttag gaaatttaaa 540 ctgcaatata tccttgttta aaacttggaa attatcgtga tcaacaagtt tattttctgt 600 agttttgcat aatttatggt ctatttcaat ggcagttacg aaattacacc tctttactaa 660 ttcaagggta aaatggcctt ttcctgagcc gatttcaaag atattatcat gttcatttaa 720 tcttatattt gtcattattt tatctatatt atgttttgaa gtaataaagt tttgactgtg 780 ttttatattt ttctcgttca ttataaccct ctttaatttg gttatatgaa ttttgcttat 840 taacgattca ttataaccac ttatttttg tttggttgat aatgaactgt gctgattaca 900 aaaatactaa aaatgcccat atttttcct ccttataaaa ttagtataat tatagcacga 960 gctctgataa atatgaacat gatgagtgat cgttaaattt atactgcaat cggatgcgat 1020 tattgaataa aagatatgag agatttatct aatttctttt ttcttgtaaa aaaagaaagt 1080 tcttaaaggt tttatagttt tggtcgtaga gcacacggtt taacgactta attacgaagt 1140 aaataagtct agtgtgttag actttatgaa atctatatac gtttatatat atttattatc 1200 cggaggtgta gcatgtctca ttcaattttg agggttgcca gagttaaagg atcaagtaat 1260 acaaacggga tacaaagaca taatcaaaga gagaataaaa actataataa taaagacata 1320 atcatgagg aacatataaaattatgat ttgattaacg cacaaataat aaagtataaa 1380 gataaaattg atgaacgat tgatgagaat tattcaggga aacgtaaaat tcggtcagat 1440 gcaattcgac atgtggacgg actggttaca agtgataag atttctttga tgatttaagc 1500 ggagaagaaa tagaacgat ttttaagat agctggagt ttcagaaaa tgaatacggt 1560 aaggaaaata tgctgtatgc gactgtccat ctggatgaaa gagtcccaca tatgcacttt 1620 ggttttgtcc ctttaacaga ggacgggaga tgtctgcaa aagacagtt ggcacaag 1680 aaagacttta ctcaattaca agatagattt atgagtag tgaatgaga aggttatgaa 1740 cttgaaagag gcacgtccaa agaggttaca gaacgagaac aaagcgat ggatcagtac 1800 aagaagata ctgtatttca taacaggaa ctgcagag ttaaggag gttacagag 1860 gcaataagc agttacagag tggaatagag catatgaggt ctacgaaacc ctttgattat 1920 gaaaatgagc gtacaggttt gttctctgga cgtgaagaga ctggtagaa gattaact 1980 gctgatgaat ttgaacgcct gcaagaaaca atctctctg cagaacggat tgttgatgat 2040 tacgaaaata ttaagagcac agactattac acagaaaatc aagaattaaa aaaacgtaga 2100 gagagtttga aagaagtagt gaatacatgg aaagaggggt atcacgaaaa aagtaaagag 2160 gttaataaat taaagcgaga gaatgatagt ttgaatgagc agttgaatgt atcagagaaa 2220 tttcaagcta gtacagtgac tttatatcgt gctgcgaggg cgaatttccc tgggtttgag 2280 aaagggttta ataggcttaa agagaaattc tttaatgatt ccaaatttga gcgtgtggga 2340 cagtttatgg atgttgtaca ggataatgtc cagaaggtcg atagaaagcg tgagaaacag 2400 cgtacagacg atttagagat gtagaggtac tttatgccg agaaaacttt ttgcgtgtga 2460 cagtccttaa aatatactta gagcgtaagc gaaagtagta gcgacagcta ttaactttcg 2520 gtttcaaagc tctaggattt ttaatggacg cagcgcatca cacgcaaaaa ggaaattgga 2580 ataaatgcga aatttgagat gttaattaaa gacctttttg aggtcttttt ttcttagatt 2640 tttggggtta tttaggggag aaaacatagg ggggtactac gacctccccc ctaggtgtcc 2700 attgtccatt gtccaaacaa ataaataaat attgggtttt taatgttaaa aggttgtttt 2760 tttagttaaa gtgaaaaaaa cagatgttgg gaggtacagt gatggttgta gatagaaaag 2820 agagaaaaa agttgctgtt actttaagac ttacacaga agaaaatgag atttaata 2880 gatchaaaataat attagcaat cagatgcaac cggtattcta aaaaaaat 2940 atgcaagga ggaatacggt gcattttaaa caaaaaaga tagacac tggcatgctg 3000 cctatctatg actaaatttt gttaagtgta ttagcaccgt tattatca tgagcgaaaa 3060 tgtataaaa gaactgaaa acagaaaaa ttcagagga cgtaattgga cattgtttt 3120 ataccagaa tcagcaaag ccgagtggtt agagtattta aaagagttac acatcaatt 3180 tgtagtgtct ccattacatg atagggatac tgatacagaa ggtaggatga aaaaagagca 3240 ttatcatatt ctagtgatgt atgaggtaa taaatcttat gaacagataa aaatattac 3300 agaagaattg aatgcgacta ttccgcagat tgcaggaagt gtgaaaggtc ttgtgagata 3360 tatgcttcac atggacgatc ctaataattt taaataatca aagagata tgagtttta 3420 tggcggtgta gatgttgatg aattaaaa gaaacaca acagatagat ataattaat 3480 taaagaaatg attgagttta ttgatgaaca aggaatcgta gaatttaaga gtttaatgga 3540 ttatgcaatg aagtttaaat ttgatgattg gttcccgctt ttatgtgata actcggcgta 3600 tgttattcaa gaatatataa aatcaaatcg gtataaatct gaccgataga ttttgaattt 3660 aggtgtcaca agacactctt ttttcgcacc agcgaaaact ggtttaagcc gactgcgcaa 3720 aagacataat cgactctaga ggatccccgg gtaccgagct ctgcctttta gtccagctga 3780 tttcactttt tgcattctac aaactgcata actcatatgt aaatcgctcc tttttaggtg 3840 gcacaaatgt gaggcatttt cgctctttcc ggcaaccact tccaagtaaa gtataacaca 3900 ctatacttta tattcataaa gtgtgtgctc tgcgaggctg tcggcagtgc cgaccaaaac 3960 cataaaacct ttaagacctt tctttttttt acgagaaaaa agaaacaaaa aaacctgccc 4020 tctgccacct cagcaaaggg gggttttgct ctcgtgctcg tttaaaaatc agcaagggac 4080 aggtagtatt ttttgagaag atcactcaaa aaatctccac ctttaaaccc ttgccaattt 4140 ttattttgtc cgttttgtct agcttaccga aagccagact cagcaagaat aaaattttta 4200 ttgtctttcg gttttctagt gtaacggaca aaaccactca aaaaaaaa gatacagag 4260 aggtctctcg tatctttt tcagcaatcg cgcccgattg ctgaacagat taataatgg 4320 ctcgaattca gatctgaatt ctgctgtcca gactgtccgc tgtgtaaaa aaaggaataa 4380 aggggttg acattatttt actgatatgt attatataat ttgtataaga aaatgtggcc 4440 acattgaaag gggaggagaa tcatgccgca atttgatatc ctgtgcaaga cacctccgaa 4500 ggtgctgtg cggcaatttg tggaaggtt tgaagaccg agcggtgaa agatcgcgct 4560 gtgtgcagcg gaactgactt atctgtgctg gatgatcaca cataacggaa ctgcgatcaa 4620 aagagcgaca ttcatgtcat acaacaat catctctaac agcctgtcgt ttgatatcgt 4680 gaacaagtcg ctgcagttta agtacagac gcaaaggcg acatcctgg aagcgtccct 4740 gaagaagctg atcccagcgt gggagtttac gatcatcccg tattacggcc agaagcacca 4800 gagcgacatc acagatatcg tgtcttcact gcaactgcaa ttcgaagtt cggaagaagc 4860 ggataaggga aactctcatt cgaagagat gctgaaggcg ctgctgagcg aaggcgaatc 4920 gatctgggag atcacggaaa agatcctgaa ctctttcgag tacactagcc ggttcactaa 4980 gactaagaca ctgtatcaat ttctgtttct ggcgaccttt atcaactgtg gaagattctc 5040 agacatcaag aacgtggacc cgaagtcgtt taagctggtg cagaacaagt atctgggagt 5100 gatcatccaa tgcctggtga cagaaactaa gacgtcggtg tccaggcata tctacttttt 5160 ctccgcgaga ggaagaatcg atccactggt gtatctggat gaatttctgc ggaactccga 5220 accggtgctg aagcgtgtga accgcacagg aaacagttcc tcaaacaagc aggaatatca 5280 gctgctgaag gataacctgg tgagatcata caacaaggcg ctgaagaaga atgcaccgta 5340 cagcatcttc gcgatcaaga acggacctaa gagccatatc ggacgccatc tgatgacttc 5400 ctttctgtca atgaagggtc tgactgaact gacaaacgtg gtggggaact ggtccgacaa 5460 aagagcgtca gcggtggcac ggaccactta tacccaccag atcactgcga tcccggatca 5520 ctactttgcg ctggtgagcc gctactatgc gtatgatcct atcagcaagg aaatgatcgc 5580 gctgaaggac gaaacaaacc cgatcgagga atggcagcat atcgaacaac tgaagggctc 5640 agcggaagga tcgatcagat atcctgcgtg gaacggaatc atctcacagg aagtgctgga 5700 ttacctgtca agctatatca acagacgcat ctagaagagc agagaggacg gatttcctga 5760 aggaaatccg tttttttatt ttgcacgcgt gctagcggcc gcgtcgacga agttcctatt 5820 ccgaagttcc tattctctag aaagtatagg aacttctatc acattgaaag gggaggagaa 5880 tcatgaataa tggcacaaat aacttccaga acttcattgg cattagcagc ctgcaaaaaa 5940 cactgagaaa tgcactgatt ccgacagaaa caacacagca gtttattgtc aaaaacggca 6000 tcatcaaaga ggatgaactg agaggcgaaa atcgccaaat tctgaaagat atcatggacg 6060 actattaccg tggctttatt tcagaaacac tgtccagcat tgatgatatc gattggacaa 6120 gcctgttcga gaaaatggaa atccaactga aaaacggcga taacaaagac acgctgatta 6180 aagaacaaac ggaatatcgc aaagcgatcc acaaaaagtt tgcaaatgat gaccgcttta 6240 aaaacatgtt cagcgcgaaa ctgattagcg atattctgcc ggaatttgtc atccacaata 6300 ataactatag cgcgagcgag aaagaagaaa aaacacaggt cattaaactg tttagccgct 6360 ttgccacaag cttcaaagac tatttcaaaa atcgcgcaaa ctgctttagc gcagatgata 6420 tttcatcatc aagctgccat cggattgtca atgataatgc ggaaatcttt tttagcaacg 6480 cactggtcta tcgcagaatt gttaaatcat tgagcaacga cgacatcaac aaaatctcag 6540 gcgatatgaa agacagcctg aaagaaatgt cactggaaga aatctacagc tacgaaaaat 6600 acggcgaatt tatcacacaa gaaggcatca gcttttacaa cgatatttgc ggcaaagtca 6660 acagctttat gaatctgtat tgccagaaaa acaaagaaaa caaaaacctg tataaactgc 6720 agaaactgca caagcagatt ctgtgcattg cagatacatc atatgaagtc ccgtacaaat 6780 ttgagagcga cgaagaagtt tatcaaagcg ttaatggctt tctggataac atcagcagca 6840 aacatattgt tgaacgcctg agaaaaattg gcgataacta taatggctac aacctggaca 6900 aaatctacat cgtcagcaaa ttttacgaaa gcgtcagcca aaaaacatat cgcgattggg 6960 aaacaattaa tacagcgctg gaaattcatt ataacaacat tctgcctggc aacggcaaaa 7020 gcaaagcaga taaagttaaa aaggcggtca aaaatgacct gcagaaaagc attacagaaa 7080 tcaatgaact gtcagcaac tacaacgt gctcagatga tatatcaag gcggaaacgt 7140 acatccatga aattagccat atcctgaaca actttgaagc gcaagaactg aaatataacc 7200 cggaaatcca tctggttgaa agcgaactga aagcaagcga gctgaaaaat gttctggatg 7260 tcattatgaa tgcgttcat tggtgcagcg tctttatgac agagaactg gtcgataaag 7320 atacaactt ttatgcggaa ctggaagaga tttacgacga atttatccg gtcatcagcc 7380 tgtataatct ggttcgcaat tagtcacac agaaccgta tagcacgaag aaaatcaaac 7440 tgaactttgg cattccgaca ctggcagatg gctggtcaa atcaaagaa tatagcaca 7500 acgcgatcat cctgatgcgc gataatcttt attatctggg cattttcaac gcgaaaaaca 7560 agccggacaa aaaatcatc gaaggcaata cgtcagagaa aaggcgac tataaaaga 7620 tgatttataa tctgcttccg ggaccgaata aaatgatccc gaaagttttt ctgtcaagca 7680 aaacaggcgt cgaaacata aaaccgtcag cgtatattct ggaggctac aaacagaaca 7740 aacacatcaa aagcagcaag gacttgaca tcacatttg ccatgatctg atcgactact 7800 ttaagaactg cattgcaatt catccggaat ggaaaaactt cggctttgat ttttcagaca 7860 cgagcacgta tgaagatatc agcggctttt atagagaagt tgaactgcag ggctataaaa 7920 tcgactggac atatatcagc gaaaaggata ttgatctgct gcaagaaaaa ggccaactgt 7980 acctgtttca gatctacaac aaagacttca gcaaaaaaag cacgggcaat gataacctgc 8040 atacgatgta cctgaaaaac ctttttagcg aagagaacct gaaagacatt gtcctgaaac 8100 tgaatggcga agccgaaatt ttctttcgca aatccagcat taaaaacccg atcatccata 8160 aaaaaggcag cattctggtt aaccgcacat atgaagcgga agaaaaagat cagtttggca 8220 acattcagat cgtccgcaaa aacattccgg aaacattta tcaagaactg tacaaatact 8280 ttaacgataa aagcgataaa gaactgtccg acgaagcagc gaaacttaaa aatgttgttg 8340 gccatcatga agcggcaaca aacattgtta aagactatcg ctatacgtac gataaatact 8400 ttctgcatat gccgatcacg atcaacttca aagcaaataa aacgggcttt atcaacgatc 8460 gcattctgca gtatattgcc aaagaaaagg atctgcatgt catcggcatt gctagaggcg 8520 aacgcaatct gatttatgtc agcgttattg atacatgcgg caacattgtc gaacagaaaa 8580 gctttaacat tgtcaacggc tatgactacc agatcaagct gaaacagcaa gaaggcgcaa 8640 gacaaattgc tcgcaaagaa tggaaagaaa tcggcaagat caaagaaatt aaagagggct 8700 atctgagcct ggtcattcat gaaatttcta aaatggtcat caaatataac gcgattatcg 8760 ccatggaaga tctgtcatat ggctttaaga aaggccgttt taaagtcgaa agacaggtct 8820 accagaaatt cgaaacaatg ctgattaaca aactgaatta tctggtgttt aaagacatca 8880 gcatcacgga aaatggcgga ctgctgaaag gctatcaact gacatatatt ccggataagc 8940 ttaaaaacgt cggccatcaa tgcggctgca tcttttatgt tccggcagcg tatacatcaa 9000 aaattgatcc gacaacaggc tttgtcaaca tcttcaaatt caaagatctg acggtcgatg 9060 cgaaacgcga attcattaag aaatttgaca gcatccgcta cgacagcgag aaaaatcttt 9120 tctgctttac gttcgactac aacaacttta tcacgcagaa tacggttatg tcaaaaagca 9180 gctggtcagt ctatacatat ggcgttagaa ttaaacgcag atttgtgaac ggcagattta 9240 gcaatgaaag cgatacaatc gatcacga aagacatgga aaaaacgctt gaatgacgg 9300 attackactg gcgtgatgga catgatcttc gccaggatat tatcgatt gaatcgtcc 9360 agcacatctt tgaaatcttt agactgacag tccaatgcg cattcactg tcagaacttg 9420 aagatagaga ttatgatcgc ctgatttctc cggtcctgaa tgaaataac atctttacg 9480 atagcgcaaa agcaggcgac gcactgccga aagatgcgga tgcaatggc gcatattgca 9540 ttgcactgaa aggcctgtat gaatcaaac aaatcaccga gattggaaa gaggacggca 9600 aattttcacg ggataactg aaaatcagca acaaggactg gtttgactc atccaaaata 9660 agcgctacct gtaaattgga gggaagcttt atgagtaag gagagaact ttcactgga 9720 gttgtcccaa ttctgttga attagatggc gatgttaatg ggcaaaaatt ctctgttagt 9780 ggagagggtg aaggtgatgc aacatacgga aaacttacc ttaaatttat ttgcactact 9840 gggaagctac ctgttccatg gccaacgctt gtcactactc tcacttatgg tgttcaatgc 9900 tttctagat acccagatca tatgaacag catgactttt tcaagagtgc catgcccgaa 9960 ggttatgtac aggaagaac tatattttac aagatgacg ggaactaca ccacgtgct 10020 gaagtcaagt tgaggtga tacccttgtt atagaatcg agttaaagg tattgatttt 10080 aaagagatg gaacattct tggacacaa atgataca attackactc acataatgta 10140 tacatcatgg cagacaacc aaagaatggc atcaagtta acttcaaat tagacacaac 10200 attaagatg gaagcgttca attagcagac cattatcac aaatactcc aattggcgat 10260 ggccctgtcc ttttaccaga caccattac ctgtccacgc aatctgccct ttccaagat 10320 cccaacgaaa agagagatca catgatcctt cttgagtttg taacagctgc tgggattaca 10380 catggcatgg atgaactata caaataatgc tgtccagact gtccgctgtg taaaaaaag 10440 gataaaggg gggttgacat tattttactg atatgtataa tataatttgt atagaaaat 10500 ggtcaaaga cctttttaat ttctactctt gtagatcagc cggaacgtca agccgttgaa 10560 gttcctattc cgaagttcct attctcaa tagtatagga acttcgctaa gcgtcgacct 10620 gca 10623 <210> 17 <211> 10623 <212> DNA <213> Artificial sequence <220> <223> DNA sequence of pSJ14440 <400> 17 ggtcgattca caaaaaatag gcacacgaaa aacaagttaa gggatgcagt ttatgcatcc 60 cttaacttac ttattaaata atttatagct attgaaaaga gataagaatt gttcaaagct 120 aatattgttt aaatcgtcaa ttcctgcatg ttttaaggaa ttgttaaatt gattttttgt 180 aaatattttc ttgtattctt tgttaaccca tttcataacg aaataattat acttttgttt 240 atctttgtgt gatattcttg atttttttct acttaatctg ataagtgagc tattcacttt 300 aggtttagga tgaaaatatt ctcttggaac catacttaat atagaaatat caacttctgc 360 cattaaaagt aatgccaatg agcgttttgt atttaataat cttttagcaa acccgtattc 420 cacgattaaa taaatctcat tagctatact atcaaaaaca attttgcgta ttatatccgt 480 acttatgtta taaggtatat taccatatat tttataggat tggtttttag gaaatttaaa 540 ctgcaatata tccttgttta aaacttggaa attatcgtga tcaacaagtt tattttctgt 600 agttttgcat aatttatggt ctatttcaat ggcagttacg aaattacacc tctttactaa 660 ttcaagggta aaatggcctt ttcctgagcc gatttcaaag atattatcat gttcatttaa 720 tcttatattt gtcattattt tatctatatt atgttttgaa gtaataaagt tttgactgtg 780 ttttatattt ttctcgttca ttataaccct ctttaatttg gttatatgaa ttttgcttat 840 taacgattca ttataaccac ttatttttg tttggttgat aatgaactgt gctgattaca 900 aaaatactaa aaatgcccat atttttcct ccttataaaa ttagtataat tatagcacga 960 gctctgataa atatgaacat gatgagtgat cgttaaattt atactgcaat cggatgcgat 1020 tattgaataa aagatatgag agatttatct aatttctttt ttcttgtaaa aaaagaaagt 1080 tcttaaaggt tttatagttt tggtcgtaga gcacacggtt taacgactta attacgaagt 1140 aaataagtct agtgtgttag actttatgaa atctatatac gtttatatat atttattatc 1200 cggaggtgta gcatgtctca ttcaattttg agggttgcca gagttaaagg atcaagtaat 1260 acaaacggga tacaaagaca taatcaaaga gagaataaaa actataataa taaagacata 1320 aatcatgagg aaacatataa aaattatgat ttgattaacg cacaaaatat aaagtataaa 1380 gataaaattg atgaaacgat tgatgagaat tattcaggga aacgtaaaat tcggtcagat 1440 gcaattcgac atgtggacgg actggttaca agtgataaag attctttga tgatttaagc 1500 ggagaagaaa tagaacgatt tttaaaagat agcttggagt ttctagaaaa tgaatacggt 1560 aaggaaaata tgctgtatgc gactgtccat ctggatgaaa gagtcccaca tatgcacttt 1620 ggttttgtcc ctttaacaga ggacgggaga ttgtctgcaa aagaacagtt aggcaacaag 1680 aaagacttta ctcaattaca agatagattt aatgagtatg tgaatgagaa aggttatgaa 1740 cttgaaagag gcacgtccaa agaggttaca gaacgagaac ataaagcgat ggatcagtac 1800 aagaaagata ctgtatttca taaacaggaa ctgcaagaag ttaaggatga gttacagaag 1860 gcaaataagc agttacagag tggaatagag catatgaggt ctacgaaacc ctttgattat 1920 gaaaatgagc gtacaggttt gttctctgga cgtgaagaga ctggtagaaa gatattaact 1980 gctgatgaat ttgaacgcct gcaagaaaca atctcttctg cagaacggat tgttgatgat 2040 tacgaaaaata ttaagagcac agactattac acagaaaatc aagaattaaa aaaacgtaga 2100 gagagtttga aagaagtagt gaatacatgg aaagaggggt atcacgaaaa aagtaaagag 2160 gttaataaat taaagcgaga gaatgatagt ttgaatgagc agttgaatgt atcagagaaa 2220 tttcaagcta gtacagtgac tttatatcgt gctgcgaggg cgaatttccc tgggtttgag 2280 aaagggttta ataggcttaa agagaaattc tttaatgatt ccaaatttga gcgtgtggga 2340 cagtttatgg atgttgtaca ggataatgtc cagaaggtcg atagaaagcg tgagaaacag 2400 cgtacagacg atttagagat gtagaggtac tttatgccg agaaaacttt ttgcgtgtga 2460 cagtccttaa aatatactta gagcgtaagc gaaagtagta gcgacagcta ttaactttcg 2520 gtttcaaagc tctaggattt ttaatggacg cagcgcatca cacgcaaaaa ggaaattgga 2580 ataaatgcga aatttgagat gttaattaaa gacctttttg aggtcttttt ttcttagatt 2640 tttggggtta tttaggggag aaaacatagg ggggtactac gacctccccc ctaggtgtcc 2700 attgtccatt gtccaaacaa ataaataaat attgggtttt taatgttaaa aggttgtttt 2760 ttatgttaaa gtgaaaaaaa cagatgttgg gaggtacagt gatggttgta gatagaaaag 2820 agagaaaaa agttgctgtt actttaagac ttacacaga agaaaatgag atttaata 2880 gatchaaaataat attagcaat cagatgcaac cggtattcta aaaaaaat 2940 atgcaagga ggaatacggt gcattttaaa caaaaaaga tagacac tggcatgctg 3000 cctatctatg actaaatttt gttaagtgta ttagcaccgt tattatca tgagcgaaaa 3060 tgtataaaa gaactgaaa acagaaaaa ttcagagga cgtaattgga cattgtttt 3120 ataccagaa tcagcaaag ccgagtggtt agagtattta aaagagttac acatcaatt 3180 tgtagtgtct ccattacatg atagggatac tgatacagaa ggtaggatga aaaaagagca 3240 ttatcatatt ctagtgatgt atgaggtaa taaatcttat gaacagataa aaatattac 3300 agaagaattg aatgcgacta ttccgcagat tgcaggaagt gtgaaaggtc ttgtgagata 3360 tatgcttcac atggacgatc ctaataattt taaataatca aagagata tgagtttta 3420 tggcggtgta gatgttgatg aattaaaa gaaacaca acagatagat ataattaat 3480 taaagaatg attgagttta ttgatgaca aggaatcgta gatttaaga gtttaatgga 3540 ttatgcaatg aagtttaaat ttgatgattg gttcccgctt ttatgtgata actcggcgta 3600 tgttattcaa gaatatataa aatcaaatcg gtataaatct gaccgataga ttttgaattt 3660 aggtgtcaca agacactctt ttttcgcacc agcgaaaact ggtttaagcc gactgcgcaa 3720 aagacataat cgactctaga ggatccccgg gtaccgagct ctgcctttta gtccagctga 3780 tttcactttt tgcattctac aaactgcata actcatatgt aaatcgctcc tttttaggtg 3840 gcacaaatgt gaggcatttt cgctctttcc ggcaaccact tccaagtaaa gtataacaca 3900 ctatacttta tattcataaa gtgtgtgctc tgcgaggctg tcggcagtgc cgaccaaaac 3960 cataaaacct ttaagacctt tctttttttt acgagaaaaa agaaacaaaa aaacctgccc 4020 tctgccacct cagcaaaggg gggttttgct ctcgtgctcg tttaaaaatc agcaagggac 4080 aggtagtatt ttttgagaag atcactcaaa aaatctccac ctttaaaccc ttgccaattt 4140 ttattttgtc cgttttgtct agcttaccga aagccagact cagcaagaat aaaattttta 4200 ttgtctttcg gttttctagt gtaacggaca aaaccactca aaataaaaaa gatacaagag 4260 aggtctctcg tatctttt tcagcaatcg cgcccgattg ctgaacagat taataatgg 4320 ctcgaattca gatctgaatt ctgctgtcca gactgtccgc tgtgtaaaa aaaggaataa 4380 aggggttg acattatttt actgatatgt attatataat ttgtataaga aaatgtggcc 4440 acattgaaag gggaggagaa tcatgccgca atttgatatc ctgtgcaaga cacctccgaa 4500 ggtgctgtg cggcaatttg tggaaggtt tgaagaccg agcggtgaa agatcgcgct 4560 gtgtgcagcg gaactgactt atctgtgctg gatgatcaca cataacggaa ctgcgatcaa 4620 aagagcgaca ttcatgtcat acaacaat catctctaac agcctgtcgt ttgatatcgt 4680 gaacaagtcg ctgcagttta agtacagac gcaaaggcg acatcctgg aagcgtccct 4740 gaagaagctg atcccagcgt gggagtttac gatcatcccg tattacggcc agaagcacca 4800 gagcgacatc acagatatcg tgtcttcact gcaactgcaa ttcgaagtt cggaagaagc 4860 ggataaggga aactctcatt cgaagagat gctgaaggcg ctgctgagcg aaggcgaatc 4920 gatctgggag atcacggaaa agatcctgaa ctctttcgag tacactagcc ggttcactaa 4980 gactaagaca ctgtatcaat ttctgtttct ggcgaccttt atcaactgtg gaagattctc 5040 agacatcaag aacgtggacc cgaagtcgtt taagctggtg cagaacaagt atctgggagt 5100 gatcatccaa tgcctggtga cagaaactaa gacgtcggtg tccaggcata tctacttttt 5160 ctccgcgaga ggaagaatcg atccactggt gtatctggat gaatttctgc ggaactccga 5220 accggtgctg aagcgtgtga accgcacagg aaacagttcc tcaaacaagc aggaatatca 5280 gctgctgaag gataacctgg tgagatcata caacaaggcg ctgaagaaga atgcaccgta 5340 cagcatcttc gcgatcaaga acggacctaa gagccatatc ggacgccatc tgatgacttc 5400 ctttctgtca atgaagggtc tgactgaact gacaaacgtg gtggggaact ggtccgacaa 5460 aagagcgtca gcggtggcac ggaccactta tacccaccag atcactgcga tcccggatca 5520 ctactttgcg ctggtgagcc gctactatgc gtatgatcct atcagcaagg aaatgatcgc 5580 gctgaaggac gaaacaaacc cgatcgagga atggcagcat atcgaacaac tgaagggctc 5640 agcggaagga tcgatcagat atcctgcgtg gaacggaatc atctcacagg aagtgctgga 5700 ttacctgtca agctatatca acagacgcat ctagaagagc agagaggacg gatttcctga 5760 aggaaatccg tttttttatt ttgcacgcgt gctagcggcc gcgtcgacga agttcctatt 5820 ccgaagttcc tattctctag aaagtatagg aacttctatc acattgaaag gggaggagaa 5880 tcatgaataa tggcacaaat aacttccaga acttcattgg cattagcagc ctgcaaaaaa 5940 cactgagaaa tgcactgatt ccgacagaaa caacacagca gtttattgtc aaaaacggca 6000 tcatcaaaga ggatgaactg agaggcgaaa atcgccaaat tctgaaagat atcatggacg 6060 actattaccg tggctttatt tcagaaacac tgtccagcat tgatgatatc gattggacaa 6120 gcctgttcga gaaaatggaa atccaactga aaaacggcga taacaaagac acgctgatta 6180 aagaacaaac ggaatatcgc aaagcgatcc acaaaaagtt tgcaaatgat gaccgcttta 6240 aaaacatgtt cagcgcgaaa ctgattagcg atattctgcc ggaatttgtc atccacaata 6300 ataactatag cgcgagcgag aaagaagaaa aaacacaggt cattaaactg tttagccgct 6360 ttgccacaag cttcaaagac tatttcaaaa atcgcgcaaa ctgctttagc gcagatgata 6420 tttcatcatc aagctgccat cggattgtca atgataatgc ggaaatcttt tttagcaacg 6480 cactggtcta tcgcagaatt gttaaatcat tgagcaacga cgacatcaac aaaatctcag 6540 gcgatatgaa agacagcctg aaagaaatgt cactggaaga aatctacagc tacgaaaaat 6600 acggcgaatt tatcacacaa gaaggcatca gcttttacaa cgatatttgc ggcaaagtca 6660 acagctttat gaatctgtat tgccagaaaa acaaagaaaa caaaaacctg tataaactgc 6720 agaaactgca caagcagatt ctgtgcattg cagatacatc atatgaagtc ccgtacaaat 6780 ttgagagcga cgaagaagtt tatcaaagcg ttaatggctt tctggataac atcagcagca 6840 aacatattgt tgaacgcctg agaaaaattg gcgataacta taatggctac aacctggaca 6900 aaatctacat cgtcagcaaa ttttacgaaa gcgtcagcca aaaaacatat cgcgattggg 6960 aaacaattaa tacagcgctg gaaattcatt ataacaacat tctgcctggc aacggcaaaa 7020 gcaaagcaga taaagttaaa aaggcggtca aaaatgacct gcagaaaagc attacagaaa 7080 tcaatgaact ggtcagcaac tacaaactgt gctcagatga taatatcaag gcggaaacgt 7140 acatccatga aattagccat atcctgaaca actttgaagc gcaagaactg aaatataacc 7200 cggaaatcca tctggttgaa agcgaactga aagcaagcga gctgaaaaat gttctggatg 7260 tcattatgaa tgcgttcat tggtgcagcg tctttatgac agagaactg gtcgataaag 7320 atacaactt ttatgcggaa ctggaagaga tttacgacga atttatccg gtcatcagcc 7380 tgtataatct ggttcgcaat tagtcacac agaaccgta tagcacgaag aaaatcaaac 7440 tgaactttgg cattccgaca ctggcagatg gctggtcaa atcaaagaa tatagcaca 7500 acgcgatcat cctgatgcgc gataatcttt attatctggg cattttcaac gcgaaaaaca 7560 agccggacaa aaaatcatc gaaggcaata cgtcagagaa aaggcgac tataaaaga 7620 tgatttataa tctgcttccg ggaccgaata aaatgatccc gaaagttttt ctgtcaagca 7680 aaacaggcgt cgaaacata aaaccgtcag cgtatattct ggaggctac aaacagaaca 7740 aacacatcaa aagcagcaag gacttgaca tcacatttg ccatgatctg atcgactact 7800 ttagaactg cattgcaatt catccggaat ggaaaaactt cggcttt tttcagaca 7860 cgagcacgta tgaagatatc agcggctttt atagagaagt tgaactgcag ggctataaaa 7920 tcgactggac atatatcagc gaaaaggata ttgatctgct gcaagaaaaa ggccaactgt 7980 acctgtttca gatctacaac aaagacttca gcaaaaaaag cacgggcaat gataacctgc 8040 atacgatgta cctgaaaaac ctttttagcg aagagaacct gaaagacatt gtcctgaaac 8100 tgaatggcga agccgaaatt ttctttcgca aatccagcat taaaaacccg atcatccata 8160 aaaaaggcag cattctggtt aaccgcacat atgaagcgga agaaaaagat cagtttggca 8220 acattcagat cgtccgcaaa aacattccgg aaacattta tcaagaactg tacaaatact 8280 ttaacgataa aagcgataaa gaactgtccg acgaagcagc gaaacttaaa aatgttgttg 8340 gccatcatga agcggcaaca aacattgtta aagactatcg ctatacgtac gataaatact 8400 ttctgcatat gccgatcacg atcaacttca aagcaaataa aacgggcttt atcaacgatc 8460 gcattctgca gtatattgcc aaagaaaagg atctgcatgt catcggcatt gctagaggcg 8520 aacgcaatct gatttatgtc agcgttattg atacatgcgg caacattgtc gaacagaaaa 8580 gctttaacat tgtcaacggc tatgactacc agatcaagct gaaacagcaa gaaggcgcaa 8640 gacaaattgc tcgcaaagaa tggaaagaaa tcggcaagat caaagaaatt aaagagggct 8700 atctgagcct ggtcattcat gaaatttcta aaatggtcat caaatataac gcgattatcg 8760 ccatggaaga tctgtnote ggctttaaga aaggccgttt taaagtcgaa agacaggtct 8820 accagaaatt cgaaacaatg ctgattaaca aactgaatta tctggtgttt aaagacatca 8880 gcatcacgga aaatggcgga ctgctgaaag gctatcaact gacatatatt ccggataagc 8940 ttaaaaacgt cggccatcaa tgcggctgca tcttttatgt tccggcagcg tatacatcaa 9000 aaattgatcc gacaacaggc tttgtcaaca tcttcaaatt caaagatctg acggtcgatg 9060 cgaaacgcga attcattaag aaatttgaca gcatccgcta cgacagcgag aaaaatcttt 9120 tctgctttac gttcgactac aacaacttta tcacgcagaa tacggttatg tcaaaaagca 9180 gctggtcagt ctatadata ggcgttagaa ttaaacgcag atttgtgaac ggcagattta 9240 gcaatgaaag cgatacaatc gacatcacga aagacatgga aaaaacgctt gaaatgacgg 9300 attackactg gcgtgatgga catgatcttc gccaggatat tatcgatt gaatcgtcc 9360 agcacatctt tgaaatcttt agactgacag tccaatgcg cattcactg tcagaacttg 9420 aagatagaga ttatgatcgc ctgatttctc cggtcctgaa tgaaataac atctttacg 9480 atagcgcaaa agcaggcgac gcactgccga aagatgcgga tgcaatggc gcatattgca 9540 ttgcactgaa aggcctgtat gaatcaaac aaatcaccga gattggaaa gaggacggca 9600 aattttcacg ggataactg aaaatcagca acaaggactg gtttgactc atccaaaata 9660 agcgctacct gtaaattgga gggaagcttt atgagtaag gagagaact ttcactgga 9720 gttgtcccaa ttctgttga attagatggc gatgttaatg ggcaaaaatt ctctgttagt 9780 ggagagggtg aaggtgatgc aacatacgga aaacttacc ttaaatttat ttgcactact 9840 gggaagctac ctgttccatg gccaacgctt gtcactactc tcacttatgg tgttcaatgc 9900 tttctagat acccagatca tatgaacag catgactttt tcaagagtgc catgcccgaa 9960 ggttatgtac aggaagaac tatattttac aagatgacg ggaactaca ccacgtgct 10020 gaagtcaagt ttgaaggtga tacccttgtt aatagaatcg agttaaaagg tattgatttt 10080 aaagaagatg gaaacattct tggacacaaa atggaataca attataactc acataatgta 10140 tacatcatgg cagacaaacc aaagaatggc atcaaagtta acttcaaaat tagacacaac 10200 attaaagatg gaagcgttca attagcagac cattatcaac aaaatactcc aattggcgat 10260 ggccctgtcc ttttaccaga caaccattac ctgtccacgc aatctgccct ttccaaagat 10320 cccaacgaaa agagagatca catgatcctt cttgagtttg taacagctgc tgggattaca 10380 catggcatgg atgaactata caaataatgc tgtccagact gtccgctgtg taaaaaaaag 10440 gaataaaggg gggttgacat tattttactg atatgtataa tataatttgt ataagaaaat 10500 ggtcaaaaga cctttttaat ttctactctt gtagatggca aattcagcac ttcaatcgaa 10560 gttcctattc cgaagttcct attcttcaaa tagtatagga acttcgctaa gcgtcgacct 10620 gca 10623 <210> 18 <211> 7323 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of pSJ14491 <400> 18 cgtagggccc gcggctagcg gccgcgtcga ctagaagagc agagaggacg gatttcctga aggaaatccg tttttttatt ttgcccgtct tataaatttc gttgtccaac tcgcttaatt gcgagttttt atttcgttta tttcaattaa ggtaactaaa gatcctctag agtcgattat gtcttttgcg cagtcggctt aaaccagttt tcgctggtgc gaaaaaagag tgtcttgtga 240 cacctaatt caaaatctat cggtcagatt tataccgatt tgattttata tattcttgaa 360. cgagttatca cataaagcg ggaccatc atcaaattta aacttcattg cataatccat taaactctta aattctacga ttccttgttc atcaataac tcaatcattt ctttaattaa tttatatcta tctgttgttg ttttctttaa taattcatca acatctacac cgccataaac tatcatatct tctttttgat atttaattt attaggatcg tccatgtgaa gcatatatct cacaagacct ttcacacttc ctgcaatctg cggaatagtc gcattcaatt cttctgtaat tatttttatc tgttcataag atttattacc ctcatacatc actagaat gataatgctc ttttttcatc ctaccttctg tatcagtatc cctatcatgt aatggagaca 720 ctacaaattg aatgtgtaac tcttttaaat actctaacca ctcggctttt gctgattctg gatataaaac aaatgtccaa ttacgtcctc ttgaattttt cttgttttca gtttctttta ttacattttc gctcatgata fathercggt gctaatacac ttaacaaaat ttagtcatag ataggcagca tgccagtgct gtctatcttt ttttgtttaa aatgcaccgt attcctcctt tgcatatttt tttattagaa taccggttgc atctgatttg ctaatattat atttttcttt gattctattt aatatctcat tttcttctgt tgtaagtctt aaagtaacag caactttttt ctcttctttt ctatctacaa ccatcactgt acctcccaac atctgttttt ttcactttaa cataaaaac aaccttttaa cattaaaaac ccaatatt tttatttgtt tggacaatgg acaatggaca cctagggggg aggtcgtagt acccccctat gttttctccc ctaaataacc ccaaaatct aagaaaaaaa gacctcaaaa aggtctttaa ttaacatctc aaatttcgca tttattccaa tttcctttttt gcgtgtgatg cgctgcgtcc attaaaatc ctagagcttt gaaaccgaaa gttaatagct gtcgctacta ctttcgctta cgctctaagt atattttaag gactgtcaca cgcaaaagt tttctcggca taaaagtacc tctacatctc taaatcgtct 1500 gtacgctgtt tctcacgctt tctatcgacc ttctggacat tatcctgtac aacatccata 1560 aactgtccca cacgctcaaa tttggaatca ttaaagaatt tctctttaag cctattaaac 1620 cctttctcaa acccagggaa attcgccctc gcagcacgat ataaagtcac tgtactagct 1680 tgaaatttct ctgatacatt caactgctca ttcaaactat cattctctcg ctttaattta 1740 ttaacctctt tactttttc gtgatacccc tctttccatg tattcactac ttctttcaaa 1800 ctctctctac gttttttaa ttcttgattt tctgtgtaat agtctgtgct cttaatattt 1860 tcgtaatcat caacaatccg ttctgcagaa gagattgttt cttgcaggcg ttcaaattca 1920 tcagcagtta atatctttct accagtctct tcacgtccag agaacaaacc tgtacgctca 1980 ttttcataat caaagggttt cgtagacctc atatgctcta ttccactctg taactgctta 2040 tttgccttct gtaactcatc cttaacttct tgcagttcct gtttatgaaa tacagtatct 2100 ttcttgtact gatccatcgc tttatgttct cgttctgtaa cctctttgga cgtgcctctt 2160 tcaagttcat aacctttctc attcacatac tcattaaatc tatcttgtaa ttgagtaaag 2220 tctttcttgt tgcctaactg ttcttttgca gacaatctcc cgtcctctgt taaagggaca 2280 aaaccaaagt gcatatgtgg gactctttca tccagatgga cagtcgcata cagcatattt 2340 tccttaccgt attcattttc tagaaactcc aagctatctt taaaaaatcg ttctatttct 2400 tctccgctta aatcatcaaa gaaatcttta tcacttgtaa ccagtccgtc cacatgtcga 2460 attgcatctg accgaatttt acgtttccct gaataattct catcaatcgt ttcatcaatt 2520 ttatctttat actttatatt ttgtgcgtta atcaaatcat aatttttata tgtttcctca 2580 tgatttatgt ctttattatt atagttttta ttctctcttt gattatgtct ttgtatcccg 2640 tttgtattac ttgatccttt aactctggca accctcaaaa ttgaatgaga catgctacac 2700 ctccggataa taaatatata taaacgtata tagatttcat aaagtctaac acactagact 2760 tatttacttc gtaattaagt cgttaaaccg tgtgctctac gaccaaaact ataaaacctt 2820 taagaacttt cttttttac aagaaaaaag aaattagata aatctctcat atcttttatt 2880 caataatcgc atccgattgc agtataaatt taacgatcac tcatcatgtt catatttatc 2940 agagctcgtg ctataattat actatttta taggaggaaaaatatggg catttttagt 3000 atttttgtaa tcattatcaaaaataagtggt tataatgaat 3060 cgttaatag caaattcat ataccaaat taaagaggggt taatgaac gagaaaaata 3120 tcaaacacag tcaaacttt attacktcaaacaatatat agataaata atgacaata 3180 taagattaaa tgaacatgat atatctttg aaatcggctc aggaaaggc cattttaccc 3240 ttgaattagt aaagaggtgt atttcgtaa ctgccattga atagaccat aaattatgca 3300 aaactacaga aaataactt gttgatcacg ataatttcca agttttaac aggatatat 3360 tgcagtttaa atttcctaaa aaccaatcct aaaatata tgtatatata ccttataaca 3420 tagtacgga tataatacgc aaaattgtt ttgatagtat agctaatgag atttatta 3480 tcgtggaata cgggtttgct aaagattat taaatacaa acgctcattg gcattactt 3540 taatggcaga agttgatatt tctatattaa gtatggttcc aagagaatat ttcatccta 3600 aacctaaagt gaatagctca cttatcagat taagtagaaa aaaatcaaga atatcacaca 3660 aagataaaca aaagtataat tatttcgtta tgaaatgggt taacaaagaa tacaagaaaa 3720 tatttacaaa aaatcaattt aacaattcct taaaacatgc aggaattgac gatttaaaca 3780 atattagctt tgaacaattc ttatctcttt tcaatagcta taaattattt aataagtaag 3840 ttaagggatg cataaactgc atcccttaac ttgtttttcg tgtgcctatt ttttgtgaat 3900 cgacctgcag gcatgcaagc ttgcatgcct gcaggtcgac gcggccgcta gcagcggtgc 3960 aaaataaaaa aacggatttc cttcaggaaa tccgtcctct ctgctcttct agatgcgtct 4020 gttgatatag cttgacaggt aatccagcac ttcctgtgag atgattccgt tccacgcagg 4080 atatctgatc gatccttccg ctgagccctt cagttgttcg atatgctgcc attcctcgat 4140 cgggtttgtt tcgtccttca gcgcgatcat ttccttgctg ataggatcat acgcatagta 4200 gcggctcacc agcgcaaagt agtgatccgg gatcgcagtg atctggtggg tataagtggt 4260 ccgtgccacc gctgacgctc ttttgtcgga ccagttcccc accacgtttg tcagttcagt 4320 cagacccttc attgacagaa aggaagtcat cagatggcgt ccgatatggc tcttaggtcc 4380 gttcttgatc gcgaagatgc tgtacggtgc attcttcttc agcgccttgt tgtatgatct 4440 caccaggtta tccttcagca gctgatattc ctgcttgttt gaggaactgt ttcctgtgcg 4500 gttcacacgc ttcagcaccg gttcggagtt ccgcagaaat tcatccagat acaccagtgg 4560 atcgattctt cctctcgcgg agaaaaagta gatatgcctg gacaccgacg tcttagtttc 4620 tgtcaccagg cattggatga tcactcccag atacttgttc tgcaccagct taaacgactt 4680 cgggtccacg ttcttgatgt ctgagaatct tccacagttg ataaaggtcg ccagaaacag 4740 aaattgatac agtgtcttag tcttagtgaa ccggctagtg tactcgaaag agttcaggat 4800 cttttccgtg atctcccaga tcgattcgcc ttcgctcagc agcgccttca gcatcttctt 4860 cgaatgagag tttcccttat ccgcttcttc cgaactttcg aattgcagtt gcagtgaaga 4920 cacgatatct gtgatgtcgc tctggtgctt ctggccgtaa tacgggatga tcgtaaactc 4980 ccacgctggg atcagcttct tcagggacgc ttccaggatt gtcgcctttt gcgtcttgta 5040 cttaaactgc agcgacttgt tcacgatatc aaacgacagg ctgttagaga tgattgtgtt gtatgacatg aatgtcgctc ttttgatcgc agttccgtta tgtgtgatca tccagcacag 5160. ataagtcagt tccgctgcac acagcgcgat cttttcaccg ctcggtcttt caaacctttc cacaaattgc cgcaccagca ccttcggagg tgtcttgcac aggatatca attgcggcat gattctcctc ccctttcaat gtggccacat tttcttatac aaattatatt atacatatca gtaaataat gtcaaccccc ctttattcct tttttttaca cagcggacag tctggacagc agaattcaga tctgaattcg agctcattat taatctgttc agcaatcggg cgcgattgct gaataaaaga tacgagagac ctctcttgta tcttttttat tttgagtggt tttgtccgtt acactagaaa accgaaagac aataaaaatt ttattcttgc tgagtctggc tttcggtaag ctagacaaaa cggacaaaat aaaaattggc aagggtttaa aggtggagat tttttgagtg atcttctcaa aaaatactac ctgtcccttg ctgattttta aacgagcacg agagcaaaac ccccctttgc tgaggtggca gagggcaggt ttttttgttt cttttttctc gtaaaaaaaa 5760 gaaggtctt aaaggtttta tggttttgt cggcactgcc gandagccctcg cagagcacac 5820 actttatgaa tataaagtat agtgtgttat actttacttg gaagtggttg ccggaagag 5880 cgaaaatgcc tcacattgt gccacctaa aaggagcgat ttacatatga gttatgcagt 5940 ttgtagaatg caaaagtga aatcagctgg actaaaaggc agagctcggt accagatcta 6000 CAaaaaaga atacgttata tagaatatg tttgaacctt cttcagatta caatatatt 6060 cggacggact ctacctcaa tgcttatcta actatagaat gatacaag cacaccttg 6120 aaatttgaa atataacta ccaatgaact tgttcatgtg atatcgct gtatttaatt 6180 ttctcaatc atatataat atgccaatac attgttacaa gtagaaatta agacaccctt 6240 gatagcctta ctatacctaa catgatgtag tattaatga atatgtaat atatttatga 6300 tagaagcga cttatttata atcattacat atttttctat tggaatgat aagattccaa 6360 Tagatagtg Taaattat TatctttgA Aggaggtg cctaaaaacg Agaacatta 6420 aaaacatata ttgcaccgt ctaatggata gaaggaggt gatccagccg caccttatga 6480 aaaatcattt tatcagtttg aaaattatgt attatgtggc cagaagttcc tattccgaag 6540 ttcctattct ctagaaagta taggaacttc ttataaaaat gaggagggaa ccgaatggct 6600 tcaactgaag acgtaatcaa agagttcatg cgcttcaaag tgcgaatgga aggaagtgta 6660 aacgggcatg agtttgaaat tgaaggtgaa ggtgaaggaa ggccttatga aggaacgcaa 6720 actgcaaaac ttaaagtgac aaaaggagga ccgctgccgt ttgcttggga catcttaagt 6780 ccgcagtttc agtatgggtc aaaagtttat gtaaagcatc ctgctgacat tcctgattac 6840 aaaaagttaa gttttcctga aggattcaag tgggagcgcg taatgaactt tgaagatgga 6900 ggtgtcgtaa ctgtaacgca agattcaagt ctgcaagacg gttgcttcat ttacaaagta 6960 aagttcattg gcgtgaactt tccaagtgat ggtcctgtaa tgcagaaaaa gacaatgggt 7020 tgggagccgt caactgagag gctttatccg cgtgatggtg tcttgaaagg tgaaattcac 7080 aaagccttaa agttgaaaga tggagggcat tatcttgttg agttcaagag catttacatg 7140 gcgaaaaagc ctgtgcagct tcctggctac tactatgttg attcaaaact tgacataact 7200 agtcacaacg aagactacac aattgttgag foottgagc gaactgaagg aaggcatcat 7260 ctttttcttt aagaagttcc tattccgaag ttcctattct tcaaatga taggaacttc 7320 acg 7323

Claims

1. A method for inserting at least one polynucleotide of interest into a host cell genome, the method comprising the following steps: a) providing a host cell, the host cell comprising in its genome: i. a polynucleotide encoding a selectable marker comprising a target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease; ii. at least one polynucleotide encoding a gRNA that is at least 95% complementary to the target sequence and capable of hybridizing to the target sequence; and iii. a polynucleotide encoding an inactive nuclease variant of an RNA-guided endonuclease that is capable of interacting with the gRNA and binding to the target sequence, thereby inhibiting the expression of the selectable marker; b) transforming the host cell with at least one polynucleotide of interest, wherein the at least one polynucleotide of interest is capable of inactivating the at least one polynucleotide encoding the gRNA; c) selecting for the trait conferred by the selectable marker; and d) identifying a transformed host cell, wherein the at least one polynucleotide encoding the gRNA has been inactivated by the at least one polynucleotide of interest.

2. A method for inserting at least two different polynucleotides of interest into a host cell genome, the method comprising the following steps: a) providing a host cell, the host cell comprising in its genome: i. at least two polynucleotides encoding at least two different selectable markers, each selectable marker comprising a different target sequence flanked by a functional PAM sequence for an RNA-guided endonuclease; ii. at least two polynucleotides encoding at least two gRNAs that are at least 95% complementary to and capable of hybridizing to the at least two different target sequences; iii. a polynucleotide encoding an ineffective nuclease variant of an RNA-guided endonuclease capable of interacting with the at least two gRNAs and binding to the at least two different target sequences, thereby inhibiting the expression of the two different selectable markers; b) transforming the host cell with at least two different polynucleotides of interest, which are capable of inactivating the at least two polynucleotides encoding at least two gRNAs; and c) selecting for the traits conferred by the at least two different selectable markers; as well as d) identifying a transformed host cell, wherein the at least two polynucleotides encoding at least two gRNAs have been inactivated by the at least two different polynucleotides of interest.

3. The method according to any one of claims 1 or 2, wherein the at least one polynucleotide or the at least two target polynucleotides encode a polypeptide.

4. The method according to any one of claims 1 or 2, wherein the host cell is a prokaryotic host cell.

5. The method according to any one of claims 1 or 2, wherein the host cell is a fungal host cell selected from the group consisting of: Acremonium, Aspergillus, Pullulan, Nicotiana, Ceroplasts, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Ustilago, Fusarium, Humicola, Pyrospora, Mucor, Myceliophthora, Neotrichia, Neurospora, Paecilomyces, Penicillium, Pseudoceratium, Radius, Chrysochrysanthemum, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolylcorrhiza, Trametes, and Trichoderma cells.

6. The method according to any one of claims 1 or 2, wherein the host cell is a yeast host cell selected from the group consisting of: Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, and Yarrowia cells.

7. according to the method described in any one in claim 1 or 2, wherein this selectable marker or these at least two different selectable markers are independently positive selection marker, negative selection marker, bidirectional marker or conditional essential gene.

8. The method of any one of claims 1 or 2, wherein the selectable marker or the at least two different selectable markers are independently selected from the group consisting of genes: cat, erm, tet, amp, spec, kana, neo, dal, lysA, araA, galE, antK, metC, xylA, gntP, glpD, glpF, glpK, glpP, lacA2, hisC, gapA, and aspB.

9. The method according to any one of claims 1 or 2, wherein the gRNA or the at least two gRNAs comprise a first RNA comprising 20 or more nucleotides that are at least 97% complementary to the one or more polynucleotides encoding one or more selective markers and are capable of hybridizing to the one or more polynucleotides encoding one or more selective markers.

10. The method according to any one of claims 1 or 2, wherein the gRNA or the at least two gRNAs comprise a first RNA comprising 20 or more nucleotides that are at least 98% complementary to the one or more polynucleotides encoding one or more selective markers and are capable of hybridizing to the one or more polynucleotides encoding one or more selective markers.

11. The method according to any one of claims 1 or 2, wherein the gRNA or the at least two gRNAs comprise a first RNA comprising 20 or more nucleotides that are at least 99% complementary to the one or more polynucleotides encoding one or more selective markers and are capable of hybridizing to the one or more polynucleotides encoding one or more selective markers.

12. The method according to any one of claims 1 or 2, wherein the gRNA or the at least two gRNAs comprise a first RNA comprising 20 or more nucleotides that are 100% complementary to the one or more polynucleotides encoding one or more selective markers and are capable of hybridizing with the one or more polynucleotides encoding one or more selective markers.

13. The method according to any one of claims 1 or 2, wherein the RNA-guided endonuclease consists of SEQ ID NO:

2.

14. The method according to any one of claims 1 or 2, wherein the polynucleotide encoding the RNA-guided endonuclease consists of SEQ ID NO:

1.

15. The method of any one of claims 1 or 2, wherein the null nuclease variant of the RNA-guided endonuclease comprises a change in the amino acid corresponding to position 877 of SEQ ID NO:

2.

16. The method according to any one of claims 1 or 2, wherein the PAM sequence is selected from the group consisting of: TTTA, TTTT, TTTG and TTTC.

17. The method according to any one of claims 1 or 2, wherein the at least one polynucleotide encoding the gRNA or the at least two polynucleotides encoding the at least two gRNAs have been partially or completely replaced in the host cell genome by the at least one polynucleotide of interest or the at least two different polynucleotides of interest, thereby inactivating the at least one polynucleotide encoding the gRNA or the at least two polynucleotides encoding the at least two gRNAs.

Images