Application of DOT1L mutation as a cancer biomarker and therapeutic target

Abstract

The present invention relates to a molecular marker for cancer diagnosis and drug use judgment, and also relates to a primer and a kit for detecting the molecular marker. The molecular marker is one or more of a series of pathological mutations I232N, Y216C, F243L, N241T, E186A, S225L, R231Q, A1003S, and A1003G present on histone methyltransferase DOT1L, and the pathological mutation is related to the occurrence and development of cancer, and can be used as a tumor biomarker for diagnosis, prognosis, and drug use judgment, and can be used as a therapeutic target for a variety of malignant tumors.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to the application of DOT1L pathological mutations as tumor biomarkers for diagnosis and drug judgment, and as therapeutic targets for various malignant tumors. Background Art

[0002] Cancer is the most important public health problem in the world and the main cause of death in the global population. The treatment of cancer has always been the focus and difficulty of people's continuous research. In recent years, epigenetic modification has become a hot spot in cancer research. In eukaryotes, nucleosomes are the basic units of chromosomes. Nucleosomes are composed of histone octamers and DNA wrapped around them. A variety of modifications can occur on nucleosomes, mainly including DNA methylation, histone modification, and RNA regulation. These modifications can change gene expression without changing the base sequence, and this change can be inherited. This phenomenon is called epigenetic modification. Among them, the methylation modification of lysine at position 79 of histone H3 can cause chromosome relaxation, making its downstream genes more easily expressed, and is closely related to the transcriptional activation of cancer-related genes. The enzyme that catalyzes the methylation of H3K79 is DOT1, which is called DOT1-like (DOT1L) in human genes. It was first discovered when screening telomere silencing factors in brewer's yeast. It is a new type of histone lysine methyltransferase and the only enzyme discovered so far that can methylate H3K79. The mechanism of action is that DOT1L uses S-(5'-adenosyl)-L-methionine (SAM) as a methyl donor and transfers the methyl group of SAM to ε-NH2, generating methylated substrates and S-adenosyl-L-homocysteine ​​(SAH). DOT1L participates in a variety of physiological processes and has been shown to be associated with cancer cell proliferation, migration, and stem cell accumulation.

[0003] At present, a large number of studies have focused on the relationship between the expression of DOT1L and the occurrence and development of tumors. However, in recent years, there have been reports that histone methyltransferase DOT1L itself will mutate, but there is a lack of research on the relationship between the various mutation sites of histone methyltransferase DOT1L itself and the occurrence and development of cancer. The present invention studies how DOT1L mutation affects the biological function of DOT1L, thereby exploring the pathogenesis of cancer and laying the foundation for exploring targeted drugs that selectively inhibit DOT1L mutations. Summary of the invention

[0004] Problem that the invention aims to solve

[0005] The first object of the present invention is to provide a molecular marker for diagnosing and treating cancer, wherein the molecular marker is a pathological mutation at different sites of the histone methyltransferase DOT1L.

[0006] The second purpose of the present invention is to provide a target for anti-tumor drug research.

[0007] Solutions for solving problems

[0008] The present invention found 9 pathological mutations of histone methyltransferase DOT1L present in lung cancer, namely I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, and R231Q. Among them, the two mutation sites A100G and A1003S are multiple mutation sites, and the remaining 7 mutations are pathological mutations present in the DOT region of the DOT1L functional active domain.

[0009] Then, the wild-type histone methyltransferase DOT1L present in the cells was constructed into the conventional genetic engineering expression vector pCMV6 empty vector by vector construction. Then, the point mutation kit was used to perform point mutations at 9 mutation sites in sequence, and finally, the histone methyltransferase DOT1L expression vector with 9 pathological mutations was successfully constructed.

[0010] The present invention discovered for the first time that nine types of mutations, namely I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, and R231Q, are related to the occurrence and development of cancer, thereby completing the present invention.

[0011] On the basis of the above research, the present invention further constructs lung cancer cells that stably express the DOT1L-R231Q mutation by means of a lentiviral expression vector, thereby verifying the results of transient transfection at another level. Studies have shown that the malignant behavior of the stably transformed lung cancer cell line is consistent with the transient transfection results, which not only determines that the pathological mutation R231Q of the histone methyltransferase DOT1L is a gain-of-function gene mutation, but also proves that the 9 DOT1L pathological mutations found in the present invention can be used as molecular markers for cancer diagnosis and drug judgment. Further, the present invention has found that the histone methyltransferase DOT1L gain-of-function gene mutation R231Q stably transformed lung cancer cell line is significantly inhibited after the application of DOT1L small molecule inhibitors EPZ004777 and SGC0946, and the growth of cancer cells is inhibited in a dose-dependent manner. Therefore, the DOT1L pathological mutation found in the present invention can be used as a target site in the treatment of cancer.

[0012] Based on the above findings, the present invention proposes the following technical solutions:

[0013] (1) A molecular marker for diagnosing and treating cancer, wherein the molecular marker is a pathological mutation site located in the DOT region of the functional active domain of histone methyltransferase DOT1L, wherein the pathological mutation site is selected from one or more of I232N, Y216C, F243L, N241T, E186A, S225L, R231Q, A1003S, and A1003G.

[0014] In one embodiment, the pathological mutation site is selected from one or more of I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003G, more preferably selected from one or more of F243L, S225L, and R231Q, and further preferably selected from R231Q.

[0015] (2) Use of primers for detecting the above molecular markers in the preparation of reagents for cancer diagnosis and prognosis detection.

[0016] In one embodiment, the histone methyltransferase DOT1L mutates at a pathological mutation site, causing a malignant phenotype of cancer cells, and the pathological mutation site is selected from one or more of I232N, Y216C, F243L, N241T, E186A, S225L, R231Q, A1003S, and A1003G.

[0017] In one embodiment, the mutations of E186A, S225L, R231Q, and A1003G promote the expression level of H3K79me2, the enzyme substrate of histone methyltransferase DOT1L, the mutations of I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003S enhance the proliferation ability of cancer cells, the mutations of F243L, S225L, and R231Q enhance the cloning ability of cancer cells, the mutations of I232N, Y216C, F243L, N241T, R231Q, and A1003G increase the migration ability of cancer cells, and the mutation of R231Q is a gain-of-function gene mutation.

[0018] In one embodiment, the above cancers include lung cancer, breast cancer, prostate cancer, liver cancer, colon cancer, gastric cancer, and glioma.

[0019] (3) A primer for detecting the above-mentioned molecular marker, the primer comprising:

[0020] The nucleotide sequences of the primers for detecting I232N are shown in SEQ ID NO.25 and SEQ ID NO.26; the nucleotide sequences of the primers for detecting Y216C are shown in SEQ ID NO.27 and SEQ ID NO.28; the nucleotide sequences of the primers for detecting F243L are shown in SEQ ID NO.29 and SEQ ID NO.30; the nucleotide sequences of the primers for detecting N241T are shown in SEQ ID NO.31 and SEQ ID NO.32; the nucleotide sequences of the primers for detecting E186A are shown in SEQ ID NO.33 and SEQ ID NO.34; the nucleotide sequences of the primers for detecting S225L are shown in SEQ ID NO.35 and SEQ ID NO.36; the nucleotide sequences of the primers for detecting R231Q are shown in SEQ ID NO.37 and SEQ ID NO.38; the nucleotide sequences of the primers for detecting A1003S are shown in SEQ ID NO.39 and SEQ ID NO.40; the nucleotide sequences of the primers for detecting A1003G are shown in SEQ ID NO. NO.41 and SEQ ID NO.42.

[0021] (4) A kit for detecting the above-mentioned molecular marker, comprising the above-mentioned primers.

[0022] (5) Application of the above molecular markers as drug targets in in vitro screening of anti-tumor drugs.

[0023] (6) Use of a DOT1L small molecule inhibitor in the preparation of anticancer drugs, wherein the DOT1L small molecule inhibitor is used to inhibit the malignant phenotype of cancer cells caused by the above-mentioned molecular markers. Preferably, the anticancer drugs include drugs for treating lung cancer, breast cancer, prostate cancer, liver cancer, colon cancer, gastric cancer, and glioma. Preferably, the malignant phenotype of cancer cells includes cancer cell proliferation.

[0024] Effects of the Invention

[0025] The present invention first discovered that pathological mutations I232N, Y216C, F243L, N241T, E186A, S225L, R231Q, A1003S, and A1003G located in the DOT region of the functional active domain of histone methyltransferase DOT1L are related to the occurrence and development of cancer. They can be used as tumor biomarkers for diagnosis, prognosis, and drug judgment, and can be used as therapeutic targets for a variety of malignant tumors.

[0026] For the first time, a gain-of-function pathological mutation R231Q located in the DOT region of the functional activity domain of the histone methyltransferase DOT1L was discovered, providing a theoretical basis for the subsequent diagnosis of lung cancer patients and clinical guidance of medication. At the same time, the discovered target can be used in the preparation of drugs for the treatment of lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1A This is the result of agarose gel electrophoresis of the DOT1L wild-type expression vector;

[0028] Figure 1B is the sequencing result of the DOT1L wild-type expression vector;

[0029] Figure 1C These are the results of agarose gel electrophoresis of 9 different types of DOT1L pathological mutations;

[0030] Figure 1D These are the sequencing results of 9 mutations (the 9 mutations are: DOT1L-I232N, DOT1L-Y216C, DOT1L-F243L, DOT1L-A1003G, DOT1L-N241T, DOT1L-E186A, DOT1L-A1003S, DOT1L-S225L, and DOT1L-R231Q sequencing results).

[0031] Figure 2A This is the agarose gel electrophoresis result of DOT1L-R231Q and wild-type (WT) lentiviral expression vector;

[0032] Figure 2B This is the sequencing result of DOT1L-R231Q;

[0033] Figure 2C is the sequencing result of the wild-type (WT) lentiviral expression vector;

[0034] Figure 2D It is the verification result after packaging of the successfully constructed lentiviral expression vector.

[0035] Figure 3A It is the expression result of the target protein DOT1L after transfecting the expression vectors of 9 mutations into cells;

[0036] Figure 3BThe expression level of DOT1L substrate protein H3K79me2 was detected in 9 mutant cells that were successfully transfected. The horizontal coordinates of the bar graph from left to right are H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / blank vector, and H460 / WT;

[0037] Figure 3C It is the result of the proliferation ability of 9 mutant cells (24 hours), in which the horizontal coordinates of the bar graph from left to right are H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / blank vector, and H460 / WT;

[0038] Figure 3D The results of the proliferation ability of 9 mutant cells (48 hours), in which the horizontal axes of the bar graphs from left to right are H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / blank vector, and H460 / WT;

[0039] Figure 3E The results of the proliferation ability of 9 mutant cells (72 hours), in which the horizontal axes of the bar graphs from left to right are H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / blank vector, and H460 / WT;

[0040] Figure 3F It is the result of the clone-forming ability of 9 mutant cells, in which the horizontal axes of the bar graph from left to right are H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / blank vector, and H460 / WT;

[0041] Figure 3GThis is an investigation of the cell migration ability of 9 successfully transfected mutant cells. The horizontal axes of the bar graph are DOT1L / I232N, DOT1L / Y216C, DOT1L / F243L, DOT1L / A1003G, DOT1L / N241T, DOT1L / E186A, DOT1L / A1003S, DOT1L / S225L, DOT1L / R231Q, DOT1L / blank vector, and DOT1L / WT from left to right.

[0042] Figure 4A is to detect the effect of R231Q mutant DOT1L on the expression level of its substrate H3K79me2;

[0043] Figure 4B It is to investigate the cell proliferation ability of DOT1L-R231Q stable transgenic cell line;

[0044] Figure 4C This is to investigate the cell clone-forming ability of DOT1L-R231Q stable transgenic cell line;

[0045] Figure 4D This is an investigation of the cell migration ability of the DOT1L-R231Q stable cell line.

[0046] Figure 5A It is the inhibitory effect of EPZ004777 on H460-R231Q mutant cells;

[0047] Figure 5B It is the inhibitory effect of EPZ004777 on H1299-R231Q mutant cells;

[0048] Figure 5C It is the inhibitory effect of EPZ004777 on H1975-R231Q mutant cells;

[0049] Figure 5D It is the inhibitory effect of EPZ004777 on H446-R231Q mutant cells;

[0050] Figure 5E is the inhibitory effect of SGC0946 on H460-R231Q mutant cells;

[0051] Fig. 5F is the inhibitory effect of SGC0946 on H1299-R231Q mutant cells;

[0052] Figure 5G is the inhibitory effect of SGC0946 on H1975-R231Q mutant cells;

[0053] Figure 5HIt is the inhibitory effect of SGC0946 on H446-R231Q mutant cells.

[0054] Fig. 6A is the effect of DOT1L mutation on the survival rate of human breast cancer cells MCF-7 and human prostate cancer cells PC-3;

[0055] Figure 6B The effect of DOT1L mutation on the survival rate of human liver cancer cells Hep3B and human colon cancer cells Colo205;

[0056] Figure 6C The effect of DOT1L mutation on the survival rate of human gastric cancer cell AGS and human glioma cell U251;

[0057] Figure 7 This is the map of the lentiviral empty vector pLVX-Puro used in the experiment of the present invention;

[0058] Figure 8 This is the agarose gel electrophoresis result of detecting the R231Q mutation in Experimental Example 2 of the present invention. DETAILED DESCRIPTION

[0059] [cancer]

[0060] Lung cancer ranks first in the world in terms of morbidity and mortality among malignant tumors, and the rates are increasing year by year. The pathological types of lung cancer mainly include two categories: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). NSCLC is mainly divided into adenocarcinoma, squamous cell carcinoma and large cell lung cancer; SCLC is mainly divided into oat cell carcinoma and mixed carcinoma. NSCLC accounts for about 85% of all lung cancer cases, and its 5-year survival rate is only 15%. Although SCLC accounts for a small proportion, it has a low degree of differentiation and a higher degree of malignancy. At present, the cause of lung cancer is still unclear. A large number of studies have shown that smoking is the main factor that induces lung cancer, followed by occupational and environmental exposure, air pollution, ionizing radiation, diet and nutrition, and chronic lung diseases, which are also related to the occurrence of lung cancer. At present, the main treatments for lung cancer include: surgical treatment, radiotherapy and chemotherapy. However, these treatments usually have significant side effects, causing patients to experience great pain during the treatment process and easily develop tolerance. Therefore, there is an urgent need to find new biological markers for lung cancer. Therefore, research on DOT1L mutations in lung cancer is particularly important.

[0061] The pathogenesis of breast cancer has not yet been elucidated. Long-term effects of estrogen, family genetic predisposition, environmental factors and long-term high-dose exposure to radiation are related to the onset of breast cancer. The histological morphology of breast cancer is very complex and there are many types. It can be roughly divided into two categories: non-invasive cancer and invasive cancer. At present, estradiol receptors, progesterone receptors and breast cancer proto-oncogene HER2 biological markers have become routine detection methods to guide the clinical treatment and prognosis of breast cancer.

[0062] Prostate cancer refers to an epithelial malignant tumor that occurs in the prostate gland. Prostate cancer is often asymptomatic in its early stages. Clinical diagnosis of prostate cancer mainly relies on rectal examination, serum PSA, transrectal prostate ultrasound, and pelvic MRI examinations.

[0063] Liver cancer can be divided into two categories: primary and secondary. Primary liver cancer is a malignant tumor that occurs in stem cells or intrahepatic bile duct epithelial cells. Its incidence is relatively high in my country and it is one of the common tumors in my country. It occurs in Indonesia and has no clinical symptoms in the early stage, so it is often in the late stage when clinically discovered, and the mortality rate is relatively high. Secondary liver cancer or metastatic liver cancer refers to malignant tumors originating from multiple organs in the body that invade the liver. It is generally common in liver metastases of malignant tumors in organs such as the stomach, bile duct, pancreas, colorectum, ovary, uterus, lung, and breast.

[0064] Colon cancer is a common malignant tumor of the digestive tract that occurs in the colon. It is more likely to occur at the junction of the rectum and the sigmoid colon. The main cause of colon cancer is a high-fat and low-fiber diet. There may be no symptoms in the early stages, but in the middle and late stages, symptoms may include abdominal distension and indigestion, followed by changes in bowel habits, abdominal pain, and mucus or bloody stools.

[0065] Gastric cancer is a malignant tumor that develops from the gastric mucosal epithelium and glandular epithelium. It ranks first or second among malignant tumors in my country. Its etiology has not yet been fully elucidated. It may be related to diet and environmental factors, nitroso compounds, and Helicobacter pylori. It can be diagnosed by the increase of serum tumor-related antigens such as CEA, CA50, CA72-4, and CA19-9, but the sensitivity and specificity are not high.

[0066] Glioma (Glioma) Tumors originating from the neuroepithelium are collectively called brain gliomas, accounting for 40% to 50% of brain tumors. Like other tumors, gliomas are also caused by the interaction of congenital genetic high-risk factors and environmental carcinogenic factors. For example, neurofibromatosis (type I) and tuberculous sclerosis are genetic susceptibility factors for brain gliomas. Glioma is difficult to cure and often recurs.

[0067] [Histone H3 lysine 79 (H3K79) methyltransferase DOT1L]

[0068] Histone H3 lysine 79 (H3K79) methyltransferase DOT1L plays a very important role in activating and maintaining gene transcription. At the same time, it plays an irreplaceable role in maintaining individual embryonic development and the normal function of the hematopoietic system, heart and kidney. However, the overexpression of DOT1L is closely related to the occurrence and development of various tumors and has received widespread attention.

[0069] Different from the above concerns, the effect of mutation of DOT1L itself on the occurrence and development of cancer has not been revealed. The present invention finds that mutation of specific sites of DOT1L is related to the occurrence and development of cancer.

[0070] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0071] Experimental Example 1: Construction of expression vectors for 9 mutation sites of histone methyltransferase DOT1L and construction of mutant R231Q lentiviral expression vector and production of lentivirus

[0072] 1. Materials

[0073] Cell lines

[0074] Human non-small cell lung cancer cells NCI-H460 and human renal epithelial cells 293T were purchased from ATCC.

[0075] Strains and plasmids

[0076] TOP10 competent cells; pCMV6 empty vector; and pLVX-Puro lentiviral vector were purchased from Addgene.

[0077] 2. Methods

[0078] 1) Construction of DOT1L wild-type expression vector

[0079] Magnetic bead-based mRNA extraction and cDNA first-strand synthesis

[0080] (1) Prepare the sample and magnetic beads. Take out the Bead Preservation Solution, vortex for 30 seconds, immediately take out 100 μL and add it to a 1.5 mL centrifuge tube for magnetic separation (place the centrifuge tube on a magnetic rack and let it stand for 2 minutes). Discard the supernatant. After removing the centrifuge tube, add 100 μL of pre-cooled sterilized PBS buffer, vortex for 10 seconds to evenly disperse the magnetic beads, perform magnetic separation, and discard the supernatant.

[0081] (2) Prepare cell samples. Use fresh culture medium to blow down the cells. Count and take 10 6cells / ml, 1000rpm / min, centrifuge for 5min, wash the cells with 500μL pre-cooled sterile PBS, 1000rpm / min, centrifuge for 5min, and discard the supernatant. Add 100μL pre-cooled sterile PBS buffer to disperse the cells. Add 200μL Lysis Buffer, mix well and add to the magnetic bead suspension obtained in step (1), repeatedly blow 20 times, and let stand at room temperature for 10min (turn over twice during the standing process to make the magnetic beads evenly dispersed in the solution). Magnetic separation, retain the magnetic beads, and discard the supernatant.

[0082] (3) Purify mRNA in a clean bench. Remove the centrifuge tube, add 1 mL of Washing Buffer, vortex for 10 seconds to evenly disperse the magnetic beads, and then perform magnetic separation and discard the supernatant. Remove the centrifuge tube and add 25 μL of Elution Buffer, vortex for 10 seconds to evenly disperse the magnetic beads. Place the centrifuge tube in a 50°C water bath for 3 minutes, immediately place it on a magnetic stand and wait for 15 seconds, carefully pipette the supernatant into a new centrifuge tube, which is the purified mRNA, and immediately place it on ice for downstream experiments;

[0083] (4) Synthesize the first strand of cDNA in a sterile clean bench on ice. Add 4 μL 5×cDNA Synthesis SuperMix, 1 μL mRNA, and 15 μL RNase-free Water to establish a 20 μL reaction system. Mix the reaction system and centrifuge it, then place it in a PCR instrument and set the following program: 42°C for 10 min, 85°C for 10 s. After the reaction is complete, store it at -20°C for later use.

[0084] PCR amplification

[0085] (1) Primers were designed based on the double restriction sites sgf1 and mlu1 on the plasmid. The primer sequences are as follows:

[0086] DOT1L Forward

[0087] GAGGCGATCGCCATGGGGGAGAA (SEQ ID No. 1);

[0088] DOT1L Reverse

[0089] GCGACGCGTGTTACCTCCAACTGA (SEQ ID No. 2).

[0090] (2) Add the reaction system to a microcentrifuge tube in the following order: 25 μL Prime STARHS (Premix), 1 μL DOT1L Forward, 1 μL DOT1L Reverse, 1 μL Template, and 20 μL DEPC Water to establish a 50 μL reaction system. (3) Mix the reaction system and centrifuge it, then place it in a PCR instrument and set the program as follows: 98°C for 10 seconds, 55°C for 5 seconds, 72°C for 5 minutes, 30 cycles, and 4°C Forever. The amplified sequence was ligated into the pCMV6-EntryVector plasmid after double restriction digestion and stored at -20°C.

[0091] Conversion

[0092] (1) Take out TOP10 competent bacteria (100 μL) from the -80°C ultra-low temperature freezer, immediately thaw at 37°C, and place on ice for 5-10 min.

[0093] (2) Add 0.5-5 μL of the ligated plasmid mixture (DNA content not exceeding 100 ng), shake gently, and place on ice for 20 min.

[0094] (3) After gently shaking, place the tube in a 42°C water bath for 45 seconds for heat shock (to ensure transformation efficiency, the 42°C water bath should be preheated in advance), then quickly return to ice and let stand for 3-5 minutes.

[0095] (4) Add 200 μL to 500 μL of LB medium (without kanamycin) to each tube in a clean bench, mix gently, and then fix the tubes on the spring frame of a shaker and shake at 37°C for 1 h.

[0096] (5) Take 1 / 5 of the above transformation mixture in the clean bench and drop it into the solid LB plate culture dish containing appropriate kanamycin (preheated at 37℃), and spread it evenly with a glass coating rod burned by an alcohol lamp until there is no flow. Place it in a 37℃ constant temperature incubator for 30-60 minutes until the liquid on the surface has penetrated into the culture medium, then turn it upside down and place it in a 37℃ constant temperature incubator overnight.

[0097] (6) Observe the colonies grown on the plate. It is best if the colonies can be separated from each other. Seal with sealing film and store upside down in a refrigerator at 4℃.

[0098] Bacterial culture

[0099] (1) Carefully pick a single colony from the LB plate with a 10 μL pipette tip, disperse it in 3 mL of liquid LB medium containing kanamycin, and place it in a 37°C constant temperature shaker at 200-300 r / min for 3 h.

[0100] (2) When the bacterial solution becomes slightly turbid, pipette 500 μL of the bacterial solution into 20 mL of liquid LB medium containing kanamycin for five times to make the total bacterial solution reach 100 mL (divide into 5 tubes for amplification to allow the bacterial solution to fully contact with air). Place the culture in a 37°C constant temperature shaker at 200-300 r / min for 16 to 18 h.

[0101] Plasmid extraction

[0102] (1) Add 2.5 mL of equilibration solution BL to the adsorption column CP6 (the adsorption column is placed in a 50 mL collection tube), centrifuge at 8,000 rpm for 2 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0103] (2) Take 100 mL of overnight culture solution and add it to a centrifuge tube. Centrifuge at 8,000 rpm for 3 min at room temperature to collect the bacteria and discard the supernatant. Add 8 mL of solution P1 to the centrifuge tube containing the bacterial cell pellet and use a pipette or vortex oscillator to thoroughly suspend the bacterial cell pellet.

[0104] (3) Add 8 mL of solution P2 to the centrifuge tube, gently invert the tube 6-8 times, and place it at room temperature for 5 min. Add 8 mL of solution P4 to the centrifuge tube, gently invert the tube 6-8 times, and mix thoroughly until white flocculent precipitates appear in the solution. Then place it at room temperature for 10 min, centrifuge at 8000 rpm for 5-10 min, and centrifuge the white precipitate to the bottom of the tube. Pour all the solution carefully into the filter, slowly push the handle to filter, and collect the filtrate in a clean 50 mL tube.

[0105] (4) Add 0.3 times the volume of isopropanol to the filtrate, mix by inversion, and transfer to the adsorption column CP6 (the adsorption column is placed in a 50 mL collection tube). Centrifuge at room temperature at 8,000 rpm (~8,228×g) for 2 min, pour out the waste liquid in the collection tube, and put the adsorption column CP6 back into the collection tube.

[0106] (5) Add 10 mL of rinse solution PW to the adsorption column CP6, centrifuge at 8,000 rpm for 2 min, discard the waste solution in the collection tube, and put the adsorption column back into the collection tube (repeat this step twice). Add 3 mL of anhydrous ethanol to the adsorption column CP6, centrifuge at 8,000 rpm for 2 min at room temperature, and discard the waste solution. Put the adsorption column CP6 back into the collection tube and centrifuge at 8,000 rpm for 5 min to absorb the remaining rinse solution in the material.

[0107] (6) Place the adsorption column CP6 in a clean 50 mL collection tube, add 1-2 mL of elution buffer TB to the middle part of the adsorption membrane, leave it at room temperature for 5 min, and then centrifuge it at 8,000 rpm (~8,228×g) for 2 min. Transfer all the eluate in the 50 mL centrifuge tube to a clean 1.5 mL centrifuge tube and store the obtained DOT1L wild-type expression vector at -20°C.

[0108] Agarose gel electrophoresis verification and plasmid DNA sequencing

[0109] (1) Take 5 μL of the PCR amplification product, add 1 μL of bromophenol blue, and electrophoresed in a 1.2% agarose gel containing 0.5 μg / mL ethidium bromide (EB). Compare the amplified band with the standard DNA molecular weight band.

[0110] (2) After gel recovery, the samples are sent to the company for sequencing.

[0111] 2) Construction of 9 mutant DOT1L expression vectors

[0112] (1) Design of mutation primers

[0113] The homologous recombination method was used to design mutation primers, and the primer sequences are shown in Table 1:

[0114] Table 1. Primers for constructing DOT1L mutations

[0115]

[0116]

[0117] (2) PCR amplification

[0118] The 9 pairs of primers shown in Table 1 were used to amplify the DOT1L wild-type plasmid, and the amplification system and conditions were the same. The KOD-NEO-PLUS amplification kit of Toyobo Co. was used for amplification. The system and conditions are shown in Tables 2 and 3 below:

[0119] Table 2. DOT1L point mutation reaction system

[0120]

[0121]

[0122] Table 3. DOT1L mutation PCR program settings are as follows:

[0123]

[0124] Subsequently, the same steps as in the above “1) Construction of DOT1L wild-type expression vector” were followed for transformation, bacterial culture, plasmid extraction (thereby preparing 9 mutant DOT1L expression vectors), agarose gel electrophoresis verification, and plasmid DNA sequencing.

[0125] 3) Construction of the gain-of-function mutation R231Q lentiviral expression vector

[0126] (1) Primer design and synthesis

[0127] Primers were designed based on the gene sequences of DOT1L mutant and wild type and the double restriction sites XhoI and EcoRI on the pLVX-Puro vector. Primers were designed using Primer Premier 5.0 software and screened and optimized on the yeastgenome website. The primer sequences were designed as shown in Table 4 below:

[0128] Table 4. Primers for DOT1L gene

[0129]

[0130]

[0131] The sequence was commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0132] (2) PCR amplification and double restriction enzyme digestion of target fragment

[0133] PCR amplification

[0134] The above primers were prepared into a 100 μM stock solution with ddH2O, and then diluted to 10 μM with ddH2O for standby use. The pCMV6-DOT1L-R231Q plasmid constructed in the previous stage was used as a template, and the above primers (SEQ ID No.21 and SEQ ID No.22) and 2×Super Pfx MasterMix kit were used for PCR reaction; and the pCMV6-DOT1L-WT plasmid constructed in the previous stage was used as a template, and the above primers (SEQ ID No.23 and SEQ ID No.24) and 2×Super Pfx MasterMix kit were used for PCR reaction. The PCR reaction system is shown in Table 5 below:

[0135] Table 5. PCR reaction system

[0136]

[0137] The above mixture was placed in a 200 μL EP tube and put into a PCR instrument to run the following program to complete PCR amplification: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 15 s as one cycle. After 30 cycles, final extension was performed at 72°C for 5 min.

[0138] PCR product purification

[0139] ① Before use, add 40 mL of anhydrous ethanol to the Washing Buffer and shake evenly.

[0140] ②Take 50-100 μL of PCR product, add 5 times the volume of Binding Buffer, mix well and add to the centrifuge column. To increase the purification yield, you can choose to let it stand for 1 minute, centrifuge at 10,000×g for 1 minute, and discard the effluent.

[0141] ③Add 650 μL Wash Buffer, centrifuge at 10,000×g for 1 min, and discard the effluent.

[0142] ④ Centrifuge at 10,000×g for 1-2 minutes to completely remove the residual Washing Buffer.

[0143] ⑤ Place the centrifuge column in a clean centrifuge tube and add 30-50μL Elution Buffer to the center of the column. To increase the purification yield, you can choose to preheat the Elution Buffer at 60℃-70℃ or deionized water at room temperature for 1 minute, centrifuge at 10000×g for 1 minute, and elute the DNA. The eluted DNA is stored at -20℃.

[0144] Product concentration determination: The concentration of the purified product was determined in the NanDrop 2000 program, using Buffer EB as a blank control and 2 μL of sample for each determination.

[0145] Double enzyme digestion target fragment

[0146] XhoI and EcoRI restriction endonucleases were used to cut the target fragment, and the protective bases were removed to expose the sticky ends. The enzyme digestion reaction system is shown in Table 6 below:

[0147] Table 6. Double restriction enzyme digestion reaction system of target gene

[0148]

[0149] The above mixture was placed in a 200 μL EP tube and placed in a PCR instrument to run the following program to complete the enzyme digestion reaction: 37°C, 15 min.

[0150] (3) Recovery of linearized vector

[0151] The map of the empty lentiviral vector pLVX-Puro used in this experiment is as follows Figure 7 As shown:

[0152] Transformation of pLVX-Puro lentiviral vector

[0153] ① Take out the Trans10 competent bacteria (50 μL) from the -80℃ refrigerator, place it on ice to slowly melt it. Add an appropriate amount of plasmid (total amount not exceeding 25 ng), mix gently and place on ice for 30 minutes.

[0154] ② Heat shock in a 42℃ water bath for 45s, quickly transfer to ice, and ice bath for 2min. Do not shake the bacterial solution at this time. Add SOC medium without antibiotics to every 50μL of bacterial solution in a clean bench, mix gently, and culture on a 37℃ constant temperature shaker at 200rpm / min for 60min.

[0155] ③ Preheat the culture dish containing ampicillin at 37℃ for 10 minutes, draw an appropriate amount of the above mixture and drop it onto the culture medium, and immediately spread it evenly with a sterilized glass coating rod that has been cooled to room temperature until there is no obvious flowing liquid.

[0156] ④ Place the LB culture medium upright in a 37°C constant temperature incubator for 60 minutes, then place the plate upside down in the incubator overnight.

[0157] ⑤ Observe the colonies on the plate. The colonies should be separated from each other, of moderate size, and free of foreign bacteria. Seal and store inverted at 4℃.

[0158] Amplification and extraction of pLVX-Puro lentiviral vector

[0159] Observe the growth of the colonies on the plate, pick up the well-growing colonies with the tip of the gun, and culture them in a liquid culture medium containing antibiotics to amplify them in large quantities. The specific steps are as follows:

[0160] ① Prepare an appropriate amount of LB liquid culture medium containing ampicillin at a ratio of 1:1000, with the requirement that no more than 15 mL of LB culture medium be placed in each 50 mL centrifuge tube.

[0161] ② Use a 10μL pipette tip to pick out a single clone from the LB plate, place it in 3mL of LB liquid medium containing ampicillin, and culture it on a constant temperature shaker at 37℃ and 200r / min for 3-8h;

[0162] ③ Add 200 μL of bacterial solution to every 15 mL of liquid culture medium, place on a 37°C constant temperature shaker, and culture at 200 r / min for 16 to 18 hours.

[0163] The bacterial solution after cultivation is extracted using a plasmid mini-extraction kit. The specific steps are as follows:

[0164] ① Column balancing step: Add 500 μL of balancing solution BL to the adsorption column CP4 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400 × g) for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. (Use the column treated on the same day)

[0165] ② Take 5-15mL of overnight cultured bacterial solution and add it to a centrifuge tube. Centrifuge at 12,000rpm (~13,400×g) for 1min and remove the supernatant as much as possible. Note: When there is a lot of bacterial solution, you can collect the bacterial precipitate into a centrifuge tube through several centrifugations. The amount of collected bacterial cells should be sufficient to lyse them. Excessive lysis of bacterial cells will reduce the efficiency of plasmid extraction.

[0166] ③ Add 500μL of solution P1 (add RNase A before use) to the centrifuge tube with bacterial cell pellets, and use a pipette or vortex oscillator to thoroughly suspend the bacterial cell pellet. If there are bacterial lumps that are not thoroughly mixed, it will affect lysis, resulting in low extraction volume and purity.

[0167] ④ Add 500μL of solution P2 to the centrifuge tube and gently flip it upside down 6-8 times to fully lyse the bacteria. Be careful to mix gently and do not shake violently to avoid contaminating the genomic DNA. At this time, the bacterial solution should become clear and viscous. The time used should not exceed 5 minutes to avoid damage to the plasmid. If the bacterial solution does not become clear, it may be due to excessive bacteria and incomplete lysis. The amount of bacteria should be reduced.

[0168] ⑤ Add 700μL of solution P3 to the centrifuge tube, and immediately and gently turn it upside down 6-8 times to mix it thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000rpm (~13,400×g) for 30min. A precipitate will form at the bottom of the centrifuge tube. Mix immediately after adding P3 to avoid local precipitation. If there is still a tiny white precipitate in the supernatant, centrifuge again and take the supernatant.

[0169] ⑥ Add the supernatant collected in the previous step to the adsorption column CP4 in portions (the adsorption column is placed in the collection tube, and its capacity is 750-800μL), and try not to suck out the precipitate. Centrifuge at 12,000rpm (~13,400×g) for 1min, pour out the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0170] ⑦ Add 600 μL of rinsing solution PW (add anhydrous ethanol before use) to the adsorption column CP4, centrifuge at 12,000 rpm (~13,400×g) for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0171] ⑧Repeat step ⑦.

[0172] ⑨ Place the adsorption column CP4 in the collection tube and centrifuge at 12,000rpm (~13,400×g) for 2 minutes to remove the residual rinse solution in the adsorption column. The residual ethanol in the rinse solution will affect the subsequent enzyme reaction (enzyme digestion, PCR, etc.) experiments. To ensure that downstream experiments are not affected by residual ethanol, the adsorption column CP4 should be opened and placed at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.

[0173] ⑩ Place the adsorption column CP4 in a clean centrifuge tube, add 60-100 μL of elution buffer EB to the middle part of the adsorption membrane, leave it at room temperature for 30 minutes, centrifuge at 12,000 rpm (~13,400×g) for 2 minutes, collect the plasmid solution into the centrifuge tube, and use it directly or store it at -20℃.

[0174] Linearization of pLVX-Puro Lentiviral Vector

[0175] According to the pLVX-Puro plasmid map, XhoI and EcoRI restriction enzymes were selected to cut the vector. The enzyme cutting reaction system is shown in Table 7 below:

[0176] Table 7. Double restriction enzyme digestion reaction system of lentiviral vector

[0177]

[0178] Place the above mixture in a 200 μL EP tube and place it in a PCR instrument to run the following program to complete the linearization of the pLVX-Puro plasmid: 37°C, 15 min. The linearized vector can be used immediately or stored at -20°C.

[0179] Agarose gel recovery

[0180] ① Agarose gel electrophoresis

[0181] a. Gel preparation: Prepare a sufficient amount of 1×TAE electrophoresis buffer. The electrophoresis buffer for gel preparation and electrophoresis must be prepared at the same time; weigh 0.3g agarose into a conical flask, add 30ml 1×TAE electrophoresis buffer, boil in a microwave oven, boil for several times until the solution is clear and transparent, add 3μL (1 / 10,000) nucleic acid dye and mix well. When the temperature drops to about 60℃, pour it onto a clean and dry plastic mold plate and wait for 40min.

[0182] b. Loading: Place the prepared gel in the electrophoresis tank and add an appropriate amount of 1×TAE electrophoresis buffer. Add DL 10000 DNA marker to the lane, draw up the digestion product and mix it with 6× loading buffer at a ratio of 5:1, so that the loading buffer in the loading system finally reaches 1×.

[0183] c. Electrophoresis: Turn on the power supply, set the voltage to 80V, and perform electrophoresis for 60 minutes.

[0184] d. Imaging: Check the electrophoresis results at 254nm and 365nm on a UV analyzer and take pictures on a gel imaging system.

[0185] ②Linearized carrier glue recovery

[0186] a. Quickly cut the agarose gel with fluorescent bands in the previous step under ultraviolet light, try to get gel containing only linearized vector, cut the gel block into pieces, weigh the gel block, and calculate the volume of the gel block. When calculating the volume of the gel block, 1mg = 1μL is used for rough calculation. Add GSB solution to the gel block to dissolve the gel, and the ratio of the volume of GSB solution to the volume of the gel block is 3:1.

[0187] b. Melt the glue in a 55℃ water bath for 6 minutes, mixing intermittently (2-3 minutes) to ensure that the glue block is completely melted.

[0188] c. After the melted gel solution has cooled to room temperature, add it to the centrifuge column and let it stand for 1 min. Centrifuge at 10,000×g for 1 min and discard the filtrate.

[0189] d. Pipette 650 μL of Washing Buffer into the centrifuge column, centrifuge at 10,000 × g for 1 min at room temperature, and discard the filtrate.

[0190] e. Centrifuge at 10,000×g for 2 min at room temperature to completely remove residual Washing Buffer.

[0191] f. Place the centrifugal column in a new EP tube, open the cover and let it stand for 1 minute to allow the residual ethanol to evaporate.

[0192] g. Add 50 μL of deionized water to the center of the column, let it stand at room temperature for 1 min, centrifuge at 10,000×g for 1 min, elute the DNA, and store at -20°C.

[0193] (4) Ligation reaction and identification and amplification of ligation products

[0194] Ligation reaction: The target fragment obtained after double enzyme digestion is connected with the linearized vector after gel recovery obtained in ② above. The ligation reaction system is shown in Table 8 below:

[0195] Table 8. Ligation reaction system

[0196]

[0197] The above mixture was placed in a 200 μL EP tube and placed in a PCR instrument to run the following program to complete the ligation reaction: 16°C overnight ligation.

[0198] Identification and amplification of the ligation product: The transformation, amplification and extraction steps of the ligation product are the same as the transformation, amplification and extraction steps of the pLVX-Puro lentiviral vector in the above step "(3) Recovery of the linearized vector". The above recombinant expression vector is preliminarily verified by double restriction enzyme digestion using XhoI and EcoRI restriction enzymes. The restriction enzyme digestion reaction system is shown in Table 9 below:

[0199] Table 9. Double restriction enzyme digestion reaction system of recombinant lentiviral expression vector

[0200]

[0201] The above mixture was placed in a 200 μL EP tube and placed in a PCR instrument to run the following program to complete enzyme digestion: 37°C, 15 min.

[0202] The gain-of-function mutation R231Q recombinant lentiviral expression vector and wild-type (WT) lentiviral expression vector prepared above were entrusted to Shanghai Bioengineering Sequencing for further verification, and the sequencing results were compared using ContingExpress and SnapeGene software.

[0203] 4) Packaging of DOT1L wild-type and R231Q mutant lentivirus

[0204] (1) Packaging of recombinant lentivirus

[0205] 1. One day before transfection, take 293T cells in the logarithmic growth phase and digest the cells with 0.05% trypsin for 1-2 minutes, resuspend the 293T cells in DMEM medium containing 10%, and plate 2-3×10 6 Cells were transferred into a 10 cm dish (density was 70%-80%).

[0206] 2. Take the 293T cells ready for transfection and change the medium. Add culture medium without double antibodies (DMEM + 10% FBS). Antibiotics can cause great damage to cells during transfection.

[0207] 3. Restore the plasmid to room temperature in advance and configure it according to the following ratio:

[0208] Table 10. Lentiviral packaging system

[0209]

[0210]

[0211] 4. Take a clean and sterile 4mL EP tube to dilute the plasmid, add Opti-MEM without serum to a volume of 1mL, and add the corresponding volume of the target plasmid according to the mass of the three plasmids shown in the table above.

[0212] 5. Take 48 μL of TransIntro TM Add EL to the diluted plasmid DNA and mix gently.

[0213] 6. Let stand at room temperature for 15-20 minutes.

[0214] 7. TransIntro TM The EL complex was slowly added to the 293T cells to be transfected in a concentric circle manner, and the 10 cm dish was gently shaken in a cross pattern before toxin production in an incubator.

[0215] 8. After the cells have been exposed to the transfection reagent for 4-6 hours, they are replaced with complete culture medium and placed in a cell culture incubator to continue to produce toxins for 48 hours.

[0216] 9. 48 hours after transfection (when 293T cells are fully grown), collect the supernatant in a 10mL centrifuge tube and centrifuge at 3000rpm for 20 minutes at 4℃, or filter the supernatant with a 0.45μm low protein binding sterile needle filter. Add 10cm of culture medium to a 10cm large dish. After 24 hours, collect the supernatant again, divide it into portions according to the amount used each time, and store it in a -80℃ refrigerator (do not freeze and thaw repeatedly).

[0217] (2) Infection of target cells

[0218] 1. NCI-H460 cells (ATCC), NCI-H1299 cells (ATCC), NCI-H1975 cells (ATCC) and NCI-H446 cells (ATCC) are the target cells. They need to be plated on 60 mm dishes one day in advance to ensure that the density during infection is 30-40%. At the same time, prepare a control group of cells that are not infected with the virus.

[0219] 2. Take out the virus in advance and dissolve it on ice, remove the culture medium of the cells to be transfected, add 5mL of virus supernatant to each dish, and add the membrane permeabilization agent Polybrene to make its final concentration 5μg / mL (you can also add a certain concentration of membrane permeabilization agent according to your specific situation).

[0220] 3. After 24 hours, discard the virus supernatant and add 5 mL of virus supernatant to each dish, and add the membrane permeabilization agent Polybrene to make the final concentration of 5 μg / mL.

[0221] 4. After 24 hours, discard the viral supernatant and add 5 mL of complete culture medium to each dish and continue culturing for 24 hours. The purpose is to allow the cells to adapt for a period of time, and then add antibiotics of corresponding concentrations for screening.

[0222] (3) Screening of target cells

[0223] 1. Minimum lethal concentration screening

[0224] ① NCI-H460 cells (ATCC), NCI-H1299 cells (ATCC), NCI-H1975 cells (ATCC) and NCI-H446 cells (ATCC) were seeded at appropriate density in 24-well plates, RPMI-1640 culture medium was used as the basal culture medium, fetal bovine serum of corresponding concentration was added, and cultured in a saturated humidity and 37°C, 5% CO2 incubator until the cell density reached about 50%.

[0225] ②Discard the culture medium in the 24-well plate, wash once with PBS, and replace with complete culture medium with final puromycin concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4, 1.6, 1.8, and 2 μg / mL, respectively. Mark the plates and culture them in a saturated humidity, 37°C, 5% CO2 incubator.

[0226] ③ The drug-treated cells were washed with PBS every other day, and the complete culture medium containing the corresponding puromycin was replaced, and cultured continuously for 3 days in a saturated humidity, 37°C, 5% CO2 incubator.

[0227] ④ After 3 days, observe the growth status of cells in each well of the 24-well plate, and select the lowest puromycin concentration that can kill all cells in the well within 3 days as the minimum lethal concentration for the above four lung cancer cells.

[0228] 2. Wash the infected target cells in (2) once with PBS and replace with complete culture medium containing the minimum lethal concentration of puromycin. Culture continuously for 3 days in a saturated humidity, 37°C, 5% CO2 incubator. Collect some cells, extract protein, and verify the transfection efficiency by Western Blot. After successful verification, freeze a large number of cells for future use in subsequent experiments.

[0229] 5) Immunoblotting to examine protein expression

[0230] (1) Protein extraction

[0231] 1. After the adherent cells obtained in the above step "(3) Screening of target cells" have grown to an appropriate density, the cells are collected in a 10 mL centrifuge tube, centrifuged for 5 min (1500 rpm / min), and the supernatant is discarded.

[0232] 2. Add 2 mL of PBS to the precipitate in the tube to rinse, centrifuge for 5 min (1500 rpm / min), discard the supernatant, and repeat twice.

[0233] 3. Add an appropriate amount of 1×RIPA lysis buffer containing protease inhibitors (1:100) and phosphatase inhibitors (1:100) to the precipitate in the tube and resuspend the cells. Quickly freeze the cell resuspension in liquid nitrogen, then take it out and quickly shake it to melt at room temperature. After the liquid melts, quickly freeze the cell resuspension again in liquid nitrogen. Repeat the freezing and thawing process 3 times.

[0234] 4. Place the repeatedly frozen and thawed samples in a 4°C centrifuge and centrifuge for 15 min (12,000 g / min). Pipette only the supernatant into a 1.5 mL centrifuge tube and place on ice for later use or store at -80°C for later use.

[0235] (2) Protein concentration determination (BCA method)

[0236] BCA protein quantification is one of the most widely used protein quantification methods. This method is fast, stable and sensitive in detecting protein concentration. In an alkaline environment, the peptide chain structure in the protein molecule can react with Cu 2+ The complex is formed and Cu 2+ Reduction to Cu + BCA reagent can sensitively and specifically react with Cu + Combine to form a stable colored complex. There is a high light absorption value at 562nm. The depth of color is proportional to the protein concentration. The protein content can be determined based on the absorption value. The protein solution can accurately measure the concentration of 2.5-200μg / ml. The operation steps are as follows:

[0237] 1. Dilution of BSA standard: Dilute the BSA standard according to the instructions to form a gradient solution of 0, 0.0625, 0.125, 0.25, 0.5, 1 and 2 μg / μL.

[0238] 2. BCA working solution: Prepare BCA solution A and solution B in a ratio of 50:1 according to the instructions.

[0239] 3. Absorbance detection: Take 20 μL of standard gradient solution or sample in a 96-well plate, and set up 3 replicate wells for each sample. Then add 180 μL of BCA working solution, mix thoroughly, and incubate in a 37°C incubator for 30 minutes. Take out the sample and cool it to room temperature, and use an enzyme reader to detect the absorbance at 562 nm.

[0240] 4. Calculate protein concentration: Draw a standard curve based on the absorbance of the standard gradient solution and calculate the concentration of the sample to be tested.

[0241] 5. Protein denaturation: According to the calculated protein concentration, balance each sample with PBS, then add 1 / 4 total volume of 5× SDS-PAGE loading buffer, vortex mix to make the loading buffer reach 1× concentration, heat in a 100℃ metal bath for 5 min, and load the sample immediately or store at -80℃ for later use.

[0242] (3) SDS polyacrylamide gel electrophoresis

[0243] 1. Preparation of separation gel and concentrated gel: Select separation gel and concentrated gel of appropriate concentration according to the molecular weight of the target protein and internal reference protein. Quickly add the components of the separation gel into a 50mL EP tube in sequence and mix evenly, quickly pour into the electrophoresis glass plate, and reserve an appropriate height for the preparation of concentrated gel. After filling the separation gel, slowly add ddH2O for liquid sealing, and let it stand at room temperature for 40-60 minutes to allow the separation gel to fully solidify. Tilt the gel rack, use filter paper to absorb the moisture above the separation gel, then prepare the concentrated gel according to the table and vortex to mix, quickly pour into the electrophoresis glass plate, insert the comb, and let it stand at room temperature for 30-40 minutes to solidify.

[0244] 2. Sample loading: After the concentrated gel has solidified, place the gel in an electrophoresis tank and add an appropriate amount of 1× electrophoresis buffer (prepared and used immediately), remove the comb, and use a pipette to repeatedly blow the sample well to remove bubbles. Prepare the protein prepared in the above step "(2) Protein concentration determination (BCA method)", add 1× loading buffer to the side wells, and then add the protein sample and a marker of appropriate molecular weight to the remaining loading wells as required;

[0245] 3. Electrophoresis: After loading, adjust the voltage of the electrophoresis instrument to 60V and perform electrophoresis for about 40 minutes. After the markers are separated, adjust the voltage to 120V and continue electrophoresis for about 1 hour. When the loading buffer is electrophoresed to the appropriate position, the electrophoresis can be terminated.

[0246] (4) Western blotting

[0247] 1. Prepare the electrotransfer filter paper in advance and soak it in the positive I, positive II and cathode electrotransfer buffers respectively, and precool it at 4°C for use. Before transfer, activate the PVDF membrane with methanol, and then put it in the positive II electrotransfer buffer for balance.

[0248] 2. Take out the gel after electrophoresis and place it into the semi-dry transfer instrument in the order of cation I, cation II, PVDF membrane, gel and cathode from bottom to top to remove all bubbles.

[0249] 3. Set the transfer time according to the molecular weight of the target protein and the internal reference protein, with a constant voltage of 22V and transfer for 20-50min.

[0250] (5) Immunoassay

[0251] 1. Place the electro-transferred PVDF membrane in the blocking solution, place it on a shaker, and block it at room temperature for 1 hour.

[0252] 2. Dilute the primary antibody (Abcam) to an appropriate concentration with 5% BSA, incubate the PVDF membrane containing the target band in the primary antibody dilution solution, and place it on a shaker at 4°C overnight.

[0253] 3. Place the PVDF membrane that has been incubated overnight on a shaker to return to room temperature for 1 hour, recover the primary antibody, and wash it with TBST three times, 10 minutes each time.

[0254] 4. Dilute the secondary antibody (Abcam) to an appropriate concentration with 5% BSA, place the PVDF membrane containing the target band in the secondary antibody dilution solution and incubate on a shaker at room temperature for 1 hour.

[0255] 5. Discard the secondary antibody and wash three times with TBST, 10 min each time.

[0256] 6. Transfer the PVDF membrane to an exposure clip covered with plastic wrap, add an appropriate amount of ECL chemiluminescent liquid in a dark room, put in X-ray film, or use an imaging system for exposure.

[0257] 7. Select an appropriate exposure time, take out the film and place it in the developer for 1 minute, rinse with clean water, fix in the fixer for 30 seconds, rinse with running water, dry, and scan into an image.

[0258] 3. Experimental results

[0259] Figure 1A-Figure 1D As shown in the figure, after constructing the DOT1L wild-type expression vector and mutant expression vector, agarose gel electrophoresis and sequencing were used to analyze the results. Figure 1A As shown, the successfully connected recombinant plasmid was subjected to agarose gel electrophoresis, and the results showed that the band was located between 7500 and 10000 bp, which was consistent with the expected vector size. Figure 1B This is the result of sequencing the successfully connected vector. The sequencing result analysis shows that the target fragment is successfully connected to the empty vector and there are no mutant bases.

[0260] like Figure 1C As shown in Figure 1, agarose gel electrophoresis was performed on 9 mutant histone methyltransferase DOT1L (I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, R231Q). The results showed that the vector bands of the 9 mutants were located between 7500 and 10000 bp, which was consistent with the expected vector size. The 9 mutant vectors were then sent for sequencing. Figure 1D As shown, the sequencing results showed that the 9 mutant DOT1L target fragments were successfully connected to the empty vector, and there were no additional mutated bases.

[0261] like Figure 2A-2D As shown in the figure, after constructing 9 kinds of DOT1L mutations, a gain-of-function gene mutation R231Q was found through screening of biological function experiments. Then, a lentiviral expression vector was constructed for the mutation, and the successfully constructed lentiviral vector was packaged into viral particles, which were then infected into target cells and then subjected to protein immunoblotting experiments to detect the expression of the target protein. Figure 2A As shown in the figure, the constructed lentiviral expression vector was double-digested and verified. From the preliminary results of agarose gel electrophoresis, it can be seen that the target fragment has been successfully linked to the lentiviral empty vector. The position size of the PCR target fragment is about 1200bp, while the linearized vector fragment size is about 8000bp, which is consistent with the expected result. The vector was then sequenced, as shown in the figure below. Figure 2B-2C As shown in the figure, whether it is a wild-type lentiviral expression vector or a mutant lentiviral expression vector, the sequencing results show that the target fragment is successfully linked to the lentiviral empty vector, and no base mutation occurs. The successfully constructed lentiviral vector is then packaged into viral particles for infecting the target cells. Figure 2D It can be seen from the results that the proteins in the target cells are expressed, thus verifying the successful packaging of the lentivirus.

[0262] 4. Conclusion

[0263] 1. The present invention successfully constructed 9 mutant DOT1L expression vectors, namely I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, and R231Q DOT1L expression vectors.

[0264] 2. Based on the transient expression vector, a DOT1L lentiviral expression vector that stably expresses the R231Q mutation was successfully constructed.

[0265] 3. Based on the successful construction of the lentiviral expression vector, the lentiviral particles used to infect the target cells were successfully packaged.

[0266] Experimental Example 2: Detection of 9 mutation sites of histone methyltransferase DOT1L

[0267] (1) Primer design and synthesis

[0268] Primers were designed based on the gene sequence of DOT1L mutation, using Primer Premier 5.0 software, and screened and optimized on the yeastgenome website. The primer sequences were designed as follows:

[0269] Table 11. Primers for detecting DOT1L mutations

[0270]

[0271]

[0272] The sequence was commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0273] (2) PCR amplification

[0274] The above primers were prepared into a 100 μM stock solution with ddH2O, and then diluted to 10 μM with ddH2O for later use. The 9 mutant DOT1L expression vectors were used as templates, and the above primers and 2×Super Pfx MasterMix kit were used for PCR reaction. The PCR reaction system is as follows:

[0275] Table 12. PCR reaction system

[0276]

[0277] Place the PCR reaction system in Table 12 in a 200 μL EP tube and put it into a PCR instrument and run the following program to complete PCR amplification: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 15 sec as one cycle. After 30 cycles, final extension was performed at 72°C for 5 min.

[0278] (3) Agarose gel electrophoresis verification

[0279] Take 5 μL of the PCR amplification product of R231Q, add 1 μL of bromophenol blue, and electrophoresed in a 1.2% agarose gel containing 0.5 μg / mL ethidium bromide (EB). Compare the amplified band with the standard DNA molecular weight band. The results are as follows: Figure 8 shown.

[0280] (4) Experimental results

[0281] The present application designs detection primers for the mutation sites of 9 mutated histone methyltransferases DOT1L (I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, R231Q), and selects the R231Q primer for verification. Figure 8 As shown, this primer can be used to detect the R231Q mutation.

[0282] (5) Conclusion

[0283] The present invention successfully constructed primers capable of detecting 9 mutations (I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, and R231Q).

[0284] Experimental Example 3: Effects of 9 mutation sites of histone methyltransferase DOT1L on the malignant phenotype of lung cancer

[0285] 1. Materials

[0286] Cell lines

[0287] Human non-small cell lung cancer cells NCI-H460 were purchased from ATCC;

[0288] 2. Methods

[0289] 1) Cell transfection

[0290] (1) Cell culture: H460 cells with a confluence of 50% were inoculated into a 60 mm culture dish, RPMI-1640 culture medium was used as the basal culture medium, 10% fetal bovine serum was routinely added, and the cells were cultured in a saturated humidity, 37°C, 5% CO2 incubator until the cell confluence reached 70% to 90%. Before transfection, the original culture medium was discarded, the cells were washed twice with PBS, and an appropriate amount of Opti-MEM culture medium was added and placed in the incubator for use.

[0291] (2) Dilute lipofectamine 3000 with Opti-MEM medium according to the multiplication factor. Take 250 μL of Opti-MEM medium, add 8.25 μL of lipofectamine 3000 liposomes and mix thoroughly. Take another 250 μL of Opti-MEM medium, add 8 μg of plasmid and mix thoroughly. Mix the liquids in the above two centrifuge tubes, gently blow and mix, incubate at room temperature for 5 minutes, and allow the DNA-liposome complex to form.

[0292] (3) Transfection: Take out the cells from the incubator, add the DNA-liposome complex prepared in the previous step dropwise into the culture dish, mix gently and place in the incubator. 6 hours after transfection, discard the culture medium and replace it with serum-containing culture medium. Continue to culture for 48 hours in a saturated humidity, 37°C, 5% CO2 incubator. The culture medium can be replaced once during the 48 hours of culture.

[0293] (4) According to the above steps, the plasmids of I232N, Y216C, F243L, A1003G, N241T, E186A, A1003S, S225L, and R231Q prepared in Experimental Example 1, 9 mutant expression vectors, an empty vector, and a wild-type expression vector were transfected respectively, and the above cells were named H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / pCMV6-EntryVector, and H460 / WT cells, respectively.

[0294] 2) MTT assay to detect cell proliferation at different time points

[0295] (1) Inoculation of cells: Take the H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / pCMV6-EntryVector and H460 / WT cells in the logarithmic growth phase in the above step "1) Cell transfection", digest them with trypsin, resuspend the cells in culture medium, count them three times, take the average, and adjust the cell suspension to equal density. Prepare a single cell suspension in culture medium containing 10% serum, and inoculate them in a 96-well plate at a density of 5000 cells / well, 4000 cells / well, 3000 cells / well, and 2000 cells / well, respectively, with 100 μL / well. The cells were cultured in a saturated humidity, 37°C, 5% CO2 incubator for 24h, 48h, 72h, and 96h, respectively.

[0296] (2) Color development: After the time point is reached, 10 μL of MTT solution is added to each well and incubated for 3 to 5 h. The culture is terminated, the supernatant is discarded, and 100 μL of dimethyl sulfoxide solution is added to each well and shaken to dissolve the crystals.

[0297] (3) Colorimetry: Place the 96-well plate in an ELISA reader, detect the OD value of each well at a wavelength of 492 nm, and calculate the cell proliferation rate of each group compared with that of H460 / pCMV6-EntryVector.

[0298] Cell proliferation rate % = average OD value of the test group / (average OD value of the H460 / pCMV6-EntryVector group) × 100%

[0299] 3) Plate cloning experiment

[0300] (1) Take the H460 / I232N, H460 / Y216C, H460 / F243L, H460 / A1003G, H460 / N241T, H460 / E186A, H460 / A1003S, H460 / S225L, H460 / R231Q, H460 / pCMV6-EntryVector and H460 / WT cells in the logarithmic growth phase in the above step "1) Cell transfection", digest the expression vector cells with trypsin, resuspend the cells in culture medium, count 3 times, take the average, and adjust the cell suspension to equal density. Inoculate the cells at a density of 500 cells per well in a six-well plate containing 10% serum culture medium, with 2 mL of complete culture medium per well. During inoculation, shake the culture dish in a cross direction to make the cells as evenly distributed as possible. Culture in a saturated humidity, 37°C, 5% CO2 incubator.

[0301] (2) The cells were cultured in a humidified, 37° C., 5% CO 2 incubator for 2-3 weeks, with the culture medium replaced every 3 days, until colonies were observed under a microscope and each colony consisted of at least 50 cells.

[0302] (3) After the colonies have grown, terminate the cell culture. Discard the culture medium, gently wash the bottom of the 6-well plate 3 times with PBS, discard the PBS, and then fix with 4% paraformaldehyde at room temperature for 15 minutes. After discarding the fixative, wash the bottom of the 6-well plate 3 times with PBS, discard the PBS, add 500μL of 0.2% crystal violet staining solution to each well, and stain at room temperature for 30 minutes. After staining, gently wash off the staining solution with running water (the standard is that the cells are stained and the blank space is clean and transparent), and place it in a ventilated place to dry naturally. Take pictures, and count and analyze (the number of clones with more than 50 cells). The experiment was repeated three times independently, and the mean and variance were taken.

[0303] 4) Scratch test

[0304] (1) The cells from step "1) Cell transfection" were plated in a 24-well plate, with 250,000 cells per well, and cultured in a 37°C incubator overnight.

[0305] (2) Scratch the cells with a gun tip, wash the cells three times with PBS buffer to remove cell debris, and take photos under an inverted microscope, which is recorded as the scratch photo at 0 h. Change to serum-free culture medium (to eliminate the influence of cell proliferation).

[0306] (3) The cells were cultured in an incubator at saturated humidity, 37°C, and 5% CO2, and photographed regularly. Image J software was used to count the scratches of each group of cells, analyze and calculate the scratch area at each time point, and the result image after edge calculation by the software was poured out. Cell migration rate calculation method: Cell migration rate = (scratch area 0h - scratch area 24h) / scratch area 0h × 100%

[0307] 3. Experimental results

[0308] Effects of nine gain-of-function mutations in DOT1L on the malignant phenotype of lung cancer cells

[0309] First, the 9 mutant expression vectors successfully constructed were transfected into H460 cells. Figure 3A As shown in Figure 1, the Western results showed that the target protein of each group of mutant cells was expressed, indicating that the 9 successfully constructed mutant vectors were successfully transfected into the target cells. Then, the substrate level of the successfully constructed target cells was detected (the operation steps were the same as "5) Immunoblotting to examine protein expression" in Experimental Example 1). Figure 3B As shown, Western results showed that H3K79me2 expression was significantly increased in H460 cells transfected with A1003G, E186A, S225L, and R231Q mutations compared with control cells (H460 / WT, H460 / Vector).

[0310] like Figure 3C-Figure 3E As shown, the MTT results showed that the cell proliferation ability of H460 cells transfected with R231Q mutation was significantly enhanced at three time points: 24, 48 and 72 hours compared with the control group cells (H460 / WT, H460 / Vector), indicating that R231Q mutated DOT1L can promote the proliferation of tumor cells to a certain extent.

[0311] like Figure 3E As shown, MTT results showed that the cell proliferation ability of H460 cells transfected with F243L and S225L mutations was significantly enhanced at the 72-hour time point compared with the control group cells (H460 / WT, H460 / Vector).

[0312] Next, the clone-forming ability of cells in each mutant group was examined. Figure 3F As shown, the results of the plate cloning experiment showed that the clone-forming ability of H460 cells transfected with F243L, S225L and R231Q mutations was significantly enhanced compared with the control group cells (H460 / WT, H460 / Vector).

[0313] Finally, the effects of 9 DOT1L mutations on the migration ability of lung cancer cells were investigated. Figure 3G As shown, the scratch assay results showed that compared with the control group cells (H460 / WT, H460 / Vector), the migration ability of H460 cells transfected with I232N, Y216C, F243L, A1003G, N241T, and R231Q mutations was significantly increased.

[0314] 4. Conclusion

[0315] 1. In lung cancer cells transfected with 9 pathological mutations of histone methyltransferase DOT1L, four mutations, A1003G, E186A, S225L, and R231Q, promoted the expression level of the enzyme substrate H3K79me2.

[0316] 2. In lung cancer cells transfected with 9 pathological mutations of histone methyltransferase DOT1L, F243L, S225L, and R231Q mutations can promote the proliferation of tumor cells to a certain extent; F243L, S225L, and R231Q mutations can enhance the cloning ability of lung cancer cells; I232N, Y216C, F243L, N241T, R231Q, and A1003G mutations significantly increase the migration ability of lung cancer cells.

[0317] Experimental Example 4: Effect of DOT1L gain-of-function mutation R231Q on the malignant phenotype of lung cancer cells

[0318] The mutation R231Q, which can significantly promote the malignant phenotype of lung cancer cells, was screened out from the above 9 mutations of DOT1L, and its function was further confirmed.

[0319] (1) Effect of DOT1L pathological mutation R231Q on its substrate levels

[0320] DOT1L is an evolutionarily conserved histone methyltransferase that can methylate lysine 79 (H3K79) of histone H3, and is the only enzyme discovered so far that can methylate H3K79. DOT1L causes changes in cell biological functions by methylating H3K79. The present invention detected the dimethylation level of H3K79 in stable lung cancer cells with pathological mutations (the operating steps are the same as those of "5) Immunoblotting to examine protein expression" in Experimental Example 1) to determine the effect of the R231Q mutation on the function of DOT1L.

[0321] The results are as follows Figure 4A As shown in the figure, in H460 lung cancer cells, the expression of H3K79me2 increased in the mutant group (NCI-H460 / R231Q) compared with the wild-type group (NCI-H460 / WT). This indicates that the DOT1L pathological mutation R231Q enhances the activity of the DOT1L enzyme to a certain extent.

[0322] (2) Effect of DOT1L pathological mutation R231Q on the proliferation ability of lung cancer cells

[0323] Real-time label-free cell analysis (RTCA) was used to detect the real-time changes in the proliferation ability of NCI-H460 / R231Q cells and NCI-H460 / WT cells from 0 to 96 hours.

[0324] Real-time label-free cell analysis (RTCA)

[0325] 1) Assembly of cell proliferation plate E-Plate and baseline measurement

[0326] 1. E-Plate assembly: Take the cell proliferation plate out of the packaging bag in the clean bench, place the fixture on the clean bench, make the blue mark point on the upper left of the fixture, and place it steadily into the corresponding groove of the fixture.

[0327] 2. Add 50 μL of complete culture medium to the cell proliferation plate. Be careful not to generate bubbles when adding liquid. You can use the reverse phase pipetting method. The culture medium of the experimental group contains 10% FBS, and the culture medium of the control group does not contain FBS.

[0328] 3. Tap the plate gently to evenly distribute the culture medium. Place the E-plate in a 37°C, 5% CO2 incubator for 1 hour.

[0329] 4. Baseline measurement: Place the E-plate that has been equilibrated for 1 hour on the RTCA DP Analyzer and start baseline detection.

[0330] 2) Preparation of cell suspension

[0331] Take out the three stable transfected cell lines, H460 blank, DOT1L-WT and DOT1L-R231Q, from the incubator, discard the culture medium, rinse once with PBS, digest with trypsin, centrifuge for 5 minutes, count with an automatic cell counter, and dilute the cells with complete culture medium to a cell density of 3×10 4 cells / ml.

[0332] 3) Inoculation of cells

[0333] The E-plate with the measured baseline was taken out from the instrument, 100 μL of cell suspension was added to the wells, and after being placed in a clean bench at room temperature for 30 minutes, it was placed in the programmed instrument for real-time automatic detection.

[0334] The results are as follows Figure 4B As shown in the figure, compared with wild-type cells (NCI-H460 / WT cells), the proliferation ability of mutant cells (NCI-H460 / R231Q cells) was significantly stronger than that of wild-type cells at any time point, indicating that the R231Q mutation enhances the proliferation ability of cells to a certain extent. However, since the H3K79me2 level of R231Q mutant cells is enhanced, it indicates that the regulation of H3K79me2 by the mutation may affect the proliferation ability of cells.

[0335] (3) Effect of DOT1L pathological mutation R231Q on the clonal formation ability of lung cancer cells

[0336] The clone formation ability is an important indicator for examining the malignancy of lung cancer cells. The present invention investigates the effect of the DOT1L pathological mutation R231Q on the clone formation ability of lung cancer cells by clone formation experiment (the operation steps are the same as "3) plate clone experiment" in Experimental Example 3). The results are as follows Figure 4C As shown, after 7-10 days of culture, the number of colony formation in the H460 / R231Q mutant group cells was significantly increased compared with the wild-type group, suggesting that the pathological mutation R231Q of the histone methyltransferase DOT1L can lead to enhanced tumor cell proliferation ability.

[0337] (4) Effect of DOT1L pathological mutation R231Q on the migration ability of lung cancer cells

[0338] Enhanced cell migration ability is one of the characteristics of increased tumor malignancy. Transwell migration assay is an experimental method to detect cell migration ability. The effect of DOT1L pathological mutation R231Q on the migration ability of lung cancer cells was investigated by cell Transwell migration assay.

[0339] Transwell migration assay

[0340] 1) Transwell chamber preparation

[0341] Take the Transwell chamber out of the package and place it in a new sterile 24-well plate that has been prepared and label it.

[0342] 2) Preparation of cell suspension

[0343] Before preparing the suspensions of the three stable transfected cell lines H460 blank, DOT1L-WT and DOT1L-R231Q, the cells were serum starved for 12-24 hours to further remove the influence of serum. This step is optional. The cells were taken out of the incubator, the original culture medium was discarded, and the cells were rinsed once with PBS. They were digested with 0.25% trypsin, centrifuged for 5 minutes, and counted with an automatic cell counter. The cells were diluted with serum-free culture medium to a cell density of 1×10 6 cells / ml.

[0344] 3) Inoculation of cells

[0345] 1. Take 100 μL of the prepared cell suspension and add it into the Transwell chamber.

[0346] 2. Add 50 μL of serum-containing culture medium to the lower chamber of the 24-well plate. Pay special attention to the fact that bubbles often appear between the lower culture medium and the small chamber. Once bubbles appear, the chemotactic effect of the lower culture medium will be weakened or even disappear. Pay special attention when seeding the plate. Once bubbles appear, lift the small chamber to remove the bubbles and then put the small chamber back into the plate.

[0347] 3. Cultivate cells: routinely culture for 12-48 hours (mainly depending on the migration ability of cancer cells). In addition to considering the migration ability of cells, the influence of treatment factors on the number of cells cannot be ignored when choosing the time point.

[0348] 4) Dyeing

[0349] After the cells were cultured for 48 hours, the chamber was taken out and placed in PBS containing calcein acetyl methyl ester for staining at 37°C for 15-20 minutes. After the staining was completed, the unmigrated cells in the upper chamber were gently wiped with a cotton swab and washed three times with PBS. The cells were observed and counted in five random fields under a fluorescence microscope.

[0350] After 48 hours of culture, 5 fields were randomly selected under a fluorescence microscope to calculate the average number of migrating cells. The statistical results after three biological replicates are as follows Figure 4D As shown: Compared with the wild-type group (NCI-H460 / WT), the number of migrated cells in the H460 mutant group (NCI-H460 / R231Q) increased significantly. The number of migrated cells of NCI-H460 / R231Q, NCI-H460 / WT and H460 / pLVX-puro were 221±4.10%, 195±0.58% and 190±0.58%, respectively; suggesting that the DOT1L pathological mutation R231Q will lead to enhanced migration ability of lung cancer cells.

[0351] in conclusion

[0352] 1. Based on the transient transfection results, the screened gain-of-function gene mutation R231Q can increase the level of H3K79me2, a substrate of DOT1L, which is consistent with the above results.

[0353] 2. The gain-of-function mutation R231Q significantly enhances the proliferation, cloning and migration abilities of lung cancer cells. This mutation can increase the malignant phenotype of lung cancer, which is consistent with the results of transient transfection.

[0354] The experimental results of Experimental Examples 3-4 showed that A1003G, N241T, E186A, S225L, F243L, I232N, Y216C, and R231Q were screened out in the results of transient transfection and can affect the malignant phenotype of lung cancer to a certain extent, and a functional gain-of-function gene mutation R231Q of DOT1L was discovered for the first time; on the basis of transient transfection, a stable lung cancer cell line was established by constructing a lentiviral expression vector, which further confirmed that the R231Q mutation promoted the proliferation, cloning and migration ability of lung cancer cells, suggesting that the R231Q mutation may serve as a new biological marker for lung cancer, and drugs targeting this mutation may be of great significance for the treatment of lung cancer.

[0355] Experimental Example 5: Inhibitory effect of DOT1L small molecule inhibitors on stably expressing DOT1L-R231Q mutation-positive lung cancer cell lines

[0356] 1. Materials

[0357] Cell lines

[0358] Human non-small cell lung cancer cells NCI-H460-R231Q, NCI-H1299-R231Q, NCI-H1975-R231Q, and NCI-H446-R231Q were constructed by our laboratory.

[0359] drug

[0360] DOT1L small molecule inhibitors EPZ004777, SGC0946 (purchased from MCE official website)

[0361] 2. Methods

[0362] 1) Drug preparation

[0363] (1) EPZ004777 (100mM): Weigh an appropriate amount of EPZ004777 white powder on an analytical balance and dissolve it in a certain volume of DMSO to prepare a 100mM stock solution. Filter with a 0.22μm filter membrane and dispense into 200μL centrifuge tubes. Protect from light and avoid repeated freezing and thawing. Store at -20℃. Dilute to the required concentration with complete culture medium before use. Ensure that the final concentration of DMSO in the drug solution in the complete culture medium does not exceed 0.1%. This drug is relatively insoluble and is generally heated in a water bath to dissolve it before use.

[0364] (2) SGC0946 (100 mM): Weigh an appropriate amount of SGC0946 white powder using an analytical balance and dissolve it in a certain volume of DMSO to prepare a 100 mM stock solution. Filter through a 0.22 μm filter membrane and dispense into 200 μL centrifuge tubes. Protect from light and avoid repeated freezing and thawing. Store at -20°C. Dilute to the required concentration with complete culture medium before use. Ensure that the final concentration of DMSO in the drug solution does not exceed 0.1% in the complete culture medium.

[0365] 2) Clone formation experiment

[0366] The operation steps are the same as those of the plate cloning experiment in Experiment 3.

[0367] 3) Dosing treatment

[0368] After the clones have stabilized for 48 hours, add the prepared drugs to the culture dish at the required concentration, change the solution and add drugs every 48 hours. When obvious clones appear in the blank group, observe the clone formation under a microscope. The appropriate size of each clone is 50 cells.

[0369] 3. Experimental results

[0370] 1) Inhibitory effect of EPZ004777 on R231Q mutant cells

[0371] The ability to form clones is an important indicator for examining the proliferation of lung cancer cells. Since small molecule inhibitors usually take a long time to take effect, the clone formation experiment was mainly used in the experimental example to examine the inhibitory effect of small molecule inhibitors on lung cancer cells with DOT1L mutations. Figure 5A-5D As shown, the mutant cells were replaced with liquid and drugs were added every two days. After 7-10 days of culture, the number of colony formation in the four lung cancer cell groups with different drug additions decreased compared with the control group. Among them, in NCI-H460 and NCI-H1975 mutant cells, the inhibitory effect was best when the drug concentration was 30μM; in NCI-H1299 mutant cells, the strongest inhibitory concentration was 25μM; and in NCI-H446 mutant cells, the strongest inhibitory concentration was 10μM. From the above results, it can be concluded that the small molecule inhibitor EPZ004777 has a certain inhibitory effect on lung cancer mutant cells, but the inhibitory effect does not increase with the increase of its concentration, and the optimal inhibitory concentration is different in each type of lung cancer mutant cells.

[0372] 2) Inhibitory effect of SGC0946 on R231Q mutant cells

[0373] The clone formation ability is an important indicator for examining the proliferation of lung cancer cells. Since small molecule inhibitors usually take a long time to take effect, this chapter mainly uses clone formation experiments to examine the inhibitory effect of small molecule inhibitors on lung cancer cells with DOT1L mutations. Figure 5E-Figure 5H As shown, the mutant cells were replaced with liquid and drugs were added every two days. After 7-10 days of culture, the number of colony formation in the four lung cancer cell groups with different drug additions decreased compared with the control group. In these four mutant lung cancer cells, the small molecule inhibitor SGC0946 had a more obvious inhibitory effect on them, and showed a dose-dependent inhibition of the proliferation of the four mutant cells. Among them, in NCI-H460 mutant cells, when the drug concentration was 15μM, the mutant cells were significantly inhibited; in NCI-H1975 and NCI-H446 mutant cells, the mutant cells were significantly inhibited at a drug concentration of 20μM; and in NCI-H1299 mutant cells, SGC0946 also showed a good inhibitory effect, and the inhibitory effect was strongest at a drug concentration of 30μM. From the above results, it can be concluded that the small molecule inhibitor SGC0946 has a strong inhibitory effect on lung cancer mutant cells, and inhibits the proliferation of mutant cells in a dose-dependent manner.

[0374] 4. Conclusion

[0375] 1. The DOT1L small molecule inhibitor EPZ004777 has a strong inhibitory effect on stably transfected lung cancer cell lines that stably express the DOT1L-R231Q mutation.

[0376] 2. The DOT1L small molecule inhibitor SGC0946 has a significant inhibitory effect on stably expressed DOT1L-R231Q mutation lung cancer cell lines, and exhibits dose-dependent inhibition of the proliferation of mutant cells.

[0377] Experimental Example 6: Selecting 7 mutation sites of histone methyltransferase DOT1L to investigate their effects on the proliferation of various malignant tumor cells

[0378] 1. Materials

[0379] Cell lines

[0380] Human breast cancer cell MCF-7 (purchased from ATCC); human prostate cancer cell PC-3 (purchased from ATCC); human liver cancer cell Hep-3B (purchased from ATCC); human colon cancer cell Colo-205 (purchased from ATCC); human gastric cancer cell AGS (purchased from ATCC); human glioma cell U251 (purchased from ATCC)

[0381] 2. Methods

[0382] 1) Cell transfection

[0383] (1) Cell culture: Inoculate cells with a confluence of 50% in a 60 mm culture dish, use RPMI-1640 culture medium as the basal culture medium, add 10% fetal bovine serum, and culture in a saturated humidity, 37°C, 5% CO2 incubator until the cell confluence reaches 70% to 90%. Before transfection, discard the original culture medium, wash twice with PBS, add an appropriate amount of Opti-MEM culture medium, and place in the incubator for use.

[0384] (2) Dilute lipofectamine 3000 with Opti-MEM medium according to the multiplication factor. Take 250 μL of Opti-MEM medium, add 8.25 μL of lipofectamine 3000 liposomes and mix thoroughly. Take another 250 μL of Opti-MEM medium, add 8 μg of plasmid and mix thoroughly. Mix the liquids in the above two centrifuge tubes, gently blow and mix, incubate at room temperature for 5 minutes, and allow the DNA-liposome complex to form.

[0385] (3) Transfection: Take out the cells from the incubator, add the DNA-liposome complex prepared in the previous step dropwise into the culture dish, mix gently and place in the incubator. 6 hours after transfection, discard the culture medium and replace it with serum-containing culture medium. Continue to culture for 48 hours in a saturated humidity, 37°C, 5% CO2 incubator. The culture medium can be replaced once during the 48 hours of culture.

[0386] (4) According to the above steps, plasmids of I232N, Y216C, F243L, N241T, S225L, R231Q, A1003S, 7 mutant expression vectors, empty vector and wild-type expression vector were transfected respectively.

[0387] 2) MTT assay to detect cell proliferation at different time points

[0388] (1) Inoculation of cells: Take cells in the logarithmic growth phase, digest them with trypsin, resuspend the cells in culture medium, count them three times, take the average, and adjust the cell suspension to equal density. Use culture medium containing 10% serum to make a single cell suspension, and inoculate them in a 96-well plate at a density of 5000 cells / well, 4000 cells / well, 3000 cells / well, and 2000 cells / well, respectively, with 100 μL / well. Culture them in a saturated humidity, 37°C, 5% CO2 incubator for 24h, 48h, 72h, and 96h.

[0389] (2) Color development: After the time point is reached, 10 μL of MTT solution is added to each well and incubated for 3 to 5 h. The culture is terminated, the supernatant is discarded, and 100 μL of dimethyl sulfoxide solution is added to each well and shaken to dissolve the crystals.

[0390] (3) Colorimetry: The 96-well plate was placed in an ELISA reader, and the OD value of each well was detected at a wavelength of 492 nm. The cell proliferation rate of each group was calculated compared with that of the pCMV6-DOT1L wild type (WT).

[0391] Cell proliferation rate % = average OD value of the test group / (average OD value of the pCMV6-DOT1L wild-type group) × 100%

[0392] 3. Experimental results

[0393] Effects of seven gain-of-function mutations of DOT1L on the proliferation of various malignant tumor cells (breast cancer, prostate cancer, liver cancer, colon cancer, gastric cancer and glioma cells)

[0394] like Figure 6A-6C As shown, the MTT results showed that the cell proliferation ability of cells transfected with I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003S mutations was significantly enhanced at 72 hours compared with the control group cells, indicating that the above-mentioned DOT1L mutations can promote the proliferation of tumor cells to a certain extent.

[0395] 4. Conclusion

[0396] In tumor cells transfected with 9 pathological mutations of histone methyltransferase DOT1L, I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003S mutations can promote tumor cell proliferation to a certain extent.

[0397] Although the above has been described in detail with general descriptions and specific implementation schemes for the possibility of using DOT1L mutation sites as biomarkers for detection in lung cancer and as therapeutic drug targets for treating lung cancer, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0398] Industrial Applicability

[0399] The DOT1L pathological mutation provided by the present invention can be used as a tumor biomarker for diagnosis, prognosis and drug judgment, and can be used as a therapeutic target for various malignant tumors. Sequence Listing <110> Shenyang Pharmaceutical University <120> Application of DOT1L mutation as a cancer biomarker and therapeutic target <130> 6660-2053482I <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> DOT1L Forward <400> 1 gaggcgatcg ccatggggga gaa 23 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DOT1L Reverse <400> 2 gcgacgcgtg ttacctccaa ctga 24 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-I232N-F1 <400> 3 gaaacgccaa cacgagtgtt atatttgtga at 32 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-I232N-R1 <400> 4 actcgtgttg gcgtttcgct ccctccactc ttctg 35 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-Y216C-F1 <400> 5 tgcagaatgc acattggaga gaggcgattt cc 32 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-Y216C-R1 <400> 6 ccaatgtgca ttctgcatgc tttttttcat acca 34 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-F243L-F1 <400> 7 taatctggcc tttggtcctg aggtggatca cc 32 <210> 8 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-F243L-R1 <400> 8 gaccaaaggc cagattattc acaaatataa cactcgtgtt gg 42 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-N241T-F1 <400> 9 ttgtgaccaa ttttgccttt ggtcctgagg tg 32 <210> 10 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-N241T-R1 <400> 10 ggcaaaattg gtcacaaata taacactcgt gttggcg 37 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-E186A-F1 <400> 11 actatggcgt cgccaaagca gacatcccgg cc 32 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-E186A-R1 <400> 12 tttggcgacg ccatagtgat gtttgcagtt gg 32 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-S225L-F1 <400> 13 tttcctcctg gaagagtgga gggagcgaat cg 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-S225L-R1 <400> 14 actcttccag gaggaaatcg cctctctcca at 32 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-F1 <400> 15 agggagcagc agatcgccaa cacgagtgtt atattt 36 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-R1 <400> 16 ttggcgatct gctccctcca ctcttctgag agga 34 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003S-F1 <400> 17 tctcccagcc accagctctc ctccagtccc cg 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003S-R1 <400> 18 agctggtggc tgggagaggc aggaagcgag tt 32 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003G-F1 <400> 19 tctcccggcc accagctctc ctccagtccc cg 32 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003G-R1 <400> 20 agctggtggc cgggagaggc aggaagcgag tt 32 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-Forward <400> 21 ccgctcgaga tgggggagaa gctggagc 28 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-Reverse <400> 22 cggaattctt acttcttggg gcgcccgcg 29 <210> 23 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-WT-Forward <400> 23 ccgctcgaga tgggggagaa gctggagc 28 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-WT- Reverse <400> 24 cggaattctt acttcttggg gcgcccgcg 29 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-I232N-F2 <400> 25 cagaagagtg gagggagcga aacgccaa 28 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-I232N-R2 <400> 26 aatataacac tcgtgttggc gtttcgct 28 <210> 27 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-Y216C-F2 <400> 27 atgaaaaaaa gcatgcagaa tgcacatt 28 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-Y216C-R2 <400> 28 aaatcgcctc tctccaatgt gcattctg 28 <210> 29 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-F243L-F2 <400> 29 gtgttatatt tgtgaataat ctggcctt 28 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-F243L-R2 <400> 30 tccacctcag gaccaaaggc cagattat 28 <210> 31 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-N241T-F2 <400> 31 acacgagtgt tatatttgtg accaattt 28 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-N241T-R2 <400> 32 tcaggaccaa aggcaaaatt ggtcacaa 28 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-E186A-F2 <400> 33 gcaaacatca ctatggcgtc gccaaagc 28 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-E186A-R2 <400> 34 ttggccggga tgtctgcttt ggcgacgc 28 <210> 35 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-S225L-F2 <400> 35 tggagagagg cgatttcctc ctggaaga 28 <210> 36 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-S225L-R2 <400> 36 attcgctccc tccactcttc caggagga 28 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-F2 <400> 37 tctcagaaga gtggagggag cagatcgc 28 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-R231Q-R2 <400> 38 ataacactgt gttggcgatt cgctccc 27 <210> 39 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003S-F2 <400> 39 actcgcttcc tgcctctccc agccacca 28 <210> 40 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003S-R2 <400> 40 ggactggagg agagctggtg gctgggag 28 <210> 41 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003G-F2 <400> 41 actcgcttcc tgcctctccc ggccacca 28 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> DOT1L-A1003G-R2 <400> 42 ggactggagg agagctggtg gccgggag 28

Claims

1. Use of primers for detecting molecular markers in the preparation of reagents for cancer diagnosis and prognosis detection, wherein the histone methyltransferase DOT1L mutates at a pathological mutation site, causing a malignant phenotype of cancer cells, the molecular marker is a pathological mutation site located in the DOT region of the functional active domain of the histone methyltransferase DOT1L, the pathological mutation site is selected from one or more of I232N, Y216C, F243L, N241T, E186A, S225L, R231Q, A1003S, A1003G, and the cancer is lung cancer; The nucleotide sequences of the primers used to detect I232N are shown in SEQ ID NO.25 and SEQ ID NO.26; The nucleotide sequences of the primers used to detect Y216C are shown in SEQ ID NO.27 and SEQ ID NO.28; The nucleotide sequences of the primers used to detect F243L are shown in SEQ ID NO.29 and SEQ ID NO.30; The nucleotide sequences of the primers used to detect N241T are shown in SEQ ID NO.31 and SEQ ID NO.32; The nucleotide sequences of the primers used to detect E186A are shown in SEQ ID NO.33 and SEQ ID NO.34; The nucleotide sequences of the primers used to detect S225L are shown in SEQ ID NO.35 and SEQ ID NO.36; The nucleotide sequences of the primers used to detect R231Q are shown in SEQ ID NO.37 and SEQ ID NO.38; The nucleotide sequences of the primers used to detect A1003S are shown in SEQ ID NO.39 and SEQ ID NO.40; The nucleotide sequences of the primers used to detect A1003G are shown in SEQ ID NO.41 and SEQ ID NO.

42.

2. The use according to claim 1, wherein the pathological mutation site is selected from one or more of I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003G.

3. The use according to claim 1, wherein the pathological mutation site is selected from one or more of F243L, S225L, and R231Q.

4. The use according to claim 1, wherein the pathological mutation site is selected from R231Q.

5. The use according to any one of claims 1 to 4, wherein the mutations of E186A, S225L, R231Q, and A1003G promote the expression level of H3K79me2, an enzyme substrate of histone methyltransferase DOT1L, The mutations of I232N, Y216C, F243L, E186A, S225L, R231Q, and A1003S enhance the proliferation ability of cancer cells. The mutations of F243L, S225L, and R231Q enhance the cloning ability of cancer cells. The mutations of I232N, Y216C, F243L, N241T, R231Q, and A1003G increase the migration ability of cancer cells. The R231Q mutation is a gain-of-function gene mutation.

6. A primer for detecting the molecular marker according to any one of claims 1 to 4, characterized in that: The primers include: The nucleotide sequences of the primers used to detect I232N are shown in SEQ ID NO.25 and SEQ ID NO.26; The nucleotide sequences of the primers used to detect Y216C are shown in SEQ ID NO.27 and SEQ ID NO.28; The nucleotide sequences of the primers used to detect F243L are shown in SEQ ID NO.29 and SEQ ID NO.30; The nucleotide sequences of the primers used to detect N241T are shown in SEQ ID NO.31 and SEQ ID NO.32; The nucleotide sequences of the primers used to detect E186A are shown in SEQ ID NO.33 and SEQ ID NO.34; The nucleotide sequences of the primers used to detect S225L are shown in SEQ ID NO.35 and SEQ ID NO.36; The nucleotide sequences of the primers used to detect R231Q are shown in SEQ ID NO.37 and SEQ ID NO.38; The nucleotide sequences of the primers used to detect A1003S are shown in SEQ ID NO.39 and SEQ ID NO.40; The nucleotide sequences of the primers used to detect A1003G are shown in SEQ ID NO.41 and SEQ ID NO.

42.

7. A kit for detecting the molecular markers according to any one of claims 1 to 4, characterized in that: The kit comprises the primers according to claim 6.

Images