Controlling flowering of plants

Abstract

The present invention relates to plants and plant parts with altered flower sex (FSL) polypeptide activity levels, and methods for controlling plant flower sex phenotypes based on altered FSL polypeptide activity and / or FSL locus genotype. Also provided are novel plants producing seed abortive and / or parthenocarpic seedless fruits and methods for producing the same.

Description

[0001] Related application data

[0002] This application claims priority to Australian Provisional Application No. 2019902304 filed on June 28, 2019 and Australian Provisional Application No. 2019902483 filed on July 12, 2019, the entire contents of each of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention relates to plants and plant parts with altered flower sex (FSL) polypeptide activity levels, and methods for controlling plant flower sex phenotypes based on altered FSL polypeptide activity and / or FSL locus genotype. Also provided are novel plants producing seed abortive and / or parthenocarpic seedless fruits and methods for producing the same. Background Art

[0004] Flower Gender

[0005] Wild grapevine plants, sometimes called wine grapes (Vitis sylvestris), are dioecious, meaning that the plant has either male or female flowers. Wild plant flowers produce large numbers of small clusters of flowers once they reach the top of the canopy and are exposed to strong light (Carmona et al., 2008). The berries produced by wild grapevine female plants are small and in small clusters. Unisexual flowers produced by Vitis species still have atrophic tubes of the opposite sex. Cultivated grapevine plants are hermaphroditic. Commercial vineyards have plants with hermaphroditic flowers, where self-fertilization (autopollination) is believed to be the primary route of pollination.

[0006] The sex of flowers is identified by observing the physical characteristics of mature plants and even subsequent mature flowers that are required for flowering. Male flowers have erect stamens, viable pollen, and small, non-functional carpels that are rudimentary. Hermaphroditic flowers have erect stamens, viable pollen, and functional carpels. Female flowers are characterized by functional carpels and reflexed stamens and sterile pollen that does not germinate (Carmona et al. 2008). Dioecious plants with only female flowers generally have lower commercial value for fruit production because they require nearby male or hermaphroditic plants to provide pollen to set fruit (Battilana et al., 2013). Flower type follows a bisexual developmental pattern in the early stages of flower development, producing unisexuality through organ abortion in the late stages, when maturation of all floral organs occurs (Pannell, 2017), which seems to apply to flowering plants and is assumed to have evolved with the origin of flowers (Chanderbali et al., 2010).

[0007] The sex of flowers remains of commercial interest because it can be a problem for breeding as well as production and crop yield (e.g., seed collection or fruit size, fruit yield per plant). In some species, the ratio of female to male flowers is a cause of low yield (Mao et al. 2017—in Vernicia fordii (tung oil tree)). Corn (Zea mays), cucumber (Cucumis sativus) and melon (Cucumis melo) are monoecious plants that have undergone significant research and development (Tanurdzic and Banks 2004) to become important crops for food and feed. Dioecious plants with male and female flowers on different plants include Silene latifolia, papaya (Caricapapaya), Cannabis sativa (Cannabis sativa) and Mercurialis annua (Mao et al., 2017).

[0008] The sex of plant flowers can be influenced or controlled by environmental conditions, genetic mutations, or hormone application, so the sexual identity of plants is considered to be quantitative (Pannell 2017). In the Cucurbitaceae family, sex expression is controlled by a network of genetic, hormonal, and environmental factors. Cucumber (Cucumis sativus) is a crop that has been bred to be all-female to increase yield by producing only female flowers. Sex expression is thought to be controlled by the F locus, which regulates the expression of female flowers, and the M locus, which is thought to regulate the expression of bisexual flowers (Yamasaki et al., 2001). Sex expression can be regulated by plant hormones such as ethylene and environmental stimuli. In watermelon, the all-female (gy), androecium (a), and trisexual (tm) loci control the inheritance of sexual forms (Ji et al., 2015). At the genetic level, sex determination in cucumber, melon, and watermelon is controlled by a combination of three pairs of genes. Monoecious cucumber is controlled by the 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, which is specifically expressed in carp and is involved in the arrest of stamen development in female flowers (Manzano et al., 2011). This gene and its family members similarly control flower sex in watermelon with the rate-limiting enzyme in ethylene biosynthesis (Ji et al., 2016), resulting in loss of function in bisexual flowers (CsACS11 / CsACS2) or promoting female flowers (CsACS1G) and interacting with transcription factors (CmWIP1) to affect plant expression of all-female or hermaphroditic flowers (Ji et al., 2017).

[0009] The ethylene biosynthetic enzyme 1-aminocyclopropane-1-carboxylic acid synthase (ACS) plays a key role in influencing the expression of female flowers in monoecious, andromonoecious, and gynomonoecious cucumber plants (Yamasaki et al. 2000; Yamasaki et al. 2001). CS-ACS2 was found to be expressed only in gynomonoecious cucumber plants and is responsible for causing higher levels of ethylene production and is regulated by the F locus (Yamasaki et al. 2001). Ethylene is the main hormone that promotes the development of female flowers in melon and cucumber, while gibberellins have the opposite effect in these plants (Yamasaki et al. 2005). In contrast to its feminizing effect on cucurbit species (cucumber, melon, and pumpkin), ethylene has a masculinizing effect in watermelon (Manzano et al., 2011). Jie et al. (2017) further demonstrated the effects of ethylene and ethylene competitors, gibberellins and silver nitrate, in different genetic backgrounds of watermelon compared to the published responses in cucumber. These results suggest that hormone production and responses have significant interactions and dependence on plant genetics, but this remains to be fully elucidated (Jie et al. 2017).

[0010] Controlling or changing the sex of flowers has practical applications in breeding and developing hybrids or populations. Since Peterson and Anhder (1960) reported the masculinizing effect of gibberellins in cucumber, it has been widely used to maintain all-female breeding lines and produce seeds in all-female cucumber cultivars. Such all-female inbred lines reduce breeding and development costs and can maintain or provide yield improvements and seed quality.

[0011] Although the determinants of sexual phenotypes are diverse, it remains unclear whether changes in the expression of these genes are the cause or consequence of organ sex determination. It is therefore necessary to show whether specific males of female development are downstream regulators of master sex control genes. In Vitis, hormones can alter flower sexual development, and cytokinins have been shown to play a major role in this process (Negi and Olmo, 1966, 1971; Zhang et al., 2013).

[0012] In grapevines of the genus Vitis, the location of the floral sex locus to linkage group 2 (LG2) was previously proposed by Dalbo et al. (2000) and Riaz et al. (2006) to be located on chromosome 2 close to the genetic marker VviS3. This was confirmed by Chaib et al. (2010) in microvine and microvine populations. Fetcher et al., (2012) identified VviAPRT, encoding an adenine phosphoribosyltransferase, as a marker to distinguish between female and male / hermaphroditic plants. Fetcher et al., (2012) predicted 11 genes and reported that adenine phosphoribosyltransferase (APRT, now called APRT3) has a key role in determining the sex of grapevine flowers and that its expression is consistent with female flowers. However, Coito et al. (2017) found that APRT3 distinguished between male and female as well as hermaphroditic plants, proposing a model that includes a third unknown gene. Gibberellic acid (GA) is considered to be an ethylene competitor that promotes the production of male flowers and inhibits the development of female flowers in cucumber (Friedlander et al., 1977).

[0013] Although many candidate genes have been proposed as genetic controllers of flower sex in grapevine, the genes controlling flower sex remain unknown.

[0014] Seedless grapes

[0015] "Seedless" table grape varieties produce seedless fruit due to flower fertilization and seed development, but stop development at an early stage (i.e., abortion), leaving only traces of seeds in the fruit. Mutation loci (either heterozygous or homozygous) in the grape MADS-box protein 5 (VvMADS5, also known as VviAGL11) gene are closely associated with seedless fruit (SDL1) in grapevines. This mutation has a G to T substitution at 590 bp in the coding sequence, resulting in an Arg-197Leu substitution, and has recently been hypothesized to be associated with the seed abortion-type seedless phenotype (Royo et al., 2018).

[0016] Although the genetic control of seed-aborting seedless grapes that produce seed scars after pollination is thought to be due to mutations in the MADS5 gene (SDL1), the genetic control of parthenocarpic seedless berry development in grapevines is unknown or not understood.

[0017] Micro vines

[0018] The inventors (Boss and Thomas, Nature, 2002) described the development of dwarf grape plants (called microvines) with a fast flowering phenotype and a SNP in the grapevine GA insensitivity gene (VvGAI1). The single nucleotide difference from T to A between VvGAI1 and Vvgai1 is at position 231 in the translated region. The point mutation present in the VvGAI1 allele converts a leucine residue of the conserved DELLA domain to a histidine. The mutant gene, the gibberellic acid insensitivity gene, is dominant (in either the heterozygous (GAI1 / gai1) or homozygous state (GAI1 / GAI1)), resulting in a dwarf and fast flowering phenotype.

[0019] Grapevine breeding and improvement

[0020] For grapevine improvement, there is a need to modify and be able to control the sex of flowers for breeding purposes to combine or maintain favorable phenotypic traits. For table grape breeding and production, it is desirable to produce true parthenocarpic seedless fruit that does not produce seed traces. For urban / indoor farming and cover farming, it is desirable to have a dwarf table grape option that can be grown at high density and produce seedless fresh fruit. Summary of the invention

[0021] The present invention is based, at least in part, on the surprising discovery of the inventors that a locus known as the floral sex (FSL) locus is responsible for floral sex in angiosperms such as grapevines, and that different FSL locus genotypes and polypeptides expressed thereby can be used to determine, control and / or select for floral sex phenotypes, i.e., female, male or hermaphroditic floral phenotypes, respectively. The inventors have characterized the FSL locus as being responsible for male organ development, behaving similarly to the floral sex determination model of Sp in Oberles 1938, i.e., in Vitis species. It is dominant in males and hermaphrodites. In females, the locus is recessive and non-functional. The inventors have also demonstrated 100% concordance between female (fsl / fsl) and hermaphroditic (FSL / fsl or FSL / FSL) genotypes between single nucleotide polymorphisms (SNPs) within the plant AT-rich sequence and zinc binding (PLATZ) domain of the FSL locus and the respective floral sex phenotypes. Wine grapes

[0022] Thus, in a first aspect, the present invention provides plants or parts thereof having altered levels of floral sex (FSL) polypeptide activity compared to corresponding plants or parts thereof having a genotype of a FSL locus conferring a male or hermaphroditic floral phenotype.

[0023] In one example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a corresponding plant or part thereof having a FSL locus genotype that confers a hermaphroditic floral phenotype. In one example, the FSL locus genotype that confers a hermaphroditic floral phenotype includes a hermaphroditic allele of the FSL locus. In one example, the FSL polypeptide encoded by the hermaphroditic allele of the FSL locus includes the amino acid sequence set forth in SEQ ID NO: 1, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO: 1. For example, the FSL polypeptide encoded by the hermaphroditic allele of the FSL locus may include an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 96% identity to the sequence set forth in SEQ ID NO: 1. For example, the FSL polypeptide may include an amino acid sequence having at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO: 1. In each of the foregoing examples describing an exemplary FSL polypeptide comprising an amino acid sequence having a level of identity to the sequence set forth in SEQ ID NO: 1, the FSL polypeptide can be an ortholog of the FSL polypeptide set forth in SEQ ID NO: 1. In a specific example, the FSL polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 1.

[0024] In one example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a corresponding plant or part thereof having a FSL locus genotype that confers a male flower phenotype. In one example, the FSL locus genotype that confers a male flower phenotype includes a male allele of the FSL locus. In one example, the FSL polypeptide encoded by the hermaphroditic allele of the FSL locus includes the amino acid sequence set forth in SEQ ID NO:3, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO:3. For example, the FSL polypeptide from the male allele of the FSL locus may include an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 96% identity to the sequence set forth in SEQ ID NO:3. For example, the FSL polypeptide may include an amino acid sequence having at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO:3. In each of the foregoing examples describing an exemplary FSL polypeptide comprising an amino acid sequence having a level of identity to the sequence set forth in SEQ ID NO: 3, the FSL polypeptide can be an ortholog of the FSL polypeptide set forth in SEQ ID NO: 3. In a specific example, the FSL polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 3.

[0025] In one example, a plant or part thereof includes a FSL locus comprising a polynucleotide sequence encoding a FSL polypeptide, wherein the polynucleotide sequence is modified relative to a corresponding polynucleotide sequence of a wild-type FSL locus allele that confers a male flower or a hermaphroditic flower phenotype when expressed. For example, a polynucleotide sequence encoding a FSL polypeptide can be modified relative to a corresponding polynucleotide sequence of a wild-type hermaphroditic allele of the FSL locus. For example, a polynucleotide sequence encoding a FSL polypeptide can be modified relative to a corresponding polynucleotide sequence of a wild-type male allele of the FSL locus. In some examples, a region of a polynucleotide sequence encoding a plant AT-rich sequence and a zinc binding (PLATZ) domain of the FSL locus can be modified, for example, relative to a polynucleotide sequence encoding a corresponding wild-type PLATZ domain. In one example, a polynucleotide sequence encoding a wild-type PLATZ domain encodes an amino acid sequence set forth as residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1. In one example, the polynucleotide sequence encoding the FSL polypeptide includes one or more nucleotide additions, deletions or substitutions relative to the corresponding polynucleotide sequence of the wild-type FSL locus allele, which when expressed confers a male or hermaphroditic floral phenotype, such as one or more nucleotide additions, deletions or substitutions in the sequence encoding the PLATZ domain. For example, the polynucleotide sequence encoding the FSL polypeptide may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotide additions, deletions or substitutions relative to the ORF sequence shown in SEQ ID NO: 6 or 7, such as between positions 153 and 189 (or one or more corresponding nucleotide positions in the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between positions 153 and 189 (or one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the ORF sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more Ts (e.g., T, TT, or TTT) deleted between positions 155 and 159 relative to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or one or more Ts deleted at one or more corresponding nucleotide positions in the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more Ts (e.g., T, TT, or TTT) added between positions 155 and 159 relative to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or one or more Ts added at one or more corresponding nucleotide positions in the corresponding genomic sequence). In some examples, the polynucleotide sequence encoding the FSL polypeptide has been gene-edited.

[0026] In some examples, the FSL polypeptide encoded by the modified polynucleotide sequence includes one or more amino acid additions, deletions or substitutions relative to the FSL polypeptide encoded by the corresponding wild-type FSL locus allele (e.g., the result of one or more nucleotide additions, deletions or substitutions of the encoding polynucleotide sequence). For example, a plant or part thereof can include a FSL polypeptide that includes one or more amino acid additions, deletions or substitutions in a PLATZ domain relative to the corresponding amino acid sequence encoded by the corresponding wild-type FSL locus allele. In one example, the PLATZ domain encoded by the corresponding wild-type FSL locus allele includes the amino acid sequence of residue 26 to residue 75 of the sequence shown in SEQ ID NO: 1. In some examples, the FSL polypeptide is truncated. In some examples, the FSL polypeptide or its domain, such as the PLATZ domain, is absent from the plant or part thereof.

[0027] In some examples, the plant or part thereof includes an RNA interference (RNAi) agent that targets a messenger RNA (mRNA) of the FSL locus, thereby reducing FSL polypeptide activity in the plant or part thereof compared to a corresponding plant or part thereof that does not include the RNAi agent. According to examples in which the plant or plant part includes an RNAi agent, the plant or part thereof can be transfected with a construct for expressing the RNAi agent (e.g., an expression vector that expresses the RNAi agent) and / or has been integrated into its genome. The RNAi agent can be any RNAi agent known in the art or described herein.

[0028] In one example, the corresponding wild-type FSL locus allele is a hermaphroditic allele of the FSL locus. According to this example, the ORF of the corresponding wild-type FSL locus allele can include the polynucleotide sequence set forth in SEQ ID NO:6, a sequence having at least 60% identity thereto, or an orthologous sequence thereof corresponding to a plant species. In one example, the ORF of the corresponding wild-type FSL locus allele includes a sequence having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO:6. In each of the foregoing examples describing the ORF of the corresponding wild-type FSL locus allele, the allele includes a sequence having a percentage level identity relative to the sequence set forth in SEQ ID NO:6, and the wild-type FSL locus allele can be an ortholog of the sequence set forth in SEQ ID NO:6. In this regard, the sequence shown in SEQ ID NO:6 represents the ORF of the hermaphroditic allele of the FSL locus of Vitus vinifera. In a specific example, the ORF of the corresponding wild-type FSL locus allele includes the sequence shown in SEQ ID NO:6.

[0029] In another example, the corresponding wild-type FSL locus allele is a male allele of the FSL locus. According to this example, the ORF of the corresponding wild-type FSL locus allele can include the polynucleotide sequence set forth in SEQ ID NO:7, a sequence having at least 60% identity thereto, or an orthologous sequence thereof corresponding to a plant species. In one example, the ORF of the corresponding wild-type FSL locus allele includes a sequence having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO:6. In each of the foregoing examples describing the ORF of the corresponding wild-type FSL locus allele, the allele includes a sequence having a percentage level identity relative to the sequence set forth in SEQ ID NO:7, and the wild-type FSL locus allele can be an ortholog of the sequence set forth in SEQ ID NO:7. In this regard, the sequence shown in SEQ ID NO:7 represents the ORF of the male allele of the FSL locus of Vitus vinifera. In a specific example, the ORF of the wild-type FSL locus includes the sequence shown in SEQ ID NO:7.

[0030] In one example, the corresponding wild-type FSL locus allele includes a polynucleotide sequence encoding a PLATZ domain, the PLATZ domain including an amino acid sequence from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1, or an amino acid sequence having at least 70% identity thereto. For example, the corresponding wild-type FSL locus allele may include a sequence encoding a PLATZ domain including an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96% identity, at least 97% identity, at least 98% or at least 99% identity to an amino acid sequence from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1. In a specific example, the corresponding wild-type FSL locus allele includes a sequence encoding a PLATZ domain including an amino acid sequence from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1.

[0031] In some examples, the FSL polypeptide activity in a plant or plant part is reduced relative to the level of FSL polypeptide activity in a corresponding wild-type plant or part thereof. For example, the FSL polypeptide activity in a plant or plant part may be reduced by at least 10% relative to the level of FSL polypeptide activity in a corresponding wild-type plant or part thereof. For example, the FSL polypeptide activity in a plant or plant part may be reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the level of FSL polypeptide activity in a corresponding wild-type plant or part thereof.

[0032] In each of the above examples, the FSL polypeptide activity can be reduced relative to the level of FSL polypeptide activity in a corresponding plant or part thereof comprising a male or hermaphroditic allele of the FSL locus. For example, the FSL polypeptide activity can be reduced relative to the level of FSL polypeptide activity in a corresponding hermaphroditic wild-type plant or part thereof, or relative to the level of FSL polypeptide activity in a corresponding male wild-type plant or part thereof.

[0033] In each of the foregoing examples describing a plant or plant part having a reduced level of FSL polypeptide activity, the reduced FSL polypeptide activity can be caused by a corresponding reduction in the expression of the FSL polypeptide relative to the expression level of the corresponding wild-type plant or part thereof. Alternatively or additionally, the reduced FSL polypeptide activity can be caused by a corresponding reduction in the expression of the FSL locus mRNA relative to the expression level of the corresponding wild-type plant or part thereof.

[0034] In some examples, FSL polypeptide activity is eliminated in a plant or plant part. For example, FSL polypeptide expression can be completely inhibited or the FSL locus encoding the FSL polypeptide can be knocked out in a plant or part thereof.

[0035] In one example, the alteration of the activity of the FSL polypeptide in a plant or part thereof results in the absence or non-function of the male reproductive parts of the plant's flowers. For example, a decrease in the activity of the FSL polypeptide described herein can result in the absence or non-function of the male reproductive parts of the plant's flowers or plant parts. In some examples, the male reproductive parts of the flowers are present but non-functional due to the altered (e.g., decreased) activity of the FSL polypeptide. The non-functional male reproductive parts of the flowers may be underdeveloped due to the altered (e.g., decreased) activity of the FSL polypeptide, resulting in them being non-functional.

[0036] In some examples, the plants produce male sterile flowers.

[0037] The present invention also provides plants or parts thereof having a reduced level of FSL polypeptide activity that produces phenotypically female flowers, wherein the level of FSL polypeptide activity is reduced compared to a plant or plant part that produces flowers that include functional male reproductive parts. In some examples, the plant or plant part can be a plant or plant part having an altered level of FSL polypeptide activity as described herein, for example, an altered level of FSL polypeptide activity relative to a corresponding plant or plant part that includes a male or hermaphroditic allele of the FSL locus. In some examples, the plant or plant part can include a FSL locus that is homozygous for a female allele (f / f) that confers a female flower phenotype. In some examples, the FSL locus (f / f) genotype is non-naturally present in the plant or plant part.

[0038] The present invention also provides a plant or part thereof producing seedless fruit, the plant comprising:

[0039] (i) a polynucleotide conferring a dwarf morphology to a plant; and

[0040] (ii) A floral sex (FSL) locus homozygous for the female allele (f / f) that confers a female floral phenotype.

[0041] In one example, the ORF of the female allele of the FSL locus includes the sequence set forth in SEQ ID NO:5, or a sequence having at least 70% identity thereto, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO:5 is A. For example, the ORF of the female allele of the FSL locus can include a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO:5, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO:5 is A. In some examples, the ORF of the female allele of the FSL locus includes the sequence set forth in SEQ ID NO:5.

[0042] In each of the foregoing examples describing the ORF of the female allele of the FSL locus, the ORF has a percentage level of identity with the sequence shown in SEQ ID NO:5, and the female allele of the FSL locus can be an ortholog of the sequence shown in SEQ ID NO:5 corresponding to the plant species.

[0043] The present invention also provides a plant or part thereof having an altered level of FSL polypeptide activity as described herein, wherein the plant comprises a polynucleotide that confers a dwarf morphology to the plant. The plant or plant part according to this embodiment produces seedless fruit.

[0044] In each of the foregoing examples describing plants or plant parts that produce seedless fruit, the polynucleotide conferring dwarf morphology is altered relative to the corresponding wild-type polynucleotide sequence.

[0045] In one example, the polynucleotide that confers a dwarf morphology is a variant of a gibberellic acid insensitive (GAI1) gene or a fragment thereof. Variants of the GAI1 gene encode variant GAI1 proteins. In one example, a variant of the GAI1 gene or a fragment thereof that confers a dwarf morphology to a plant includes one or more mutations in a region encoding a DELLA domain. For example, one or more mutations in a region of a DELLA domain encoding a GAI1 protein may change the gibberellic acid (GA) response characteristics of a plant or plant part. One or more mutations may be selected from amino acid substitutions, deletions or additions. One or more mutations in the DELLA domain may prevent a plant or plant part from responding to GA signal transduction. Therefore, in some examples, a plant or plant part comprising a variant of a GAI1 gene or a fragment thereof is unresponsive or responds poorly to GA signal transduction. In one example, the variant GAI1 protein includes the sequence shown in SEQ ID NO:8 having a Leu to His substitution at position 38, or a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of the sequence shown in SEQ ID NO:8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO:8 is replaced by a larger basic residue, such as His. In a preferred embodiment, the variant GAI1 protein includes a sequence having at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7% or at least 99.8% identity to the sequence shown in SEQ ID NO:8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO:8 is replaced by a larger basic residue, such as His. In each of the foregoing examples describing a variant GAI1 protein comprising a sequence having a percent identity to the sequence shown in SEQ ID NO: 8, the variant GAI1 protein can be an ortholog of the sequence shown in SEQ ID NO: 8, including a replacement of Leu at a position corresponding to residue 38 of SEQ ID NO: 8, for example, with a larger basic residue such as His. In one example, the variant GAI1 protein sequence comprises the sequence shown in SEQ ID NO: 9.

[0046] In one example, a variant of the GAI1 gene or a fragment thereof that confers a dwarf morphology is present in a homozygous (GAI1 / GAI1) state.

[0047] In one example, a variant of the GAI1 gene or a fragment thereof that confers a dwarf morphology is present in a heterozygous (GAI1 / Gai1) state.

[0048] In one example, the DELLA domain is altered, truncated or deleted from the GAI1 gene or a fragment thereof, such as due to one or more mutations.

[0049] In another example, the GAI1 protein or its DELLA domain is silenced, such as post-transcriptionally. According to this example, the polynucleotide conferring dwarf morphology to the plant can be an RNAi agent targeting the mRNA transcript of the GAI1 protein (eg, corresponding to the DELLA domain).

[0050] In each of the above examples, when the flowers are not pollinated, the plant or part thereof produces parthenocarpic seedless fruit, and when the flowers are pollinated by viable pollen, the plant or part thereof produces fruit containing seeds.

[0051] In each of the foregoing examples, the plant or part thereof further comprises a polynucleotide that confers seedless fruit to the plant or part thereof.

[0052] In an example, the polynucleotides that confer plant or its part seedless fruit are changed with respect to corresponding wild-type gene or its wild-type allele. For example, the polynucleotides that confer plant or its part seedless fruit can comprise one or more sudden changes with respect to corresponding wild-type gene or its wild-type allele. One or more sudden changes can be selected from amino acid replacement, disappearance or interpolation.

[0053] In one example, the polynucleotide that confers seedless fruit to a plant or plant part is a variant of the grape MADS box protein 5 (VvMADS5) locus.

[0054] In one example, the VvMADS5 locus encodes a VvMADS5 protein comprising the amino acid sequence set forth in SEQ ID NO: 10, and the variant VvMADS5 protein comprises a substitution of Arg at position 197 of the sequence set forth in SEQ ID NO: 10 with a hydrophobic amino acid, such as Leu (R197L). In one example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising the amino acid sequence set forth in SEQ ID NO: 11, or a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the sequence set forth in SEQ ID NO: 11, provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. For example, a variant VvMADS5 locus can encode a variant VvMADS5 protein comprising an amino acid sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identical to the sequence shown in SEQ ID NO: 11, provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. In each of the foregoing examples describing a variant VvMADS5 locus encoding a variant VvMADS5 protein, the variant VvMADS5 protein comprises a sequence that has a percentage level of identity relative to the sequence shown in SEQ ID NO: 11, and the variant VvMADS5 protein can be an ortholog of the sequence shown in SEQ ID NO: 11 that comprises the corresponding amino acid substitution at position 197.

[0055] In one example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising the amino acid sequence shown in SEQ ID NO:11.

[0056] In one example, the variant VvMADS5 locus that confers seedless fruit is present in a homozygous state.

[0057] In one example, the variant VvMADS5 locus that confers seedless fruit is present in a heterozygous state.

[0058] In one example, the variant VvMADS5 locus includes one or more mutations that result in the absence or truncation of the VvMADS5 protein.

[0059] In another example, the VvMADS5 protein is silenced, such as post-transcriptionally. According to this example, the polynucleotide that confers seedless fruit to a plant can be an RNAi agent that targets an mRNA transcript encoded by the VvMADS5 locus.

[0060] The present invention also provides a plant or part thereof producing seedless fruit, the plant comprising:

[0061] (i) a floral sex (FSL) locus genotype, which is a heterozygous form as described herein (FSL / fsl), or a homozygous form of a hermaphroditic FSL locus allele (FSL / FSL) as described herein;

[0062] (ii) a polynucleotide conferring a dwarf morphology to a plant as described herein; and

[0063] (iii) a polynucleotide conferring seedless fruit as described herein.

[0064] In each of the foregoing examples describing a plant or plant part further comprising a polynucleotide that confers seedless fruit, the plant produces parthenocarpic seedless fruit when the flower is not pollinated and produces seed-aborting fruit when the flower is pollinated by viable pollen.

[0065] In one example, a plant as described herein is a dioecious plant species.

[0066] In another example, the plant as described herein is a hermaphroditic plant species.

[0067] In each of the above embodiments, the plant is preferably a fruit-producing plant, i.e., an angiosperm. For example, the plant may be a berry-producing plant, a citrus-producing plant, a stone fruit-producing plant, a pome-producing plant, or a gourd-producing plant.

[0068] In one example, the plant is a berry-producing plant. For example, the plant can be a Vitis sp., i.e., for example, a Vitis sp. selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis, and hybrids thereof. In one example, the Vitis sp. produces table grapes. In another example, the Vitis sp. produces wine grapes.

[0069] In one example, the plant part is a cell, seed, fruit, root, plant cutting or scion.

[0070] Also provided herein are methods of controlling flower sex in a plant, the methods comprising altering the level of FSL polypeptide activity in a plant or part thereof as compared to the level of FSL polypeptide activity in a corresponding plant or part thereof having a genotype of a FSL locus that confers a male or hermaphroditic floral phenotype. In one example, the plant or part thereof has an altered level of FSL polypeptide activity as compared to a corresponding plant or part thereof expressing a FSL polypeptide encoded by a wild-type hermaphroditic allele of the FSL locus. In another example, the plant or part thereof has an altered level of FSL polypeptide activity as compared to a corresponding plant or part thereof expressing a FSL polypeptide encoded by a wild-type male allele of the FSL locus. Exemplary FSL polypeptides encoded by wild-type hermaphroditic and male alleles of the FSL locus are described herein.

[0071] In one example, the FSL locus genotype that confers a hermaphroditic floral phenotype includes a hermaphroditic allele of the FSL locus that encodes a FSL polypeptide, the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO: 1; and

[0072] The FSL locus genotype conferring a male flower phenotype comprises a male allele of the FSL locus encoding a FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:3, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO:3.

[0073] In some examples, the plant or plant part with altered FSL polypeptide activity levels includes a FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2, a biologically active fragment thereof, or an amino acid sequence that is at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:2.

[0074] In one embodiment, the method comprises modifying a FSL locus containing a polynucleotide sequence encoding a FSL polypeptide or a biologically active fragment thereof. For example, the method may comprise modifying a region of the FSL locus encoding a plant AT-rich sequence and a zinc binding (PLATZ) domain, for example relative to a corresponding polynucleotide sequence of a wild-type hermaphrodite or male allele of the FSL locus encoding a PLATZ domain. Modifying a region of the FSL locus may comprise introducing one or more nucleotide additions, deletions, or substitutions into a polynucleotide sequence encoding the FSL polypeptide relative to a corresponding polynucleotide sequence of a wild-type FSL locus allele that confers a male or hermaphrodite floral phenotype when expressed. For example, a polynucleotide sequence encoding a FSL polypeptide may be modified relative to a corresponding polynucleotide sequence of a wild-type hermaphrodite allele of the FSL locus. For example, a polynucleotide sequence encoding a FSL polypeptide may be modified relative to a corresponding polynucleotide sequence of a wild-type male allele of the FSL locus. In one example, the polynucleotide sequence encoding the FSL polypeptide may include an ORF with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotide additions, deletions or substitutions between positions 153 and 189, such as between positions 155 and 159 (or one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between positions 153 and 189 (or one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF with one or more Ts (e.g., T, TT or TTT) deleted between positions 155 and 159 (or one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF with one or more Ts (e.g., T, TT, or TTT) added between positions 155 and 159 relative to the sequence shown in SEQ ID NO: 6 or 7 (or one or more Ts added at one or more corresponding nucleotide positions in the corresponding genomic sequence).

[0075] In one embodiment, modification of the FSL locus is achieved using gene editing technology. For example, the polynucleotide sequence encoding the FSL polypeptide can be gene edited using CRISPR, TALON or ZFN technology or a combination thereof.

[0076] In one example, the FSL polypeptide or biologically active fragment thereof encoded by the modified polynucleotide sequence comprises one or more amino acid additions, deletions or substitutions relative to the FSL polypeptide encoded by the corresponding wild-type FSL locus allele (e.g., due to one or more nucleotide additions, deletions or substitutions of the encoding polynucleotide sequence). For example, modification of the polynucleotide at the FSL locus can result in one or more amino acid additions, deletions or substitutions in the PLATZ domain of the FSL polypeptide relative to the corresponding wild-type amino acid sequence. In some examples, the FSL polypeptide encoded by the modified polynucleotide sequence is truncated. In some examples, the FSL polypeptide or domain thereof, such as the PLATZ domain, encoded by the modified polynucleotide sequence is not present in the plant or part thereof.

[0077] In other examples, the level of FSL polypeptide activity in a plant or part thereof is altered by post-transcriptional silencing with an RNA interference (RNAi) agent that targets a messenger RNA (mRNA) of the FSL locus. According to this embodiment, the method can include introducing into the plant or part thereof an RNAi agent that targets an mRNA of the FSL locus or an allele thereof. For example, the plant or part thereof can be transfected with a construct for expressing the RNAi agent (e.g., an expression vector that expresses the RNAi agent) and / or has been integrated into its genome. The RNAi agent can be any RNAi agent known in the art or described herein.

[0078] In some examples, the polynucleotide sequence of the FSL locus is modified relative to the polynucleotide sequence of the corresponding wild-type FSL locus allele.

[0079] In one example, the corresponding wild-type FSL locus allele can be a hermaphroditic allele of the FSL locus. According to this example, the ORF of the corresponding wild-type FSL locus allele can include the polynucleotide sequence shown in SEQ ID NO:6, a sequence having at least 60% identity thereto, or an orthologous sequence thereof corresponding to a plant species. In one example, the ORF of the corresponding wild-type FSL locus allele includes a sequence having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence shown in SEQ ID NO:6. In a specific example, the ORF of the corresponding wild-type FSL locus allele includes the sequence shown in SEQ ID NO:6.

[0080] In another example, the corresponding wild-type FSL locus allele can be a male allele of the FSL locus. According to this example, the ORF of the corresponding wild-type FSL locus allele can include the polynucleotide sequence shown in SEQ ID NO:7, a sequence having at least 60% identity thereto, or an orthologous sequence thereof corresponding to a plant species. In one example, the ORF of the corresponding wild-type FSL locus allele includes a sequence having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence shown in SEQ ID NO:7. In a specific example, the ORF of the corresponding wild-type FSL locus allele includes the sequence shown in SEQ ID NO:7.

[0081] According to an example of a method of controlling flower sex in a plant as described herein, the FSL polypeptide activity in a plant or plant part is reduced relative to the level of FSL polypeptide activity in a corresponding wild-type plant or part thereof. For example, the FSL polypeptide activity in a plant or plant part may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% relative to the level of FSL polypeptide activity in a corresponding wild-type plant or part thereof.

[0082] In each of the foregoing examples describing a plant or plant part having a reduced level of FSL polypeptide activity after performing the method, the reduction in FSL polypeptide activity may be caused by a corresponding reduction in FSL polypeptide expression or a reduction in FSL polypeptide activity or a reduction in the activity of a polynucleotide encoding a FSL polypeptide. Alternatively or additionally, the reduction in FSL polypeptide activity may be caused by a corresponding reduction in the expression of FSL locus mRNA relative to the expression level in a corresponding wild-type plant or part thereof (e.g., a corresponding hermaphrodite or male wild-type plant or part thereof).

[0083] In some examples, after performing the method, FSL polypeptide activity is eliminated in the plant or plant part. For example, FSL polypeptide expression can be completely inhibited or the FSL locus encoding the FSL polypeptide can be knocked out in the plant or its part.

[0084] In one example, altering the activity of a FSL polypeptide in a plant or part thereof results in the absence or non-function of the male reproductive parts of the plant's flowers. For example, reducing the activity of a FSL polypeptide as described herein can result in the absence or non-function of the male reproductive parts of a plant's flowers or plant parts. In some examples, reducing the activity of a FSL polypeptide as described herein can result in the male reproductive parts of a flower being non-functional (even if present). The non-functional male reproductive parts of a flower may be underdeveloped due to the alteration (e.g., reduction) in the activity of a FSL polypeptide, resulting in it being non-functional. Thus, altering the level of a FSL polypeptide in a plant or part thereof can result in a plant or plant part that produces a phenotypically female or male sterile flower.

[0085] In some examples, the plant or plant part in which the FSL polypeptide activity is altered comprises a polynucleotide that confers a dwarf state as described herein. In some examples, the plant or plant part in which the FSL polypeptide activity is altered already comprises a polynucleotide that confers a dwarf state. In other examples, the method comprises introducing into the plant or plant part a polynucleotide that confers a dwarf state.

[0086] In some examples, the plant or plant part in which the FSL polypeptide activity is altered comprises a polynucleotide that confers seedless fruit as described herein. In some examples, the plant or plant part in which the FSL polypeptide activity is altered already comprises a polynucleotide that confers seedless fruit. In other examples, the method comprises introducing into the plant or plant part a polynucleotide that confers seedless fruit.

[0087] In one example, the plant or plant part in which the activity of a FSL polypeptide is altered is a dioecious plant species.

[0088] In another example, the plant or plant part in which the activity of the FSL polypeptide is altered is a hermaphroditic plant species.

[0089] In each of the above embodiments, the plant in which the activity of the FSL polypeptide is altered is preferably a plant that produces fruit, i.e., angiosperms. For example, the plant can be a berry-producing plant, a citrus-producing plant, a stone fruit-producing plant, a pome-producing plant, or a gourd-producing plant.

[0090] In one example, the plant or plant part in which the FSL polypeptide activity is altered produces berries. For example, the plant can be a Vitis sp., i.e., for example, a Vitis sp. selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis, and hybrids thereof. In one example, the Vitis sp. produces table grapes. In another example, the Vitis sp. produces wine grapes.

[0091] In one example, the plant part is a cell, a seed or a seed part, a fruit, a root, a plant cutting or a scion.

[0092] The present invention also relates to a method for controlling floral sex in a plant, comprising increasing the activity level of a FSL polypeptide encoded by a male or hermaphroditic allele of a FSL locus in a plant or a part thereof relative to the activity level of a corresponding FSL polypeptide in a corresponding plant or a part thereof having a genotype of the FSL locus that confers a female floral phenotype.

[0093] In one example, the FSL polypeptide encoded by the hermaphroditic allele of the FSL locus includes the amino acid sequence set forth in SEQ ID NO: 1, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO: 1. Other exemplary FSL polypeptides encoded by the hermaphroditic allele of the FSL locus are described and contemplated herein. In a specific example, the hermaphroditic allele of the FSL locus encodes a FSL polypeptide including the amino acid sequence set forth in SEQ ID NO: 1, or a biologically active fragment thereof.

[0094] In one example, the FSL polypeptide encoded by the male allele of the FSL locus includes the amino acid sequence set forth in SEQ ID NO: 3, a biologically active fragment thereof, or an amino acid sequence having at least 40% identity to the sequence set forth in SEQ ID NO: 3. Other exemplary FSL polypeptides encoded by the male allele of the FSL locus are described and contemplated herein. In a specific example, the male allele of the FSL locus encodes a FSL polypeptide including the amino acid sequence set forth in SEQ ID NO: 3, or a biologically active fragment thereof.

[0095] In one example, increasing the level of activity of a FSL polypeptide encoded by a male or hermaphroditic allele of the FSL locus in a plant or part thereof confers a floral phenotype in which functional male reproductive parts are present.

[0096] The present invention also provides a method for producing a plant that produces flowers of known sex, the method comprising the steps of:

[0097] i) crossing two parent plants,

[0098] ii) screening one or more progeny plants from the cross to determine the genotype at the floral sex (FSL) locus, and

[0099] iii) selecting progeny plants capable of expressing a desired floral sex phenotype based on the FSL locus genotype, wherein an FSL locus genotype homozygous for a female FSL locus allele (f / f) confers a female floral phenotype, an FSL locus genotype heterozygous for a female FSL locus allele and a hermaphroditic FSL locus allele (f / H) confers a hermaphroditic floral phenotype, an FSL locus genotype homozygous for a hermaphroditic FSL locus allele (H / H) confers a hermaphroditic floral phenotype, and an FSL locus genotype heterozygous for a male FSL locus allele and a female FSL locus allele (M / F) or a hermaphroditic FSL locus allele (M / H) confers a male floral phenotype, and an FSL locus genotype homozygous for a male FSL locus allele (M / M) confers a male floral phenotype,

[0100] This results in plants that produce flowers of known sex.

[0101] FSL locus sequences, including male, female and hermaphroditic FSL locus allele sequences, are described herein and, unless otherwise indicated, should be applied mutatis mutandis to each example describing a method of producing a plant producing flowers of known sex as described herein.

[0102] In one example, the method includes selecting progeny plants having a FSL locus genotype that is homozygous for a female FSL locus allele (f / f), thereby producing plants that produce female flowers.

[0103] In one example, the method includes selecting progeny plants having a FSL locus genotype that is heterozygous for a female FSL locus allele and a hermaphroditic FSL locus allele (f / H) or homozygous for a hermaphroditic FSL locus allele (H / H), thereby producing plants that produce hermaphroditic flowers.

[0104] In one example, the female allele of the FSL locus has an ORF that includes the sequence set forth in SEQ ID NO:5, or a sequence having at least 70% identity thereto, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO:5 is A. For example, the female allele of the FSL locus can include an ORF that includes a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO:5, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO:5 is A. In some examples, the ORF of the female allele of the FSL locus includes the sequence set forth in SEQ ID NO:5.

[0105] In each of the foregoing examples describing the ORF of the female allele of the FSL locus, the ORF has a percentage level of identity with the sequence shown in SEQ ID NO: 5, and the ORF of the FSL locus can be an ortholog of the sequence shown in SEQ ID NO: 5 corresponding to a plant species.

[0106] In one example, the hermaphrodite allele of the FSL locus has an ORF that includes the sequence set forth in SEQ ID NO:6, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the sequence set forth in SEQ ID NO:6, with the proviso that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO:6 is C. In some examples, the ORF of the hermaphrodite allele of the FSL locus includes the sequence set forth in SEQ ID NO:6.

[0107] In each of the foregoing examples describing an ORF of a hermaphroditic allele of the FSL locus, the ORF has a percent level of identity to the sequence set forth in SEQ ID NO: 6, and the ORF of the FSL locus can be an ortholog of the sequence set forth in SEQ ID NO: 6 corresponding to a plant species.

[0108] The present invention also provides a method for producing a plant that produces seedless fruit, the method comprising the steps of:

[0109] i) crossing two parental plants, wherein one parental plant comprises a FSL locus that is homozygous for a female allele (f / f) conferring a female floral phenotype and the other parental plant comprises a polynucleotide conferring a dwarf morphology,

[0110] ii) screening one or more progeny plants from the cross for the presence or absence of an FSL locus homozygous for the female allele (f / f) and the presence or absence of a polynucleotide conferring a dwarf morphology, and

[0111] iii) selecting progeny plants comprising a FSL locus that is homozygous for the female allele (f / f) and comprises a polynucleotide conferring a dwarf morphology,

[0112] This results in a plant that produces seedless fruit.

[0113] The present invention also provides a method for producing a plant that produces seedless fruit, the method comprising the steps of:

[0114] i) crossing two parental plants, wherein at least one parental plant comprises (a) a floral sex (FSL) locus that is homozygous for fsl / fsl that confers a pistil floral phenotype, homozygous for (FSL / FSL) that confers a hermaphroditic floral phenotype, or heterozygous or homozygous for (FSL / fsl) a floral sex (FSL) locus, (b) at least one parental plant comprises a polynucleotide that confers a dwarf morph, and (c) at least one parental plant comprises a polynucleotide that confers seedless fruit,

[0115] ii) screening one or more progeny plants from the cross for the presence or absence of a FSL locus that is homozygous for a female phenotype (fsl / fsl), homozygous for a hermaphroditic phenotype (FSL / FSL), or heterozygous for a hermaphroditic phenotype (FSL / fsl), (b) the presence or absence of a polynucleotide that confers a dwarf morph, and (c) the presence or absence of a polynucleotide that confers seedless fruit, and

[0116] iii) selecting progeny plants comprising (a) a genotype of the FSL locus that confers a pectoris or hermaphroditic floral phenotype, (b) a polynucleotide conferring a dwarf morphology, and (c) a polynucleotide conferring a seedless fruit,

[0117] This results in a plant that produces seedless fruit.

[0118] A progeny plant producing seed-aborting seedless fruits, comprising (a) a FSL locus genotype conferring a hermaphroditic floral phenotype, (b) a polynucleotide conferring a dwarf phenotype, and (c) a polynucleotide conferring seedless fruits.

[0119] A progeny plant producing parthenocarpic seedless fruits comprising (a) a FSL locus genotype conferring a female flower phenotype, (b) a polynucleotide conferring a dwarf phenotype, and (c) a polynucleotide conferring seedless fruits.

[0120] The present invention also provides a method for producing a plant that produces seedless fruit, the method comprising the steps of:

[0121] i) crossing two parental plants, wherein at least one parental plant comprises a FSL locus homozygous for a female allele (f / f) conferring a female floral phenotype, at least one parental plant comprises a polynucleotide conferring a dwarf morphology, and at least one parental plant comprises a polynucleotide conferring seedless fruit,

[0122] ii) screening one or more progeny plants from the cross for the presence or absence of an FSL locus that is homozygous for the female allele (f / f), and the presence or absence of a polynucleotide conferring a dwarf morph, and the presence or absence of a polynucleotide conferring seedless fruit, and

[0123] iii) selecting progeny plants comprising the FSL locus homozygous for the female allele (f / f), the polynucleotide conferring dwarf morphology and the polynucleotide conferring seedless fruit,

[0124] This results in plants producing parthenocarpic, seedless fruits.

[0125] The present invention also provides a method for producing a plant that produces seedless fruit, the method comprising the steps of:

[0126] i) crossing two parental plants, wherein at least one parental plant comprises a polynucleotide that confers a dwarf morphology and at least one parental plant comprises a polynucleotide that confers seedless fruit,

[0127] ii) screening one or more progeny plants from the cross for the presence or absence of a polynucleotide conferring a dwarf morph and the presence or absence of a polynucleotide conferring seedless fruit, and

[0128] iii) selecting progeny plants comprising the polynucleotide conferring dwarf morphology and the polynucleotide conferring seedless fruit,

[0129] This results in plants producing parthenocarpic, seedless fruits.

[0130] In each of the foregoing examples describing a method of producing seedless fruit, the method may further comprise:

[0131] iv) backcrossing the progeny selected in iii) with a plant having the same genotype as one or the parent plant but lacking the polynucleotide for which the progeny was selected a sufficient number of times to produce a plant having most of the genotype of the parent but including the polynucleotide of interest, and

[0132] iv) selecting progeny plants having the polynucleotide of interest, preferably wherein the progeny comprises the hermaphroditic FSL locus allele or the female FSL locus allele or both, more preferably wherein the progeny are homozygous for the female FSL locus allele.

[0133] The female allele of the FSL locus has been previously described herein and should be applied mutatis mutandis to each example of the method of producing a plant producing seedless fruit as described herein, unless otherwise specified. In a specific example, the female allele of the FSL locus has an ORF comprising the sequence shown in SEQ ID NO:5.

[0134] Exemplary polynucleotides that confer dwarf morphology and seedless fruit, respectively, are described herein and, unless otherwise specified, are applied mutatis mutandis to each example of the method for producing a plant producing seedless fruit as described herein. In a specific example, the polynucleotide conferring dwarf morphology is a variant of the GAI1 gene encoding a variant GAI1 protein comprising the sequence set forth in SEQ ID NO: 9. In a specific example, the polynucleotide conferring seedless fruit is a variant of the VvMADS5 locus encoding a variant VvMADS5 protein comprising the sequence set forth in SEQ ID NO: 11.

[0135] In one example, the plant producing seedless fruit is a dioecious plant species.

[0136] In one example, the plant that produces seedless fruit is a hermaphroditic plant species.

[0137] In one example, the plant producing soft fruit is a berry producing plant, a citrus producing plant, a stone fruit producing plant, a pome producing plant, or a gourd producing plant.

[0138] In one example, the plant produces seedless berries. For example, the plant can be a Vitis sp., i.e., for example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis, and hybrids thereof. In one example, the Vitis species produces table grapes. In another example, the Vitis species produces wine grapes.

[0139] The present invention also provides plants or parts thereof produced by the methods described herein.

[0140] In one example, the plant part is a cell, a seed or a seed part, a fruit, a root, a plant cutting or a scion.

[0141] Also provided herein are fruits produced by the plants described herein.

[0142] In one embodiment, the plant is Vitis sp. and the fruit is grape.

[0143] In one example, the fruit is seedless. In one example, the fruit is a seed-aborted seedless fruit. In one example, the fruit is parthenocarpic seedless.

[0144] The present invention also provides a method of producing fruit, the method comprising growing a plant as described herein so as to produce fruit.

[0145] In one example, the method of producing fruit further comprises harvesting the fruit produced from the plant.

[0146] In one embodiment, the method for producing a fruit further comprises processing the fruit. For example, processing the fruit may comprise packaging the fruit. For example, processing the fruit may comprise producing one or more products from the fruit.

[0147] The present invention also provides products produced from the plants described herein or fruits thereof.

[0148] In one example, the product is a food, a food ingredient, a beverage product or a beverage ingredient. The food may be selected from the group consisting of, for example, table grapes, jam, marmalade, jelly, sultanas and raisins. The food ingredient may be, for example, cooked wine, cranberry, vinegar or glucose syrup (mosto cotto). The beverage product may be, for example, wine, grappa, brandy or grape juice. The beverage ingredient may be, for example, wine grapes, table grapes or their juice.

[0149] In one example, the invention provides a FSL polypeptide as described herein. For example, the FSL polypeptide may include an amino acid sequence selected from the group consisting of: a) a sequence as shown in SEQ ID NO: 1, 2 or 3, or a biologically active fragment of any one thereof, or b) an amino acid sequence having at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence as shown in SEQ ID NO: 1, 2 or 3.

[0150] In another example, the present invention provides an isolated nucleic acid molecule comprising a polynucleotide sequence encoding a FSL polypeptide described herein. For example, the nucleic acid molecule may include a) a polynucleotide sequence shown in SEQ ID NO:4, 5, 6 or 7, or a polynucleotide sequence having an ORF shown in SEQ ID NO:4, 5, 6 or 7, b) a polynucleotide sequence having at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence shown in SEQ ID NO:4, 5, 6 or 7, or a polynucleotide sequence having an ORF having at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence shown in SEQ ID NO:4, 5, 6 or 7, or c) a polynucleotide sequence complementary to the polynucleotide sequence in a) or b).

[0151] In one example, an isolated nucleic acid molecule includes a recombinant polynucleotide.

[0152] The present invention also provides expression vectors comprising the isolated nucleic acid molecules described herein.

[0153] In one example, the isolated nucleic acid molecule is operably linked to a promoter.

[0154] In one example, the expression vector is a plasmid or a virus.

[0155] The present invention also provides isolated cells of a plant as described herein.

[0156] The present invention also provides a host cell comprising a nucleic acid molecule as described herein or an expression vector comprising a nucleic acid molecule as described herein. The host cell can be a yeast, a bacterium or a plant cell.

[0157] The present invention also provides a method for determining the floral sex of a plant, the method comprising performing one or more assays on a sample obtained from the plant to determine the genotype of the plant at a floral sex (FSL) locus and determining the floral sex of the plant based on the FSL locus genotype,

[0158] Plants comprising an FSL locus genotype that is homozygous for the female FSL locus allele (f / f) will produce flowers that are phenotypically female.

[0159] Plants comprising an FSL locus genotype that is heterozygous for both the female FSL locus allele and the hermaphroditic FSL locus allele (f / H) will produce flowers that are phenotypically hermaphroditic,

[0160] wherein plants having a FSL locus genotype that is homozygous for the hermaphroditic FSL locus allele (H / H) will produce flowers that are phenotypically hermaphroditic, and

[0161] Plants comprising a FSL locus genotype that is heterozygous for the female FSL locus allele and the male FSL locus allele (f / M) will produce flowers that are phenotypically male.

[0162] In one example, the female allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:5, or a sequence having at least 70% identity thereto, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO:5 is A. Exemplary female FSL locus allele sequences are described herein. In some examples, the female allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:5.

[0163] In each of the foregoing examples describing a female allele of the FSL locus having an ORF having a percent level identity to the sequence set forth in SEQ ID NO:5, the female allele of the FSL locus can be an ortholog of the sequence set forth in SEQ ID NO:5 corresponding to a plant species.

[0164] In one example, a hermaphroditic allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:6, or a sequence at least 70% identical thereto, provided that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO:6 is C. Exemplary hermaphroditic FSL locus allele sequences are described herein.

[0165] In some examples, the hermaphroditic allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:6.

[0166] In each of the foregoing examples describing a hermaphroditic allele of the FSL locus having an ORF having a percent identity to the sequence set forth in SEQ ID NO:6, the hermaphroditic allele of the FSL locus can be an ortholog of the sequence set forth in SEQ ID NO:6 corresponding to a plant species.

[0167] In one example, the male allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:7, or a sequence having at least 70% identity thereto, provided that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO:7 is C. Exemplary male FSL locus allele sequences are described herein. In some examples, the male allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO:7.

[0168] In each of the foregoing examples describing a male allele of the FSL locus having an ORF having a percent identity to the sequence set forth in SEQ ID NO:7, the male allele of the FSL locus can be an ortholog of the sequence set forth in SEQ ID NO:7 corresponding to a plant species.

[0169] In one embodiment, the genotype of the plant at the FSL locus is determined by a PCR-based assay.

[0170] Unless specifically stated otherwise, any embodiment herein should be construed as analogous to any other embodiment mutatis mutandis.

[0171] The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for illustrative purposes only. As used herein, functionally equivalent products, compositions and methods are clearly within the scope of the present invention.

[0172] Throughout the specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be considered to include both one and multiple (ie, one or more) those steps, compositions of matter, groups of steps or groups of compositions of matter.

[0173] The invention is now described by way of the following non-limiting examples and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0174] Figure 1 (a) DNA sequence of the FSL hermaphrodite allele (H) from Cabernet Sauvignon; (b) DNA sequence of the FSL female allele (f) from Vitis spp. clone 04C023V0003; (c) DNA sequence of the FSL hermaphrodite allele (H) from Vitis spp. clone 04C023V0006. (d) DNA sequence of the FSL male allele (M) from Vitis spp. clone 04C023V0016. In each of (a)-(d), the open reading frame is underlined and the sequence encoding the PLATZ domain is bolded.

[0175] Figure 2 Multiple sequence alignment of the open reading frames (ORFs) of the female allele (SEQ ID NO: 5), hermaphroditic allele (SEQ ID NO: 6) and male allele (SEQ ID NO: 7) of the FSL locus was performed using CLUSTAL O (1.2.4).

[0176] Figure 3 (a) Protein sequences of the FSL hermaphrodite allele (H) from Cabernet Sauvignon and Vitis spp. clone 04C023V0006; (b) Protein A sequence of the FSL female allele (f) from Vitis spp. clone 04C023V0003; (c) Protein sequence of the FSL hermaphrodite allele (H) from Vitis spp. clone 04C023V0006. In each of (a)-(c), the sequence encoding the PLATZ domain is indicated in bold.

[0177] Figure 4 .Evolutionary tree of hermaphroditic protein sequences from Vitus vinifera.

[0178] Figure 5. Shows the expression of FSL during stages 1-2 of flower development, as determined by a modified EL system (Coombe (1995)). In situ hybridization was used to localize FSL transcripts in (A and B) male flowers, (C and D) hermaphrodites, and (E and F) female flowers. The perianth (p) organ encloses the reproductive organs. The red and green arrows point to the anthers and filaments of the stamens in (A). The ovules are marked by blue arrows.

[0179] Figure 6 Relative gene expression of FSL in leaves and early flowers measured by RT-qPCR

[0180] Figure 7 In vitro screening of CRISPR guide RNAs targeting the FSL locus in grapevine. Guide RNAs named sgRNAFS1 and sgRNAFS4 were selected for CRISPR editing of microvines.

[0181] Figure 8 .Genetic transformation of microvines with CRISPR constructs targeting FSL.

[0182] Fig. 9 Illustration of the difference in floral phenotype between hermaphrodite and FSL-edited plants. Hermaphrodite flowers have erect stamens (A), while FSL-edited plants have rarely formed stamens with contracted filaments (B). Pollen is viable in hermaphrodite flowers as seen by the extension of pollen tubes (C), while FSL-edited plants have no fertile pollen as determined by pollen germination assays (D).

[0183] Fig.10 .Shows the highest frequency mutations found in FSL knockout plants. The top 13 mutation frequencies indicate that most mutations are T insertions or T gelation at the 16th base of the guide RNA. Note - Only 17 bp of the total 20 bp guide are shown.

[0184] Fig.11 Amino acid alignment of FSL knockout and H alleles. Both T insertion and T deletion produce nonsense mutations, leading to premature termination of protein synthesis.

[0185] Fig.12 . Showing parthenocarpic seedless fruits from female microvines that were unpollinated (A) and pollinated with pollen to produce viable brown seeds (B).

[0186] Fig.13 . Shows parthenocarpic and seed-aborting seedless fruits from female microvines (A) and produces non-viable seed traces when pollinated with pollen (B).

[0187] Fig.14. Aborted seedless fruits from a hermaphroditic microvine (A) are shown. A typical hermaphroditic microvine plant with brown seeds (B).

[0188] Fig.15 . A schematic diagram of the CRISPR / Cas9 vector and the cloning locations of the guide RNAs designated FS1 and FS4 is provided.

[0189] Fig.16 . DNA sequence alignment of FSL locus mutants obtained for FS1 and FS4 is provided, showing the type and location of mutations occurring at a frequency of >10%. Mutations in FS1 and FS4 primarily involve base T and occur 5' to the PAM site.

[0190] Fig.17 .Genomic DNA sequence alignment of homozygous mutants of the FSL locus obtained in T1 generation CRISPR / Cas9 flower sex lines. DNA sequence translation and alignment for the hermaphroditic locus and homozygous mutant lines. Four lines with FS4-guided mutations and three lines with FS1-guided mutations. The Fs1-guide sequence resulted in T insertion or T deletion or double deletion at 157 bp from the start codon. The FS4-guide sequence resulted in a 5 bp deletion, a T insertion at 184 bp from the start codon and a CT deletion at 182 bp from the start codon and a 10 bp deletion at 180 bp from the start codon. Mutations are underlined. Exon-intron boundaries are indicated by arrows.

[0191] Fig.18 Amino acid sequence alignment of homozygous mutants of the FSL locus obtained in T1 generation CRISPR / Cas9 floral sex lines obtained for FS1 and FS4 guide RNAs. The alignment shows the effect of the mutation on the protein sequence.

[0192] Sequence Listing Keywords

[0193] SEQ ID NO: 1 is the amino acid sequence corresponding to the FSL hermaphroditic allele (H) from grape.

[0194] SEQ ID NO: 2 is the amino acid sequence corresponding to the FSL female allele (f) from various grape varieties.

[0195] SEQ ID NO: 3 is the amino acid sequence corresponding to the FSL male allele (M) from various grape varieties.

[0196] SEQ ID NO: 4 is the open reading frame (ORF) DNA sequence corresponding to the FSL hermaphroditic allele (H) from Cabernet Sauvignon.

[0197] SEQ ID NO: 5 is the open reading frame (ORF) sequence corresponding to the FSL female allele (f) from various grape varieties.

[0198] SEQ ID NO: 6 is the open reading frame (ORF) sequence corresponding to the FSL hermaphroditic allele (H) from various grape varieties.

[0199] SEQ ID NO: 7 is the open reading frame (ORF) sequence corresponding to the FSL male allele (M) from various grape varieties.

[0200] SEQ ID NO: 8 is the amino acid sequence of the gibberellic acid insensitive (GAI1) DELLA protein encoded by the GAI1 gene in grape.

[0201] SEQ ID NO: 9 is the amino acid sequence of a variant GAI1 protein comprising a Leu to His substitution, which is encoded by a variant GAI1 gene in grape.

[0202] SEQ ID NO: 10 is the amino acid sequence of the Vitus vinifera MADS-box 5 (VvMADS5) protein encoded by the VvMADS5 gene in grape.

[0203] SEQ ID NO: 11 is the amino acid sequence of a variant VvMADS5 protein encoded by a variant VvMADS5 gene in grapes.

[0204] SEQ ID NO: 12 is the DNA sequence of a primer designated as oligonucleotide dTB26.

[0205] SEQ ID NO: 13 is the DNA sequence of the primer designated CSFS1_CDS_F1.

[0206] SEQ ID NO: 14 is the DNA sequence of the primer designated FSL_RT_F1.

[0207] SEQ ID NO: 15 is the DNA sequence of the primer designated FSL_RT_R1.

[0208] SEQ ID NO: 16 is the DNA sequence corresponding to a single guide RNA (sgRNA) designated "Guide FS1" (antisense orientation).

[0209] SEQ ID NO: 17 is the DNA sequence corresponding to a single guide RNA (sgRNA) designated "Guide FS4" (antisense orientation).

[0210] SEQ ID NO: 18 is the DNA sequence corresponding to a single guide RNA (sgRNA) designated "Guide FS2" (antisense orientation).

[0211] SEQ ID NO: 19 is the DNA sequence corresponding to a single guide RNA (sgRNA) designated "Guide FS3" (sense orientation).

[0212] SEQ ID NO: 20 is the DNA sequence of a primer designated as VvSDLF1.

[0213] SEQ ID NO: 21 is the DNA sequence of a primer designated as VvSDLF2.

[0214] SEQ ID NO: 22 is the DNA sequence of the primer designated VvSDLRev. DETAILED DESCRIPTION

[0215] General techniques and definitions

[0216] Unless explicitly defined otherwise, all technical and scientific terms used herein should be deemed to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in plant molecular genetics, plant breeding, cell culture, protein chemistry, wine production, and biochemistry).

[0217] Unless otherwise indicated, the recombinant DNA, recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard methods well known to those skilled in the art. These techniques are described and explained in, for example, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), TA Brown (ed.), Essential Molecular Biology: A Practical Approach, Vols. 1 and 2, IRL Press (1991), DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, Vols. 1-4, IRL Press (1995 and 1996), and FM Ausubel et al., (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (eds.) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and JE Coligan et al., (eds.), Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0218] Throughout the specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of stated steps or elements or integers, or groups of steps or elements or integers, but not the exclusion of any other steps or elements or integers or groups of elements.

[0219] The term "and / or", such as "X and / or Y", should be understood to mean "X and Y" or "X or Y", and should be understood to provide clear support for both meanings or either meaning.

[0220] Flower Gender

[0221] As used herein, the term "flower" refers to the reproductive structure of flowering plants (angiosperms). Flowers are generally composed of two parts: a vegetative part, consisting of petals and related structures in the perianth, and a reproductive or sexual part. A "flower" may have male and female reproductive parts (wherein the flower may be hermaphroditic), or may have only male or female reproductive parts, in which case the flower may be a male flower or a female flower, respectively. The male reproductive part is generally referred to as a "stamen" and the female reproductive part is referred to as a "pistil". The stamen has two parts: anther and filament. Anther carries pollen and is generally held by a thread-like part called a filament. The pistil has three parts: stigma, style and ovary. Stigma is a sticky structure at the top of the pistil that captures and holds pollen transferred from anther. Style is a tubular structure that holds the stigma and leads downward to the ovary including the ovule (or egg). Depending on whether the flower is male, female or hermaphroditic, it will have only male reproductive parts, only female reproductive parts, or both female and male reproductive parts.

[0222] It will be appreciated by those skilled in the art that plants may be monoecious, dioecious or hermaphroditic. "Monoecious plants" are understood to refer to plants with male and female reproductive systems on the same plant, i.e., plants with some female flowers and other male flowers. "Male flowers" are flowers that develop stamens full of pollen without developed pistils, while "female flowers" are flowers that develop pistils that hold ovules without developed stamens. On the other hand, "dioecious plants" are understood to refer to plants in which male and female reproductive systems appear on different plants. That is, one plant has male reproductive parts (flowers with stamens full of pollen) and another plant has female parts (flowers with pistils that hold ovules). Male or female flowers (as in the case of dioecious and monoecious plants) are sometimes referred to as "incomplete flowers". "Hermaphrodite plant" or "hermaphrodite" is understood to refer to a plant that produces flowers containing both male and female reproductive parts (i.e., stamens filled with pollen and pistils holding ovules). Hermaphrodite plants are primarily self-pollinating and truly bisexual. Flowers from hermaphrodite plants are sometimes also referred to as "complete flowers."

[0223] As used herein, the terms "female flower phenotype", "phenotypically female flowers" or similar terms should be understood to mean flowers that have only functional female reproductive parts and exhibit a female flower phenotype. In some examples, flowers that exhibit a female flower phenotype may be genetically hermaphroditic flowers, wherein the male reproductive parts are non-functional and / or absent, i.e., due to a reduction or absence of FSL polypeptide activity in the plant. According to this example, the reduction or absence of FSL polypeptide activity in the plant prevents or inhibits the development and / or maturation of the male reproductive parts of the flower. "Genetically hermaphroditic flowers" should be understood to refer to flowers that have a hermaphroditic genotype at the FSL locus, i.e., HH=hermaphrodite or Hf=hermaphrodite. Similarly, "hermaphroditic flower phenotype", "hermaphroditic flower phenotype" or the like should be understood to refer to flowers that have functional male and female reproductive parts. Therefore, the term "male flower phenotype" refers to flowers that have only functional male reproductive parts.

[0224] As used herein, the term "controlling the sex of flowers in plants" or similar terms should be understood to mean controlling or influencing whether a plant will develop flowers that are phenotypically male, female, or hermaphroditic. That is, controlling whether a plant will develop flowers that have only male reproductive parts (pollen-filled stamens), only female reproductive parts (pistils that hold ovules), or both.

[0225] As used herein, the term "floral sex (FSL) locus" or "FSL locus" or "FSL gene" is understood to refer to a gene or locus encoding a polypeptide (herein referred to as FSL polypeptide) that the inventors have shown to be responsible for floral sex or floral sex in angiosperms. The inventors have characterized the female (f) and hermaphroditic (H) and male (M) alleles of the FSL locus in grapes, whose open reading frame (ORF) DNA sequences are given in SEQ ID NOs: 5-7, respectively. Thus, references to "FSL locus" herein are intended to include ORFs of the FSL locus allele sequences shown in SEQ ID NOs: 5-7, as well as FSL locus sequences having at least 60% identity thereto (e.g., at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the sequences shown in SEQ ID NOs: 5-7). Orthologs of those sequences corresponding to a particular plant species of interest are also contemplated.

[0226] The term "locus"(s) should be understood to refer to the specific position or location on a chromosome where a gene, polynucleotide or genetic marker is found.

[0227] As used herein, the term "allele" refers to any one or more alternative forms or variants of a gene or polynucleotide sequence at a particular locus, all of which relate to a common trait or characteristic. In a polyploid (e.g., diploid) cell of a plant or plant part, one allele is present at a corresponding position on each chromosome of a pair of homologous chromosomes. In the context of the FSL locus, the term "allele" is used herein to define alternative forms of the FSL locus that the inventors have shown to be associated with different flower sex phenotypes. For example, the inventors have characterized the female (f) and hermaphroditic (H) and male (M) alleles of the FSL locus in grapes, the ORF DNA sequences of which are given in SEQ ID NOs: 5-7, respectively. Therefore, reference herein to "female alleles of the FSL locus," "female FSL locus alleles," or the like should be understood to refer to variants of the FSL locus associated with a female flower phenotype. Similarly, references herein to "hermaphrodite alleles of the FSL locus," "hermaphrodite alleles of the FSL locus," "hermaphrodite FSL locus alleles," "hermaphrodite FSL locus alleles," or the like should be understood to refer to variants of the FSL locus associated with a hermaphrodite flower phenotype. References herein to "male alleles of the FSL locus," "male FSL locus alleles," or the like should be understood to refer to variants of the FSL locus associated with a male flower phenotype.

[0228] A genomic form or clone of a gene containing a transcribed region may be interrupted by non-coding sequences called "introns" or "intervening regions" or "intervening sequences", which may be homologous or heterologous to the "exons" of the gene. As used herein, "introns" are gene segments that are transcribed as part of the primary RNA transcript but are not present in the mature mRNA molecule. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; therefore, introns are not present in the messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers. As used herein, "exon" refers to a DNA region corresponding to an RNA sequence present in a mature mRNA or mature RNA molecule when the RNA molecule is not translated. mRNA acts during the translation process to determine the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes synthetic or fusion molecules encoding all or part of the proteins of the present invention described herein and nucleotide sequences complementary to any of the above. The gene can be introduced into a suitable vector for extrachromosomal maintenance in the cell, or preferably for integration into the host genome. By modifying the FSL locus polynucleotide sequence in grapes and thereby changing the FSL polypeptide activity therein, the inventors have found that the expression of the FSL locus is essential for the development of male reproductive organs in grape flowers. Specifically, the inventors have shown that the knockout of the FSL locus causes the male reproductive organs of flowers in grapes to be non-functional, producing phenotypically female flowers. This supports the conclusion that the expression of the male or hermaphroditic allele of the FSL locus is necessary for the normal development of male reproductive organs in flowers. In the absence of such expression or the absence of an appropriate level of expression, the male reproductive organs will be non-functional or non-existent, producing phenotypically female flowers. As used herein, "non-functional male reproductive organs" or "non-functional male reproductive parts" or similar terms should be understood to mean stamens that cannot fertilize the female reproductive organs (i.e., pistils) of flowers. In some instances, the stamen is non-functional because it contains pollen without vitality, i.e., sterile pollen, and / or because it is reflexed and underdeveloped. However, other embodiments in which the stamen is non-functional are also contemplated and included herein. Flowers with non-functional male reproductive parts exhibit "male sterility".

[0229] Based on the discovery that the expression of the FSL locus, particularly the male or hermaphroditic allele of the FSL locus, is required for the development of functional male reproductive organs in flowers, the present invention contemplates the production and use of plants or parts thereof having altered levels of FSL polypeptide activity compared to corresponding wild-type plants or parts thereof comprising the wild-type FSL locus or its allele. Such altered expression can be used to control the sex of flowers by altering the development of male reproductive organs or parts.

[0230] The present inventors have characterized polypeptide sequences encoded by hermaphroditic, female and male alleles of the FSL locus in species of the genus Vitis, which are set forth in SEQ ID NOs: 1-3, respectively. Reference herein to "FSL polypeptides" is intended to include FSL polypeptide sequences set forth in SEQ ID NOs: 1-3, as well as FSL polypeptide sequences having at least 40% identity thereto (e.g., at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity to the sequences set forth in SEQ ID NOs: 1-3). Orthologs of those sequences corresponding to a particular plant species of interest are also contemplated. In specific examples, the activity of the FSL polypeptide encoded by the male or hermaphroditic alleles of the FSL locus may be altered, as these alleles are believed to be necessary for the development of functional male reproductive organs.

[0231] The term "altered FSL polypeptide activity level" or similar terms should be understood to mean an altered (e.g., increased or decreased) FSL polypeptide activity level relative to the FSL polypeptide activity level in a corresponding comparison plant or plant part that includes a FSL locus genotype that confers a male or hermaphroditic floral phenotype. The FSL locus genotype that confers a hermaphroditic floral phenotype may include a hermaphroditic allele of the FSL locus, such as a wild-type hermaphroditic allele of the FSL locus. Similarly, the FSL locus genotype that confers a male floral phenotype may include a male allele of the FSL locus, such as a wild-type male allele of the FSL locus. According to the above examples, an "altered FSL polypeptide activity level" may be an altered FSL polypeptide activity level relative to the activity of a FSL polypeptide encoded by a hermaphroditic or male allele of the FSL locus. In one example, the alteration in the FSL polypeptide activity level is a decrease in the FSL polypeptide activity relative to the FSL polypeptide activity level in the corresponding comparison plant or plant part. In another example, the altered level of FSL polypeptide activity is the absence of FSL polypeptide activity in a corresponding comparison plant or plant part.

[0232] Altering the level of FSL polypeptide activity in a plant or plant part can be achieved by modifying the polynucleotides within the FSL locus relative to the corresponding polynucleotide sequence of a wild-type allele of the FSL locus, e.g., relative to the corresponding polynucleotide sequence of a wild-type male or hermaphrodite allele of the FSL locus. In one example, the polynucleotide sequence encoding the FSL polypeptide can include an ORF with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotide additions, deletions or substitutions between positions 153 and 189, e.g., between positions 155 and 159 (or at one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide can have an ORF with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between positions 153 and 189 (or at one or more corresponding nucleotide positions in the corresponding genomic sequence) relative to the sequence shown in SEQ ID NO: 6 or 7. For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF with one or more Ts (e.g., T, TT, or TTT) deleted between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF with one or more Ts (e.g., T, TT, or TTT) added between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide encoding the FSL polypeptide may be modified such that the open reading frame is interrupted by a stop codon due to one or more mutations (e.g., nucleotide substitutions, deletions, or additions). According to this example, the modification may result in a non-functional FSL polypeptide. In another example, the polynucleotide encoding the FSL polypeptide may be modified to be more similar to the female allele of the FSL locus. In this regard, the inventors have determined that a variant of the FSL polypeptide encoded by the female allele of the FSL locus and comprising the amino acid sequence set forth in SEQ ID NO:2 results in loss of male function, i.e., no male reproductive parts develop in flowers from plants or plant parts expressing the variant FSL polypeptide. The FSL polypeptide variant (referred to herein as the female FSL polypeptide) confers loss of male function relative to the FSL polypeptide encoded by the corresponding hermaphroditic and male alleles of the FSL locus (set forth in SEQ ID NO:1 and 3, respectively). In certain embodiments, the FSL polypeptide variant conferring loss of male function does not include a methionine (M) at the position corresponding to amino acid position 138 of the sequence set forth in SEQ ID NO:2.In other embodiments, the FSL polypeptide variant that confers male loss of function includes one or more or all of the amino acids at positions corresponding to positions 79, 120, 145, 166, 195, 200, 226, 232 of the sequence set forth in SEQ ID NO: 1. Thus, altering the level of FSL polypeptide activity in a plant or plant part can be achieved by modifying a polynucleotide encoding a FSL polypeptide to achieve loss of male function as described herein. Methods for modifying polynucleotide sequences (e.g., CRISPR, Talon, and ZFN) are described in the art and herein.

[0233] In another embodiment, altering the level of FSL polypeptide activity in a plant or plant part can be achieved by altering the expression level of the FSL polypeptide (e.g., increasing or decreasing the expression level). For example, FSL polypeptide activity can be altered by altering the abundance of the FSL polypeptide expressed in a plant or plant part. For example, the expression level of the FSL polypeptide can be modulated by altering the number of copies per cell of the FSL locus or its allele encoding the FSL polypeptide. This can be achieved by introducing a synthetic gene construct comprising a coding sequence and transcriptional control elements operably linked thereto and functional in the cell. A variety of transformants can be selected and screened for those transformants having favorable levels of FSL polypeptide activity and / or expression specificity resulting from the influence of endogenous sequences near the site of integration of the synthetic construct. A favorable level and pattern of expression of the synthetic construct is a level and pattern that results in a significant change in the FSL phenotype or other phenotype. Alternatively, individual lines having altered FSL polypeptide activity or other phenotypes associated with flower sex can be screened from a population of mutagenized seeds or plants from a breeding program.

[0234] In another embodiment, altering the level of FSL polypeptide activity in a plant or plant part can be achieved by altering the level of transcripts of the FSL locus. For example, RNA interference (RNAi) agents can be used to target the mRNA of the FSL locus, thereby reducing the activity of the FSL polypeptide in a plant or plant part compared to a corresponding wild-type plant or plant part.

[0235] In another embodiment, altering the level of FSL polypeptide activity in a plant or plant part can be achieved by modifying the interaction of the FSL polypeptide with one or more of its binding partners (eg, DNA or protein binding partners involved in the transcription process).

[0236] As described herein, altering the activity of a FSL polypeptide can include reducing the level of activity. For example, reducing the level of activity of a FSL polypeptide can include reducing the expression of a FSL polypeptide, including the level of expression of a functional or biologically active FSL polypeptide. For example, the activity of a FSL polypeptide in a plant or plant part can be reduced by at least 10% relative to the level of activity of a FSL polypeptide in a corresponding plant or part thereof comprising a genotype of a FSL locus that confers a male or hermaphroditic floral phenotype. For example, the activity of a FSL polypeptide in a plant or plant part can be reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the level of activity of a FSL polypeptide in a corresponding plant or part thereof comprising a genotype of a FSL locus that confers a male or hermaphroditic floral phenotype. In some examples, altering the activity of a FSL polypeptide can include completely inhibiting the FSL polypeptide or preventing the expression of the FSL polypeptide by knocking out the FSL locus or its alleles.

[0237] The inventors have identified that the FSL locus encodes a "Plant AT-rich sequence and zinc binding" or "PLATZ" domain. The PLATZ superfamily of transcription factors has been found to be present only in plants and are likely transcription factors. Prior to the present invention, PLATZ proteins had not been identified as being involved in floral sex determination. In fact, the precise function of PLATZ proteins in plants remains poorly understood. In grape studies, Diaz-Riquelman (2014) found that the PLATZ family of transcription factors was upregulated in tendrils, which was thought to be associated with cell differentiation that occurs during tendril development. The inventors have identified the PLATZ domain at positions 26 to 75 of the sequences shown in SEQ ID NOs: 1 and 3 and at positions 24 to 73 of the sequence shown in SEQ ID NO: 2 in the grape FSL polypeptide. This domain is conserved at the polypeptide level (i.e., 100% identity) in each female, hermaphroditic, and male allele of Vitus vinifera. The PLATZ domain appears to be required for FSL polypeptide activity and its role in the development of male reproductive organs. On this basis, altering the activity of a FSL polypeptide in a plant or plant part to control the sex of a flower may include modifying a polynucleotide sequence encoding a PLATZ domain, or post-transcriptional silencing of FSL mRNA transcripts using an RNAi agent targeted to a region of the transcript corresponding to the PLATZ domain.

[0238] An alteration in the activity of a FSL polypeptide in a plant or part thereof, such as a reduction in the activity of a FSL polypeptide as described herein, can result in the male reproductive parts of the plant's flowers being absent or non-functional. In some instances, the male reproductive parts of the flower may not be present due to an altered (e.g., reduced) activity of the FSL polypeptide. In some instances, the male reproductive parts of the flower may not be present due to an altered (e.g., reduced) activity of the FSL polypeptide caused by one or more mutations in the polynucleotide sequence of the FSL locus or its alleles encoding the FSL polypeptide. In other instances, the male reproductive parts of the flower may be present but non-functional due to an altered (e.g., reduced) activity of the FSL polypeptide. The non-functional male reproductive parts of the flower may be underdeveloped due to an altered (e.g., reduced) activity of the FSL polypeptide, resulting in it being non-functional. In some instances, a plant or plant part having an altered (e.g., reduced) level of the FSL polypeptide produces male-sterile flowers.

[0239] The inventors have also identified a specific sense mutation SNP in the region of the FSL locus encoding the PLATZ domain that shows 100% consistency between the genotype, i.e., male flowers (FSL / fsl or FSL / FSL), female flowers (fsl / fsl), or hermaphroditic flowers (FSL / fsl or FSL / FSL) and the floral sex phenotype in grapes. As used herein, the SNP may be referred to as a "floral sex SNP." In the female allele of the FSL locus, the floral sex SNP is located at position 621 of the ORF sequence set forth in SEQ ID NO:5 and includes an A. In the hermaphroditic allele of the FSL locus, the SNP is located at position 627 of the ORF sequence set forth in SEQ ID NO:6 and includes a C. The inventors contemplate using this floral sex SNP to determine the FSL locus genotype of a plant or plant part and thereby predict its floral sex phenotype, e.g., even before the plant or plant part is sufficiently mature to produce flowers. As described herein, the SNP may form part of a diagnostic method or test for determining the floral sex of a plant or plant part. For example, a "female allele of the FSL locus" (or similar terms) may have an ORF comprising the sequence set forth in SEQ ID NO:5, or a sequence having at least 70% identity thereto (e.g., having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity thereto), provided that the nucleotide position corresponding to position 621 of the ORF sequence set forth in SEQ ID NO:5 is an A. For example, a "hermaphroditic allele of the FSL locus" or a "male allele of the FSL locus" (or similar terms) can have a sequence comprising the sequence shown in SEQ ID NO:6, or a sequence having at least 70% identity thereto (e.g., at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity to the sequence shown in SEQ ID NO:5), with the proviso that the nucleotide position corresponding to position 627 of the ORF sequence shown in SEQ ID NO:6 is C. Floral sex can be predicted or determined by genotyping a plant or plant part at a floral sex SNP within the FSL locus (using standard molecular techniques).

[0240] As used herein, the terms "FSL locus," "FSL locus allele," and "FSL polypeptide" are intended to include orthologous FSL locus sequences, orthologous FSL allele sequences (including male, female, and hermaphroditic FSL allele sequences), and orthologous FSL polypeptide sequences of exemplified Vitis species. Orthologs will preferably correspond to the particular plant species produced. An "orthologous" gene, locus, allele, or polypeptide is a homolog that has mutated following a speciation event. Although sequence variation may occur between orthologous genes, loci, alleles, or polypeptides once two species diverge, orthologs may maintain the same or substantially the same function as their evolutionary ancestral gene, locus, allele, or polypeptide. Therefore, orthologous FSL locus sequences, including male, female and hermaphroditic alleles thereof, will be understood to include FSL locus sequences derived from plant species other than grapes, which have the same ancestor as the sequences shown in SEQ ID NOs: 4-7, and perform the same or similar functions in the respective plant species. Similarly, orthologous FSL polypeptides will be understood to include FSL polypeptide sequences derived from plant species other than grapes, which have a common ancestor with the sequences shown in SEQ ID NOs: 1-3, and perform the same or similar functions in the respective plant species.

[0241] The term "wild type" is generally understood to refer to a typical or common form of a gene, locus, allele, polypeptide or phenotype that is naturally present in an organism (or a given population). Unless otherwise specifically stated, the term "wild type" is understood to have its conventional meaning. However, in the context of the FSL locus, the term "wild type" is used herein to describe the naturally occurring or unmodified form of the FSL locus allele and the modified or altered counterparts of the content of the present invention. In this regard, the inventors have shown that there are sex-specific alleles of the FSL locus, i.e., male-specific FSL locus alleles, female-specific FSL locus alleles and hermaphrodite-specific FSL locus alleles. In order to describe the naturally occurring or unmodified form of the respective sex-specific FSL locus allele and the modified or altered counterparts of the present invention, the term "wild type" is also used to represent the respective naturally occurring or unmodified allele form. Therefore, the terms "wild-type male FSL locus allele", "wild-type male allele of the FSL locus" or similar terms used herein should be understood to refer to the naturally occurring or unmodified male allele of the FSL locus. Similarly, the terms "wild-type female FSL locus allele", "wild-type female allele of the FSL locus" or similar terms used herein should be understood to refer to the naturally occurring or unmodified female allele of the FSL locus. Similarly, the terms "wild-type hermaphrodite FSL locus allele", "wild-type hermaphrodite allele of the FSL locus" or similar terms used herein should be understood to refer to the naturally occurring or unmodified hermaphrodite allele of the FSL locus. According to the example in which the plant species is grape, the wild-type alleles of female, hermaphrodite and male can have ORFs comprising the sequences shown in SEQ ID NOs: 5-7, respectively. However, it is understood that the sequences of the female, hermaphroditic, and male alleles of the FSL locus can vary within a particular species (e.g., between different populations), as well as between species (e.g., orthologs). Thus, it is understood that reference to wild type in the context of the female, hermaphroditic, and male alleles of the FSL locus can also include ORF sequences that are at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequences shown in SEQ ID NOs: 5-7, respectively.

[0242] The inventors have also discovered that sex-specific alleles of the FSL locus encode FSL polypeptides having different sequences. Thus, the term "wild-type" as referred to herein in the context of FSL polypeptides refers to naturally occurring or unmodified FSL polypeptide variants encoded by the wild-type hermaphrodite, female and male alleles of the FSL locus described herein, respectively. According to the example in which the plant species is grape, the FSL polypeptides encoded by the wild-type hermaphrodite, female and male alleles of the FSL locus may include the sequences shown in SEQ ID NOs: 1-3, respectively. However, as with the FSL locus and its sex-specific alleles, it should be understood that the FSL polypeptide sequences encoded by the wild-type hermaphrodite, female and male alleles of the FSL locus may vary within a particular species (e.g., between different populations), as well as between different species (e.g., FSL polypeptide orthologs). Therefore, it should be understood that references to FSL polypeptide sequences encoded by wild-type hermaphroditic, female and male alleles of the FSL locus (collectively referred to as "wild-type FSL polypeptides") may also include sequences that have at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97, at least 98%, at least 99% identity to the amino acid sequences shown in SEQ ID NOs: 1-3, respectively.

[0243] The term "wild type" used in the context of a plant or part thereof of the present invention is to be understood as meaning a plant or plant part in which the FSL locus or FSL polypeptide has not been modified, i.e. a plant or plant part comprising the FSL locus or its alleles naturally occurring in that plant species.

[0244] Terms such as "modifying," "modify," "modifies," or similar terms as used herein in the context of modifying the FSL locus or its alleles are to be understood to refer to the introduction of one or more physical changes, including nucleotide substitutions, additions, and / or deletions, into a FSL locus sequence or its alleles relative to a reference FSL locus sequence, such as the sequence of a wild-type male or hermaphrodite allele of the FSL locus. Exemplary modifications are described herein. Modification of the FSL locus sequence can be achieved using any method known in the art for modifying nucleic acids, including, for example, random and site-directed mutagenesis, transgenic expression, CRISPR, TALON, and / or ZFN technology, as described in the art or herein. One or more changes in the FSL locus sequence or its alleles preferably result in one or more changes in the amino acid sequence of the FSL polypeptide encoded thereby, such as one or more amino acid additions, deletions, or substitutions relative to the FSL polypeptide sequence encoded by the corresponding unmodified FSL locus sequence or its alleles. Thus, a change in the level of FSL polypeptide activity can be achieved by introducing one or more changes in the sequence of the FSL locus or its alleles. Preferably, the FSL polypeptide activity is reduced or eliminated by modifying the sequence of the FSL locus or its alleles and the corresponding FSL polypeptide encoded thereby. However, in some alternative examples, the FSL polypeptide activity can be increased by modifying the sequence of the FSL locus or its alleles, for example, by introducing one or more copies of the male allele or hermaphroditic allele of the FSL locus into the plant or plant part using recombinant methods.

[0245] As used herein, the term "heterozygous" refers to the presence of different alleles (forms of a given gene) at a particular locus. Thus, reference to a "heterozygote" refers to a diploid or polyploid individual plant cell or plant having different alleles (forms of a given gene) present at at least one locus.

[0246] As used herein, the term "homozygous" refers to the presence of identical alleles at one or more loci in homologous chromosome segments. Therefore, "homozygous" as mentioned herein refers to a single plant cell or plant having identical alleles at one or more loci.

[0247] As used herein, the term "progeny plants capable of expressing a desired floral sex phenotype based on the FSL locus genotype" is understood to refer to progeny having a FSL locus genotype that confers the desired floral sex phenotype. In some instances, the "progeny plants capable of expressing a desired floral sex phenotype based on the FSL locus genotype" actually express the desired floral sex phenotype, i.e., the progeny plants are in the flowering stage or the flowers are in the development stage. In other instances, the "progeny plants capable of expressing a desired floral sex phenotype based on the FSL locus genotype" are not in the flowering stage, for example, at a certain step. This may be because the progeny plants are immature and cannot yet bloom, or because environmental conditions are not conducive to flowering.

[0248] No core

[0249] As used herein, the term "fruit" is understood to mean the seed-bearing structure that develops from the ovary of an angiosperm flower, usually after fertilization with viable pollen.

[0250] As used herein, the term "seed" is intended to include "mature seeds" as well as "developing seeds," which occurs after fertilization, before establishment of seed dormancy and before harvest.

[0251] The term "seedless" as used herein in the context of fruits may refer to the complete absence of hard seeds in the (ripe) fruit (i.e. "seedless group" due to parthenocarpy) and / or a significant reduction in the total number of seeds (i.e. "reduced seed group") and / or the arrest of seed development at an early stage (e.g. due to seedless fruit), such that the final number of fully developed seeds is significantly reduced, wherein significantly reduced means reduced to at least 40% of the wild type, preferably reduced to at least 50%, 60%, 70%, 80%, 90%, 95% or 98% of the wild type, most preferably reduced to 100% (i.e. completely seedless). Seed-aborted seedless fruits occur by a biological process whereby the perianth is fertilized and seed development begins, but the development of the seed is interrupted at an early stage, leaving a "seed trace" in the fruit. Thus, the term "seedless" as used herein includes phenotypes in which the fruit contains seed traces or one or more soft seeds, which are the remains of abnormally interrupted undeveloped seeds.

[0252] Dwarf

[0253] The present invention provides novel plants or plant parts that produce seedless fruit, wherein the plants or plant parts have an altered, e.g., reduced, FSL polypeptide activity as described herein, and a polynucleotide that confers a dwarf morphology.

[0254] The present invention provides novel plants or plant parts that produce seedless fruits, wherein the plants or plant parts include a FSL locus homozygous for the female allele (f / f) of the FSL locus as described herein, and a polynucleotide that confers a dwarf morphology. For plants or plant parts homozygous for the female allele (f / f) of the FSL locus, flower sex SNPs as described herein can be used for identification.

[0255] As used herein, a "dwarf" plant is understood to mean an individual plant or plant variety of a particular species that is shorter in height relative to the average (normal) height of the particular species. Thus, a "dwarf type" is a dwarfed morphology.

[0256] The literature is rich with the development of dwarf plants including genes and means to achieve dwarf morphology.Any polynucleotide known in the art for conferring dwarf morphology on plants is contemplated herein.

[0257] In one example, a polynucleotide that confers dwarf morphology to a plant is altered relative to the corresponding wild-type or naturally occurring polynucleotide sequence.

[0258] The present inventors have previously described the development of dwarf grapevines (termed "microvines") with a rapid flowering phenotype (Boss and Thomas, (2002) Nature, 416(6883): 847-850). The previously reported "microvine" phenotype is based on a variant of the gibberellic acid insensitive (VvGAI1) gene that includes a SNP (T to A mutation) in the translation region at position 231 of the normal VvGAI1 gene. The point mutation present in the variant VvGAI1 gene converts a leucine residue in the conserved DELLA domain to a histidine, thereby altering the gibberellic acid (GA) response properties of the plant. When present in a heterozygous (GAI1 / gai1) or homozygous (gai1 / gai1) state, the variant GAI1 gene causes a dwarf and rapid flowering phenotype. Thus, in some instances, reference herein to a "mutated gibberellic acid insensitive (GAI1) gene" or the like in the context of a plant or its plant progeny, propagation material or fruit should be understood to refer to a mutant GAI1 gene variant that confers a dwarf and rapid flowering phenotype as previously described in Boss and Thomas (2002), the entire contents of which are incorporated herein by reference, or other mutant GAI1 gene variants that similarly prevent the GAI1 protein from responding to GA signal transduction.

[0259] In one example, the polynucleotide that confers a dwarf morphology is a variant of the GAI1 gene or a fragment thereof. The variant of the GAI1 gene can encode a "variant GAI1 protein". In one example, the variant of the GAI1 gene or a fragment thereof includes one or more mutations in the region encoding the DELLA domain. For example, one or more mutations in the region encoding the DELLA domain of the GAI1 protein can change the GA response characteristics of the plant or plant part, for example, as in microvines. For example, one or more mutations in the DELLA domain can prevent the plant or plant part from responding to GA signal transduction. Therefore, in some examples, plants or plant parts comprising variants of the GAI1 gene or a fragment thereof are unresponsive or respond poorly to GA signal transduction. One or more mutations can be selected from amino acid substitutions, deletions or additions. In one example, the variant GAI1 protein may include a sequence having a Leu to His substitution at position 38 of SEQ ID NO: 8, or a sequence having at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity to the sequence shown in SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a more basic residue, such as His. In one example, the variant GAI1 protein includes a sequence having at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, or at least 99.8% identity to the sequence shown in SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a more basic residue, such as His.

[0260] The variant GAI1 protein may include the sequence shown in SEQ ID NO: 9. According to this example, the plant or plant part may be a "microvine" as described in Boss and Thomas, (2002) Nature, 416(6883): 847-850, having an altered level of FSL polypeptide activity as described herein. In other examples, the DELLA domain may be altered, truncated or completely deleted from the GAI1 gene or fragment thereof, for example as a result of one or more mutations. The one or more mutations preferably result in a non-functional GAI1 gene.

[0261] The polynucleotide conferring dwarf morphology, such as a variant of the GAI1 gene or a fragment thereof, may exist in a homozygous (GAI1 / GAI1) state or a heterozygous (GAI1 / Gai1) state.

[0262] Also contemplated are plants or plant parts in which the GAI1 protein or its DELLA domain is silenced (e.g., post-transcriptionally silenced using an RNAi agent). According to this example, the polynucleotide conferring a dwarf morphology on a plant can be an RNAi agent targeting an mRNA transcript of the GAI1 protein (e.g., corresponding to a DELLA domain). RNAi agents are described herein.

[0263] In each of the foregoing embodiments describing a plant or plant part having an altered level of FSL polypeptide activity and a polynucleotide that confers a dwarf morph, the plant or plant part can produce parthenocarpic, seedless fruit when the flowers are not pollinated, and can produce fruit containing seeds when the flowers are pollinated by viable pollen.

[0264] Seedless fruit

[0265] The present invention also contemplates novel plants and plant parts that produce seedless fruit, wherein the plant or plant part comprises: an altered, e.g., reduced, level of FSL polypeptide activity as described herein; a polynucleotide that confers a dwarf morph as described herein; and a polynucleotide that confers seedless fruit.

[0266] The present invention also contemplates novel plants and plant parts that produce seedless fruit, wherein the plant or plant part comprises an FSL locus homozygous for the female allele (f / f) of the FSL locus as described herein; a polynucleotide conferring a dwarf morph as described herein; and a polynucleotide conferring seedless fruit.

[0267] "Seedless fruit" is a biological mechanism that produces seedlessness in some fruits, particularly many table grapes. In "seed aborted" seedless fruit, normal pollination and fertilization are still required to ensure that the fruit "sets", i.e., continues to develop on the plant; however, the subsequent abortion of the embryo that begins to grow after fertilization results in a state close to seedlessness. The remnants of the undeveloped seeds are visible in the fruit. "Seedless" table grape varieties produce seedless fruit because the flowers are fertilized and the seeds begin to develop, but development stops at an early stage, leaving traces of the seeds in the fruit. In some instances, the fruit produced from the plants or plant parts of the present invention is "seedless", which has a consistent seedless phenotype exhibited by fruit produced from fertilized female ovules of seed aborted plants. Typically, seed aborted fruit may contain one or more "soft seeds", which are the remains of a stagnant fertilized seed.

[0268] Parthenocarpy is identified from seedless fruit. "Parthenocarpy" is generally understood in the art, and is also understood in connection with the present invention to describe the development of fruit without fertilization of the female ovule. "Parthenocarpy" literally means "fruit in its original state". Since no pollination process is required to produce the fruit, seeds never develop. In this sense, "parthenocarpy" fruit exhibits true seedlessness.

[0269] Any polynucleotide known in the art for conferring seedless fruit to plants is contemplated herein. In some instances, the polynucleotide conferring seedless fruit to plants or parts thereof may be altered relative to the corresponding wild-type or naturally occurring gene. In a specific example, the polynucleotide conferring seedless fruit to plants or parts thereof is a variant of the grape MADS box protein 5 (VvMADS5) locus. When present in a heterozygous or homozygous state, it is known that variant or mutated VvMADS5 locus (also referred to as VviAGL11) is associated with the seedless fruit (SDL1) seedless phenotype in the genus Vitus. Mutations in VvMADS5 variants result in G to T substitutions at 590bp of the coding sequence, resulting in Arg197Leu substitutions (Royo et al., 2018). Therefore, "mutated VvMADS5 genes associated with seedless fruit", "variant VvMADS5 loci" or the like mentioned herein should be understood to include the mutant VvMADS5 genes described in Royo et al. (2018), the entire contents of which are incorporated herein by reference.

[0270] In one example, the polynucleotide that confers seedless fruit is a variant of the VvMADS5 locus. The VvMADS5 locus encoding the VvMADS5 protein (i.e., the endogenous or non-variant protein) may include the amino acid sequence shown in SEQ ID NO: 10, and the variant VvMADS5 protein may include a replacement of Arg at position 197 of the sequence shown in SEQ ID NO: 10 with a hydrophobic amino acid, such as Leu (R197L). In one example, the variant VvMADS5 locus encodes a variant VvMADS5 protein, the variant VvMADS5 protein includes the amino acid sequence shown in SEQ ID NO: 11 or a sequence having at least 80% identity thereto (e.g., at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity with the sequence shown in SEQ ID NO: 11), provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. For example, the variant VvMADS5 locus can encode a variant VvMADS5 protein comprising an amino acid sequence having at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identity to the sequence shown in SEQ ID NO: 11, provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. In a specific example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising the amino acid sequence shown in SEQ ID NO: 11, as described in Royo et al., 2018. In other examples, the VvMADS5 protein is truncated or completely absent from the plant or plant part, for example as a result of one or more mutations of the VvMADS5 locus. The one or more mutations preferably result in a non-functional VvMADS5 protein.

[0271] The polynucleotides of the variant VvMADS5 locus conferring seedless fruit, eg, encoding the variant VvMADS5 proteins described herein, may be present in a homozygous or heterozygous state.

[0272] In another example, the VvMADS5 protein is silenced, such as post-transcriptionally. According to this example, the polynucleotide that confers seedless fruit to a plant can be an RNAi agent that targets an mRNA transcript encoded by the VvMADS5 locus.

[0273] In each of the foregoing examples describing a plant or plant part further comprising a polynucleotide that confers seedless fruit, the plant produces parthenocarpic seedless fruit when the flower is not pollinated and produces seed-aborting fruit when the flower is pollinated by viable pollen.

[0274] Peptides

[0275] As used herein, the term "FSL polypeptide" is understood to refer to a polypeptide encoded by the FSL locus or its alleles as described herein, the activity of which has been shown by the inventors to be responsible for the sex of flowers. In particular, the inventors have shown that the FSL polypeptides encoded by the male and hermaphroditic alleles of the FSL locus are responsible for the development of the male reproductive organs of flowers. As used herein, the term "FSL polypeptide" generally relates to a family of proteins having a high level of substantial sequence identity to the polypeptide sequences shown in SEQ ID NOs: 1-3, such as FSL polypeptide sequences having at least 40% identity to the sequences shown in SEQ ID NOs: 1-3 (e.g., having at least 50%, or at least 60%, preferably at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity to the sequences shown in SEQ ID NOs: 1-3). Orthologs of those sequences corresponding to a particular plant species of interest are also contemplated. The inventors have determined that the altered activity levels of certain variants of the FSL polypeptide family cause altered floral sex phenotypes when expressed in plants. Examples of variants include the amino acid sequence provided in SEQ ID NO:2, encoded by the female allele of the FSL locus. The FSL polypeptide variants (referred to herein as female FSL polypeptides) confer male loss of function, i.e., functional male reproductive parts do not develop in flowers, relative to the FSL polypeptides encoded by the corresponding hermaphroditic and male alleles of the FSL locus (shown in SEQ ID NOs:1 and 3, respectively). In certain embodiments, the FSL polypeptide variants that confer male loss of function do not include a methionine (M) at the position corresponding to amino acid position 138 of the sequence shown in SEQ ID NO:2. In other embodiments, the FSL polypeptide variants that confer male loss of function include one or more or all of the amino acids at positions 79, 120, 145, 166, 195, 200, 226, 232 of the sequence shown in SEQ ID NO:1. In a specific example, the activity of a FSL polypeptide encoded by a male or hermaphroditic allele of the FSL locus can be altered to confer male loss of function by modifying one or more amino acids as described herein, as these alleles are believed to be required for the development of functional male reproductive organs.

[0276] The inventors have identified that the FSL polypeptide includes a "plant AT-rich sequence and zinc binding" or "PLATZ" domain. The PLATZ superfamily of transcription factors has been found to exist only in plants and are likely transcription factors. Prior to the present invention, PLATZ proteins had not been identified as being involved in flower sex determination. The inventors have identified the PLATZ domains at positions 26 to 75 of the sequences set forth in SEQ ID NOs: 1 and 3 and at positions 24 to 73 of the sequence set forth in SEQ ID NO: 2 in the grape FSL polypeptide. Thus, the "PLATZ domain" referred to herein is intended to include amino acid sequences from positions 26 to 75 of the sequences shown in SEQ ID NOs: 1 and 3 and from positions 24 to 73 of the sequence shown in SEQ ID NO: 2, as well as PLATZ domains of FSL polypeptides having at least 40% identity to those sequences (e.g., at least 80%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the PLATZ domains within the sequences shown in SEQ ID NOs: 1-3). Orthologs of those sequences corresponding to a particular plant species of interest are also contemplated. In some examples, one or more mutations can be introduced into the PLATZ domain of a FSL polypeptide to alter the activity of the FSL polypeptide, such as to confer loss of male function.

[0277] The "variant GAI1 protein" mentioned herein should be understood to mean a protein or polypeptide encoded by a variant of the GAI1 gene or a fragment thereof, which includes one or more mutations, for example in the region encoding the DELLA domain, as described herein. The one or more mutations in the region encoding the DELLA domain of the GAI1 protein preferably alter the GA response characteristics of the plant or plant part expressing the variant GAI1 protein. The one or more mutations may be selected from amino acid substitutions, deletions or additions. Exemplary "variant GAI1 proteins" include, but are not limited to, a sequence including a Leu to His substitution at position 38 as shown in SEQ ID NO: 8, or a sequence having at least 80% identity thereto (e.g., having at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity to the sequence shown in SEQ ID NO: 8), provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, such as His. In preferred examples, the variant GAI1 protein includes a sequence having at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7% or at least 99.8% identity to the sequence shown in SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a larger basic residue such as His. A preferred variant GAI1 protein may include the sequence shown in SEQ ID NO: 9.

[0278] Reference herein to a "variant VvMADS5 protein" should be understood to mean any protein or polypeptide encoded by a variant VvMADS5 locus or a fragment thereof, provided that the polypeptide differs in sequence from a wild-type or naturally occurring VvMADS5 protein. Exemplary "variant VvMADS5 proteins" include, but are not limited to, those polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 11, or a sequence having at least 80% identity thereto (e.g., at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity to the sequence set forth in SEQ ID NO: 11), provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. For example, the variant VvMADS5 locus can encode a variant VvMADS5 protein comprising an amino acid sequence having at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identity to the sequence shown in SEQ ID NO: 11, provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, such as Leu. A preferred variant VvMADS5 protein comprises the amino acid sequence shown in SEQ ID NO: 11, as described in Royo et al., 2018.

[0279] As used herein, a "biologically active fragment" of a FSL polypeptide is a portion of a FSL polypeptide of the present invention that retains the activity of the full-length FSL polypeptide. As used herein, biologically active fragments do not include the full-length polypeptide. Biologically active fragments can be portions of any size, as long as they retain a defined activity. In one example, a biologically active fragment of a FSL polypeptide is a PLATZ domain. Preferably, the biologically active fragment retains at least 10% of the activity of the full-length polypeptide.

[0280] The terms "polypeptide" and "protein" are often used interchangeably herein.

[0281] A polypeptide or polypeptides may be defined by the degree of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater % identity to one reference amino acid sequence than to another reference amino acid sequence. The % identity of a polypeptide to a reference amino acid sequence is typically determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) with parameters of gap creation penalty=5, and gap extension penalty=0.3. The query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns the two sequences over their full length and the degree of identity is determined over the full length of the reference sequence. A polypeptide or polypeptides may have the same enzymatic activity as a reference polypeptide, or an activity different from that of a reference polypeptide, or lack the activity of a reference polypeptide. Preferably, the activity of a FSL polypeptide whose activity is altered according to the invention is at least 10% lower (e.g., at least 20% lower, or at least 30% lower, or at least 40% lower, or at least 50% lower, or at least 60% lower, or at least 70% lower, or at least 80% lower, or at least 90% lower) than the activity of a reference FSL polypeptide (e.g., a FSL polypeptide encoded by a wild-type allele of a FSL locus as described herein). In some examples, an alteration in the level of FSL polypeptide activity means that FSL activity is absent.

[0282] As used herein, a "biologically active fragment" is a portion of a polypeptide of the present invention that retains a defined activity of a full-length reference polypeptide. As used herein, biologically active fragments do not include full-length polypeptides. Biologically active fragments can be portions of any size, as long as they retain a defined activity.

[0283] With respect to a defined polypeptide or enzyme, it will be appreciated that higher % identity figures than those provided herein will include preferred embodiments. Thus, where applicable, based on the minimum % identity figures, preferred polypeptides / enzymes include an amino acid sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, even more preferably at least 99.9% identical to the associated named SEQ ID NO.

[0284] The amino acid sequence mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into the nucleic acids defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues in the amino acid sequence. A combination of deletions, insertions and substitutions can be performed to obtain the final construct, provided that the final polypeptide product has the desired characteristics.

[0285] Mutant (altered or variant) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from the mutated / altered DNA can be readily screened using techniques known in the art and described herein to determine whether they have FSL polypeptide activity and affect the development of male reproductive part flowers.

[0286] When designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the feature to be modified. Mutation sites can be modified individually or in tandem, for example, by (1) first replacing with conservative amino acid selections and then replacing with more radical selections based on the results obtained, (2) deleting the target residue or (3) inserting other residues adjacent to the targeted site.

[0287] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably from about 1 to 10 residues, and usually from about 1 to 5 contiguous residues.

[0288] The substitution mutant has removed at least one amino acid residue in the polypeptide and inserted a different residue in its place. The optimal target site for substitution mutagenesis to inactivate the enzyme includes a site identified as the active site. Other target sites are sites identical to the specific residues obtained from various strains or species. These positions may be important for biological activity. These sites, especially those sites belonging to sequences of at least three other identical conservative sites, are preferably replaced in a relatively conservative manner. Such conservative replacements are presented under the title of "exemplary replacements" in Table 1.

[0289] Table 1. Exemplary substitutions.

[0290]

[0291] In a preferred embodiment, when compared to a naturally occurring polypeptide, the mutant / variant polypeptide has only or no more than one or two or three or four amino acid changes. Mutants with the desired activity can be engineered using standard methods in the art, for example by random mutagenesis, targeted mutagenesis or saturation mutagenesis of known target genes, or by DNA shuffling of different genes.

[0292] Also contemplated are FSL polypeptides of the invention, for example, with altered FSL activity, which are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, attachment to antibody molecules or other cellular ligands, etc. Such polypeptides may be post-translationally modified in cells, for example, by phosphorylation, which may modulate their activity. These modifications may be used to increase the stability and / or biological activity of the FSL polypeptides of the invention.

[0293] Polynucleotide

[0294] The terms "polynucleotide" and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or their analogs. The polynucleotides of the present invention may be of genomic, cDNA, semisynthetic or synthetic origin, double-stranded or single-stranded, and by virtue of their origin or manipulation: (1) not associated with all or part of a polynucleotide to which it is naturally associated, (2) linked to a polynucleotide other than a polynucleotide to which it is naturally associated, or (3) not naturally present. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, chimeric DNA of any sequence, nucleic acid probes and primers. For in vitro applications, the polynucleotides may include modified nucleotides, for example by conjugation to a labeling component.

[0295] As used herein, "isolated polynucleotide" refers to a polynucleotide that has been separated from polynucleotide sequences with which it is associated or linked in its native state, or a non-naturally occurring polynucleotide.

[0296] As used herein, the term "gene" is considered in its most extensive context, and includes a deoxyribonucleotide sequence that includes the transcription region (if translated) and the protein coding region of the structural gene, and includes sequences adjacent to the coding region at the 5' and 3' ends, the distance at either end being at least about 2kb, and it participates in the expression of the gene. In this regard, the gene includes a control signal, such as a promoter, enhancer, termination and / or polyadenylation signal or a heterologous control signal that is naturally associated with a given gene, in which case the gene is referred to as a "chimeric gene". The sequence that is located 5' of the protein coding region and present on the mRNA is referred to as a 5' non-translated sequence. The sequence that is located 3' or downstream of the protein coding region and present on the mRNA is referred to as a 3' non-translated sequence. The term "gene" includes cDNA and genomic forms of the gene. The genomic form or clone of the gene contains a coding region that is interrupted by a non-coding sequence that can be referred to as an "intron", "interval" or "interval sequence". Introns are gene fragments that are transcribed into nuclear RNA (nRNA). Introns can contain regulatory elements such as enhancers. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; thus, introns are not present in the mRNA transcript. A gene containing at least one intron can undergo alternative splicing to produce alternative mRNAs from a single transcribed gene, thereby producing polypeptide variants. A gene in its native state or a chimeric gene may lack introns. The mRNA functions during translation to determine the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes synthetic or fusion molecules encoding all or part of the proteins of the invention described herein and nucleotide sequences complementary to any of the above.

[0297] As used herein, "chimeric DNA" refers to any DNA molecule that is not naturally found in nature; also referred to herein as a "DNA construct" or "gene construct". Typically, chimeric DNA includes regulatory and transcriptional or protein coding sequences that are not naturally found together in nature. Therefore, chimeric DNA may include regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different from that which occurs in nature. The open reading frame may or may not be connected to its natural upstream and downstream regulatory elements. The open reading frame may be incorporated into, for example, a plant genome, a non-natural location, or a replicon or vector that is not naturally found, such as a bacterial plasmid or a viral vector. The term "chimeric DNA" is not limited to DNA molecules that can be replicated in a host, but includes DNA that can be connected to a replicon by, for example, a specific conjugant sequence.

[0298] The terms "genetically modified," "genetically modified," "modified" (in the context of nucleic acid sequences) and variations thereof are broader terms that include introducing a gene into a cell by transformation or transduction, mutating a gene in a cell and genetically altering or modulating the regulation of a gene in a cell or in the progeny of any cell modified as described above.

[0299] The "recombinant polynucleotide" of the present invention refers to a nucleic acid molecule constructed or modified by an artificial recombination method. The recombinant polynucleotide may be present in a cell or part thereof of a plant in an amount changed compared to its natural state or expressed at a changed rate (e.g., in the case of mRNA). In one embodiment, the polynucleotide is endogenous to the plant or part thereof, and its expression is changed by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous target gene so that the transformed plant or part thereof can express a polypeptide encoded by the gene, or a deletion is produced in the target gene by ZFN, Talen or CRISPR methods.

[0300] "Recombinant polynucleotides" of the present invention include polynucleotides that have not been separated from other components of a cell-based or cell-free expression system in which they are present, as well as polynucleotides produced in a cell-based or cell-free system and subsequently purified from at least some other components. A polynucleotide may be a continuous nucleotide segment or comprise two or more continuous nucleotide segments from different sources (naturally occurring and / or synthetic) that are linked to form a single polynucleotide. Typically, such a chimeric polynucleotide comprises at least one open reading frame encoding a polypeptide of the present invention, the open reading frame being operably linked to a promoter suitable for driving transcription of the open reading frame in a target cell.

[0301] In addition, in the context of polynucleotides (nucleic acids), the term "exogenous" refers to a polynucleotide that does not naturally include the polynucleotide when present in a cell. The cell can be a cell that includes a non-endogenous polynucleotide that causes an altered production of the encoded polypeptide, such as an exogenous polynucleotide that increases expression of an endogenous polypeptide, or a cell that does not produce the polypeptide in its native state. The increase in the production of a polypeptide of the present invention is also referred to herein as "overexpression."

[0302] With respect to defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will include preferred embodiments. Thus, where applicable, based on the minimum % identity figures, preferred polynucleotides include a polynucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, even more preferably at least 99.9% identical to the associated named SEQ ID NO.

[0303] A polynucleotide of the invention or useful in the invention may selectively hybridize under stringent conditions to a polynucleotide as defined herein. As used herein, stringent conditions are: (1) use of a denaturing agent such as formamide during hybridization, e.g., 50% (v / v) formamide with 0.1% (w / v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer (pH 6.5) with 750 mM NaCl, 75 mM sodium citrate at 42°C; (2) use of 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, salmon sperm DNA (50 g / ml) sonicated in 0.2×SSC and 0.1% SDS at 42°C, 0.1% SDS and 10% dextran sulfate, and / or (3) use of low ionic strength and high temperature for washing, e.g., 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50°C.

[0304] When compared to naturally occurring molecules, the polynucleotides of the invention may have one or more mutations, which are deletions, insertions or substitutions of nucleotide residues. The polynucleotides having mutations relative to a reference sequence may be naturally occurring (i.e., isolated from a natural source) or synthetic (e.g., by site-directed mutagenesis or DNA shuffling on nucleic acids as described herein).

[0305] Nucleic acid construct

[0306] The present invention includes nucleic acid constructs comprising polynucleotides that can be used to prepare plants and plant parts of the present invention, as well as vectors and host cells containing these, their production methods and uses, and their uses. The present invention relates to elements that are operably linked or connected. "Operably linked" or "operably connected" etc. refer to polynucleotide elements that are connected in a functional relationship. Generally, operably linked nucleic acid sequences are continuously connected, and when it is necessary to connect two protein coding regions, they are continuous and in the reading frame. When RNA polymerase transcribes two coding sequences into a single RNA, the coding sequence is "operably linked to" another coding sequence, and if the single RNA is translated, it is translated into a single polypeptide with amino acids derived from the two coding sequences. Coding sequences do not have to be adjacent to each other, as long as the expressed sequence is ultimately processed to produce the desired protein.

[0307] As used herein, the term "cis-acting sequence", "cis-acting element" or "cis-regulatory region" or "regulatory region" or similar terms should be understood to mean any nucleotide sequence that, when appropriately positioned and linked relative to an expressible genetic sequence, is capable of at least partially regulating the expression of a genetic sequence. Those skilled in the art will appreciate that a cis-regulatory region is capable of activating, silencing, enhancing, inhibiting or altering the expression level and / or cell type specificity and / or developmental specificity of a genetic sequence at the transcriptional or post-transcriptional level. In a preferred embodiment, the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.

[0308] "Operably connecting" a promoter or enhancer element to a transcribable polynucleotide refers to placing a transcribable polynucleotide (e.g., a polynucleotide encoding a protein or other transcript) under the regulation of a promoter, which then controls the transcription of the polynucleotide. In the construction of a heterologous promoter / structural gene combination, it is generally preferred that a promoter or a variant thereof be positioned at a certain distance from the transcription start site of a transcribable polynucleotide, which is approximately the same as the distance between the promoter and the protein coding region controlled by the promoter in its natural environment; that is, the gene from which the promoter originates. As known in the prior art, some changes in this distance can be adjusted without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, an enhancer, etc.) relative to a transcribable polynucleotide to be placed under its control is limited by the positioning of the element in its natural environment; that is, the gene from which it originates.

[0309] "Promoter" or "promoter sequence" as used herein refers to a region of a gene, usually upstream (5') of the RNA coding region, which controls the initiation and level of transcription in the target cell. "Promoter" includes transcriptional regulatory sequences of classical genomic genes, such as TATA box and CCAAT box sequences, and additional regulatory elements (i.e., upstream activation sequences, enhancers, and silencers) that respond to developmental and / or environmental stimuli or change gene expression in a tissue-specific or cell-type-specific manner. Promoters are usually, but not necessarily (e.g., some Pol III promoters) located upstream of structural genes, which regulate the expression of structural genes. In addition, regulatory elements including promoters are usually located within 2kb of the transcription start site of the gene. Promoters may contain other specific regulatory elements located further away from the start site to further enhance expression in the cell, and / or change the time or inducibility of expression of structural genes operably linked thereto.

[0310] "Constitutive promoter" refers to a promoter that directs expression of an operably linked transcribed sequence in many or all tissues of an organism, such as a plant. The term constitutive as used herein does not necessarily mean that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in the level is usually detectable.

[0311] In a preferred embodiment, if a constitutive promoter is used, it results in high levels of mRNA transcribed from the exogenous polynucleotide, such that the level of a specific NAC transcription factor produced in at least a portion of the plant is at least about 5-fold or 10-fold or 15-fold or 20-fold higher than that of an isogenic wheat plant lacking the exogenous polynucleotide. Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992, 1993), Sambrook et al. (1989, supra) and US 5,164,316. Examples of constitutive promoters that can result in these levels of mRNA production include, but are not limited to, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO99 / 43838 and US 6,072,050; the core CaMV 35S promoter (Odell et al., 1985) or an enhanced form thereof; rice actin (McElroy et al., 1990); ubiquitin (Christensen et al., 1989 and 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (US 5,659,026), etc. Other constitutive promoters include, for example, those discussed in US Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0312] As used herein, "selective expression" refers to expression almost exclusively in a particular organ of a plant, such as an egg cell, sperm cell, ovule, pollen, stamen, anther, endosperm, embryo, leaf or root. In a preferred embodiment, the promoter is selectively or preferentially expressed in flowers or flower parts of grapevine plants. Thus, selective expression can be contrasted with constitutive expression, and refers to expression in many or all tissues of a plant under most or all conditions experienced by the plant.

[0313] Selective expression can also result in the compartmentalization of gene expression products in specific plant tissues, organs or developmental stages. Compartmentalization in specific subcellular locations such as plastids, cytosols, vacuoles or non-plastid spaces can be achieved by including appropriate signals in the structure of the gene product, such as signal peptides, for transport to the desired cellular compartment, or in the case of semi-autonomous organelles (plastids and mitochondria), by integrating the transgene with appropriate regulatory sequences directly into the organelle genome.

[0314] A "tissue-specific promoter" or "organ-specific promoter" is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably in most, if not all, other tissues or organs in, for example, a plant. Typically, a promoter is expressed at a level 10-fold higher in a specific tissue or organ than in other tissues or organs.

[0315] An "inducible promoter" selectively expresses an operably linked DNA sequence in response to an endogenous or exogenous stimulus, such as by the presence of a chemical compound (chemical inducer), or in response to an environmental, hormonal, chemical, and / or developmental signal. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, infection or drought, plant hormones, wounds, or chemicals such as ethanol, jasmonates, salicylic acid, or safeners. As used herein, a "plant stress-inducible promoter" is any inducible promoter that is functional in wheat plants, and the term is therefore not limited to promoters derived from plants.

[0316] Suitable inducible promoters for expressing the above nucleic acids in plants include promoters that are induced by physiological or environmental conditions that trigger or are associated with flowering. Suitable inducible promoters are known in the art and are contemplated herein.

[0317] Other operable cis-acting sequences include transcription and / or translation enhancers. The enhancer region is well known to those skilled in the art, and may include an ATG translation initiation codon and adjacent sequences. When including an initiation codon, the initiation codon should be in phase with the coding sequence reading frame, which relates to external or exogenous polynucleotides, to ensure translation of the entire sequence, if to be translated. The translation initiation region may be provided by the source of the transcription initiation region, or may be provided by an external or exogenous polynucleotide. The sequence may also derive from the source of a promoter selected for driving transcription, and may be specifically modified to increase the translation of mRNA.

[0318] The nucleic acid construct of the present invention may include a 3' non-translated sequence of about 50 to 1,000 nucleotide base pairs, which may include a transcription termination sequence. The 3' non-translated sequence may contain a transcription termination signal, which may include or exclude a polyadenylation signal and any other regulatory signal that can affect mRNA processing. The polyadenylation signal is used to add a polyadenylic acid fragment to the 3' end of the mRNA precursor. The polyadenylation signal is usually identified by the presence of homology to the standard type 5'AATAAA-3', although variations are not uncommon. The transcription termination sequence that does not include a polyadenylation signal includes the terminator of PolI or PolIII RNA polymerase, which includes 4 or more thymidines. An example of a suitable 3' non-translated sequence is a 3' transcription non-translated region (Bevan et al., 1983) containing a polyadenylation signal of the octopine synthase (ocs) gene or the nopaline synthase (nos) gene from Agrobacterium tumefaciens. Suitable 3' non-translated sequences may also be derived from plant genes, such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those skilled in the art may also be used.

[0319] Since the DNA sequence inserted between the transcription start site and the start of the coding sequence, i.e., the untranslated 5' leader sequence (5'UTR), can affect gene expression if it is translated and transcribed, one can also use a specific leader sequence. Suitable leader sequences include those that include sequences selected to direct optimal expression of exogenous or endogenous DNA sequences. For example, such leader sequences include preferred sequences that can increase or maintain mRNA stability and prevent inappropriate translation initiation as described by Joshi (1987).

[0320] Polynucleotides for reducing gene expression

[0321] The change of the activity level of the FSL polypeptide according to the present invention can also be achieved by post-transcriptional silencing of messenger RNA (mRNA) transcribed from the FSL locus using RNA interference (RNAi). The term "RNA interference" or "RNAi" generally refers to RNA-dependent silencing of gene expression triggered by double-stranded RNA (dsRNA) molecules in the cytoplasm of cells. The dsRNA molecules reduce or inhibit the transcription product of the target nucleic acid sequence, thereby silencing the gene or reducing the expression of the gene. "Double-stranded RNA" or "dsRNA" refers to an RNA molecule having a double-stranded structure and including an "antisense sequence" or "guide strand" and a "sense sequence" or "follower strand" of similar length to each other. Homologous antisense and sense sequences can be in a single RNA strand or in separate RNA strands. The antisense sequence is substantially complementary to the target sequence, which in the case of the present invention is a region of the FSL polypeptide transcript. A series of different RNAi techniques known in the art can be used to alter the activity of the FSL polypeptide. The altered FSL polypeptide activity can be determined relative to the level of activity of the FSL polypeptide in a corresponding wild-type plant or part thereof, in which no modification has been made to the FSL locus sequence or expression product.

[0322] RNA interference

[0323] RNA interference (RNAi) is particularly useful for specifically reducing the expression of a gene, which, if the gene encodes a protein, results in a reduction in the production of a particular protein. Although not wishing to be limited by theory, Waterhouse et al. (1998) have provided a model of the mechanism by which dsRNA (double-stranded RNA) can be used to reduce protein production. The technology relies on the presence of dsRNA molecules containing sequences substantially identical to the mRNA of the target gene or a portion thereof. Conveniently, dsRNA can be produced by a single promoter in a recombinant vector or host cell, wherein the sense and antisense sequences are flanked by unrelated sequences, which allow the sense and antisense sequences to hybridize to form dsRNA molecules, and the unrelated sequences form a loop structure. The design and production of suitable dsRNA molecules are well within the capabilities of those skilled in the art, particularly in view of Waterhouse et al. (1998), Smith et al. (2000), WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815.

[0324] In one example, a DNA is introduced that directs the synthesis of at least a portion of a double-stranded RNA product that has homology to a target gene to be inactivated (e.g., the FSL locus). Thus, the DNA includes sense and antisense sequences that, when transcribed into RNA, can hybridize to form a double-stranded RNA region. In one embodiment of the invention, the sense and antisense sequences are separated by a spacer region that includes introns that are spliced ​​off when transcribed into RNA. This arrangement has been shown to result in more efficient gene silencing (Smith et al., 2000). The double-stranded region can include one or two RNA molecules transcribed from one or two DNA regions. The presence of the double-stranded molecule is believed to be a response from an endogenous system that destroys double-stranded RNA and homologous RNA transcripts from the target gene, effectively reducing or eliminating the activity of the target gene.

[0325] The length of the sense and antisense sequences of the hybridization should each be at least 19 consecutive nucleotides, preferably at least 50 consecutive nucleotides, more preferably at least 100 or at least 200 consecutive nucleotides. Typically, sequences of 100-1000 nucleotides corresponding to the target gene mRNA region are used. The full-length sequence corresponding to the entire gene transcript can be used. The degree of identity of the sense sequence to the target transcript (and therefore also the identity of the antisense sequence to the complementary sequence of the target transcript) should be at least 85%, at least 90% or 95-100%. The RNA molecule can of course include unrelated sequences, which can act as a stabilizing molecule. The RNA molecule can be expressed under the control of an RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.

[0326] Preferred small interfering RNA ("siRNA") molecules include a nucleotide sequence identical to about 19-25 consecutive nucleotides of the target mRNA. Preferably, the siRNA sequence begins with the dinucleotide AA, includes a GC content of about 30-70% (preferably 30-60%, more preferably 40-60%, more preferably about 45%-55%), and does not have a high percentage identity with any nucleotide sequence other than the target in the genome of the organism to be introduced, for example, as determined by a standard BLAST search.

[0327] MicroRNA

[0328] MicroRNA (abbreviated as miRNA) is a non-coding RNA molecule of typically 19-25 nucleotides (typically about 20-24 nucleotides in plants) derived from a larger precursor that forms an incomplete stem-loop structure. MiRNA binds to a complementary sequence on a target messenger RNA transcript (mRNA), typically resulting in translational inhibition or target degradation and gene silencing. Artificial miRNA (amiRNA) can be designed based on natural miRNA to reduce the expression of any target gene, as is well known in the art.

[0329] In plant cells, it is believed that miRNA precursor molecules are extensively processed in the nucleus. Pre-miRNA (containing one or more local double-stranded or "hairpin" regions and the usual 5' "cap" and polyadenylated tail of mRNA) is processed into shorter miRNA precursor molecules, which also include stem-loop or fold-back structures and are referred to as "pre-miRNA". In plants, pre-miRNA is cleaved by different DICER-like (DCL) enzymes to produce miRNA:miRNA* duplexes. These duplexes are methylated before being transported out of the nucleus.

[0330] In the cytoplasm, miRNA single strands from miRNA:miRNA duplexes are selectively incorporated into active RNA-induced silencing complexes (RISC) for target recognition. The RISC-complex contains a specific subset of Argonaute proteins that exert sequence-specific gene repression (see, e.g., Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005).

[0331] Co-suppression

[0332] A gene can suppress the expression of related endogenous genes and / or transgenes already present in the genome, a phenomenon known as homology-dependent gene silencing. Most cases of homology-dependent gene silencing fall into two categories - those that act at the transcriptional level of the transgene and those that operate post-transcriptionally.

[0333] Post-transcriptional homology-dependent gene silencing (i.e., co-suppression) describes the loss of expression of transgenics and related endogenous or viral genes in transgenic plants. Co-suppression usually, but not always, occurs when transgenic transcripts are abundant, and is generally believed to be triggered at the level of mRNA processing, localization and / or degradation. There are several models to explain how co-suppression works (see Taylor, 1997).

[0334] Co-suppression involves introducing an extra copy of a gene or fragment thereof into a plant in a sense orientation relative to the promoter from which it is expressed. The size of the sense fragment, its correspondence with the target gene region and the degree of sequence identity with the target gene can be determined by a person skilled in the art. In some cases, the extra copy of the gene sequence interferes with the expression of the target plant gene. For methods of implementing the co-suppression method, reference is made to WO 97 / 20936 and EP 0465572.

[0335] Antisense polynucleotides

[0336] The term "antisense polynucleotide" refers to a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and is capable of interfering with post-transcriptional events such as mRNA translation. The use of antisense methods is well known in the art (see, for example, G. Hartmann and S. Endres, Manual of antisense methodology, Kluwer (1999)). Bourque (1995) and Senior (1998) reviewed the application of antisense technology in plants. Bourque (1995) lists a large number of examples of how antisense sequences can be used as gene inactivation methods in plant systems. Bourque also pointed out that it may not be necessary to obtain 100% inhibition of any enzyme activity, because partial inhibition will more likely result in measurable changes in the system. Senior (1998) pointed out that antisense methods are now a very mature technology for manipulating gene expression.

[0337] In one embodiment, the antisense polynucleotide hybridizes under physiological conditions, that is, the antisense polynucleotide (which is completely or partially single-stranded) is at least capable of forming a double-stranded polynucleotide with an mRNA encoding an endogenous polypeptide, for example: under normal conditions in the cell, FSL polypeptide mRNA (e.g., corresponding to the ORF sequence shown in SEQ ID NO: 5-7 or a sequence having a percentage level identity thereto as described herein), GAI1 protein mRNA (corresponding to the sequence shown in SEQ ID NO: 8 or 9 or a sequence having a percentage level identity thereto as described herein) and / or VvMADS5 protein mRNA (e.g., corresponding to the sequence shown in SEQ ID NO: 10 or 11 or a sequence having a percentage level identity thereto as described herein).

[0338] Antisense molecules can include sequences corresponding to structural genes or sequences that affect the control of gene expression or splicing events. For example, antisense sequences can correspond to the targeted coding region of endogenous genes, or 5'-untranslated regions (UTRs) or 3'-UTRs or combinations of these. It can be partially complementary to intron sequences that can be spliced ​​off during or after transcription, preferably only complementary to the exon sequences of the target gene. Considering the usually larger differences of UTRs, targeting these regions provides higher gene inhibition specificity.

[0339] The length of the antisense sequence should be at least 19 consecutive nucleotides, preferably at least 50 nucleotides, more preferably at least 100, 200, 500 or 750 nucleotides. Full-length sequences complementary to the entire gene transcript can be used. The length is most preferably 100-750 nucleotides. The degree of identity of the antisense sequence to the target transcript should be at least 90%, more preferably 95-100%. Antisense RNA molecules can of course include unrelated sequences, which can act to stabilize the molecule.

[0340] Recombinant vector

[0341] One embodiment of the present invention includes a recombinant vector, which includes at least one polynucleotide defined herein, and can deliver the polynucleotide to a host cell. Recombinant vectors include expression vectors. Recombinant vectors contain heterologous polynucleotide sequences, i.e., polynucleotide sequences that are not naturally adjacent to the polynucleotides defined herein, preferably from different species. The vector can be RNA or DNA, typically a viral vector, derived from a virus or a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide easy selection, amplification and transformation of expression cassettes in prokaryotes, such as vectors from pUC sources, vectors from pGEM sources, vectors from pSP sources, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include replication origins to provide autonomous replication of the vector; selectable marker genes, preferably encoding antibiotics or herbicide resistance; unique multiple cloning sites, providing multiple sites to insert genes encoded in nucleic acid sequences or nucleic acid constructs; and sequences that enhance transformation of prokaryotic cells and eukaryotic cells (particularly plant cells).

[0342] As used herein, "expression vector" is a DNA vector that is capable of transforming a host cell and affecting the expression of one or more specific polynucleotides. The expression vector of the present invention contains regulatory sequences, such as transcription control sequences, translation control sequences, replication origins, and other regulatory sequences that are compatible with the host cell and control the expression of the polynucleotides of the present invention. In particular, the expression vector of the present invention includes a transcription control sequence. A transcription control sequence is a sequence that controls the initiation, extension, and termination of transcription. Particularly important transcription control sequences are sequences that control the initiation of transcription, such as promoters, enhancers, operators, and repressor sequences. The selection of the regulatory sequence used depends on the target organism, such as a plant and / or a target organ or tissue. Such a regulatory sequence can be obtained from any eukaryotic organism, such as a plant or a plant virus, or can be chemically synthesized. Many vectors suitable for stable transfection of plant cells or establishment of transgenic plants have been described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, Supplement, 1987, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989, and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors may also contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally or developmentally regulated, or cell or tissue-specific expression), a transcription initiation site, a ribosome binding site, a transcription termination site, and / or a polyadenylation signal.

[0343] Many constitutive promoters active in plant cells have been described. Suitable promoters for constitutive expression in plants are known in the art and described herein above.

[0344] For expression in the source tissue of a plant, for example in a flower and its reproductive parts, buds, fruits, roots or stems, it may be preferred that the promoter used in the present invention has relatively high expression in these specific tissues. For this purpose, genes with tissue or cell specificity or enhanced expression can be selected from a number of promoters. Examples of such promoters are reported in the literature and are known to those skilled in the art.

[0345] As used herein, "operably linked" refers to the functional relationship between two or more nucleic acid (e.g., DNA) fragments. Typically, it refers to the functional relationship between a transcriptional regulatory element (promoter) and a transcribed sequence. For example, if a promoter stimulates or regulates the transcription of a coding sequence in a suitable cell, it is operably linked to the coding sequence of a polynucleotide defined herein. Typically, promoter transcriptional regulatory elements operably linked to a transcribed sequence are physically adjacent to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory elements, such as enhancers, do not need to be physically adjacent to or very close to the coding sequence that they enhance transcription.

[0346] When multiple promoters are present, each promoter may independently be the same or different.

[0347] The recombinant vector may also contain one or more signal peptide sequences to retain the expressed polypeptide defined herein in the endoplasmic reticulum (ER) of the cell, or to transfer to the plastid, and / or contain a fusion sequence that causes the nucleic acid molecule to be expressed as a fusion protein. Examples of suitable signal segments include any signal segment that can direct the secretion or localization of a polypeptide defined herein.

[0348] For the ease of identifying transformants, recombinant vectors ideally include selectable or screenable marker genes." marker gene " refers to the gene that gives the cell unique phenotype of expressing this marker gene, therefore allows the cell of this conversion to be distinguished from the cell without this mark. Selectable marker genes promote the proterties that can be "selected" based on the resistance to selection agents (such as herbicides, antibiotics). Screenable marker genes (or reporter genes) give the proterties (such as, beta-glucuronidase, luciferase, GFP or other enzyme activities that do not exist in untransformed cells) that can be identified by "screening" by observation or testing. Exemplary selectable markers for selecting plant transformants include, but are not limited to, the hyg gene encoding hygromycin B resistance; the neomycin phosphotransferase (nptII) gene, which confers resistance to kanamycin, paromomycin; the glutathione-S-transferase gene from rat liver, which confers resistance to glutathione-derived herbicides, as described, for example, in EP256223; the glutamine synthetase gene, which, when overexpressed, confers resistance to glutamine synthetase inhibitors such as phosphinothricin, as described, for example, in WO 87 / 05327; an acetyltransferase gene from Streptomyces viridochromogenes, which confers resistance to the selection agent glufosinate, as described, for example, in EP 275 957; a gene encoding 5-enolshikimate-3-phosphate synthase (EPSPS), which promotes resistance to N-phosphonomethylglycine, as described by Hinchee et al. (1988); a bar gene conferring resistance to bialaphos, as described, for example, in WO 91 / 02071; a nitrilase gene, for example from Klebsiella odorifera. ozaenae), which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene that promotes methotrexate resistance (Thillet et al., 1988); a mutated acetolactate synthase gene (ALS) that confers resistance to imidazolinones, sulfonylureas or other ALS-inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyltryptophan; or a dalapon dehalogenase gene that confers herbicide resistance.

[0349] 5' non-translated leader sequence can be derived from the promoter selected for expressing the polynucleotide of the present invention, or can be heterologous relative to the coding region of the enzyme to be produced, and can be specifically modified to increase the translation of mRNA if necessary. For a review on optimizing transgenic expression, see Koziel et al. (1996). 5' non-translated region can also be obtained from plant viral RNA (tobacco mosaic virus, tobacco etch virus, corn dwarf mosaic virus, alfalfa mosaic virus, etc.) from suitable eukaryotic genes, plant genes (wheat and corn chlorophyll a / b binding protein gene leader sequences) or synthetic gene sequences. The present invention is not limited to constructs in which the non-translated region is derived from the 5' non-translated sequence of the accompanying promoter sequence. The leader sequence can also be from an unrelated promoter or coding sequence. Leader sequences that can be used in the context of the present invention include corn Hsp70 leader sequences (US 5,362,865 and US 5,859,347) and TMV ω elements.

[0350] Termination of transcription is achieved by operably connecting to the 3' non-translated DNA sequence of the target polynucleotide in the expression vector. The 3' non-translated region of the recombinant DNA molecule contains a polyadenylation signal, which acts in plants to cause adenylate nucleotides to be added to the 3' end of the RNA. The 3' non-translated region can be obtained from various genes expressed in plant cells. The 3' non-translated region of nopaline synthase, the 3' non-translated region from the small subunit Rubisco of pea, and the 3' non-translated region from the soybean 7S seed storage protein gene are generally used for this function. The 3' transcription, non-translated region containing the polyadenylic acid signal of the Agrobacterium tumor induction (Ti) plasmid gene is also suitable.

[0351] Recombinant DNA technology can be used to improve the expression of the transformed polynucleotide, for example by manipulating the translation efficiency of the resulting transcript by codon optimization or deletion of sequences that destabilize the transcript, depending on the host cell species, as well as the efficiency of post-translational modifications.

[0352] Preferably, the recombinant vector is stably incorporated into the genome of a cell, such as a plant cell. Thus, the recombinant vector may include appropriate elements that allow the vector to be integrated into the genome or chromosome of the cell.

[0353] Agrobacterium-mediated transfer is a widely applicable system for gene import into vegetable cells, because DNA can be imported into whole plant tissues, thereby bypassing the needs of regenerating complete plants from protoplasts. It is well known in the art (see, for example, US 5,177,010, US 5,104,310, US5,004,863, US 5,159,135) to use agrobacterium-mediated plant integration vectors to import DNA into vegetable cells. In addition, the integration of T-DNA is a relatively accurate process, which causes seldom rearrangement. The DNA region to be transferred is limited by border sequences, and inserting DNA usually inserts into plant genome.

[0354] Agrobacterium transformation vectors are capable of replicating in both E. coli and Agrobacterium for manipulation as described in (Klee et al., Plant DNA Infectious Agents, Hohn and Schell, (eds.), Springer-Verlag, New York, (1985): 179-203). Genetically modified plants formed using Agrobacterium transformation methods typically contain a single genetic locus on one chromosome. Such genetically modified plants may be referred to as being hemizygous for the added gene or gene variant. More preferred are genetically modified plants that are homozygous for the added gene or gene variant; i.e., a genetically modified plant that contains two added genes, one gene located at the same locus on each chromosome of a chromosome pair. Homozygous genetically modified plants can be obtained by sexually mating (selfing) independent segregants of genetically modified plants containing a single added gene or gene variant, germinating some of the resulting seeds and analyzing the resulting plants for the gene of interest.

[0355] It should also be understood that two different genetically modified plants can also be mated / hybridized to produce progeny containing two independently separated introduced genes or gene variants. Selfing of suitable progeny can produce plants that are homozygous for the introduced genes or gene variants. Also included are backcrossing with the parent plant and outcrossing with another plant, such as asexual reproduction. Descriptions of other breeding methods commonly used for different traits and crops can be found in Fehr, Breeding Methods for Cultivar Development (breeding methods for cultivar development), J. Wilcox (editor), American Society of Agronomy (American Society of Agronomy), Madison wis. (1987).

[0356] Transformation of plant protoplasts can be achieved using calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. The application of these systems in different plant strains depends on the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for regenerating cereals from protoplasts have been described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).

[0357] Other methods of cell transformation may also be used, including but not limited to introducing DNA into plants by transferring polynucleotides such as DNA directly into pollen, by injecting polynucleotides such as DNA directly into reproductive organs of plants, or by injecting polynucleotides such as DNA directly into cells of immature embryos and then rehydrating the dried embryos.

[0358] Regeneration, development and cultivation of plants from individual protoplast transformants or from various transformed explants are well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process generally includes the steps of selecting transformed cells, culturing those individualized cells through the usual stages of embryonic development to the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are then planted in a suitable plant growth medium such as soil.

[0359] In order to confirm the presence of the introduced genetic material in cells and plants, methods known to those skilled in the art can be used to perform polymerase chain reaction (PCR) amplification or Southern blot analysis. The expression product of the introduced gene or gene variant can be detected in any of a variety of ways, depending on the nature of the product, and includes Western blot and enzyme assays. A particularly useful method for quantitative protein expression and detection of replication in different plant tissues is to use reporter genes, such as GUS. Once transgenic plants are obtained, they can be grown to produce plant tissues or parts with a desired phenotype. Plant tissues or plant parts can be harvested, and / or seeds can be collected. Seeds can be used as sources of other plants that grow tissues or parts with desired characteristics.

[0360] cell

[0361] The present invention also provides recombinant cells comprising host cells transformed with one or more recombinant molecules defined herein or their daughter cells. The conversion of nucleic acid molecules into cells can be achieved by any method that can insert nucleic acid molecules into cells. Conversion techniques include but are not limited to transfection, electroporation, microinjection, lipofection, adsorption and protoplast fusion. Recombinant cells can remain unicellular or can grow into tissues, organs or multicellular organisms. The converted nucleic acid molecules can remain outside the chromosome or can be integrated into one or more sites in the chromosome of the transformed (i.e. recombinant) cell in a manner that maintains its expression ability. Preferred host cells are plant cells, more preferably grapevine cells.

[0362] The present invention also provides plant cells isolated from plants or plant parts of the present invention. For example, cells isolated from plants or plant parts with altered levels of FSL polypeptide activity as described herein. For example, cells isolated from plants or plant parts that produce seedless fruits as described herein. In some instances, culture cells.

[0363] Plants and plant parts

[0364] The term "plant" when used as a noun refers to the whole plant, while the term "plant part" or "part thereof" (in the context of plants) refers to plant cells and their progeny, multiple plant cells, structures present in any stage of plant development, or plant tissues. Such structures include, but are not limited to, leaves, stems, cuttings and scions, flowers, fruits, nuts, roots, seeds, seed coats, embryos. The term "plant tissue" includes differentiated and undifferentiated tissues of plants, including those present in leaves, stems, flowers, fruits, nuts, roots, seeds, such as embryonic tissue, endosperm, dermal tissue (e.g., epidermis, periderm), vascular tissue (e.g., xylem, phloem) or ground tissue (including parenchyma, collenchyma and / or sclerenchyma cells), and cells in culture (e.g., unicellular, protoplasts, callus, embryos, etc.). Plant tissues can be plants, organ cultures, tissue cultures, or cell cultures.

[0365] As used herein, "progeny" refers to the immediate and all subsequent generations of progeny produced from a parent, such as second, third or later generations.

[0366] As used herein, the term "plant" includes all species of flowering plants, i.e., angiosperms. In one example, the plant as described herein is a dioecious plant. In another example, the plant as described herein is a hermaphroditic plant. The plant is preferably a plant that produces fruit. For example, the plant can be a berry-producing plant, a citrus-producing plant, a drupe-producing plant, a pome-producing plant, or a gourd-producing plant. Exemplary fruit-producing plants in each of these broad fruit categories are known in the art and are contemplated herein.

[0367] Plants contemplated for use in practicing the present invention include monocots and dicots. Target plants include, but are not limited to, the following: cereals (e.g., wheat, barley, rye, oats, rice, corn, sorghum, and related crops); grapes; beets (sugar beets and fodder beets); pome, stone fruit, and small fruit (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries, and blackberries); legumes (beans, lentils, peas, soybeans); oil plants (rapeseed or other Brassicas, mustard, poppy, olive, sunflower, safflower, flax, coconut, castor oil plants, cocoa beans, peanuts); cucumbers plants (zucchini, cucumber, melon); fiber plants (cotton, flax, hemp, jute); citrus fruits (oranges, lemons, grapefruit, mandarins); vegetables (spinach, lettuce, asparagus, cabbage, carrots, onions, tomatoes, potatoes, red peppers); lauraceae (avocado, cinnamon, camphor); or plants such as corn, tobacco, nuts, coffee, sugar cane, tea, grapevines, hops, turf, bananas and natural rubber plants, and ornamental plants (flowers, shrubs, broadleaf trees and evergreen plants such as conifers).

[0368] In a specific example, the plant is a plant that produces berries. For example, the plant can be a Vitis sp., i.e., for example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitislambrusca, Vitis rotundifolia, Vitis aestivalis, Vitus riperia, and hybrids thereof. In one example, the Vitis species produces table grapes. In another example, the Vitis species produces wine grapes. Vitis rotundifolia is also known as Muscadinia rotundifolia and includes other subgenus Muscadinia species.

[0369] Methods of producing plants and plant parts

[0370] There are many technologies known in the art that can be used to produce plants with altered levels of FSL polypeptide activity as described herein, including plants and plant parts that produce seedless fruits as described herein, including but not limited to TILLING, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR).

[0371] TILLING

[0372] The plants of the present invention can be produced using a method called TILLING (targeted induced local lesions in genomes). In the first step, introduced mutations such as new single base pair changes are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen, and then advancing the plants to a generation where the mutations will be stably inherited. DNA is extracted and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.

[0373] For TILLING determination, PCR primers are designed to specifically amplify the single gene target of interest. If the target is a member of a gene family or a part of a polyploid genome, specificity is particularly important. Then, dye-labeled primers can be used for amplifying PCR products from the combined DNA of multiple individuals. These PCR products are denatured and reannealed to form mismatched base pairs. Mismatches or heteroduplexes represent naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants in a population may carry the same polymorphism) and induced SNPs (i.e., only rare single plants may show mutations). After heteroduplex formation, the use of endonucleases such as Cel I that recognize and cut mismatched DNA is the key to finding new SNPs in the TILLING population.

[0374] Using this method, thousands of plants can be screened to identify any individual with a single base change as well as a small insertion or deletion (1-30 bp) in any gene or specific region of the genome. The size range of the genomic fragments analyzed can be 0.3 to 1.6 kb. At 8-fold pooling and 96 lanes per assay, this combination allows screening of up to a million base pairs of genomic DNA per single assay, making TILLING a high-throughput technology.

[0375] TILLING is further described in Slade and Knauf (2005) and Henikoff et al., (2004).

[0376] In addition to allowing efficient detection of mutations, high-throughput TILLING technology is ideal for the detection of natural polymorphisms. Thus, querying unknown homologous DNA by heteroduplexing with known sequences reveals the number and location of polymorphic sites. Nucleotide changes and small insertions and deletions, including at least some repeat number polymorphisms, are identified. This is called Ecotilling (Comai et al., 2004).

[0377] Each SNP is recorded by its approximate position within a few nucleotides. Therefore, each haplotype can be archived according to its mobility. Sequence data can be obtained in relatively small incremental efforts using aliquots of the same amplified DNA used for the mismatch cleavage assay. The left or right sequencing primer for a single reaction is selected by its proximity to the polymorphism. Sequencher software performs multiple alignments and finds base changes, confirming the gel band in each case.

[0378] In ecotilling plates containing arrayed ecotypic DNA, ecotypic DNA can be screened instead of a DNA pool from a mutagenized plant. Because the assay is performed on a gel with near base pair resolution and the background pattern is consistent across lanes, bands of the same size can be matched, allowing SNPs to be discovered and genotyped in a single step. PCR products used for screening can be subjected to DNA sequencing.

[0379] Genome editing using site-specific nucleases

[0380] Genome editing uses engineered nucleases consisting of a sequence-specific DNA binding domain fused to a nonspecific DNA cleavage module. These chimeric nucleases achieve efficient and precise genetic modification by inducing double-strand breaks in the target DNA, which stimulate the cell's endogenous cellular DNA repair mechanisms to repair the induced breaks. These mechanisms include, for example, error-prone nonhomologous end joining (NHEJ) and homology-directed repair (HDR).

[0381] In the presence of a donor plasmid with extended homology arms, HDR can lead to the introduction of single or multiple transgenes to correct or replace existing genes. In the absence of a donor plasmid, NHEJ-mediated repair generates small insertion or deletion mutations of the target causing gene disruption.

[0382] Engineered nucleases useful in the methods of the invention include zinc finger nucleases (ZFNs) and transcription activator-like (TAL) effector nucleases (TALENs).

[0383] Typically, nuclease encoding genes are delivered to cells via plasmid DNA, viral vectors, or in vitro transcribed mRNA. The use of fluorescent alternative reporter vectors also allows enrichment of ZFN- and TALEN-modified cells. As an alternative to ZFN gene delivery systems, cells can be contacted with purified ZFN proteins that can cross the cell membrane and induce endogenous gene disruption.

[0384] Complex genomes often include multiple copies of sequences that are identical or highly homologous to the intended DNA target, which can lead to off-target activity and cellular toxicity. To address this problem, constructs (Miller et al., 2007; Szczepek et al., 2007) and selection-based approaches (Doyon et al., 2011; Guo et al., 2010) can be used to generate improved ZFN and TALEN heterodimers with optimized cleavage specificity and reduced toxicity.

[0385] Zinc finger nuclease (ZFN), which includes a DNA binding domain and a DNA cleavage domain, wherein the DNA binding domain is composed of at least one zinc finger and is operably connected to the DNA cleavage domain. The zinc finger DNA binding domain is located at the N-terminus of the protein, and the DNA cleavage domain is located at the C-terminus of the protein.

[0386] ZFNs must have at least one zinc finger. In a preferred embodiment, ZFNs have at least three zinc fingers so as to have sufficient specificity for targeted gene recombination in a host cell or organism. Typically, ZFNs with more than three zinc fingers will have progressively greater specificity for each additional zinc finger.

[0387] The zinc finger domain can be derived from any species or type of zinc finger. In a specific embodiment, the zinc finger domain includes a Cis2His2 type zinc finger, which is typically represented by, for example, zinc finger transcription factors TFIIIA or Sp1. In a preferred embodiment, the zinc finger domain includes three Cis2His2 type zinc fingers. The DNA recognition and / or binding specificity of the ZFN can be changed to achieve targeted gene recombination at any selected site in the cell DNA. This modification can be accomplished using known molecular biology and / or chemical synthesis techniques. (See, for example, Bibikova et al., 2002).

[0388] The ZFN DNA cleavage domain is derived from a class of non-specific DNA cleavage domains, such as the DNA cleavage domain of type II restriction enzymes such as FokI (Kim et al., 1996). Other useful endonucleases may include, for example, Hhal, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI.

[0389] If present, the joint between the cutting and recognition domains of ZFN includes a selected amino acid residue sequence so that the resulting joint is flexible. Alternatively, for maximum target site specificity, a jointless construct is prepared. The jointless construct strongly prefers to bind to a recognition site 6 bp apart and then cuts between the recognition sites. However, for a joint length between 0 and 18 amino acids, the ZFN-mediated cutting occurs between recognition sites between 5 and 35 bp apart. For a given joint length, there will be a restriction on the distance between the recognition sites consistent with binding and dimerization. (Bibikova et al., 2001). In a preferred embodiment, there is no joint between the cutting and recognition domains, and the target locus includes two recognition sites of 9 nucleotides that are reversed relative to each other, separated by a spacer of 6 nucleotides.

[0390] In order to target genetic recombination or mutation according to the preferred embodiment of the present invention, two 9bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites will be in opposite directions from each other and separated by about 6bp of DNA. ZFNs are then produced by designing and generating a zinc finger combination that specifically binds DNA at the target locus and then attaching the zinc finger to the DNA cleavage domain.

[0391] ZFN activity can be increased by using transient low-temperature culture conditions to increase nuclease expression levels (Doyon et al., 2010) and co-delivery of site-specific nucleases with DNA end-processing enzymes (Certo et al., 2012). The specificity of ZFN-mediated genome editing can be improved by using zinc finger nickases (ZFNickases), which stimulate HDR without activating the error-prone NHE-J repair pathway (Kim et al., 2012; Wang et al., 2012; Ramirez et al., 2012; McConnellSmith et al., 2009).

[0392] Transcription activator-like (TAL) effector nucleases (TALENs) include a TAL effector DNA binding domain and an endonuclease domain.

[0393] TAL effectors are proteins of plant pathogenic bacteria that are injected into plant cells by the pathogens, where they travel to the nucleus and function as transcription factors to turn on specific plant genes. The primary amino acid sequence of a TAL effector determines the nucleotide sequence to which it binds. Therefore, the target sites of TAL effectors can be predicted, and TAL effectors can be engineered and produced for the purpose of binding to specific nucleotide sequences.

[0394] Fused to the nucleic acid sequence encoding the TAL effector is a sequence encoding a nuclease or a portion of a nuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as FokI (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. The fact that some endonucleases (e.g., FokI) only function as dimers can be exploited to enhance the target specificity of TAL effectors. For example, in some cases, each FokI monomer can be fused to a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are in close proximity will the inactivated monomers come together to produce a functional enzyme. By requiring DNA binding to activate the nuclease, highly site-specific restriction enzymes can be produced.

[0395] Sequence-specific TALEN can recognize specific sequences within a preselected target nucleotide sequence present in a cell. Therefore, in some embodiments, the target nucleotide sequence can be scanned for nuclease recognition sites, and specific nucleases can be selected based on the target sequence. In other cases, TALEN can be engineered to target specific cell sequences.

[0396] Genome editing using programmable RNA-guided DNA endonucleases

[0397] Unlike the above-mentioned site-specific nucleases, the clustered regularly interspaced short palindromic repeats (CRISPR) / Cas system provides an alternative to ZFN and TALEN for inducing targeted genetic changes. The CRISPR system relies on CRISPR RNA (crRNA) and trans-activating chimeric RNA (tracrRNA) for sequence-specific silencing of invading exogenous DNA. There are three types of CRISPR / Cas systems: In the type II system, Cas9 is used as an RNA-guided DNA endonuclease that cuts DNA upon crRNA-tracrRNA target recognition. CRISPR RNA base pairs with tracrRNA to form a double RNA structure that guides the Cas9 endonuclease to a complementary DNA site for cutting.

[0398] The CRISPR system can be carried to plant cells by co-delivering a plasmid expressing a Cas endonuclease and the necessary crRNA components, as described in the art and herein. The Cas endonuclease can be converted into a nickase to provide additional control over the DNA repair mechanism (Cong et al., 2013).

[0399] CRISPR loci are a unique class of interspersed short sequence repeats (SSRs) that were first identified in Escherichia coli (Ishino et al., 1987; Nakata et al., 1989). Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (Groenen et al., 1993; Hoe et al., 1999; Matepohl et al., 1996; Mojica et al., 1995).

[0400] Common structural features of CRISPR loci are described in Jansen et al., (2002) as (i) the presence of multiple short direct repeat sequences that show no or very little sequence variation within a given locus; (ii) the presence of non-repeating spacer sequences between repeat sequences of similar size; (iii) the presence of a common leader sequence of several hundred base pairs in most species carrying multiple CRISPR loci; (iv) the absence of long open reading frames within the locus; and (v) the presence of one or more cas genes.

[0401] CRISPRs are typically short, partially palindromic sequences of 24-40 bp, containing up to 11 bp of internal and terminal inverted repeats. Although isolated elements have been detected, they are typically arranged in clusters of repeat units (up to about 20 per genome or more) separated by unique intervening 20-58 bp sequences. CRISPRs are typically homogeneous within a given genome, with most of them being identical. However, there are examples of heterogeneity in, for example, archaea (Mojica et al., 2000).

[0402] As used herein, the term "cas gene" refers to one or more cas genes that are generally associated with or close to a flanking CRISPR locus or coupled near a flanking CRISPR locus. Haft et al. (2005) comprehensively reviewed the Cas protein family. The most frequently used CRISPR-Cas system in eukaryotic work uses a Cas9 effector protein, typically using an RNA-guided Streptococcus pyogenes Cas9 or optimized sequence variants in a variety of plant species (Luo et al., 2016). Cas used herein includes Cas9, Cas12 enzymes (e.g., Cas12a, Cas12b, Cas12f, Cpf1, C2c1, C2c3) and other CRISPR-Cas systems such as RNA-guided Cas13 RNA enzymes.

[0403] Nicking enzyme

[0404] The CRISPR-Cas II system uses a Cas9 nuclease with two enzyme cleavage domains, RuvC and HNH domains. Mutations have been shown to change double-stranded cleavage to single-stranded cleavage and produce technical variants of Cas9 called nickase or nuclease inactivation. The RuvC subdomain cuts non-complementary DNA strands, and the HNH subdomain cuts DNA strands complementary to the gRNA. Nickase or nuclease inactivated Cas9 retains the DNA binding ability guided by gRNA. Mutations in subdomains are known in the art, such as Streptococcus pyogenes Cas9 nucleases with D10A mutations or H840A mutations.

[0405] Genome base editing or modification

[0406] Base editing is produced by fusing a deaminase to a Cas9 domain (WO 2018 / 086623). Through the fusion, the deaminase can utilize sequence targeting guided by the gRNA to convert the targeted cytidine (C) to uracil (U) by deamination of cytidine in the DNA. The cell's mismatch repair mechanism then replaces U with T. Suitable cytidine deaminases may include APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, and CDA1. In addition, the Cas9-deaminase fusion may be a mutant Cas9 with nickase activity to produce single-strand breaks. It has been shown that nickase proteins may be more effective in promoting homology-directed repair (Luo et al., 2016).

[0407] Conventional plant breeding methods

[0408] In addition to the aforesaid method, plant of the present invention can also be produced using conventional plant breeding techniques known in the art. Such methods generally include hybridization with a parental line of known polynucleotides or genes (including specific variants thereof), which imparts specific traits, and screening the progeny produced by hybridization to identify a specific combination of polynucleotides or genes of interest and / or a progeny showing a specific phenotype of interest. The screening of progeny can be based on phenotype and / or based on the molecular characterization using molecular techniques known in the art. In some instances, conventional breeding methods relate to backcrossing with the parental line subsequently to realize a specific genotype state at one or more polynucleotides or gene places. Conventional plant breeding techniques are well known in the art, and this paper contemplates the production of plants producing flowers of known sex and / or the production of plants producing seedless fruits, as described herein.

[0409] Fruits and their products

[0410] Also provided herein is a fruit produced by a plant as described herein. The fruit may be seedless. Preferably, the fruit is a seedless fruit of abortive type. More preferably, the fruit is parthenocarpic and seedless. According to an example in which the plant growing the fruit is a species of the genus Vitis, the fruit will be a grape, such as a seedless grape. In one example, the grape is a seedless table grape.

[0411] Fruit of the present invention can be produced by making plant as described herein grow under the condition and time period that are enough to make plant bloom and produce fruit.In some instances, fruit can be gathered in the crops from plant.But, in other instances, may wish to leave fruit on plant (for example, for nursery sale).In some instances, the method further comprises processing fruit.For example, processing fruit can comprise packaging fruit and / or produce one or more products (for example, one or more food or beverage products or composition) by fruit.

[0412] The present invention also provides products produced by plants as described herein or fruits thereof. In one example, the product is a food, a food ingredient, a beverage product or a beverage ingredient. The food can be selected from the group consisting of, for example, table grapes, jam, marmalade, jelly, sultanas and raisins. The food ingredient can be, for example, cooked wine, sour fruit juice, vinegar or glucose syrup (mostocotto). The beverage product can be, for example, wine, grappa, brandy or grape juice. The beverage ingredient can be, for example, wine grapes, table grapes or their juice.

[0413] Example

[0414] Example 1: Materials and Methods

[0415] Microvine plant strains

[0416] Microvine plants were grown in greenhouses or growth chambers at 25-30°C during the day and 20-25°C at night for 16 hours at the CSIRO Urrbrae site in Adelaide, Australia. Plants were kept in pots, watered daily and given slow release fertilizers at regular intervals. The microvine genotypes studied had male flowers (FSL / fsl), female flowers (fsl / fsl) or hermaphroditic flowers (FSL / FSL or FSL / fsl). A number of microvine lines with different flower types were studied, examples including 03C003V0060 (L1 Pinot Meunier progeny x Richter 110) (male flowers, M / f), 04C023V0003 (female flowers, f / f), 04C023V0006 (hermaphroditic flowers, H / H). Microvine lines with male flowers were obtained by crossing the grapevine rootstock Richter 110 (M / f) with the female microvine line 00C001V0008 (f / f).

[0417] Flower sex was phenotyped by morphological scoring using OIV descriptor No 151 (http: / / www.oiv.int / ).

[0418] Genomic DNA was extracted from leaves of the grapevine using the DNAeasy Plant Mini Kit (Qiagen 69106).

[0419] Cloning of male, hermaphroditic, and female alleles

[0420] To obtain coding DNA sequences and translated protein sequences, total RNA was extracted from flowering stages 1-2 of the modified EL system using the Spectrum Plant Total RNA kit, catalog #STRN250 (Sigma) according to the manufacturer's instructions. A description of the modified EL system can be found in Coombe's 'Adoption of a system for identifying grapevine growth stages' (1995) Aust. J. Grape and Wine Res. 1:104-110. Total RNA was extracted from FSL gene edited plants (FSL knockout), male plants 03C003V0016 (from L1 Pinot Meunier progeny x Richter 110), female plants 04C023V0003 (from Grenache x L1 Pinot Meunier progeny) and homozygous hermaphrodite 04C023V0006 (from Grenache x L1 Conifer progeny). First strand cDNA was generated using the Superscript IV First Strand Synthesis System, Catalog #18091050 (Invitrogen) according to the manufacturer's instructions using oligo dT B26 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3' (SEQ ID NO: 12). MyTaq from Bioline Catalog #BIO-25047 was used. TMHS Red Mix, the coding sequence was amplified from cDNA using standard PCR techniques according to the manufacturer's instructions for a 20 μl reaction volume and 2 μl template. The PCR reaction conditions were 3 minutes at 95°C for initial denaturation, followed by 35 cycles of 30 seconds at 95°C, 30 seconds at 58°C, 1 minute at 72°C, and 40 seconds. A final extension incubation was performed at 72°C for 10 minutes. The primers used for amplification were B26 and CSFS1_CDS_F1 5'-CAG TGC CAGTTT TGC AGG C-3' (SEQ ID NO: 13), which were designed from the Cabernet Sauvignon cDNA H sequence in Example 2. The PCR product was cloned for sequencing using the Qiagen PCR cloning kit, catalog #231124, according to the manufacturer's instructions.

[0421] FSL expression during floral stages 1-2 in hermaphroditic and gynaecological lines

[0422] Gene expression of FSL was measured using RT-qPCR from first strand cDNA. First strand cDNA and gene specific primers were designed for 3 major regions of each allele. The primers used were:

[0423] FSL_RT_F1 5'-ACGCCGGTGGAATAAACAGG-3' (SEQ ID NO: 14); and

[0424] FSL_RT_R1 5'-TCT CCT TTC TCC ATC CCT AAT TGA-3' (SEQ ID NO: 15).

[0425] LightCycler 480SYBR Green 1 Master 2x concentration Catalog #04 887 352 001 (Roche) was used at 1X concentration in RT-qPCR assays, along with gene-specific primers 10 pMol / reaction (1 μl of 10 μM stock) and 3 μl first-strand cDNA in a 15 μl reaction volume. PCR amplification was performed in a Rotor-Gene RG-3000 (Corbett Research) at 95°C for 10 minutes, followed by 50 cycles of 95°C for 20 seconds, 58°C for 20 seconds, and 72°C for 20 seconds, followed by a final step of 72°C for 5 minutes. Standard curves, melting curves, and Ct values ​​were generated for each gene and each cDNA sample using Rotor-Gene 3000 software (Corbett Research). Ct values ​​were normalized using the reference gene ubiquitin to determine relative gene expression levels in each sample using the relative quantification comparison method described in the Qiagen handout “Critical Faces for Success Real-time PCR” (https: / / www.gene-quantification.de / qiagen-qpcr-sample-assay-tech-guide-2010.pdf).

[0426] Pollen germination test

[0427] Anthers from flowers were collected on single chamber slides and dried for 5 minutes to release pollen. Pollen was collected in germination solution (0.5 M sucrose, boric acid 100 mg / mL and calcium nitrate 300 mg / L, pH 5.4) and incubated overnight on inverted slides in a humidified container at 28 degrees Celsius in the dark. Pollen germination was evaluated at 20X magnification by differential interference contrast (DIC) bright field microscopy.

[0428] Genetic transformation of homozygous hermaphrodite (H / H)04C023V0006 using FSL gene editing vector

[0429] The binary vector pCLB1301NH containing the gene editing cass9-sgRNA cassette was inserted into the homozygous hermaphrodite 04C023V0006 by Agrobacterium-mediated transformation. The complete method is described in Iocco et al., (2001), and transgenic plants were regenerated using the method described in Chaib, J et al., (2010) Plant Journal, 62(6): 1083-1092. The gene editing vector design is described in more detail in Example 6.

[0430] Development and breeding of grapevine inbred lines

[0431] Producing homozygous strains that differ in both stature and flower sex is desirable to improve the breeding efficiency of future micro-grapevines and normal-stature grapes. Identifying the FSL gene and the sequence used for selection will allow breeders to screen out female plants at the seedling stage. In order to achieve this continuous inbreeding by self-pollination (selfing), selfing is performed while maintaining heterozygous states (VvGAI1 / Vvgai1) and flower sex (FSL / fsl) at two sites. The original L1 Pinot Meunier mutant micro-grapevine is used as the female parent, and the flowers are emasculated to receive pollen from Cabernet Sauvignon or Riesling as the male parent. After soaking for 12 hours in fresh 0.5M H2O2, the progeny population is germinated from the collected seeds, rinsed in sterile water and transferred to sterile 2.6mM GA (gibberellic acid) for overnight incubation, then cleaned again in sterile water and sealed with moisture. The seeds are stored at 4°C for about 3 weeks, chopped, incubated again in GA for 18 h and transferred to a Petri dish lined with sterile filter paper. The seeds are kept at 25°C under light, transferred to pots after germination and kept in a growth room or greenhouse for 16 h at 25-30°C during the day and 20-25°C at night. Segregation of stature alleles produces 50% of the progeny with dwarf morphology. The FSL locus follows the expected segregation ratio of 1:1 for the FSL / fsl×fsl / fsl cross. Microvine individuals are isolated for each population and grown in a greenhouse. Vines can be grown at high density, with 100 plants per m 2 Grow 34 Microvines.

[0432] Example 2: Cloning of the hermaphroditic locus by genetic mapping and cloning and sequencing of male, female and hermaphroditic Somatic allele

[0433] Through gene mapping, the inventors have identified the gene that is believed to be responsible for the sex of flowers in grapevines. The inventors named it the flower sex (FSL) gene. The sequencing of this locus identified the single nucleotide polymorphism (SNP) between the male (M), female (f) and hermaphrodite (H) alleles of FSL. The SNP markers from this gene have been used for genotyping of plant H and F alleles, with 100% matching between genotype and phenotype. Using standard molecular methods, the full-length H cDNA from Cabernet Sauvignon was sequenced from the flower cDNA library produced at CSIRO. A cDNA library was prepared from immature inflorescences at stage 12 of the modified EL system. Tissues were collected from plants grown in the field. A description of the modified EL system can be found in the paper of BG Coombe (1995) "Aust. J. Grape and Wine Res.", 1: 104-110. Figure 1A and SEQ ID NO: 1 set forth the cDNA of FSL from Cabernet Sauvignon.

[0434] Using the cloning methods described in Example 1, FSL was isolated from males, females and hermaphrodites of genotypes 03C003V0016 and 04C023V003, and 04C023V0006 was isolated. These are shown in Figure 1 BD and are shown in SEQ ID NOs: 2-4, respectively. An alignment of the open reading frames (ORFs) of the female, hermaphroditic, and male alleles of the FSL locus (SEQ ID NOs: 5-7, respectively) is provided in Figure 2 middle.

[0435] Example 3: Protein sequence and BLAST analysis

[0436] The protein sequence was obtained from the cDNA sequence, and the protein and cDNA sequences were blasted. Figure 3 AC and SEQ ID NOs: 5-7. These alignments predict the presence of a PLATZ (Plant AT-Rich Sequence and Zinc Binding) domain (Nagano et al., (2001) Nucleic Acids Res. 29(20): 4097-4105).

[0437] For cDNA sequences ( Figure 1 AD) and amino acid sequence ( Figure 3 AC), the predicted region of the PLATZ domain (zinc finger box) is highlighted in yellow. The region in each case was identified using the online tool PROSITE (Sigrist, CJA, (2009) Nucleic Acids Research, 38: 161-166.). It is clear from the sequence that there is no difference in the amino acid sequence between the different alleles, however, there is a C to T substitution in the cDNA sequence of the female allele (bold), which produces a sense mutation GAC→GAT that encodes aspartic acid (see Figure 1 BD).

[0438] A phylogenetic tree was also constructed for hermaphroditic protein sequences ( Figure 3 ). Most of the hits were uncharacterized sequences with no known function. The protein sequence alignment and hits obtained for the phylogenetic tree supported the conclusion that the FSL gene contains a PLATZ domain and that it is a transcription factor. PLATZ superfamily transcription factors have been found only in plants and have not been identified so far as being involved in flower sex determination. In fact, the precise function of PLATZ proteins in plants remains poorly understood, and there are indications that they may function in response to stress (So et al., (2015) POJ, 8(6): 479-484).

[0439] The amino acid sequence of the protein is similar to that of other uncharacterized proteins predicted from the genomic sequences of higher plants. However, no orthologous sequences have been found outside the plant kingdom. Multiple alignments among these orthologous proteins show that several cysteine ​​and histidine residues are invariant, indicating that these proteins are a new class of zinc-dependent DNA binding proteins (Nagano et al. 2001).

[0440] Example 4: Expression of the floral sex (fsl) gene in grapevine flowers

[0441] To better understand the function of FSL in specifying flower sex, mRNA in situ hybridization was performed to identify floral organs and tissues where the gene is transcribed. A digoxigenin-labeled 711 bp probe was synthesized from the FSL gene (54-765 bp of the sequence shown in SEQ ID NO: 4). Blast analysis of the 711 bp probe showed that the probe was specific for hybridization with the FSL transcript. Flowers at the young immature stage (flowers that were not separated from each other) were used to determine the expression pattern of FSL. In situ hybridization was performed according to the method described by Jackson, DP (1992) in In-situ hybridization in plants. In: Molecular Plant Pathology: A Practical Approach. Practical Approach Series, 1(85). Oxford University Press and https: / / www.its.caltech.edu / ~plantlab / protocols / insitu.pdf.

[0442] Results from mRNA in situ hybridization showed that FSL was expressed in the filaments and anthers of stamens and in the ovules of male flowers ( Figure 5 A and B). In hermaphroditic flowers, expression was detected in filaments and ovules of stamens ( Figure 5 C and D). FSL expression was reduced in anthers of hermaphrodite flowers compared to male flowers. In male and hermaphrodite flowers, FSL expression was not detected in perianth organs ( Figure 5 AD). As female flowers were expected to display a non-functional FSL phenotype, little or no expression was observed in stamens, anthers and filaments ( Figure 5 Interestingly, FSL appears to be expressed in ovules ( Figure 5 E). Taken together, these results indicate that FSL is predominantly expressed in the stamens of male and hermaphroditic flowers, whereas expression of this gene is absent in female flowers in which the male reproductive organs are nonfunctional.

[0443] Real-time PCR analysis was also performed on cDNA obtained from leaves and early developing floral stages 1-2, when the flowers were still compact and tightly closed, to determine the expression pattern of FSL using the methods described in Example 1. Figure 6 As shown, the expression of FSL is highest in V6 homozygous hermaphrodites (H / H) and very low in V3 females (f / f), which supports the finding that FSL is involved in flower sex determination through normal stamen development. The results of this experiment show that the f allele is 27-fold less expressed in flowers than the H allele. This data suggests that FSL is downregulated to produce a female flower phenotype.

[0444] Example 5: Gene editing to convert grapevine flowers from hermaphroditic to female

[0445] Methods and Results

[0446] CRISPR / Cas9-mediated mutations were introduced into the putative PLATZ domain of the FSL gene with the goal of generating FSL knockout microvine plants to determine gene function in flowering. The CRISPR / Cas9 vector has spCas9 followed by a single crRNA:tracRNA sgRNA (Jinek et al. (2012) Science 337(6096):816-821). SpCas9 was codon-optimized for use in grapevine to optimize translation efficiency.

[0447] All possible 20 bp guide RNAs for FSL were identified using the online tool Benchling (https: / / benchling.com). Guide RNAs located within the putative PLATZ domain were selected and then screened for in vitro cleavage using CAS9 and DNA template using the Guide-it sgRNA In Vitro Transcription and Screening System, Catalog #632639 (Takara Bio USA, Inc). Two guide RNAs were selected and named sgRNAFS1 and sgRNAFS4 ( Figure 7 ).

[0448] The CRISPR / Cas9-sgRNA cassette was synthesized by Genscript (https: / / www.genscript.com / ) and cloned into the binary vector pCLB1301NH for transformation using the general method described in Example 1. The sgRNA sequences used were as follows:

[0449] Guide FS1 (in antisense direction): GGCGGTGAGGGAGCAAACAG (SEQ ID NO: 16)

[0450] Guide FS4 (in antisense direction): AGGGGTGCACCTGTAGAAGG (SEQ ID NO: 17)

[0451] Guide FS2 (in antisense direction): GTCTTGCAAGCTTCGTTCGC (SEQ ID NO: 18)

[0452] Guide FS3 (in sense orientation): GCAGCAGCGTCTCTGTACCT (SEQ ID NO: 19)

[0453] Figure 8 Genetic transformation of microvines is illustrated.

[0454] The resulting transgenic T0 plantlets were checked for gene editing by amplicon Sanger sequencing, and more than 62% of the plants had edits in the predicted region of FSL. Some plants were further analyzed with Next Gen gene sequencing to determine the mutation type, location, and frequency. T0 plants with high mutation frequencies around the predicted location were selected for T1 crosses.

[0455] The flower sex of the T0 generation was also phenotyped using the methods described in Example 1. Two plants edited with sgRNA FS1 developed female flowers with reflexed stamens and sterile pollen, as determined by the pollen germination assay described in Example 1. Fig. 9 The floral phenotypes of the original hermaphrodite plants and the FSL knockout plants are shown.

[0456] The mutation type, location and frequency of mutations in FSL knockout plants were determined by Amplicon NextGen sequencing. For both leaf and flower genomic DNA samples, the mutation frequency around the guide sequence was 98%, which means that both alleles had been mutated by gene editing and that the mutation could be passed on to the T1 generation. Fig.10 The most common mutation type and position was shown to be a T insertion or T deletion at base 16 of the guide sequence. The resulting T insertion or T deletion edits correspond to positions 155 and 159 relative to the sequence shown in SEQ ID NO: 6 or 7.

[0457] Comparison of the predicted amino acid sequences of the FSL knockout and H alleles showed that the knockout produced a nonsense mutation in which protein synthesis was prematurely interrupted by a stop codon ( Fig.11 ).

[0458] discuss

[0459] The conversion of hermaphrodites to female flowers by gene editing of FSL in microvines strongly supports the conclusion that FSL is involved in male organ development, confirming the findings in Example 4. The mutation introduced by gene editing results in a truncated non-functional protein, thereby preventing the development of male reproductive organs and producing a female flower phenotype. Therefore, the present invention provides new methods and overall general methods for converting hermaphroditic flowering plants to female flowering plants. These methods and approaches can be used in male sterility selection breeding strategies.

[0460] Example 6: Parthenocarpic seedless dwarf female grapevines

[0461] Based on the discovery that the FSL gene is responsible for flower sex in grapevines, the inventors subsequently developed dwarf plants that flower quickly and produce seedless fruit and methods for their production. Growth conditions and protocols for microvines used for propagation and seed germination are described in Chaib et al., 2010. Plants were grown in a greenhouse at Waite, South Australia. This was achieved by combining two genes in a single plant: 1) a mutant gene for the gibberellic acid insensitivity gene in either heterozygous (GAI1 / gai1) or homozygous state (GAI1 / GAI1), which results in a dwarf and rapid flowering phenotype; and 2) a female FSL locus (f / f in homozygous state). The population was visually phenotyped for plant stature and berry color.

[0462] Plants with the above genetic characteristics are then tested by artificially pollinating some inflorescences of female microvines when flowering with viable pollen from a genotype such as Riesling, and leaving other inflorescences unpollinated. The inflorescences are marked with paper tags showing the name of the pollen donor and the date of pollination. The pollinated inflorescences are grown in clusters, and the fruits are harvested and sliced ​​to observe seed development (if any) about 3 months after pollination. Hard seeds are found in slices of berries developed from pollinated flowers on female microvines, but no seeds are found in berries developed from non-pollinated flowers ( Fig.12 A and B).

[0463] Normal female grapevines produce flowers that do not develop fruit when not pollinated, but produce fruit when these flowers are cross-pollinated with pollen from male or hermaphroditic plants. In contrast, the female microvines developed herein were shown to produce berries that are usually seedless unless cross-pollinated. Thus, the dwarfing genes combined with the FSL f / f genotype produce seedless fruit in the absence of pollination, but produce hard, viable seeds when the flowers are pollinated with viable pollen.

[0464] Example 7: Dwarf female grapevines with parthenocarpic and seed-aborting seedless fruits

[0465] Based on the findings of Example 6, the present inventors have developed dwarf plants that can quickly flower and produce seedless fruits even after being pollinated with viable pollen, and methods for producing the same. This was achieved by combining three genes in a single plant: 1) a mutant gibberellic acid insensitive gene in a heterozygous (GAI1 / gai1) or homozygous state (GAI1 / GAI1), which results in a dwarf and rapid flowering phenotype; 2) a female FSL locus (f / f in the homozygous state); and 3) a mutant locus of the grape MADS-box protein 5 (VvMADS5) gene (either in a heterozygous or homozygous state) that is closely related to seedless fruits (SDL1) of grapevines. VvMADS5 has been isolated and its sequence has been deposited in the GenBank database (GenBank: AF373604.1; Boss et al., (2002) J. Plant Sci., 162(6):887-895). This gene was identified as a key gene associated with anucleus in several subsequent papers and was also called VviAGL11.

[0466] Briefly, pollen was collected from seedless grape varieties in vials during flowering, dried overnight in an oven at 42°C and stored in a freezer at -80°C until use. The seedless varieties initially selected were Crimson Seedless, Ruby Seedless, Black Gem Currant and MS-03-48-44. Later, pollen from varieties such as Fantasy Seedless (FRESNO B 36-27×FRESNO C 78-68) and Summer Royal Seedless (FRESNO A 69-190×FRESNO C 20-149) has also been used to produce dwarf female grapevines with parthenocarpic and seed abortive types. When the inflorescences of the female microvine plants begin to drop their caps, gently remove all the caps and apply pollen of the selected seedless variety to the stigmas of the dwarf female microvine flowers developed in Example 6. Label the inflorescences with a paper tag showing the name of the pollen donor and the date of pollination. Repeat the pollination over the next day or two to cover all the later-developing flowers.

[0467] The fruits are harvested and seeds are extracted about 3 months after pollination. The seeds are germinated and the isolated progeny are grown in pots in a greenhouse. When the inflorescence develops in the isolated progeny, the plants are crossed with viable pollen from test varieties such as Riesling to confirm the seedless phenotype of the progeny and to identify and select true seedless plants.

[0468] A seedless marker test was also developed to confirm that those plants that exhibited a true seedless phenotype had the VvMADS5 genotype. Briefly, primers were developed to isolate the genomic region of VvMADS5 by PCR from seedless varieties such as Crimson Seedless, Ruby Seedless, and inoculated Sultana monococci using SNPS. Primers were then designed and the results were analyzed using the "Guide to running KASP™ genotyping reactions on Roche LC480 series instruments" from LGC Biosearch Technologies. TM The seedless varieties were genotyped using the KASPTM method using the Roche LC480-series instruments. A set of primers (below) successfully identified the seedless SNP and matched it to the phenotype. The marker was named SDL1.

[0469] Primers used:

[0470] VvSDLF1: GAAGGTGACCAAGTTCATGCTATCCAGGCATTAGTTTCTCG (SEQ ID NO: 20)

[0471] VvSDLF2: GAAGGTCGGAGTCAACGGATTATCCAGGCATTAGTTTCTCT (SEQ ID NO: 21)

[0472] VvSDLRev: AAGTGGGTAGCCTGTGGAT (SEQ ID NO: 22)

[0473] There are situations where the inflorescence of a female microvine may be pollinated by airborne pollen from other grapevines, in which case the berries may develop hard seeds. Therefore, it is important to develop truly seedless microvines that do not form hard seeds after pollination to address situations where flowers are unintentionally pollinated by windblown pollen. The inventors have achieved this by introducing a mutant VvMADS5 seedless fruit locus into a female microvine that includes a mutant GAI1 dwarfing gene combined with the FSL female (f / f) locus. This plant produces seedless fruit even after pollination. When all three genes are combined, dwarf grapevines with sterile pollen are produced, and seedless fruit with or without fertilization is produced. Genotyping with a seedless marker confirmed the mutant locus of the VvMADS5 gene. The phenotype was further tested with vigorous pollen from genotypes such as Riesling by artificially pollinating some inflorescences of several female microvines at flowering. The inflorescences were labeled with paper tags with the name of the pollen donor and the date of pollination. Pollinated inflorescences were allowed to grow into clusters, and the fruits were harvested and sectioned to observe seed development (if any) about 3 months after pollination. In berries that developed from unfertilized flowers, parthenocarpic seedlessness was evident ( Fig.13 A). In berries developed from pollinated flowers, seed abortion was evident, i.e. only traces of soft seeds that usually did not germinate were observed ( Fig.13 B).

[0474] Example 8: Dwarf Hermaphroditic Grapevines with Seedless Fruits of Abortive Type

[0475] The inventors have also developed new dwarf hermaphrodite plants that can quickly flower and produce seedless fruits even after being pollinated with viable pollen, and methods for their production. The plants and methods combine two genes: 1) a mutant gene gibberellic acid insensitivity gene in heterozygous (GAI1 / gai1) or homozygous state (GAI1 / GAI1), which results in a dwarf and rapid flowering phenotype; and 2) a mutant locus of the VvMADS5 gene (whether in heterozygous or homozygous state) that is closely associated with seedless fruits (SDL1) in grapevines.

[0476] When caps begin to fall in the inflorescences of female microvine plants, gently remove all caps and brush pollen from a selected seedless variety (as in Example 7) onto the stigma of the flowers. Label the inflorescences with a paper tag showing the name of the pollen donor and the date of pollination. Repeat pollination over the next day or two to cover all late-stage flowers.

[0477] Fruits were harvested and seeds were extracted approximately 3 months after pollination. Seeds were germinated and segregated progeny were grown in pots in a greenhouse. Genotyping was performed with a seedless marker (described in Example 7) to confirm the mutant locus of the VvMADS5 gene in plants that produced hermaphroditic flowers and developed into seedless berries. Berry sections of hermaphroditic microvines confirmed that plants genotyped as seed-aborted seedless fruits using the SDL marker and containing the mutant VvMADS5 locus were seedless or had only soft seed marks, while other hermaphroditic plants had hard brown seeds ( Fig.14 A and B).

[0478] The hermaphroditic microvines exhibit a typical hermaphroditic phenotype of flowers and develop hard seeds in the berries. By introducing the mutant VvMADS5 locus into a hermaphroditic background (either by conventional plant breeding or recombinant DNA techniques), hermaphroditic microvine plants with seedless berries were generated. Seedless hermaphrodites are important for the table grape market and for further breeding efforts to introduce seedlessness into other grape genotypes.

[0479] Example 9: Other new combinations

[0480] Female and hermaphroditic micro-vines were bred with novel combinations of berry flesh color (red flesh trait from grape variety Dunkelfelder) and berry flavor (muscat aroma from Muscadine and Frontignac White grape varieties; cotton candy flavor from Muscadinia-MS27-31 hybrids). Thus, select micro-vines have been developed that can provide year-round fruit production to suit different tastes and flavors.

[0481] Example 10: Grape berry juice production and analysis

[0482] Berry juices from various microvine lines exemplified herein were analyzed using f / f black berry seedless microvine (15C018V0005), seedless white berry hermaphrodite line (15C018V0058) and inoculated Muscat flavored hermaphrodite (17C001V0006). TM The analysis was performed using a Brix Analyzer (TSS) according to the manufacturer's instructions. The berries were crushed in a sterile plastic bag and 2 ml of berries were transferred to a 2 ml Eppendorf tube and centrifuged at 13000 rpm for 1 min. The Oenofoss TM About 0.6 ml of the supernatant was analyzed by a Brix Analyzer (TSS) to test the sample pH, total acidity, volatile acidity, alpha amino nitrogen, ammonia, tartaric acid, malic acid and density. The results are shown in Table 2.

[0483] Example 11: Wine production from microvine berries

[0484] Wine was prepared on a small scale from fruit produced by seedless hermaphrodite (15C018V0058) and seeded hermaphrodite (17C001V0006) microvines. 2 kg of grape bunches were transferred to a press-seal bag (305 mm x 405 mm 50 um) with one tablespoon of dry ice and 1.2 mL of PMS 100 mg / ml solution (based on 50 ppm, 60% juice recovery). The berries were squeezed until all berries were broken and free-flowing juice could be seen. The juice was filtered through a kitchen sieve and centrifuged at 1489 rcf for 2 minutes to remove solids. 500 mL of juice was removed from the centrifuge bottle and transferred to a 500 ml Schott bottle with an air lock and silicon sampling septum. The juice temperature was adjusted for 1-2 hours before adding yeast, DAP and PVPP. The juice was inoculated with 10 mL of overnight yeast culture (Maurivin PDM yeast), 1 mL of 476 mg / mL DAP stock solution (200 ppm YAN-yeast assimilable nitrogen) and 1 mL of PVPP 130 mg / ml (260 ppm PVPP). The juice was fermented at 18°C ​​with shaking at 100 rpm for 2 minutes every two hours. Total sugar was measured every 24 hours. When the sugar reached 2.5 g / L, the wine was filled in clear wine bottles with 500 μL copper sulfate 1 mg / mL and 500 μL PMS (100 mg / mL) under argon pressure using a siphon device and left to stand at 4°C for 7 days. The head space was minimized by filling the top with a pellet. After cold settling, the wine was filtered through a 0.45 μm autoclaved groundwater filter (Air-Met FTH-45) by pushing it into a combination of 200 mL, 100 mL and 50 mL amber bottles (Cospak) using argon. The bottles were sealed with Tampertell caps (Cospak) and then sealed with wax. Oenofoss from Foss was used according to the manufacturer's instructions. TM The analyzer performs finished wine analysis on wine samples of each grape variety.

[0485] OenoFoss Measurement of Wine

[0486] Briefly, approximately 1 mL of wine was collected during the winemaking process and transferred to a 2 ml Eppendorf tube and centrifuged at 13000 rpm for 1 min. TM The analyzer analyses approximately 0.6 ml of the supernatant for ethanol, pH, total acidity, volatile acidity, malic acid, wine density and glucose / fructose.

[0487] By OenoFoss TMThe results of the wine analyses performed are shown in Table 3.

[0488] discuss:

[0489] The berries were picked before full maturity, so sugar levels were suboptimal for alcohol development. The resulting wines had alcohol levels below the detectable level of 8% as determined by OenFoss. However, the experiment successfully demonstrated that a rich muscat flavor was present in wines made from the muscat-flavored microvine line 17C001V0006. Seedless berries could potentially be used in white wine production, which currently requires the removal of seeds due to flavor issues caused by the seeds' naturally very high phenolic content. The high phenolics can be extracted into the wine during fermentation, so the absence of seeds could improve the quality of the wine. Skin-contacted white wines Skin-fermented white wine processing allows the wine to develop while the skins are still present, unlike conventional white wine production, which crushes the grapes that recover the juice into the fermentation vessel, resulting in the loss of color pigments, phenols and tannins. Red wines require skin contact and maceration to develop color, aroma and texture.

[0490] Table 2: OenoFoss values ​​for different characteristics of table grape must from samples of microvine grapes. Values ​​are from randomly selected berry samples of each line harvested at approximately 17-18 BRIX measured using a bag refractometer.

[0491]

[0492] Table 3: OenoFoss analysis of small-scale wine samples prepared from selected microvine grapes

[0493]

[0494] Example 12: Genotypic and phenotypic evaluation of homozygous T1 mutants of VViFSL generated by gene editing

[0495] Position of the guide sequence in VviFSL

[0496] Two guide RNA sequences, FS1 and FS4, located in the second exon of VviFSL were designed. These compounds were selected based on the presence of PAM sequences, their on-target and off-target Benchling scores, and the ability to form CRISPR / Cas9 complexes and cleave template DNA in vitro (data not shown). Fig.15 The cloning locations of the CRISPR / Cas9 vector and guide RNA are shown.

[0497] Generation and genotyping of T1 plants

[0498] Several T0 gene-edited plants directed by FS1 and FS4 were selected for self-pollination to obtain T1 progeny, determine the inheritance pattern of mutations and obtain T1 homozygous mutants. T0 lines were selected for T1 progeny production based on mutation frequency. Self-pollination was performed as described in Chaib et al., 2010 and seeds were germinated. Roots from germinated embryos were genotyped using amplicon Sanger sequencing (according to Example 5). Embryonic mutation homozygotes, heterozygotes and non-mutation homozygotes were scored, transferred to SM medium for 2 weeks to form plants, and then potted into soil (BioGro soil mixture purchased from Van Schaiks, Mount Gambier, South Australia), and transferred to a greenhouse or growth chamber to develop flowers for 4 months. The greenhouse temperature was set to 25°C during the day and 20°C at night, and watered twice a day for 5 minutes. The growth chamber temperature was set to 25°C, humidity 85°C, 16 hours of daylight / 8 hours of night cycle bulb 400W (420kWh / 1000h) white light. Water the plants once a day for 5 minutes.

[0499] Analysis of gene editing in the first generation of T0 transgenic plants

[0500] Fifteen GFP-positive plants of FS1 and FS4 analyzed for CRISPR / Cas9 gene editing showed Sanger sequence disruptions of the amplicons surrounding the guide sequence. Nextgen sequencing analysis of these amplicons showed gene editing frequencies ranging from 91.8% to 35.9% for FS1 and from 58.6% to 17.3% for FS4. The types and locations of mutations that occurred at a frequency of >10% in any one plant were identified. Fig.16 These mutations are shown. The mutations in FS1 and FS4 mainly involved base T and occurred 5' to the PAM site.

[0501] Inheritance pattern of mutations in the T1 generation

[0502] When the mutation frequency in the T0 parent is close to 100%, as in hybrids A and E, it is likely that both alleles have been gene-edited, that is, biallelic mutations explain why there is no wild-type progeny segregation in the T1 generation, and there is a 1:1 segregation of homozygous mutants and heterozygotes carrying different mutations on each allele. When the mutation frequency is about 50%, in the case of hybrids C, DQ, F&V, one of the alleles may have been gene-edited while the other is not edited, that is, a monoallelic mutation. This produces 50% heterozygous and 25% homozygous mutants or 25% wild-type progeny. For the case of hybrids C, QF and V, the chi-square test p value of the observed genotype is not significant. However, hybrid D shows a significant deviation from the expected genotype frequency, indicating that the 40% nextgen mutation frequency is not due to monoallelic mutations, but due to mutations that exist in a mosaic state in T0 plants, in which some fragments are mutated and other fragments are not mutated. T1 homozygous mutants are still obtained. Although no wild-type progeny were obtained for cross A, it was probably low mosaic because the flowers in the T0 parent remained hermaphroditic, unlike cross E, in which T0 plants exhibited female flowers, indicating that both FSL genes had been completely knocked out.

[0503] The T1 homozygous mutants obtained from T0 self-crosses are listed in Table 4. Some mutations were common to different crosses and they have been Fig.17 A comparison was made in .

[0504] Homozygous T1 mutants of FS1 and FS4 guide RNAs were obtained. The coding sequences were translated and aligned to determine the effect of the mutations on the protein sequence ( Fig.18 ).

[0505] Table 4: Types of mutations obtained from each T0 hybridization. FS1 and FS4 refer to the original guide sequences.

[0506] Hybrid name T0 Plants Homozygous mutation in T0 flower phenotype T1 T1 Plant Name A FS1_A1B_01 Hermaphrodite FS1_2T_deletion T1_A_FS1_2Tdel C FS4_M2B_14 Hermaphrodite FS4_CT_deletion T1_C_FS4_CTdel C FS4_M2B_14 Hermaphrodite FS4_10bp deletion T1_C_FS4_10bpdel D FS4_M2B_03 Hermaphrodite FS4_5bp_deletion T1_D_FS4_5bpdel D FS4_M2B_03 Hermaphrodite FS4_T_insert T1_D_FS4_Tins E FS1_BIA_3 Female FS1_T_Inserted T1_E_FS1_Tins E FS1_BIA_3 Female FS1_T_deletion T1_E_FS1_Tdel

[0507] Mutations cause significant changes in the amino acid sequence

[0508] All DNA base deletions and insertions resulted in frameshift or nonsense mutations, which may affect protein activity. T1_C_FS4_CTdel, T1-D_FS4, T1_A_FS1_tins, and T1_A_FS1_2Tdel produced nonsense mutations within the PLATZ domain. T1_C-FS4_CTdel appeared earlier than the other mutants. T1_A_FS1_2Tdel and T1_AFs1_Tins produced nonsense mutations at the same position.

[0509] Floral phenotypes in the T1 generation

[0510] All homozygous mutants from the T1 generation showed conversion from hermaphroditism to female flowers with contracted stamens, and one mutant did not produce pollen. Flowers from 2 to 6 individual inflorescences were scored, and 22 to 54 flowers of each mutant were scored (Table 5). Using pollen germination assay, pollen from all mutants showed vigor. This was further confirmed by using pollen in hybridization, in which the mutation was transmitted. There was no significant difference in the pollen count per anther of the mutant between the original hermaphrodite plant and the mutant producing pollen. The number of anthers analyzed was 6-49. At least 3 single homozygous mutants were confirmed to have female flowers, and the wild-type T1 progeny had a hermaphrodite phenotype, confirming that the mutation caused a phenotypic change.

[0511] Table 5: Summary of genotypes and phenotypes of T1 mutants.

[0512]

[0513] discuss

[0514] The inventors have used CRISPR / Cas9 technology to demonstrate that the VViFSL PLATZ transcription factor is essential for normal male organ development in flowers within grapevine linkage group 2. Knockout of the gene appears to be recessive, as plants with only one mutant allele display a hermaphroditic phenotype.

[0515] No differences were found between male and hermaphrodite VViFSL at the DNA and protein levels, suggesting that it behaves similarly to Sp, a dominant gene required for male organ development as described by Oberle, 1938. However, in the female allele, amino acid substitutions as well as changes in the position of the start codon were found to render the protein nonfunctional and result in the loss of male organ development.

[0516] The significantly lower expression in the female genotype (fsl / fsl) indicates a lack of gene expression / protein levels that interfere with male organ development. Figure 2 ), the ATG start position of the female gene is further extended 5', which may change the 5' upstream sequence and affect the binding of transcription inducers. However, there are also amino acid substitutions that may affect protein activity.

[0517] Using CRISPR / Cas9 mutants, the inventors similarly achieved a female phenotype by inactivating VviFSL due to changes in the protein sequence. The monoallelic mutant of T0 maintained the original hermaphroditic flower phenotype, indicating that only one functional FSL gene is required for the development of male organs, making it a dominant trait.

[0518] Based on the SNPs, NCBI LOC100247272 appears to be a dominant FSL causing normal male organ development, while LOC100852507 appears to be a recessive FSL causing abnormal male organ development. This indicates that the Pinot Noir genome is heterozygous for the sex locus FSL / fsl.

[0519] It is unclear why the CT mutation affects pollen fertility, while the other mutations produce shrunken stamens and viable pollen. The nonsense mutation occurs earlier within the PLATZ domain and therefore may have more impact on its function.

[0520] This is the first time that a PLATZ domain transcription factor has been described to function in plant flower development.

[0521] Example 13: Discussion

[0522] The present inventors have identified a locus, termed the floral sex (FSL) locus, that is responsible for floral sex in angiosperms such as grapevines, and that different FSL locus genotypes and polypeptides expressed thereby can be used to determine, control and / or select for floral sex phenotypes, i.e., female, male or hermaphroditic floral phenotypes, respectively. The present inventors have characterized the locus responsible for male sex organ determination, the FSL locus in species of the genus Vitis, and have also demonstrated 100% concordance between female fsl / fsl and hermaphroditic FSL / FSL or FSL / fsl genotypes between single nucleotide polymorphisms (SNPs) within the plant AT-rich sequence and zinc binding (PLATZ) domain of the FSL locus and the respective floral sex phenotypes.

[0523] The inventors have generated FSL knockout grape plants by introducing mutations in the PLATZ domain of the FSL locus using CRISPR. The inventors have demonstrated that the resulting FSL knockout plants do not develop functional male reproductive organs, supporting the conclusion that expression of the FSL locus is essential for the development of functional male reproductive organs in flowers. Based on these findings, the present invention describes plants and plant parts with altered FSL polypeptide activity, as well as methods for producing plants with specific flower sex phenotypes by selecting for specific FSL locus genotypes or by modifying the FSL locus.

[0524] The present invention is also based on the inventors' discovery that new parthenocarpic seedless grape varieties can be produced by combining (i) the FSL locus, which determines the sex of male flowers that have been modified to confer a female flower phenotype, and (ii) polynucleotides conferring dwarf morphology, such as variants of the gibberellic acid insensitivity (GAI1) locus that confer dwarf morphology and rapid flowering to grapevines. The inventors have shown that grapevines with the above fsl\\ / GAI1 genetic characteristics produce parthenocarpic seedless fruits when the flowers are not pollinated, and produce fruits containing seeds when the flowers are pollinated with viable pollen.

[0525] Furthermore, the present invention is based on the surprising discovery of the inventors that new seed-aborting / parthenocarpic seedless grape varieties can be produced by combining: (i) a FSL locus that is homozygous in females or has been modified to confer a female flower phenotype, (ii) a polynucleotide conferring a dwarf morphology, such as a variant of the GAI1 locus that confers a dwarf morphology and rapid flowering in grapevines; (iii) a polynucleotide conferring seedless fruit, such as a variant of the grape MADS box protein 5 (VvMADS5) locus. The inventors have shown that grapevines having the above-mentioned fsl / GAI1 / VvMADS5 genetic characteristics produce parthenocarpic seedless fruit when the flowers are not pollinated, and produce seed-aborting fruit when the flowers are pollinated with viable pollen. In this regard, the present invention provides new "seedless" genotypes that are capable of producing seedless fruit in grapevines, including "true seedless" fruit even after pollination.

[0526] It will be appreciated by those skilled in the art that many changes and / or modifications may be made to the invention as shown in the specific examples without departing from the spirit or scope of the invention as broadly described. Therefore, the present embodiments are to be considered in all aspects as illustrative and not restrictive.

[0527] All publications discussed and / or cited herein are incorporated herein in their entirety.

[0528] Any discussion of documents, acts, materials, devices, articles and the like included in this specification is solely for the purpose of providing a context for the present invention. It should not be taken as an admission that any or all of these form part of the prior art base or are common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

[0529] References

[0530] Almeida and Allshire (2005) TRENDS Cell Biology 15:251-258.

[0531] Antcliff (1980) Annales de l'Amelioration des Plantes 39:113-122.

[0532] Ausubel et al., (eds.), Current Protocols in Molecular Biology, Greene Pub. (1988, including all updates to date), Associates and Wiley-Interscience.

[0533] Battilana et al. (2013) Molecular Biotechnology 54(3):1031-1037.

[0534] Bevan et al. (1983) Nucleic Acid Ressearch, 11:369-385.

[0535] Bibikova et al. (2001) Molecular and Cellular Biology, 21: 289-287.

[0536] Bibikova et al. (2002) Genetics 161:1169-1175.

[0537] Boss and Thomas, (2002) Nature, 416(6883): 847-850

[0538] Bourque (1995) Plant Science, 105:125-149.

[0539] Brown TA (ed.), Essential Molecular Biology: A Practical Approach (1991). Vol. 1 and 2, IRL Press,

[0540] Carmona et al. (2008) Journal of Experimental Botany, 59(10): 2579-2596.

[0541] Certo et al. (2012) Nature Methods 8:941-943.

[0542] Chaib et al. (2010) The Plant Journal, 62(6): 1083-1092.

[0543] Chanderbali et al. (2010) PNAS USA, 107:22570–22575.

[0544] Christensen & Quail (1989) Plant Molecular Biology. 12: 619-632.

[0545] Christensen et al. (1992) Plant Molecular Biology. 18: 675-689.

[0546] Coito et al. (2017) Frontiers in Plant Science, 8:98.

[0547] Coito et al., (2019) PeerJ, DOI 10.7717 / peerj.7879.

[0548] Coligan et al. (eds.) Current Protocols in Immunology, John Wiley & Sons.

[0549] Comai et al. (2004) Plant Journal, 37:778-786.

[0550] Coombe adopted a system for identifying grapevine growth stages ('Adoption of a system for identifying grapevine growth stages') (1995) "Aust. J. Grape and Wine Res." 1:104-110 Dalbo, et al. (2000).

[0551] Doyon et al. (2010) Nature Methods 7:459-460.

[0552] Doyon et al. (2011) Nature Methods 8:74-79.

[0553] Fechter et al. (2012) Molecular Genetics and Genomics, 287 247–259.

[0554] Friedlander et al. (1977) Plant and Cell Physiology, 18(1): 261-269.

[0555] Gelvin et al. Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990

[0556] Glover and Hames (Eds.), DNA Cloning: A Practical Approach, (1995 and 1996) (Vols. 1-4), IRL Press.

[0557] Groenen et al. (1993) Molecular Microbiology, 10:1057-1065.

[0558] Guo et al. (2010) Journal of Molecular Biology, 400:96-107.

[0559] Haft et al. (2005) Computational Biology, 1(6):e60

[0560] Harlow and Lane (eds.) Antibodies: A Laboratory Manual (1988), Cold Spring Harbor Laboratory,

[0561] Hartmann and Endres, Manual of Antisense Methodology, Kluwer (1999).

[0562] Henikoff et al. (2004) Handbook of Antisense Methodology (Plant Physiology), 135:630-636.

[0563] Hinchee et al. (1988) Biotechnology, 6:915.

[0564] Hoe et al. (1999) Emerging Infectious Diseases, 5:254-263.

[0565] Iocco et al. (2001) Transgenic Research 10:105–112.

[0566] Ishino et al. (1987) Journal of Bacteriology, 169:5429-5433.

[0567] Jackson (1992) In-situ hybridisation in plants. In: Molecular Plant Pathology: A Practical Approach. Practical Approach Series, 1(85). Oxford University Press.

[0568] Janssen et al. (2002) OMICS Journal of Integrated Biology, 6:23-33.

[0569] Ji et al. (2015) Scientia Horticulturae, 193: 367-373.

[0570] Ji et al. (2016) Journal of Integrated Plant Biology, 58:762-765.

[0571] Jie et al. (2017) Horticultural Plant Journal, 3(3): 91-100.

[0572] Jinek et al. (2012) Science 337(6069):816-821.

[0573] Joshi (1987) Nucleic Acid Research, 15: 6643-6653.

[0574] Kim et al. (1996) Proceedings of the National Academy of Sciences, 93:1156-1160.

[0575] Kim et al. (2012) Genome Research, 22:1327-1333.

[0576] Koziel et al. (1996) Plant Molecular Biology, 32: 393-405.

[0577] Last et al. (1991) Theoretical and Applied Genetics, 81(5):581-588.

[0578] Medberry et al. (1992) Plant Cell, 4:185-192.

[0579] Medberry et al. (1993) Plant Journal, 3:619-626.

[0580] Manzano et al. (2011) Plant Growth Regulation, 65:213–221.

[0581] Mao et al. (2017) Frontiers in Plant Science, 8:1291.

[0582] McElroy et al. (1990) Plant Cell, 2:163-171.

[0583] McConnell Smith et al. (2009) PNAS USA, 106:5099-5104.

[0584] Millar and Waterhouse (2005) Functional and Integrative Genomics, 5:129-135.

[0585] Miller et al. (2007) Nature Biotechnology 25:778-785.

[0586] Mojica et al. (1995) Molecular Microbiology, 17:85-93.

[0587] Mojica et al. (2000) Molecular Microbiology, 36:244-246.

[0588] Nakata et al. (1989) Journal of Bacteriology, 171:3553-3556.

[0589] Nagano et al. (2001) Nucleic Acids Research, 29(20):4097-4105.

[0590] Negi and Olmo (1966) Science, 152:1624–1625.

[0591] Negi and Olmo (1971) Vitis, 9:265-279.

[0592] Odell et al. (1985) Nature 313:810-812.

[0593] Oberle (1938) New York State Agricultural Experiment Station Bulletin 250:3-32.

[0594] Pannell (2017) Current Biology, 27(5): R191-R197.

[0595] Perbal (1984), A Practical Guide to Molecular Cloning, John Wiley and Sons (1987 supplement).

[0596] Pasquinelli et al. (2005) Current Opinions in Genetics and Development, 15:200-205.

[0597] Peterson and Anhder (1960) Science, 131:1673–1674.

[0598] Pouwels et al. Cloning Vectors: A Laboratory Manual, 1985.

[0599] Ramirez et al. (2012) Nucleic Acids Research, 40:5560-5568.

[0600] Riaz et al. (2006) Theoretical and Applied Genetics, 113:1317-1329.

[0601] Royo et al. (2018) Plant Physiology, 177:1234-1253.

[0602] Sambrook et al., (1989), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0603] Senior (1998) Biotechology and Genetic Engineering Reviews, 15:79-119.

[0604] Sigrist, C.J.A. (2009) Nucleic Acids Research, 38:161-166.

[0605] Slade and Knauf (2005) Transgenic Research, 14:109-115.

[0606] Smith et al. (2000) Nature 407:319-320.

[0607] So et al., (2015) POJ, 8(6): 479-484.

[0608] Stalker et al. (1988) Science 242:419-423.

[0609] Szczepek et al. (2007) Nature Biotechnology 25:786-793.

[0610] Taylor (1997) The Plant Cell 9:1245-1249.

[0611] Tanurdzic and Banks (2004) Plant Cell, 16(Suppl 1):S61–S71.

[0612] Thillet et al. (1988) The Journal of Biological Chemistry, 263:12500.

[0613] van Embden et al. (2000) Journal of Bacteriology, 182:2393-2401.

[0614] Valleau (1916) The American Naturalist 50(597):554-564.

[0615] Velten et al. (1984) EPBO Journal, 3:2733-2730.

[0616] Waterhouse et al. (1998) PNAS USA, 95:13959-13964.

[0617] Wang et al. (2012) Genome Research, 22:1316-1326.

[0618] Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.

[0619] Yamasaki et al. (2000) Plant and Cell Physiology, 41:608–616.

[0620] Yamasaki et al. (2001) Plant and Cell Physiology, 42:608–619.

[0621] Yamasaki, et al. (2005) Vitamins and Hormones, 72:79-110.

[0622] Zhang et al. (2013) Current Biology, 23(20): 1979-1989. Sequence Listing <110> Commonwealth Scientific and Industrial Research Organization <120> Controlling flowering of plants <130> 530339PCT <150> AU2019902304 <151> 2019-06-28 <150> AU2019902483 <151> 2019-07-12 <160> twenty two <170> PatentIn version 3.5 <210> 1 <211> 255 <212> PRT <213> Grape <400> 1 Met Lys Met Val Gly Phe Gly Cys Asp Ile Pro His Trp Leu Glu Ile 1 5 10 15 Leu Leu Gly Glu Lys Phe Phe Asn Ala Cys Val Val His Glu Cys Ala 20 25 30 Lys Lys Asn Glu Lys Asn Ile Phe Cys Leu Asp Cys Cys Thr Ser Ile 35 40 45 Cys Pro His Cys Leu Leu Pro His Arg His His Arg Leu Leu Gln Ile 50 55 60 Arg Arg Tyr Val Tyr His Asp Val Ile Arg Leu Asp Asp Ala Gln Glu 65 70 75 80 Leu Met Asp Cys Ser Leu Val Gln Ser Tyr Thr Thr Asn Ser Ala Lys 85 90 95 Val Val Phe Leu Asn Gln Arg Pro Met Ser Arg Pro Phe Arg Gly Ser 100 105 110 Gly Asn Leu Cys Tyr Thr Cys Glu Arg Ser Leu Gln Asp Pro Tyr Leu 115 120 125 Phe Cys Ser Leu Ala Cys Lys Val His His Thr Met Asn Val Lys Gly 130 135 140 Ser Ala Thr Lys His Leu His Asn Phe Glu Phe Leu Pro Leu Pro Asp 145 150 155 160 Arg Ala Arg Gly Glu Thr Phe Ser Glu Leu Asp Asp Arg Gln Met Thr 165 170 175 Pro Glu Ser Val Leu Asp Ser Pro Val Ser Leu Arg Thr Ser Ser Gly 180 185 190 Ser Ser Ser Thr Gly Gly Ala Leu Ser Cys Arg Ala Leu Ala Cys Thr 195 200 205 Ala Thr Thr Glu Phe Val Lys Lys Lys Arg Ser Ser Val Ser Val Pro 210 215 220 Arg Ser Pro Phe Arg Pro Ile Phe Ser Pro Ala Ser Asp Asn Ala Gly 225 230 235 240 Gly Ile Asn Arg Arg Lys Gly Val Pro His Arg Ser Pro Leu His 245 250 255 <210> 2 <211> 253 <212> PRT <213> Vitis <400> 2 Met Val Gly Phe Gly Cys Asp Ile Pro His Trp Leu Glu Ile Leu Leu 1 5 10 15 Gly Glu Lys Phe Phe Asn Ala Cys Val Val His Glu Cys Ala Lys Lys 20 25 30 Asn Glu Lys Asn Ile Phe Cys Leu Asp Cys Cys Thr Ser Ile Cys Pro 35 40 45 His Cys Leu Leu Pro His Arg His His Arg Leu Leu Gln Ile Arg Arg 50 55 60 Tyr Val Tyr His Asp Val Ile Arg Leu Asp Asp Ala Gln Lys Leu Met 65 70 75 80 Asp Cys Ser Leu Val Gln Ser Tyr Thr Thr Asn Ser Ala Lys Val Val 85 90 95 Phe Leu Asn Gln Arg Pro Met Ser Arg Pro Phe Arg Gly Ser Gly Asn 100 105 110 Leu Cys Tyr Thr Cys Asp Arg Ser Leu Gln Asp Pro Tyr Leu Phe Cys 115 120 125 Ser Leu Ala Cys Lys Val His His Thr Val Asn Val Lys Gly Gly Ala 130 135 140 Thr Lys His Leu His Asn Phe Glu Phe Leu Pro Leu Pro Asp Arg Ala 145 150 155 160 Arg Gly Glu Ala Phe Ser Glu Leu Asp Asp Arg Gln Met Thr Pro Glu 165 170 175 Ser Val Leu Asp Ser Pro Val Ser Leu Arg Thr Ser Ser Gly Ser Ser 180 185 190 Pro Thr Gly Gly Ala Val Ser Cys Arg Ala Leu Ala Cys Thr Ala Thr 195 200 205 Thr Glu Phe Val Lys Lys Lys Arg Ser Ser Val Ser Val Pro Arg Phe 210 215 220 Pro Phe Arg Pro Ile Leu Ser Pro Ala Ser Asp Asn Ala Gly Gly Ile 225 230 235 240 Asn Arg Arg Lys Gly Val Pro His Arg Ser Pro Leu His 245 250 <210> 3 <211> 255 <212> PRT <213> Vitis species <400> 3 Met Lys Met Val Gly Phe Gly Cys Asp Ile Pro His Trp Leu Glu Ile 1 5 10 15 Leu Leu Gly Glu Lys Phe Phe Asn Ala Cys Val Val His Glu Cys Ala 20 25 30 Lys Lys Asn Glu Lys Asn Ile Phe Cys Leu Asp Cys Cys Thr Ser Ile 35 40 45 Cys Pro His Cys Leu Leu Pro His Arg His His Arg Leu Leu Gln Ile 50 55 60 Arg Arg Tyr Val Tyr His Asp Val Ile Arg Leu Asp Asp Ala Gln Glu 65 70 75 80 Leu Met Asp Cys Ser Leu Val Gln Ser Tyr Thr Thr Asn Ser Ala Lys 85 90 95 Val Val Phe Leu Asn Gln Arg Pro Met Ser Arg Pro Phe Arg Gly Ser 100 105 110 Gly Asn Leu Cys Tyr Thr Cys Glu Arg Ser Leu Gln Asp Pro Tyr Leu 115 120 125 Phe Cys Ser Leu Ala Cys Lys Val His His Thr Met Asn Val Lys Gly 130 135 140 Ser Ala Thr Lys His Leu His Asn Phe Glu Phe Leu Pro Leu Pro Asp 145 150 155 160 Arg Ala Arg Gly Glu Thr Phe Ser Glu Leu Asp Asp Arg Gln Met Thr 165 170 175 Pro Glu Ser Val Leu Asp Ser Pro Val Ser Leu Arg Thr Ser Ser Gly 180 185 190 Ser Ser Ser Thr Gly Gly Ala Leu Ser Cys Arg Ala Leu Ala Cys Thr 195 200 205 Ala Thr Thr Glu Phe Val Lys Lys Lys Arg Ser Ser Val Ser Val Pro 210 215 220 Arg Ser Pro Phe Arg Pro Ile Phe Ser Pro Ala Ser Asp Asn Ala Gly 225 230 235 240 Gly Ile Asn Arg Arg Lys Gly Val Pro His Arg Ser Pro Leu His 245 250 255 <210> 4 <211> 768 <212> DNA <213> Grape <400> 4 atgaaaatgg ttggttttgg ttgtgatatt cctcactggc ttgaaattct tctgggggag 60 aagttcttta acgcgtgtgt ggttcatgag tgcgctaaga agaacgagaa gaacatcttt 120 tgcttggact gttgcaccag catctgcccc cactgtttgc tccctcaccg ccatcaccgc 180 cttctacaga tacggaggta cgtttatcac gacgttatac ggttggatga tgctcaagag 240 ctgatggatt gttctcttgt tcaatcatac acaacaaaca gtgcaaaagt ggtgtttttg 300 aaccaaaggc ctatgtctcg gccctttaga gggtccggca acctctgcta cacctgcgaa 360 cgaagcttgc aagacccata tctcttctgc tctctcgcat gcaaggttca tcacacgatg 420 aacgtcaaag gtagtgccac aaaacacctc cacaactttg aattccttcc attacctgat 480 agagcacgag gcgaggcctt ttccgagctc gacgaccgcc aaatgacccc agaatccgtc 540 ctcgactccc ctgtttctct ccgaacttcg tctggctcga gctccaccgg cggtgccttg 600 agttgcagag cgctggcctg cactgccacc accgagttcg tgaagaaaaa gcgcagcagc 660 gtctctgtac ctcggtcccc tttccgtccg atcttctcac cggcgtcaga caacgccggt 720 ggaataaaca ggagaaaggg tgtccctcac cgatcgccgc tgcactga 768 <210> 5 <211> 762 <212> DNA <213> Vitis species <400> 5 atggttggtt ttggttgtga tattcctcac tggcttgaaa ttcttctggg ggagaagttc 60 tttaacgcgt gtgtggttca tgagtgcgct aagaagaacg agaagaacat cttttgcttg 120 gattgttgca ccagcatctg cccccactgt ttgctccctc accgccatca ccgccttcta 180 cagataagga ggtacgttta tcacgacgtt atacggttgg atgatgctca aaagctgatg 240 gattgttctc ttgttcaatc atacacaaca aacagtgcaa aagtggtgtt tttgaaccaa 300 aggcctatgt ctcggccttt tagagggtcc ggcaacctct gctacacctg cgaccgaagc 360 ttgcaagacc catatctctt ctgctctctc gcatgcaagg ttcatcacac ggtgaacgtc 420 aaaggtggtg ccacaaaaca cctccacaac tttgaattcc ttccattacc tgatagagca 480 cgaggcgagg ccttttccga gctcgacgac cgccaaatga ccccagaatc cgtcctcgac 540 tcccctgttt ctctccgaac ttcgtctggc tcgagcccca ccggcggtgc cgtgagttgc 600 agagcgctgg cctgcactgc aaccaccgag ttcgtgaaga aaaagcgcag cagcgtctct 660 gtgcctcggt tccctttccg tccgatcctc tcaccggcgt cagacaacgc cggtggaata 720 aacaggagaa agggtgtccc tcaccgatcg ccgctgcact ga 762 <210> 6 <211> 768 <212> DNA <213> Vitis species <400> 6 atgaaaatgg ttggttttgg ttgtgatatt cctcactggc ttgaaattct tctgggggag 60 aagttcttta acgcgtgtgt ggttcatgag tgcgctaaga agaacgagaa gaacatcttt 120 tgcttggact gttgcaccag catctgcccc cactgtttgc tccctcaccg ccatcaccgc 180 cttctacaga tacggaggta cgtttatcac gacgttatac ggttggatga tgctcaagag 240 ctgatggatt gttctcttgt tcaatcatac acaacaaaca gtgcaaaagt ggtgtttttg 300 aaccaaaggc ctatgtctcg gccctttaga gggtccggca acctctgcta cacctgcgaa 360 cgaagcttgc aagacccata tctcttctgc tctctcgcat gcaaggttca tcacacgatg 420 aacgtcaaag gtagtgccac aaaacacctc cacaactttg aattccttcc attacctgat 480 agagcacgag gcgaggcctt ttccgagctc gacgaccgcc aaatgacccc agaatccgtc 540 ctcgactccc ctgtttctct ccgaacttcg tctggctcga gctccaccgg cggtgccttg 600 agttgcagag cgctggcctg cactgccacc accgagttcg tgaagaaaaa gcgcagcagc 660 gtctctgtac ctcggtcccc tttccgtccg atcttctcac cggcgtcaga caacgccggt 720 ggaataaaca ggagaaaggg tgtccctcac cgatcgccgc tgcactga 768 <210> 7 <211> 768 <212> DNA <213> Vitis species <400> 7 atgaaaatgg ttggttttgg ttgtgatatt cctcactggc ttgaaattct tctgggggag 60 aagttcttta acgcgtgtgt ggttcatgag tgcgctaaga agaacgagaa gaacatcttt 120 tgcttggact gttgcaccag catctgcccc cactgtttgc tccctcaccg ccatcaccgc 180 cttctacaga tacggaggta cgtttatcac gacgttatac ggttggatga tgctcaagag 240 ctgatggatt gttctcttgt tcaatcatac acaacaaaca gtgcaaaagt ggtgtttttg 300 aaccaaaggc ctatgtctcg gccctttaga gggtccggca acctctgcta cacctgcgaa 360 cgaagcttgc aagacccata tctcttctgc tctctcgcat gcaaggttca tcacacgatg 420 aacgtcaaag gtagtgccac aaaacacctc cacaactttg aattccttcc attacctgat 480 agagcacgag gcgagacctt ttccgagctc gacgaccgcc aaatgacccc agaatccgtc 540 ctcgactccc ctgtttctct ccgaacttcg tctggctcga gctccaccgg cggtgccttg 600 agttgcagag cgctggcctg cactgccacc accgagttcg tgaagaaaaa gcgcagcagc 660 gtctctgtac ctcggtcccc tttccgtccg atcttctcac cggcgtcaga caacgccggt 720 ggaataaaca ggagaaaggg tgtccctcac cgatcgccgc tgcactga 768 <210> 8 <211> 590 <212> PRT <213> Grape <400> 8 Met Lys Arg Glu Tyr His His Pro His His Pro Thr Cys Ser Thr Ser 1 5 10 15 Pro Thr Gly Lys Gly Lys Met Trp Asp Ala Asp Pro Gln Gln Asp Ala 20 25 30 Gly Met Asp Glu Leu Leu Ala Val Leu Gly Tyr Asn Val Lys Ala Ser 35 40 45 Asp Met Ala Glu Val Ala Gln Lys Leu Glu Gln Leu Glu Glu Val Ile 50 55 60 Val Asn Ala Gln Glu Asp Gly Leu Ser His Leu Ala Ser Glu Thr Val 65 70 75 80 His Tyr Asn Pro Ser Asp Leu Ser Asn Trp Leu Gly Ser Met Leu Ser 85 90 95 Glu Phe Asn Pro Thr Pro Asn Cys Ala Leu Asp Asn Pro Phe Leu Pro 100 105 110 Pro Ile Ser Pro Leu Asp Tyr Thr Asn Cys Ser Thr Gln Pro Lys Gln 115 120 125 Glu Pro Ser Ile Phe Asp Ser Pro Ser Leu Asp Tyr Asp Leu Lys Ala 130 135 140 Ile Pro Gly Lys Ala Leu Tyr Ser His Ile Glu Gln Pro Pro Gln Gln 145 150 155 160 Pro Pro Ala Pro Pro Leu Tyr Gln Arg Asp Asn Lys Arg Leu Lys Pro 165 170 175 Thr Thr Ser Ala Thr Ala Asn Ser Val Ser Ser Val Ile Gly Gly Trp 180 185 190 Gly Val Pro Thr Glu Ser Ala Arg Pro Val Val Leu Val Asp Ser Gln 195 200 205 Glu Thr Gly Ile Arg Leu Val His Thr Leu Met Ala Cys Ala Glu Ala 210 215 220 Val Gln Gln Glu Asn Leu Lys Leu Ala Glu Ala Leu Val Lys Gln Ile 225 230 235 240 Gly Phe Leu Ala Val Ser Gln Ala Gly Ala Met Arg Lys Val Ala Thr 245 250 255 Tyr Phe Ala Glu Gly Leu Ala Arg Arg Ile Tyr Arg Leu Tyr Pro Asp 260 265 270 Lys Pro Leu Asp Ser Ser Phe Ser Asp Ile Leu Gln Met His Phe Tyr 275 280 285 Glu Thr Cys Pro Tyr Leu Lys Phe Ala His Phe Thr Ala Asn Gln Ala 290 295 300 Ile Leu Glu Ala Phe Glu Gly Lys Lys Arg Val His Val Ile Asp Phe 305 310 315 320 Ser Met Lys Gln Gly Met Gln Trp Pro Ala Leu Met Gln Ala Leu Ala 325 330 335 Leu Arg Pro Gly Gly Pro Pro Ser Phe Arg Leu Thr Gly Ile Gly Pro 340 345 350 Pro Ser Thr Asp Asn Thr Asp His Leu His Glu Val Gly Trp Lys Leu 355 360 365 Ala Gln Leu Ala Glu Thr Ile His Val Glu Phe Glu Tyr Arg Gly Phe 370 375 380 Val Ala Asn Ser Leu Ala Asp Leu Asp Ala Ser Met Leu Glu Leu Arg 385 390 395 400 Asp Gly Glu Ser Val Ala Val Asn Ser Val Phe Glu Leu His Ser Leu 405 410 415 Leu Ala Arg Pro Gly Gly Ile Glu Arg Val Leu Ser Ala Val Lys Asp 420 425 430 Met Lys Pro Asp Ile Val Thr Ile Val Glu Gln Glu Ala Asn His Asn 435 440 445 Gly Pro Val Phe Leu Asp Arg Phe Thr Glu Ser Leu His Tyr Tyr Ser 450 455 460 Thr Leu Phe Asp Ser Leu Glu Gly Cys Gly Val Ser Pro Val Asn Thr 465 470 475 480 Gln Asp Lys Leu Met Ser Glu Val Tyr Leu Gly Gln Gln Ile Cys Asn 485 490 495 Val Val Ala Cys Glu Gly Pro Glu Arg Val Glu Arg His Glu Thr Leu 500 505 510 Ala Gln Trp Arg Ala Arg Leu Gly Ser Ala Gly Phe Asp Pro Val Asn 515 520 525 Leu Gly Ser Asn Ala Phe Lys Gln Ala Ser Met Leu Leu Ala Leu Phe 530 535 540 Ala Gly Gly Asp Gly Tyr Arg Val Glu Glu Asn Asn Gly Cys Leu Met 545 550 555 560 Leu Gly Trp His Thr Arg Pro Leu Ile Ala Thr Ser Ala Trp Gln Leu 565 570 575 Ala Asn Lys Pro Ala Leu Pro Ser Ser Thr Pro Ala Ser Asn 580 585 590 <210> 9 <211> 590 <212> PRT <213> Grape <400> 9 Met Lys Arg Glu Tyr His His Pro His His Pro Thr Cys Ser Thr Ser 1 5 10 15 Pro Thr Gly Lys Gly Lys Met Trp Asp Ala Asp Pro Gln Gln Asp Ala 20 25 30 Gly Met Asp Glu Leu His Ala Val Leu Gly Tyr Asn Val Lys Ala Ser 35 40 45 Asp Met Ala Glu Val Ala Gln Lys Leu Glu Gln Leu Glu Glu Val Ile 50 55 60 Val Asn Ala Gln Glu Asp Gly Leu Ser His Leu Ala Ser Glu Thr Val 65 70 75 80 His Tyr Asn Pro Ser Asp Leu Ser Asn Trp Leu Gly Ser Met Leu Ser 85 90 95 Glu Phe Asn Pro Thr Pro Asn Cys Ala Leu Asp Asn Pro Phe Leu Pro 100 105 110 Pro Ile Ser Pro Leu Asp Tyr Thr Asn Cys Ser Thr Gln Pro Lys Gln 115 120 125 Glu Pro Ser Ile Phe Asp Ser Pro Ser Leu Asp Tyr Asp Leu Lys Ala 130 135 140 Ile Pro Gly Lys Ala Leu Tyr Ser His Ile Glu Gln Pro Pro Gln Gln 145 150 155 160 Pro Pro Ala Pro Pro Leu Tyr Gln Arg Asp Asn Lys Arg Leu Lys Pro 165 170 175 Thr Thr Ser Ala Thr Ala Asn Ser Val Ser Ser Val Ile Gly Gly Trp 180 185 190 Gly Val Pro Thr Glu Ser Ala Arg Pro Val Val Leu Val Asp Ser Gln 195 200 205 Glu Thr Gly Ile Arg Leu Val His Thr Leu Met Ala Cys Ala Glu Ala 210 215 220 Val Gln Gln Glu Asn Leu Lys Leu Ala Glu Ala Leu Val Lys Gln Ile 225 230 235 240 Gly Phe Leu Ala Val Ser Gln Ala Gly Ala Met Arg Lys Val Ala Thr 245 250 255 Tyr Phe Ala Glu Gly Leu Ala Arg Arg Ile Tyr Arg Leu Tyr Pro Asp 260 265 270 Lys Pro Leu Asp Ser Ser Phe Ser Asp Ile Leu Gln Met His Phe Tyr 275 280 285 Glu Thr Cys Pro Tyr Leu Lys Phe Ala His Phe Thr Ala Asn Gln Ala 290 295 300 Ile Leu Glu Ala Phe Glu Gly Lys Lys Arg Val His Val Ile Asp Phe 305 310 315 320 Ser Met Lys Gln Gly Met Gln Trp Pro Ala Leu Met Gln Ala Leu Ala 325 330 335 Leu Arg Pro Gly Gly Pro Pro Ser Phe Arg Leu Thr Gly Ile Gly Pro 340 345 350 Pro Ser Thr Asp Asn Thr Asp His Leu His Glu Val Gly Trp Lys Leu 355 360 365 Ala Gln Leu Ala Glu Thr Ile His Val Glu Phe Glu Tyr Arg Gly Phe 370 375 380 Val Ala Asn Ser Leu Ala Asp Leu Asp Ala Ser Met Leu Glu Leu Arg 385 390 395 400 Asp Gly Glu Ser Val Ala Val Asn Ser Val Phe Glu Leu His Ser Leu 405 410 415 Leu Ala Arg Pro Gly Gly Ile Glu Arg Val Leu Ser Ala Val Lys Asp 420 425 430 Met Lys Pro Asp Ile Val Thr Ile Val Glu Gln Glu Ala Asn His Asn 435 440 445 Gly Pro Val Phe Leu Asp Arg Phe Thr Glu Ser Leu His Tyr Tyr Ser 450 455 460 Thr Leu Phe Asp Ser Leu Glu Gly Cys Gly Val Ser Pro Val Asn Thr 465 470 475 480 Gln Asp Lys Leu Met Ser Glu Val Tyr Leu Gly Gln Gln Ile Cys Asn 485 490 495 Val Val Ala Cys Glu Gly Pro Glu Arg Val Glu Arg His Glu Thr Leu 500 505 510 Ala Gln Trp Arg Ala Arg Leu Gly Ser Ala Gly Phe Asp Pro Val Asn 515 520 525 Leu Gly Ser Asn Ala Phe Lys Gln Ala Ser Met Leu Leu Ala Leu Phe 530 535 540 Ala Gly Gly Asp Gly Tyr Arg Val Glu Glu Asn Asn Gly Cys Leu Met 545 550 555 560 Leu Gly Trp His Thr Arg Pro Leu Ile Ala Thr Ser Ala Trp Gln Leu 565 570 575 Ala Asn Lys Pro Ala Leu Pro Ser Ser Thr Pro Ala Ser Asn 580 585 590 <210> 10 <211> 223 <212> PRT <213> Grape <400> 10 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Asn 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Val Tyr Glu Tyr Ser Asn Asn Asn Ile Lys Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Ser Ser Asp Ser Thr Asn Gly Gly 65 70 75 80 Phe Thr Met Glu Ile Asn Ala Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg Gln Gln Ile Gln Met Leu Gln Asn Ser Asn Arg His Leu Met 100 105 110 Gly Asp Ser Leu Ala Ser Leu Thr Val Lys Glu Leu Lys Gln Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Leu Ala Glu Ile Glu Tyr Leu Gln Lys Arg Glu Ile Glu Leu 145 150 155 160 Glu Asn Glu Ser Val Tyr Leu Arg Thr Lys Ile Ala Glu Val Glu Arg 165 170 175 Leu Gln Gln Ala Asn Met Val Ser Thr His Glu Phe Asn Ala Ile Gln 180 185 190 Ala Leu Val Ser Arg Asn Phe Phe Gln Pro Asn Met Ile Glu Gly Gly 195 200 205 Ser Thr Gly Tyr Pro Leu His Asp Lys Lys Val Leu His Leu Gly 210 215 220 <210> 11 <211> 223 <212> PRT <213> Grape <400> 11 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Asn 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Val Tyr Glu Tyr Ser Asn Asn Asn Ile Lys Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Ser Ser Asp Ser Thr Asn Gly Gly 65 70 75 80 Phe Thr Met Glu Ile Asn Ala Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg Gln Gln Ile Gln Met Leu Gln Asn Ser Asn Arg His Leu Met 100 105 110 Gly Asp Ser Leu Ala Ser Leu Thr Val Lys Glu Leu Lys Gln Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Leu Ala Glu Ile Glu Tyr Leu Gln Lys Arg Glu Ile Glu Leu 145 150 155 160 Glu Asn Glu Ser Val Tyr Leu Arg Thr Lys Ile Ala Glu Val Glu Arg 165 170 175 Leu Gln Gln Ala Asn Met Val Ser Thr His Glu Phe Asn Ala Ile Gln 180 185 190 Ala Leu Val Ser Leu Asn Phe Phe Gln Pro Asn Met Ile Glu Gly Gly 195 200 205 Ser Thr Gly Tyr Pro Leu His Asp Lys Lys Val Leu His Leu Gly 210 215 220 <210> 12 <211> 35 <212> DNA <213> Artificial sequence <220> <223> OligodT B26 <400> 12 gactcgagtc gacatcgatt tttttttttt ttttt 35 <210> 13 <211> 19 <212> DNA <213> Artificial sequence <220> <223> CSFS1_CDS_F1 <400> 13 cagtgccagt tttgcaggc 19 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> FSL_RT_F1 <400> 14 acgccggtgg aataaacagg 20 <210> 15 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> FSL_RT_R1 <400> 15 tctcctttct ccatccctaa ttga 24 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Guide FS1 <400> 16 ggcggtgagg gagcaaacag 20 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Guide FS4 <400> 17 aggggtgcac ctgtagaagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Guide FS2 <400> 18 gtcttgcaag cttcgttcgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Guide FS3 <400> 19 gcagcagcgt ctctgtacct 20 <210> 20 <211> 41 <212> DNA <213> Artificial sequence <220> <223> VvSDLF1 <400> 20 gaaggtgacc aagttcatgc tatccaggca ttagtttctc g 41 <210> twenty one <211> 41 <212> DNA <213> Artificial sequence <220> <223> VvSDLF2 <400> twenty one gaaggtcgga gtcaacggat tatccaggca ttagtttctc t 41 <210> twenty two <211> 19 <212> DNA <213> Artificial sequence <220> <223> VxDV <400> twenty two aagtgggtag cctgtggat 19

Claims

1. A product produced from a plant of the genus Vitis or a part thereof having reduced floral sex, i.e., FSL polypeptide activity levels, compared to a corresponding plant or part thereof having a genotype of the FSL locus conferring a male or hermaphroditic floral phenotype, wherein the plant or part thereof comprises a FSL locus consisting of a polynucleotide sequence encoding the FSL polypeptide, wherein the region of the polynucleotide sequence encoding a plant AT-rich sequence and a zinc binding (PLATZ) domain is genetically modified relative to the corresponding polynucleotide sequence of a wild-type FSL locus allele that confers a male or hermaphroditic floral phenotype when expressed, such that the FSL polypeptide encoded by the FSL locus is non-functional or absent in the plant and male reproductive organs are non-functional or absent in the plant, in: (a) a wild-type FSL locus allele that confers a hermaphroditic floral phenotype when expressed encodes a FSL polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; and (b) a wild-type FSL locus allele that confers a male flower phenotype when expressed encodes a FSL polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; and The product described therein is not a plant variety.

2. The product produced from the Vitis spp. plant or part thereof according to claim 1, wherein the polynucleotide sequence encoding the PLATZ domain of the FSL locus is genetically modified to contain one or more nucleotide additions or deletions relative to the corresponding polynucleotide sequence encoding the PLATZ domain of a wild-type FSL locus allele that confers a male or hermaphroditic floral phenotype when expressed, such that the FSL polypeptide is non-functional or absent.

3. The product produced from the Vitis spp. plant or part thereof according to claim 1, comprising a polynucleotide that confers a dwarf morphology to the Vitis spp. plant.

4. The product produced from the Vitis spp. plant or part thereof according to claim 3, wherein the polynucleotide conferring dwarf morphology to the Vitis spp. plant is a mutant of the gibberellic acid insensitive (GAI1) gene encoding a GAI1 protein variant that does not respond to gibberellic acid signal transduction or has reduced gibberellic acid signal transduction compared to the corresponding wild-type GAI1 protein.

5. The product produced from the Vitis sp. plant or part thereof according to claim 4, wherein the mutant of the GAI1 gene conferring a dwarf morphology on the plant comprises one or more mutations in the region encoding the DELLA domain.

6. The product produced from the Vitis sp. plant or part thereof according to claim 4, wherein the mutant of the GAI1 gene is present in a homozygous (GAI1 / GAI1) or heterozygous (GAI1 / Gai1) state.

7. The product produced from the Vitis sp. plant or part thereof according to claim 4, wherein the mutant of the GAI1 gene encodes a variant GAI1 protein consisting of the amino acid sequence shown in SEQ ID NO:

9.

8. The product produced from the Vitis sp. plant or part thereof according to claim 4, wherein the mutant of the GAI1 gene encodes a variant GAI1 protein in which the DELLA domain is deleted or truncated.

9. The product produced from the Vitis spp. plant or part thereof according to claim 3, comprising a polynucleotide that confers seedless fruit.

10. The product produced from the Vitis species plant or part thereof according to claim 9, wherein the seedless fruit conferring polynucleotide is a mutant grape MADS box protein 5 (VvMADS5) locus.

11. The product produced from the Vitis spp. plant or part thereof according to claim 10, wherein the mutant VvMADS5 locus encodes a variant VvMADS5 protein consisting of the amino acid sequence shown in SEQ ID NO:

11.

12. The product produced from the Vitis spp. plant or part thereof according to claim 10, wherein the mutant VvMADS5 locus comprises one or more mutations relative to the wild-type VvMADS5 locus that result in the absence or truncation of the VvMADS5 protein.

13. The product produced from said Vitis sp. plant or part thereof according to claim 10, wherein said seedless fruit conferring mutant VvMADS5 locus is present in a homozygous or heterozygous state.

14. A product produced from a Vitis spp. plant or part thereof, said Vitis spp. plant or part thereof comprising: (i) a polynucleotide conferring a dwarf morphology to a plant of a species of the genus Vitis; (ii) a floral sex locus that is homozygous for the female allele (f / f) that confers a female floral phenotype, i.e., the FSL locus; and (iii) a polynucleotide conferring seedless fruit, wherein the female allele of the FSL locus has an ORF in which the nucleotide at position 621 corresponding to the sequence shown in SEQ ID NO: 5 is A, and The product described therein is not a plant variety.

15. The product produced from the Vitis sp. plant or part thereof according to claim 14, wherein the female allele of the FSL locus has an ORF consisting of the sequence shown in SEQ ID NO:

5.

16. The product produced from the Vitis spp. plant or part thereof according to claim 14, wherein the polynucleotide conferring dwarf morphology to the Vitis spp. plant is a mutant of the gibberellic acid insensitive (GAI1) gene encoding a GAI1 protein variant that does not respond to gibberellic acid signaling or has reduced gibberellic acid signaling compared to the corresponding wild-type GAI1 protein.

17. The product produced from the Vitis sp. plant or part thereof according to claim 16, wherein the mutant of the GAI1 gene conferring dwarf morphology to the plant comprises one or more mutations in the region of the GAI1 gene encoding the DELLA domain.

18. The product produced from the Vitis sp. plant or part thereof according to claim 17, wherein the mutant of the GAI1 gene encodes a variant GAI1 protein in which the DELLA domain is deleted or truncated.

19. The product produced from the Vitis sp. plant or part thereof according to claim 16, wherein the mutant of the GAI1 gene is present in a homozygous (GAI1 / GAI1) or heterozygous (GAI1 / Gai1) state.

20. The product produced from the Vitis sp. plant or part thereof according to claim 16, wherein the mutant of the GAI1 gene encodes a variant GAI1 protein consisting of the amino acid sequence shown in SEQ ID NO:

9.

21. The product produced from said Vitis sp. plant or part thereof according to claim 14, wherein said polynucleotide conferring seedless fruit is a mutant grape MADS box protein 5 (VvMADS5) locus.

22. The product produced from the Vitis sp. plant or part thereof according to claim 21, wherein the mutant VvMADS5 locus encodes a variant VvMADS5 protein consisting of the amino acid sequence shown in SEQ ID NO:

11.

23. The product produced from the Vitis sp. plant or part thereof according to claim 21, wherein the mutant VvMADS5 locus comprises one or more mutations relative to the wild-type VvMADS5 locus that result in the absence or truncation of the VvMADS5 protein.

24. The product produced from said Vitis sp. plant or part thereof according to claim 21, wherein said seedless fruit conferring mutant VvMADS5 locus is present in a homozygous or heterozygous state.

25. The product produced from the Vitis spp. plant or part thereof according to any one of claims 1 to 24, wherein the product is a food, a food ingredient, a beverage product or a beverage ingredient.

26. The product produced from the Vitis species plant or part thereof according to claim 25, wherein: (i) the food product is selected from the group consisting of sterile table grapes, jams, marmalades, jellies, sultanas and raisins; (ii) the food ingredient is cooked wine, vinegar or glucose syrup (mosto cotto); (iii) the beverage product is wine, grappa, brandy or grape juice; (iv) the beverage ingredient is sterile wine grapes or sterile table grapes.

27. A method of controlling the sex of flowers in a plant of the genus Vitis, the method comprising: The genetic modification is in a region within the FSL locus encoding a plant AT-rich sequence and zinc-binding (PLATZ) domain that confers a male or hermaphroditic floral phenotype relative to the corresponding region of a wild-type FSL locus allele that, when expressed, confers a male or hermaphroditic floral phenotype. wherein genetically modifying said region of the FSL locus encoding the PLATZ domain reduces the level of FSL polypeptide activity in said Vitis sp. plant or part thereof as compared to the level of FSL polypeptide activity in a corresponding plant or part thereof having a FSL locus genotype comprising one or more of the wild-type FSL locus alleles that confer a male or hermaphroditic floral phenotype when expressed, in: (a) a wild-type FSL locus allele that confers a hermaphroditic floral phenotype when expressed encodes a FSL polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; and (b) a wild-type FSL locus allele that confers a male flower phenotype when expressed encodes a FSL polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; and Wherein genetic modification of the region of the FSL locus encoding the PLATZ domain causes the FSL polypeptide to be non-functional or absent in the Vitis species plant or plant part, thereby reducing the level of FSL polypeptide activity in the plant or part thereof and resulting in the non-functional or absent male reproductive organs in the plant.

28. The method of claim 27, wherein the Vitis species plant or plant part having reduced levels of FSL polypeptide activity comprises a FSL polypeptide consisting of the amino acid sequence shown in SEQ ID NO:

2.

29. The method of claim 27, comprising introducing one or more nucleotide additions or deletions into the region of the FSL locus encoding the PLATZ domain of the FSL polypeptide relative to the corresponding region of a wild-type FSL locus allele that confers a male or hermaphroditic floral phenotype when expressed.

30. The method of claim 27, wherein the plant part is selected from the group consisting of fruits, roots, stems, scions, cuttings, cells, seeds, and seed parts.

31. A method of producing a Vitis species plant that produces flowers of known sex, the method comprising the steps of: i) Crossing two parent plants, ii) screening one or more progeny plants from said cross of i) to determine the genotype of said progeny plant at the floral sex, i.e., FSL, locus, and iii) selecting one or more progeny plants that are capable of expressing a desired floral sex phenotype based on the genotype of the FSL locus, in The female allele (f) of the FSL locus has an ORF in which the nucleotide at position 621 corresponding to the sequence shown in SEQ ID NO: 5 is A; the hermaphroditic allele (H) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 6 is C; and The male allele (M) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 7 is C; and in (a) The FSL locus genotype, which is homozygous for the female FSL locus allele (f / f), confers a female flower phenotype, (b) a (f / H)FSL locus genotype heterozygous for the female FSL locus allele and the hermaphroditic FSL locus allele confers a hermaphroditic floral phenotype, and a (H / H)FSL locus genotype homozygous for the hermaphroditic FSL locus allele confers a hermaphroditic floral phenotype, (c) an FSL locus genotype that is heterozygous for the male FSL locus allele and the female FSL locus allele (M / f) or the hermaphroditic FSL locus allele (M / H) confers a male flower phenotype, and an FSL locus genotype that is homozygous for the male FSL locus allele (M / M) confers a male flower phenotype, This results in plants that produce flowers of known sex.

32. The method of claim 31, wherein The female allele (f) of the FSL locus has an ORF consisting of the sequence shown in SEQ ID NO: 5; The hermaphroditic allele (H) of the FSL locus has an ORF consisting of the sequence shown in SEQ ID NO: 6; and The male allele (M) of the FSL locus has an ORF consisting of the sequence shown in SEQ ID NO:

7.

33. The method of claim 31 or 32, comprising selecting one or more progeny plants having a genotype of the FSL locus that is homozygous for the female allele (f / f), thereby obtaining plants that produce female flowers.

34. A method of producing a Vitis spp. plant that produces seedless fruit, the method comprising the steps of: i) crossing two parental plants, wherein the parental plants each comprise a floral sex, i.e., FSL locus genotype, that is homozygous (f / f) for a female FSL locus allele, heterozygous (f / H) for a female FSL locus allele and a hermaphroditic FSL locus allele, or heterozygous (f / M) for a female FSL locus allele and a male FSL locus allele, and at least one of the parental plants comprises a polynucleotide that confers a dwarf morphology, ii) screening one or more progeny plants from said cross of i) for the presence or absence of a (f / f) FSL locus genotype homozygous for the female FSL locus allele and the presence or absence of a polynucleotide conferring a dwarf morphology, and iii) selecting progeny plants comprising a (f / f) FSL locus homozygous for the female FSL locus allele and comprising a polynucleotide conferring a dwarf morphology, Thereby obtaining a plant of the species Vitis genus producing seedless fruits, in The female allele (f) of the FSL locus has an ORF in which the nucleotide at position 621 corresponding to the sequence shown in SEQ ID NO: 5 is A; the hermaphroditic allele (H) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 6 is C; and The male allele (M) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 7 is C; and The polynucleotide conferring dwarf morphology is a mutant of the gibberellic acid insensitive (GAI1) gene encoding a GAI1 protein variant that does not respond to gibberellic acid signal transduction or has reduced gibberellic acid signal transduction compared to the wild-type GAI1 protein of a plant of the genus Vitis.

35. A method of producing a Vitis spp. plant that produces seedless fruit, the method comprising the steps of: i) crossing two parental plants, wherein (a) the parental plants each comprise a floral sex, i.e., FSL locus genotype, that is homozygous (f / f) for a female FSL locus allele, homozygous (H / H) for a hermaphroditic FSL locus allele, heterozygous (f / H) for a female FSL locus allele and a hermaphroditic FSL locus allele, heterozygous (f / M) for a female FSL locus allele and a male FSL locus allele, or heterozygous (H / M) for a hermaphroditic FSL locus allele and a male FSL locus allele, (b) at least one of the parental plants comprises a polynucleotide that confers a dwarf morph, and (c) at least one of the parental plants comprises a polynucleotide that confers seedless fruit, ii) screening one or more progeny plants from said cross of i) according to the presence or absence of an FSL locus genotype that is homozygous for a female FSL locus allele (f / f) that confers a female floral phenotype, homozygous for a hermaphroditic FSL locus allele (H / H) that confers a hermaphroditic floral phenotype, or heterozygous for a hermaphroditic FSL locus allele and a female FSL locus allele (H / f) that confers a hermaphroditic floral phenotype, (b) the presence or absence of a polynucleotide that confers a dwarf morphology, and (c) the presence or absence of a polynucleotide that confers seedless fruit, and iii) selecting one or more progeny plants comprising: (a) a genotype of the FSL locus that confers a pectoris or hermaphroditic floral phenotype, (b) a polynucleotide conferring a dwarf morph, and (c) a polynucleotide conferring a seedless fruit, Thereby obtaining a plant of the species Vitis genus producing seedless fruits, in The female allele (f) of the FSL locus has an ORF in which the nucleotide at position 621 corresponding to the sequence shown in SEQ ID NO: 5 is A; the hermaphroditic allele (H) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 6 is C; and The male allele (M) of the FSL locus has an ORF in which the nucleotide at position 627 corresponding to the sequence shown in SEQ ID NO: 7 is C; and The polynucleotide conferring dwarf morphology is a mutant of the gibberellic acid insensitive (GAI1) gene encoding a GAI1 protein variant that does not respond to gibberellic acid signal transduction or has reduced gibberellic acid signal transduction compared to the wild-type GAI1 protein of a plant of the genus Vitis.

36. The method of claim 35, comprising selecting progeny plants that produce seed-aborting seedless fruits, or selecting progeny plants that produce parthenocarpic seedless fruits, in: Progeny plants comprising (a) a FSL locus genotype conferring a hermaphroditic floral phenotype, (b) a polynucleotide conferring a dwarf phenotype, and (c) a polynucleotide conferring a seedless fruit produce seed-aborting seedless fruit; and Progeny plants comprising (a) a FSL locus genotype conferring a female flower phenotype, (b) a polynucleotide conferring a dwarf phenotype, and (c) a polynucleotide conferring seedless fruit produce parthenocarpic seedless fruit.

37. The method of claim 35, wherein the polynucleotide conferring seedless fruit is the mutant grape MADS box protein 5 (VvMADS5) locus.

38. The method of claim 37, wherein the mutant VvMADS5 locus encodes a variant VvMADS5 protein consisting of the amino acid sequence shown in SEQ ID NO:

11.

39. The method of claim 37, wherein the mutant VvMADS5 locus comprises one or more mutations relative to the wild-type VvMADS5 locus that result in the absence or truncation of the VvMADS5 protein.

40. The method of claim 37, wherein the seedless fruit conferring mutant VvMADS5 locus is present in the progeny plants in a homozygous or heterozygous state.

41. The method of claim 34 or 35, wherein the mutant of the GAI1 gene that confers dwarf morphology to plants of the genus Vitis comprises one or more mutations in the region of the GAI1 gene encoding the DELLA domain.

42. The method of claim 41, wherein the variant of the GAI1 gene encodes a variant GAI1 protein in which the DELLA domain is deleted or truncated.

43. The method according to claim 34 or 35, wherein the mutant of the GAI1 gene encodes a variant GAI1 protein consisting of the amino acid sequence shown in SEQ ID NO:

9.

44. The method according to claim 34 or 35, wherein the mutant of the GAI1 gene is present in a homozygous (GAI1 / GAI1) or heterozygous (GAI1 / Gai1) state.

Images