SCAR primers related to purple stripe trait of pepper fruit and their application

Abstract

The present invention relates to the technical field of pepper molecular breeding, and discloses SCAR primers related to the purple stripe trait of pepper green fruit and applications thereof. The present invention identifies a gene marker that is co-segregated with the purple stripe trait of pepper green fruit. The use of the marker for identification does not require the pepper fruiting period, and whether the pepper green fruit has the purple stripe feature can be accurately detected at the seedling stage. The SCAR marker primers of the present invention do not require enzyme cutting, but only require PCR one-step detection, with low detection cost and high accuracy, which significantly improves breeding efficiency and reduces breeding costs.

Description

Technical Field

[0001] The invention relates to the technical field of pepper molecular breeding, in particular to SCAR primers related to the purple stripe trait of pepper green fruit and applications thereof. Background Art

[0002] Color is one of the most important quality traits of pepper fruit, and it has an irreplaceable contribution to its sensory quality and nutritional quality. The color of pepper fruit varies from green to mature stage. Among them, purple pepper fruit is rich in anthocyanins, which is beneficial to human health. In addition, anthocyanins are an important antioxidant substance, which also plays an important role in pepper disease resistance, stress resistance and fruit storage stability.

[0003] Two key genes that regulate the accumulation of anthocyanins in immature pepper fruits have been identified in pepper, namely CaAn2 and Ca3gt. The phenotypic characteristics of pepper materials with CaAn2 genotype are that all tissues of pepper plants can accumulate anthocyanins. The CaAn2 gene encodes an R2R3-MYB transcription factor. There is no difference in the coding region of the CaAn2 gene between purple pepper and green pepper. The reason why purple pepper can accumulate anthocyanins is that a 4.3kb non-long terminal repeat sequence retrotransposon is inserted into the promoter region of the CaAn2 gene to activate gene expression. Based on the differences in the promoter region of the CaAn2 gene, a genetic marker A_SCAR (F: 5'CACTCCGACTTGTCTTTACGG3', P1R: 5'TAACTTGAGCCGGGGGTCT 3', P2R: 5'CACGGAAGGAGGCTAGTCAA 3') that is completely co-segregated with the CaAn2 gene was obtained, which can accurately identify pepper germplasm with the CaAn2 genotype. The Ca3gt gene is an anthocyanin transporter gene. The phenotypic characteristic of this genotype of pepper is that anthocyanins are accumulated only in the peel of immature fruits, while other tissues and organs cannot accumulate anthocyanins. The Ca3gt gene was also located on chromosome 10 of pepper and a gene marker CAPS-78-708 (F: 5'CATGCCACAAGAAGTTGTAGCACAT 3', R: 5'ACTTTCATCAGAATTAACATCTGAAATAA 3') was obtained.

[0004] The green fruit purple stripe material involved in the present invention is not of the CaAn2 and Ca3g genotypes, and the purple stripe trait is manifested as unevenly distributed purple longitudinal stripes on the fruit starting from the young fruit stage of the green pepper, similar to the "bamboo silk eggplant" among eggplants, and the purple stripe coloring is not significantly induced by light. Among the Solanaceae vegetables, except for the "bamboo silk eggplant" whose fruit peel presents purple stripes, it is not common for tomatoes and peppers to have purple stripes. Therefore, it is of great significance to use the pepper material with the purple stripe trait to carry out pepper quality breeding, and it also enriches the theory of the synthesis and regulation mechanism of pepper anthocyanins and provides a new case for the study of the purple trait of pepper. Summary of the invention

[0005] The object of the present invention is to provide a specific SCAR marker primer closely related to the purple stripes of pepper green fruit, wherein the primers are F: 5'-GTGGCACCTTGTTCCTGCTA-3'; R1: 5'-TAGAGCTTTTGACCCCGGCT-3' and R2: 5'-TGCAGTTAGCCCAACTACTACAG-3'.

[0006] Another object of the present invention is to provide an application of the primers of the present invention for screening purple stripes in green pepper fruit

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Acquisition of a specific SCAR marker closely related to the purple stripes on pepper green fruit:

[0009] The present invention is to compare the green fruit purple stripe material 'bamboo thread pepper Chen12' (purchased from Hubei Shugu Agricultural Technology Co., Ltd.) and the green fruit non-purple stripe pepper '16ZX101-M-1 Line pepper' (Li Ning, Gong Liyuan, Gao Shenghua, Yin Yanxu, Yu Chuying, Wang Fei, Chen Cai, Wu Jun, Jiao Chunhai, Yao Minghua. Molecular marker detection of resistance genes in pepper germplasm [J]. Chinese Vegetables, 2020(08):19-32) Construction of F 2The isolated population was used to precisely locate and identify the candidate genes regulating the purple stripes of green pepper fruits by using BSA-seq combined with population mapping methods. Based on the differences in candidate genes between the purple striped and non-purple striped parents, the candidate segment of genes related to the purple striped trait of green fruit was located in the interval of physical positions 184,002,197 to 184,365,711 on chromosome 10 of pepper (the pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ). According to the gene annotation information of the reference genome CM334, the candidate genes controlling the purple stripe characteristics of pepper were determined within the located interval. A gene marker SCAR690-01 that completely co-segregates with the purple stripe trait was developed, and primers were designed based on the marker, including forward primer SCAR690-01F: GTGGCACCTTGTTCCTGCTA, reverse primer SCAR690-01R1: TAGAGCTTTTGACCCCGGCT, and R2: 5'-TGCAGTTAGCCCAACTACTACAG-3'.

[0010] The green pepper fruit described in the present invention is the green pepper fruit at the mature stage.

[0011] The above primers are used to perform PCR amplification on the whole genome DNA of the pepper to be tested. If the PCR amplification product is a 732bp fragment, the green fruit of the pepper material to be tested has purple stripes; if the PCR amplification product is three fragments of 1844bp, 1112bp and 732bp, the green fruit of the pepper material to be tested has purple stripes and is a heterozygote; if the PCR amplification product contains only the 1112bp fragment, the green fruit of the pepper material to be tested does not have purple stripes;

[0012] The protection scope of the present invention also includes the application of the above-mentioned SCAR molecular marker SCAR690-01 in the breeding of pepper varieties with green fruits and purple stripes.

[0013] Compared with the prior art, the present invention has the following advantages:

[0014] The present invention constructs the F gene of the purple stripe trait of pepper green fruit 2 Separate populations, using BSA-seq combined with population mapping methods, finely locate and identify candidate genes that regulate purple stripes in pepper green fruit, and based on the differences in candidate genes between purple stripes and non-purple stripes parents, develop for the first time a genetic marker SCAR690-01 that is completely co-segregated with the purple stripe trait. 2 The detection efficiency in the segregating population reached 100%, and the purity of the green fruit purple stripe genotype could be detected.

[0015] The molecular markers developed by the present invention can provide an effective technical means for auxiliary selection breeding of pepper fruit color quality. Molecular markers can be used for screening at the seedling stage, which greatly reduces the workload of field identification and speeds up the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the phenotypic characteristics of the parents;

[0017] Among them: a is the plant of the purple striped parent 'Bamboo Thread Pepper Chen12', b is the flower and fruit of the purple striped parent 'Bamboo Thread Pepper Chen12', c is the non-purple striped parent '16ZX101-M-1 Plants of 'Line Pepper', d is the non-purple striped parent '16ZX101-M-1 Flowers and fruits of 'Pepper');

[0018] Figure 2 For fine positioning of candidate intervals.

[0019] Figure 3 For the gene marker SCAR690-01 to F 2 Genotype detection of some individual plants in the population. DETAILED DESCRIPTION

[0020] The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood to be illustrative rather than limiting the scope of the present invention.

[0021] The experimental methods used in the following examples are conventional methods unless otherwise specified; the instruments, materials and reagents used are all commercially available unless otherwise specified.

[0022] Embodiment 1:

[0023] The development of SCAR primers related to the purple stripe trait of pepper green fruit specifically includes the following steps:

[0024] The applicant discovered during the years of pepper cultivation that there are mutants with purple stripe traits. The purple stripe trait is characterized by unevenly distributed purple longitudinal stripes on the pepper fruit starting from the young fruit stage, similar to the "bamboo eggplant" in eggplant, and the purple stripe coloring is not significantly induced by light. Peppers with this trait appear in multiple varieties of peppers. The applicant suspects that it is controlled by the same gene, so the corresponding molecular marker for this trait has been developed.

[0025] The present invention is to carry out the research on the green fruit purple stripe material 'Bamboo Thread Pepper Chen12' ( Figure 1, purchased from Hubei Shugu Agricultural Technology Co., Ltd.) and green fruit non-purple striped pepper '16ZX101-M-1 Line pepper' (Li Ning, Gong Liyuan, Gao Shenghua, Yin Yanxu, Yu Chuying, Wang Fei, Chen Cai, Wu Jun, Jiao Chunhai, Yao Minghua. Molecular marker detection of resistance genes in pepper germplasm [J]. Chinese Vegetables, 2020(08):19-32) Construction of F 2 The isolated population was used to finely locate and identify the candidate genes regulating the purple stripes of green pepper fruits by using BSA-seq combined with population mapping methods. Based on the differences in candidate genes between the purple stripes and non-purple stripes parents, the candidate segment of the gene related to the purple stripes trait of green fruit was located in the interval of physical position 184,002,197 to 184,365,711 on chromosome 10 of pepper (the pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ) (specifically, Figure 2 According to the gene annotation information of the reference genome CM334, the candidate genes controlling the purple stripe characteristics of pepper were identified in the positioning interval. The gene marker SCAR690-01, which is completely co-segregated with the purple stripe trait, was developed. Primers were designed based on the marker, with the forward primer SCAR690-01F: GTGGCACCTTGTTCCTGCTA and the reverse primer SCAR690-01R1: TAGAGCTTTTGACCCCGGCT.

[0026] The forward and reverse primers were used to identify the green fruit purple stripe material 'Bamboo-thread pepper Chen12' and green fruit non-purple stripe pepper '16ZX101-M-1 The gDNA of 'Line Pepper' was amplified, and the fragment length amplified in the gDNA of the purple stripe material was 3041bp (the sequence is shown in SEQ ID NO.4), and the fragment length amplified in the non-purple stripe material was 1112bp (the sequence is shown in SEQ ID NO.5). In the intron region of the candidate gene in 'Bamboo Thread Pepper Chen12', there was a sequence insertion of 1926bp in length (the sequence is shown in SEQ ID NO.6), which is a nucleotide length polymorphism related to the purple stripes of green fruit. The present invention compares the detection results of the SCAR marker SCAR690-01 in other pepper materials whose green fruit does not show the purple stripe trait. The results show that the SCAR molecular marker SCAR690-01 is completely co-separated with the purple stripe trait of green fruit, indicating that the specific molecular marker SCAR690-01 provided by the present invention can be used to identify the purple stripe trait of green fruit of pepper. However, due to the competitive amplification of fragments of different sizes in the PCR reaction, the purple stripe pepper material of the heterozygous genotype cannot be distinguished.

[0027] According to SCAR690-01 in 'Bamboo Chili Chen12' and '16ZX101-M-1 The reverse primer SCAR690-01R2 of SCAR690-01 was optimized again based on the sequence differences in 'Line Pepper': TGCAGTTAGCCCAACTACTACAG. The SCAR690-01 primer set (i.e., the upstream primer and two downstream primers) showed that after PCR amplification, the band with a 1112bp band was non-purple striped pepper, and the band with a 732bp band or three bands of 1844bp, 1112bp, and 732bp was purple striped pepper.

[0028] The PCR amplification system was as follows: 25 μL in total, 1.0 μL of 50 ng / μL DNA, 13.0 μL of 2× Taq Master Mix, 1.5 μL of 10 μmol mixed primers (i.e., upstream primer and two downstream primers), ddH 2 O margin.

[0029] The PCR amplification program was as follows: pre-denaturation at 94°C for 1 min 30 s, denaturation at 94°C for 20 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, 35 cycles, extension at 72°C for 5 min, storage at 16°C for 10 min, and detection of amplified products by 1% agarose gel electrophoresis.

[0030] Embodiment 2:

[0031] Application of SCAR primers related to the purple stripe trait of pepper green fruit in screening of the purple stripe trait of pepper green fruit:

[0032] Application of the SCAR molecular marker SCAR690-01 in Example 1 to the 'bamboo-thread pepper Chen12' and the green fruit non-purple striped pepper '16ZX101-M-1 Pepper, F 1 Generation and 541 copies of F 2 Verification test of the purple stripe trait of green fruit in a population.

[0033] The base sequences of the upstream and downstream primers of the molecular marker SCAR690-01 are:

[0034] SCAR690-01-F (upstream primer): 5'-GTGGCACCTTGTTCCTGCTA-3'

[0035] SCAR690-01-R1 ​​(downstream primer): 5'-TAGAGCTTTTGACCCCGGCT-3'

[0036] SCAR690-01-R2 (downstream primer): 5'-TGCAGTTAGCCCAACTACTACAG-3'

[0037] The PCR amplification system was as follows: 25 μL in total, 1.0 μL of 50 ng / μL DNA, 13.0 μL of 2× Taq Master Mix, 1.5 μL of 10 μmol mixed primers (i.e., upstream primers + downstream primers), ddH 2 O margin.

[0038] The PCR amplification program was as follows: pre-denaturation at 94°C for 1 min 30 s, denaturation at 94°C for 20 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, 35 cycles, extension at 72°C for 5 min, storage at 16°C for 10 min, and detection of amplified products by 1% agarose gel electrophoresis.

[0039] The amplified products were detected by 1% agarose gel electrophoresis. If there was a band of 1112 bp, it was a non-purple striped pepper; if there was a band of 732 bp or three bands of 1844 bp, 1112 bp and 732 bp, it was a purple striped pepper. The plant that could amplify three bands was a heterozygous genotype.

[0040] Using SCAR690-01 marker to identify 541 purple stripe population F 2 The marker was completely co-segregated with the purple stripe trait of pepper and the detection efficiency reached 100%.

[0041] The PCR amplification products were subjected to gel electrophoresis. Due to the length of the paper, the test results of some materials are shown in the following figure. Figure 3 As shown: In the figure, from left to right are F 2 Population individual, Marker, F 1 , the purple striped parent 'Bamboo Chili Chen12' and the non-purple striped parent '16ZX101-M-1 String pepper'. Figure 3 It can be seen that SCAR690-01 can completely distinguish between purple striped materials and non-purple striped materials. Specifically: purple striped materials have a 732bp fragment or three fragments of 1844bp, 1112bp and 732bp, while non-purple striped materials have a 1112bp band.

[0042] It should be pointed out that the above embodiments are only explanations of the present invention rather than limitations of the invention, and any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Institute of Economic Crops, Hubei Academy of Agricultural Sciences <120> SCAR primers related to purple stripe trait of pepper fruit and their application <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 gtggcacctt gttcctgcta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tagagctttt gaccccggct 20 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <400> 3 tgcagttagc ccaactacta cag 23 <210> 4 <211> 3041 <212> DNA <213> Artificial Sequence <400> 4 gtggcacctt gttcctgcta gagctggtaa actaaccact actactttct ccgtctcatt 60 ttaacgagtt tcaaaagtct ttatttcttt atgtgcaggt ctaaatagat gtcggaagag 120 ctgcagactt cggtggttga attatctgag gccacatatc aagagaggtg acttcgatcc 180 agatgaagtg gatctcattt tgaggcttca taagctctta ggaaacaggc aattttatgt 240 tttagattca cctaaatttg cgggatcatc tcatttgaaa gttaatgata ttagagatct 300 agagtacaat tcttattact atataattat gcctcaacat gctggccaat tggtgcactg 360 tgcgcaggca tttataattc tgttatacat gagtagaagc acataaaaat atttcattgc 420 tacttttttt tcatggcact ttagaccgaa tttgcacttt aatttctctc aaatttacac 480 tttaattgct tcaatttggg aatttctatg actttgacct aatttttagg gattttgggt 540 ttatcttctc cttagagaac atttgattgc tgggctcatt ttattgcgtg aaatttttta 600 ttcttccttg taattctgcc gattacagtc gttatgttgg gaaaaatatt gtaatgtgtt 660 atattgacaa gagaaagttg aggaacatta gcgttactga ttagagtaac tgtagtagtt 720 gggctaactg cagtagattt tagcattttt aagggtgttc ttgtttatat tgatgtgcag 780 attaattggt gttccattgg ttgatttgta ttgttattat tttcttattt tacaatttag 840 aacctgataa gaatcatttc gttcatcatt tcacgattca cttatattag caataaagat 900 <h2 style=";text-align:left;direction:ltr">gttcttacat gttgaagttg ttgttcttca ctatatatct ccagacacgc ctttgaacaa 960<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcaggggagag acctaggcta catattttacc caaggaaaag acattgatat tgagaagatt 1020<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatcaatata agtactttct ttctcttttt cagctacatg aaggcactgc ttaaggtgaa 1080<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> caggtgtgtg aactaaagaa tttatttatt tcccttttct tttctgtcac cagcgctgaa 1140<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatcctatct acgtgcttgt tcatttttct ttggttttcc aactttattc aagttgcttc 1200<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acatttcttg tgaataaaga gcgatcattt tgagatagaa gaagtcattt gaagcgtatt 1260<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atcttgcagg gagatcaatt aaacagatat aacaatatgg gtagcaggac cttgaaactt 1320<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggaatgtaag tttaatgacg taaggcggga gaatgaggta gtagtgaggc tagaagcaca 1380<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggaggtagag aaaagggata agttcaagta tctcgggtcc gtgatccaga gtaacggtga 1440<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gattgacgag gatgtctcgc accgtattgg ggcgggatgg atgaagtgga aacttgcatc 1500<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gggggtgctg tgtgataaga aggtgccgcc caagcttaaa ggtaaattct atagggtggt 1560<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agtccgtccg gccttgctgt atggagtgga gtgttggcca gttaagaact cccacatcca 1620<h2 style=";text-align:left;direction:ltr"> aagaatgaag gtggcagaaa tgcggatgtt gcgctggatg tgtggactga cccgaaggga 1680 tagagctcgg aatgagacta tccgggagaa ggttggtgtg acttcagtgg agtgtaagat 1740 gcgggaagca cgattgagat ggttcggaca cgtgaagagg aggggcatgg atgccccggt 1800 ccgtaggtgt gagaggctag cgttggatgg tttagacgg ggtaggggta gaccgaagaa 1860 gtactggggt gaggtgatta ggcgggacat ggaacagtta cagcttaccg aggacatgac 1920 cctagatagg aaggtctgga agacgcgaat tacggcagag gattagggcc agttcgggtc 1980 gctaatgtag ggaagtaatt gggtgggggg tgtattcctg ttatgattcc gtattcaatg 2040 ttccgtgttc cgtgttccat gttttgttat gaatctgtgt gctttcctct gctttatatt 2100 cctgcattcc tgctttatc tgttttatat tccttatggc tgcagtatct atgttatgtc 2160 atctgcttct gtgctgtact atgtgtttgt gtgatatctc gtatctcgta actcgtaact 2220 tgagccgggg gtctttcgga aacagccttt ctacttcatc agaggtagag gtatggactg 2280 cgtacatctt acccccccag accccactaa gtgggaatac actgggtttg ttgttgttgt 2340 tgttgttgtt acttttttt catggcagta taattttaaa ttcacgagat catgaaattt 2400 tgacatcata ttaattgaat acatgtgatc attcattta aaacttacgc aaattatgtt 2460 atatatgtag atggtcactt attgctggta gacttccggg aaggacagcg aacgatgtga 2520 agaatttctg gaatactcgc cttctgagga aggtaaatat tgctccgatt aacaataaga 2580 tcggagacaa tattaatact aagaatgaga taataagacc tcaacctcgg aacttctcaa 2640 gtaccatgaa gaatgtttct tggtgcaact acaaaagtat cataaatgaa gcaaatatac 2700 tggaaaattg caatgaaatt gaagaagcaa tagcaactgg aactagaaca cctttatgca 2760 agaatatcag ctctgagaaa aattgcaatg aaattgataa aacaccatgt tttttaaatg 2820 gtggaggcaa cgccatgcaa caaggacaaa gtgatggtgg ttgggatgaa ttttctatgg 2880 atgacatatg gaatctactt aattagcggg taatgtcttg agaagttgac ggtcttgaac 2940 tttatcaacc tcgcttgtct tatggacaaa acttcaaatt taacgtctta attgttatct 3000 tgatgatttg ccaatgaagc aagccggggt caaaagctct a 3041 <210> 5 <211> 1112 <212> DNA <213> Artificial Sequence <400> 5 gtggcacctt gttcctgcta gagctggtaa actaaccact actactttct ccgtctcatt 60 ttaacgagtt tcaaaagtct ttatttcttt atgtgcaggt ctaaatagat gtcggaagag 120 ctgcagactt cggtggttga attatctgag gccacatatc aagagaggtg acttcgatcc 180 agatgaagtg gatctcattt tgaggcttca taagctctta ggaaacaggc aattttatgt 240 tttagattca cctaaatttg aggcatcatc tcatttgaaa gttaatgata ttagagatct 300 agagtacaat tcttattact atataattat gcctcaacat gctggccaat tggtgcactg 360 tgcgcaggca tttataattc tgttatacat gagtagaagc acataaaaat atttcattgc 420 tacttttttt gcatggcagt ataattttaa attcacgaga tcatgaagtt ttgacatcat 480 attaattgaa tacgtgtgat catttcattt aaaacttacg caaattatgt tatatatgta 540 gatggtcact tattgctggt agacttccgg gaaggacagc gaacgatgtg aagaatttct 600 ggaatactcg ccttctgagg aaggtaaata ttgctccgat taacaataag atcggagaca 660 720 agaatgtttc ttggtgcaac aacaaaagta tcataaatga agcaaatata ctggaaaatt 780 gcaatgaaat tgaagaagca atagcaactg gaactagaac acctttatgc aagaatatca 840 gctctgagaa aaattgcaat gaaattgata aaacaccatg ttttttaaat ggtggaggca 900 acgccacgca acaaggacaa agtgatggtg gttgggatga attttctatg gatgacatat 960 ggaatctact taattagcgg gtaatgtctt gagaagttga cggtcttgaa ctttatcaac 1020 ctcgcttgtc ttatggacaa aacttcaaat ttaacgtctt aattgttatc ttgatgattt 1080 gccaatgaag caagccgggg tcaaaagctc ta 1112 <210> 6 <211> 1926 <212> DNA <213> Artificial Sequence <400> 6 tacttttttt tcatggcact ttagaccgaa tttgcacttt aatttctctc aaatttacac 60 tttaattgct tcaatttggg aatttctatg actttgacct aatttttagg gattttgggt 120 ttatcttctc cttagagaac attgattgc tgggctcatt ttattgcgtg aaatttttta 180 ttcttccttg taattctgcc gattacagtc gttatgttgg gaaaaatatt gtaatgtgtt 240 300 gggctaactg footgattt tagcatttt aagggtgttc ttgtttatt tgatgtgcag 360 attaattggt gttccattgg ttgatttgta ttgttattat tttcttattt tacaatttag 420 aacctgataa gaatcatttc gttcatcatt tcacgattca cttattag aataagat 480 gttcttacat gttgaagttg ttgttcttca ctatatatct ccagacacgc ctttgaacaa 540 gcagggagag acctaggcta catatttacc caaggaaaag acattgatat tgagaagatt 600 aatcaatata agtactttct ttctctttt cagctacatg aaggcactgc ttaaggtgaa 660 720 aatcctatct acgtgcttgt tcatttttct ttggttttcc aactttattc aagttgcttc 780 acatttcttg tgaataaga gcgatcattt tgagataga gaagtcattt gaagcgtatt 840 atcttgcagg gagatcaatt aaacagatat aacaatatgg gtagcaggac cttgaaactt 900 ggaatgtaag tttaatgacg taaggcggga gaatgaggta gtagtgaggc tagaagcaca 960 ggaggtagag aaaagggata agttcaagta tctcgggtcc gtgatccaga gtaacggtga 1020 gattgacgag gatgtctcgc accgtattgg ggcgggatgg atgaagtgga aacttgcatc 1080 gggggtgctg tgtgataaga aggtgccgcc caagcttaaa ggtaaattct atagggtggt 1140 agtccgtccg gccttgctgt atggagtgga gtgttggcca gttaagaact cccacatcca 1200 aagaatgaag gtggcagaaa tgcggatgtt gcgctggatg tgtggactga cccgaaggga 1260 tagagctcgg aatgagacta tccgggagaa ggttggtgtg acttcagtgg agtgtaagat 1320 gcgggaagca cgattgagat ggttcggaca cgtgaagagg aggggcatgg atgccccggt 1380 ccgtaggtgt gagaggctag cgttggatgg ttttagacgg ggtaggggta gaccgaagaa 1440 gtactggggt gaggtgatta ggcgggacat ggaacagtta cagcttaccg aggacatgac 1500 cctagatagg aaggtctgga agacgcgaat tacggcagag gattagggcc agttcgggtc 1560 gctaatgtag ggaagtaatt ggtgggggtg tattcctgtt atgattccgt attcaatgtt 1620 ccgtgttccg tgttccatgt ttgttatgaa tctgtgtgct ttcctctgct ttatattcct 1680 gcattcctgc tttactctgt tttatattcc ttatggctgc agtatctatg ttatgtcatc 1740 tgcttctgtg ctgtactatg tgtttgtgtg atatctcgta tctcgtaact cgtaacttga 1800 gccgggggtc tttcggaaac agcctttcta cttcatcaga ggtagaggta tggactgcgt 1860 acatcttacc cccccagacc ccactaagtg ggaatacact gggtttgttg ttgttgttgt 1920 tgttgt 1926

Claims

1. A specific SCAR marker primer closely related to the purple stripes of pepper green fruit, the primers are F: 5'-GTGGCACCTTGTTCCTGCTA-3'; R1: 5'-TAGAGCTTTTGACCCCGGCT-3' and R2: 5'-TGCAGTTAGCCCAACTACTACAG-3', the peppers are bamboo pepper Chen12, 16ZX101-M-1 Bell pepper or its hybrid progeny.

2. Application of the primers described in claim 1 in the breeding of peppers with green fruits and purple stripes, wherein the peppers are bamboo peppers Chen12, 16ZX101-M-1 Bell pepper or its hybrid progeny, and application process thereof include: Using the primers described in claim 1, PCR amplification is performed on the whole genome DNA of the pepper to be tested. If the PCR amplification product is a 732bp fragment, the green fruit of the pepper material to be tested has purple stripes; if the PCR amplification product is three fragments of 1844bp, 1112bp and 732bp, the green fruit of the pepper material to be tested has purple stripes and is a heterozygote; if the PCR amplification product only contains the 1112bp fragment, the green fruit of the pepper material to be tested does not have purple stripes.

Images