Molecular marker for identifying male sterility recovery character of pepper and application of molecular marker
By developing dCAPS and KASP molecular markers based on the CaT2T06g03535 gene mutation site, and utilizing high-throughput KASP technology and PCR reaction system, the problem of screening cytoplasmic male sterile lines in peppers was solved, achieving rapid and accurate pepper breeding screening, and reducing costs and time.
Patent Information
- Application Number
- CN202511040361.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-11-07
AI Technical Summary
The existing molecular marker library is not rich enough to effectively screen the paternal material for restorative male sterile lines of pepper cytoplasm, and cannot meet the needs for rapid and accurate identification of large-scale samples.
We developed dCAPS and KASP molecular markers based on the CaT2T06g03535 gene mutation site, used KASP technology for high-throughput rapid identification, and designed specific primers to screen for male sterility restoration traits in peppers by combining PCR reaction system and fluorescent probe technology.
This technology enables rapid and accurate screening of cytoplasmic male sterility restorer lines and individual plants carrying restorer genes in pepper breeding, shortening breeding time, improving detection efficiency and accuracy, enriching the molecular marker library, and reducing costs.
Smart Images

Figure CN120905424A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a molecular marker for identifying a pepper male sterile restoration trait and application thereof. BACKGROUND
[0002] Pepper is an annual or perennial herb of Solanaceae Capsicum, and is the largest vegetable crop in planting area in China. With the increase of pepper planting area, the demand for seeds is also gradually increasing. Pepper hybrids have obvious heterosis in yield, quality, stress resistance, disease resistance, growth potential and uniformity, and have been widely used in production. Pepper hybrid seed production mainly adopts artificial emasculation hybrid seed production and male sterile line seed production technology. The former has defects such as low efficiency, high cost and difficult control of purity, and the latter restores the fertility of the female male sterile line through pepper Rf gene, and the F1 generation of hybrid produces normally. This technology can reduce cost, improve seed purity, protect intellectual property rights, and is more suitable for commercial seed production.
[0003] With the development of biotechnology, molecular marker assisted breeding technology has become an important means to improve efficiency in the field of breeding. Through molecular markers, pepper male sterile restorer lines can be quickly and accurately screened, thereby accelerating the breeding process of excellent pepper hybrids. Compared with traditional marker systems, SNPs, as the most widely distributed sequence variation in plant genomes, have a lower mutation frequency, and therefore have gradually become an important marker tool in the field of plant molecular genetics research.
[0004] The second generation of molecular markers based on PCR technology, such as STS, SSR, AFLP, etc., has limited detection throughput, which is difficult to meet the actual needs of large-scale sample molecular identification. Since 2014, when the pepper genome sequencing work was successfully completed, SNP fingerprinting has been applied. Competitive allele-specific PCR (KASP) is a new high-throughput SNP genotyping technology that can accurately determine SNPs and specific position InDels in a large number of genomic DNA samples based on the specific matching of primer terminal bases. KASP can accurately distinguish molecular markers in a short period of time, with small average genetic analysis error, high analysis stability and accuracy, improved operation flexibility, shortened analysis time, and can realize automatic operation process, simple operation, while greatly reducing the cost required for variety identification, which is a very ideal genotyping technology. The dCAPS molecular marker technology constructs an enzyme digestion site by introducing a mismatch base around the SNP mutation site, which has the advantages of co-dominant expression, strong site specificity, simple operation process and low detection cost, and also plays an important role in molecular marker assisted breeding practice.
[0005] For the identification of pepper cytoplasmic male sterile restorer line material and single plant carrying the restorer gene, there are reports of introducing molecular marker identification. However, due to the lack of molecular marker library, the existing molecular marker has limited scope, which cannot well screen the restorer male parent material of pepper cytoplasmic male sterile line, and new suitable primer markers are urgently needed to enrich the fertility detection molecular marker library, expand the identification range of pepper cytoplasmic male sterile material, and better be used for the seed production of pepper hybrid. SUMMARY
[0006] The purpose of the present application is to provide a molecular marker for identifying the male sterile restorer trait of pepper and its application. The molecular marker for identifying the male sterile restorer trait of pepper provided by the present application includes a dCAPS marker for identifying the pepper cytoplasmic male sterile restorer line material and a KASP marker for high-throughput rapid identification.
[0007] To achieve the purpose of the above-mentioned application, the technical scheme adopted by the present application is as follows:
[0008] The present application provides a molecular marker for identifying the male sterile restorer trait of pepper, which is a dCAPS molecular marker based on the mutation site of gene CaT2T06g03535. The mutation site is an A / T base mutation, and the primer pair sequence of the dCAPS molecular marker is shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0009] The present application provides a molecular marker for identifying the male sterile restorer trait of pepper, which is a KASP molecular marker based on the mutation site of gene CaT2T06g03535. The mutation site is an A / T base mutation, and the primer pair of the KASP marker includes a forward primer FAM, a forward primer HEX and a reverse universal primer. The sequence of the forward primer FAM is shown in SEQ ID NO. 3, the sequence of the forward primer HEX is shown in SEQ ID NO. 4, and the sequence of the reverse universal primer is shown in SEQ ID NO. 5.
[0010] The present application also provides the application of the molecular marker in identifying the genotyping of pepper varieties.
[0011] Further, the PCR reaction system for identifying genotyping is as follows: 2xKASP Mix 240ul, forward primer FAM and forward primer HEX 0.48ul each, and reverse primer 1.44ul.
[0012] Further, the PCR reaction procedure for identifying the genotyping is as follows: pre-denaturation at 94℃ for 10 min; in the first round of PCR amplification, denaturation at 95℃ for 15 s, annealing / extension at 61℃ for 1 min, 10 cycles, to complete the allele recognition, and the reverse universal primer also combines and completes the whole PCR process; in the second round of PCR amplification, denaturation at 95℃ for 15 s, annealing / extension at 55℃ for 1 min, 35 cycles, to complete the introduction of the universal tag sequence into the PCR product corresponding to the SNP, and then the probe carrying fluorescence is added to the PCR product by combining with the DNA chain complementary to the tag; in the identification result, the homozygous genotype TT corresponds to the phenotype of the pepper sterility trait, and the homozygous genotype AA and the heterozygous genotype AT correspond to the phenotype of the pepper fertility trait.
[0013] The application further provides the use of the molecular marker in identifying the pepper male sterility restoration trait.
[0014] Further, the use comprises the following steps: (1) extracting total DNA of a pepper sample to be identified; (2) performing PCR reaction by using the molecular marker; (3) identifying the PCR product, and screening the pepper male sterility restoration variety, strain and single plant.
[0015] Further, the PCR reaction system by using the dCAPS marker is as follows: 12.5 μL 2×Go Taq R Colorless Master Mix, 1 μL forward primer, 1 μL reverse primer, 2 μL DNA template, and 8.5 μL ddH2O.
[0016] Further, the PCR amplification procedure by using the dCAPS marker is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 15 s, extension at 72℃ for 30 s, 35 cycles; finally, total extension at 72℃ for 5 min, and preservation at 4℃.
[0017] Further, in the step (3), when there is only one band of 186 bp in the electrophoresis result, the genotype of the SNP site is AA homozygous type, and the pepper fertility is the fertile F type; when there is only one band of 166 bp in the electrophoresis result, the genotype of the SNP site is TT homozygous type, and the pepper fertility is the sterile S type; when there are two bands of 186 bp and 166 bp in the electrophoresis result, the genotype of the SNP site is AT heterozygous type, and the pepper fertility is the fertile hybrid type.
[0018] Compared with the prior art, the application has the following effects and advantages:
[0019] 1. The application locates the site related to fertility restoration trait between 229.80Mb-256.00Mb of the end of chromosome 6 of the pepper genome by BSA-seq, a region of 26.2Mb, further fine locates the interval to 1.01Mb by recombination single plant combined with KASP gene typing technology, and finally develops PR-dCAPS and PR-KASP primers for identifying the cytoplasmic male sterility restoration of pepper based on the sequence variation site of the gene CaT2T06g03535 in the fine location interval, which are used for rapid identification and screening of the cytoplasmic male sterility restoration line and single plant carrying the restoration gene of pepper in pepper breeding.
[0020] 2. According to the mutation site of the new gene, the application develops dCAPS molecular markers and KASP molecular markers for screening the cytoplasmic male sterility restoration of pepper, which are used for screening and identification of male sterility restoration line materials of pepper and molecular marker assisted breeding.
[0021] 3. The PR-dCAPS and PR-KASP primers developed by the application enrich the marker library for screening the male sterility restoration trait of pepper, and solve the problem that the molecular marker primer has narrow adaptation range and cannot screen more materials carrying the cytoplasmic male sterility restoration gene of pepper.
[0022] 4. The KASP molecular marker of the application can effectively identify the pepper varieties, lines and single plants containing the molecular marker associated with the molecular marker, and can also be used for purity and fertility restoration result identification of pepper commercial seeds, greatly shortening the breeding time and improving the work efficiency. The KASP molecular marker platform has high automation degree, high detection flux, and can quickly detect a large number of samples in a short time, improving the detection efficiency.
[0023] 5. The dCAPS molecular marker and KASP molecular marker developed by the application can be used for early screening and identification of fertility in large-scale population of pepper hybrid offspring, which can provide basis for identification of pepper breeding materials and commercial seeds, reduce the required manpower and cost in the breeding process, and improve the selection efficiency and accuracy. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 It is the homologous alignment analysis result of the gene CaT2T06g03535;
[0025] Figure 2 It is the identification result of PR-KASP primer;
[0026] Figure 3 It is the phenotype investigation result graph of the sterile trait and fertile trait of pepper at flowering stage.
[0027] Figure 4 The detection results of pepper parent, F1 and F2 generations of some single plants by using PR-dCAPS primers;
[0028] Figure 5 The detection results of pepper male sterile three-line commercial varieties by using PR-dCAPS primers. DETAILED DESCRIPTION
[0029] The technical solutions of the present application are further described in detail below in combination with the drawings and specific embodiments, but the scope of protection required by the present application is not limited to the scope expressed by the examples.
[0030] Example 1 1. Preparation of pepper variety samples to be identified
[0031] 1.1 Preparation of pepper materials for testing
[0032] Pepper cultivation is carried out according to the conventional cultivation management mode, and after the flowers are fully opened, the sample can be taken, preferably 2-3 young leaves, stored in a sealed bag, numbered and recorded, and stored at -80°C for long-term storage and at -20°C for short-term storage.
[0033] 1.2 Extraction of total DNA
[0034] After the stored pepper samples are added with liquid nitrogen and rapidly ground, the total DNA of the pepper samples to be identified is extracted by using a modified cetyltrimethylammonium bromide (CTAB) method.
[0035] 2. Location of fertility restoration gene of pepper
[0036] Two comparative gene pools for pollen abortion and fertility traits in pepper were constructed. Genomic DNA was extracted from leaves of 25 hybrid progeny peppers in each pool using the CTAB method described above. Agarose gel electrophoresis was used for preliminary detection of DNA integrity and purity. After passing the initial detection, the DNA samples were diluted for precise quantification of DNA concentration. Equal amounts of DNA were mixed in each pool, and BSA-seq analysis was performed for sample resequencing. The results showed that the linkage region for the restoration of cytoplasmic male sterility in pepper was located between 229.80 Mb and 256.00 Mb at the end of chromosome 6. Furthermore, KASP primers were designed to target SNP differences within this region. Combining KASP-detected genotypes with phenotypes narrowed the region to 1.01 Mb, between 243.43 Mb and 244.44 Mb at the end of chromosome 6. Based on sequencing and bioinformatics analysis, an A / T base mutation was found in the CaT2T06g03535CDS coding region of the gene within this finely mapped region, which led to changes in the protein's tertiary structure. Ultimately, based on the CaT2T06g03535 gene mutation site, a molecular marker was developed to identify the restoration of male sterility in pepper cytoplasm.
[0037] Through systemic evolutionary analysis, such as Figure 1 As shown, the newly identified gene CaT2T06g03535 was compared with publicly reported cytoplasmic male sterility restoration genes. The gene clustered independently and did not form a close cluster with any of the publicly reported fertility restoration gene family members.
[0038] 3. Screening and identification of SNP loci for male sterility restoration in pepper cytoplasm
[0039] Using CaT2T06g03535 (the genome number of pepper, available at http: / / www.pepperbase.site / node / 3) within the fine mapping region of the male sterility restoration gene in pepper cytoplasm, nucleotide sequence alignment was performed using Geneious Prime software to verify the SNP site. The results showed an A / T base mutation at the SNP site. When the base in the male sterile pepper plant was T, the amplified fragment could be digested by EcoRI, while when the SNP site in the male sterile restored fertile pepper plant was mutated to A, it could not be digested by the enzyme.
[0040] 4. Development of molecular markers for identifying male sterility restoration traits in peppers
[0041] 4.1 Development of KASP molecular markers
[0042] The PR-KASP primer of the KASP molecular marker developed for this site includes two forward specific primers and one reverse universal primer, and FAM fluorescence (5'- GAAGGTGACCAAGTTCATGCT-3') and HEX fluorescence (5'- GAAGGTCGGAGTCAACGGATT-3') adapters are added at the 5' ends of the two forward specific primers, respectively, and the 3' end is the PK site allelic variation base.
[0043] The KASP primer is designed by using Geneious Prime, the amplification length is 20-100 bp, the longest is not more than 120 bp, the specific forward primer length is 18-26 bp, the universal reverse primer length is 18-30 bp, the Tm value is between 55-62℃, the GC content is 30%-70%, the primer itself does not have 4-base complement, avoiding forming a hairpin structure, and the primers do not contain 4-base complement, avoiding forming a primer dimer structure, and the base distribution is uniform.
[0044] 4.2 Development of dCAPS molecular markers
[0045] The primer sequence pair of the dCAPS molecular marker is designed by using dCAPS Finder 2.0 and Primer Premier 5 software, and the restriction enzyme EcoRI is selected for enzyme digestion, and a mismatch base is introduced by designing a primer to construct a recognition site of the restriction enzyme, and the sequence length is about 186 bp.
[0046] The PR-dCAPS primer sequence of the dCAPS molecular marker is shown in SEQ ID NO. 1 and SEQ ID NO. 2; the PR-KASP primer sequence of the KASP molecular marker includes forward primer FAM, forward primer HEX and reverse universal primer, the sequence of the forward FAM specific primer is shown in SEQ ID NO. 3, the sequence of the forward HEX specific primer is shown in SEQ ID NO. 4, and the sequence of the reverse universal primer is shown in SEQ ID NO. 5.
[0047] Table 1. Primer sequences of dCAPS and KASP molecular markers for pepper male sterile recovery traits
[0048] 5. Identification of pepper variety (line) male sterile recovery using KASP molecular marker primers
[0049] 5.1 Sample plate preparation
[0050] The sample of the pepper variety to be identified is aliquoted in a 96-well plate with about 100 μL of DNA sample, and 1-5 blank controls are contained in the 96-well plate, and the number and position of the blank controls can be adjusted according to the number of samples to be identified.
[0051] 5.2 Construction of PCR reaction system
[0052] The PCR reaction system for pepper variety identification genotyping is configured as follows: 2xKASP Mix 240 μL, 0.48 μL of forward primer FAM and 0.48 μL of forward primer HEX, and 1.44 μL of reverse universal primer, and after thorough mixing, the reagents are transferred to a 200 μL PCR tube, and centrifuged to ensure that there are no bubbles in the reagents and that the reagents are on the bottom of the tube before being loaded onto the machine.
[0053] Place the sample plate in the sample position, the reagent tube in the reagent rack position, and the 384-well reaction plate in the reaction plate position, and fix it well, and then perform subsequent operations.
[0054] 5.3 PCR amplification program
[0055] The prepared PCR reaction system is subjected to the following amplification program:
[0056] PCR reaction program: 94℃ pre-denaturation for 10 min; in the first round of PCR amplification, 95℃ denaturation for 15 s, 61℃ annealing / extension for 1 min, 10 cycles, to complete allele recognition, and the reverse universal primer will also bind and complete the entire PCR process, and in this stage, the fluorescently labeled probe is still combined with its complementary quenched probe and will not produce a fluorescent signal. In the second round of PCR amplification, 95℃ denaturation for 15 s, 55℃ annealing / extension for 1 min, 35 cycles, which completes the introduction of the universal tag sequence into the PCR product corresponding to the SNP, and then the probe carrying the fluorescence is added to the PCR product by binding to the DNA strand complementary to the tag, so that it is no longer combined with the complementary quenched probe, thereby producing a fluorescent signal and being detected.
[0057] 5.4 Fluorescence scanning
[0058] After the water bath PCR amplification is completed, the reaction plate is wiped dry of water spots, and after the reaction plate cools to room temperature, fluorescence scanning is performed.
[0059] 5.5 Data analysis
[0060] The obtained fluorescence data is analyzed using genotyping data comprehensive analysis management software (Matrix Master).
[0061] The identification results of the PR-KASP primer in the present application are determined through experiments as follows: Figure 2As shown, the three genotypes of homozygous genotype 1, heterozygous genotype and homozygous genotype 2 are well distinguished, clustered, typed and determined, and the implementation effect of the PR-KASP primer is good. 17 randomly selected pepper F2 generation plants were detected by KASP molecular markers. The reference base and variation base of the PR-KASP primer are A and T respectively, and the red dot is defined as the homozygous genotype TT, and the corresponding phenotype is the sterile trait of pepper; the blue dot is the homozygous genotype AA, and the green dot is the heterozygous genotype AT, and the genotypes of AA / AT are all fertile traits of pepper anther.
[0062] Example 2: Field investigation verification of PR-KASP primer identification results
[0063] 15 single plants of pepper male sterile three-line hybrid F2 generation were randomly selected, and the single plant numbers were 2, 3, 16, 52, 83, 94, 108, 113, 117, 147, 154, 171, 182, 183 and 192. Field flower fertility recovery detection was carried out, and the detection results were verified.
[0064] Field fertility investigation: 15 single plants of pepper male sterile three-line hybrid F2 generation were randomly selected, and three times of field flower organ fertility detection were carried out at the flowering stage. The more pollen, the more fertile (F) phenotype detection results; the anther of the single plant without pollen production is shriveled and shriveled, and the phenotype identification result is sterile (S). Once in the result period, the fertility detection was carried out, and the fertility detection was carried out according to whether there was fruit and seed in the fruit. If there are seeds in the fruit, the phenotype detection result is fertile (S), and there is no fruit or seed in the fruit, which is sterile (S).
[0065] Detection results: 15 single plants of pepper male sterile three-line hybrid F2 generation were randomly selected for PR-KASP primer detection. As shown in Figs. 2 and 3, Figure 2 the KASP results of F2 generation pepper single plant 2 are green dots 2, the genotype of SNP site is AT heterozygous, the fertility of pepper is fertile (F), and the phenotype identification of the variety is also fertile (F), which is consistent with the single plant phenotype result identification. In the KASP results of F2 generation pepper single plant 52, the detection result of the single plant is red dot, the genotype of SNP site is TT homozygous, the fertility of pepper is homozygous sterile (S), and the phenotype identification of the variety is also sterile single plant (S), which is consistent with the single plant phenotype result identification. Therefore, the molecular marker identification result is accurate, and the PR-KASP primer can be used as a molecular marker for screening the male sterile recovery trait of pepper.
[0066] Table 2: Phenotype identification and PR-KASP primer detection results
[0067] Note: S is sterile; F is fertile
[0068] Example 3
[0069] Male sterility restoration identification of pepper varieties (lines) using PR-dCAPS primers
[0070] 1. PCR reaction system and procedure
[0071] Reaction system: 25 μL reaction system was used, including 12.5 μL 2x Go Taq R Colorless MasterMix, 1 μL forward primer, 1 μL reverse primer, 2 μL DNA template, and 8.5 μL ddH2O.
[0072] Amplification procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; finally 72℃ total extension for 5 min, and 4℃ preservation.
[0073] 2. Enzyme digestion reaction system and procedure
[0074] The enzyme used for digestion is EcoRI restriction enzyme;
[0075] Digestion system: 10 μL PCR product, 2 μL 10x FiniCut Buffer, 1 μL EcoRI restriction enzyme, and 17 μL ddH2O;
[0076] The enzyme digestion conditions are: 37℃ incubation for 30 min, and 80℃ incubation for 20 min to terminate the reaction.
[0077] 3. Electrophoresis
[0078] The above enzyme digestion product was subjected to agarose gel electrophoresis, and a gel imaging instrument was used to take pictures, and the electrophoresis conditions were: 3% agarose gel (2.4 g agarose, 80 ml 1x TAE solution), voltage: 180 V, time: 35 min.
[0079] 4. 3% agarose gel electrophoresis, band comparison and identification of the PCR product after enzyme digestion
[0080] For example Figure 4As shown in the figure, the experimental results revealed that the fragment lengths of the amplified products exhibited polymorphism after enzyme digestion, with three banding patterns present in the population: when the electrophoresis result showed only one 186 bp band, the genotype of the SNP locus was homozygous AA, and the pepper was fertile (F); when the electrophoresis result showed only one 166 bp band, the genotype of the SNP locus was homozygous TT, and the pepper was sterile (S); when the electrophoresis result showed only two bands, one 186 bp and the other 166 bp, the genotype of the SNP locus was heterozygous AT, and the pepper was fertile (F). Therefore, cytoplasmic male-sterile pepper varieties can be screened.
[0081] 5. Sample phenotypic verification
[0082] The field fertility survey method is as described in Example 2.
[0083] Table 3. Phenotypic identification and PR-dCAPS primer detection results
[0084] Note: S indicates infertility; F indicates fertility.
[0085] Twenty individual plants were randomly selected from the F2 generation of a male-sterile three-line hybrid pepper. Before sampling to verify the molecular marker PR-dCAPS, these plants were renumbered as follows: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. The field test results and molecular marker detection results were analyzed and compared. F2 generation pepper plants 10 and 17 were used as examples. Figure 2 As shown, the electrophoresis results of F2 generation pepper plant 10 showed only one 166bp band, indicating a homozygous TT genotype at the SNP locus, and the pepper was sterile (S). Phenotypic identification also confirmed this variety as sterile (S), with molecular markers consistent with the single-plant phenotypic results. In the electrophoresis results of F2 generation pepper plant 17, only one 186bp band was observed, indicating a homozygous AA genotype at the SNP locus, and the pepper was homozygous fertile. Phenotypic identification also confirmed this variety as a fertile plant, with molecular markers consistent with the single-plant phenotypic results. Therefore, PR-dCAPS primers can be used to screen for the male sterility restorer trait in peppers. When screening pepper varieties containing the restorer gene, the SNP genotype can be selected as AA or AT, facilitating rapid selection of pepper breeding materials at the seedling stage. Peppers with the AA genotype are homozygous restorer lines; those with the AT genotype are heterozygous restorer lines, requiring further isolation and screening later.
[0086] Twelve pepper male sterile three-line hybrid commercial varieties (codes F01-F09, F16, F18, F32), one homozygous restorer fertile (code F) and one homozygous sterile (code S) pepper varieties were used as examples. First, the relatively widely applicable Jo et al. (2016) pepper male sterile restoration molecular marker Co1Mod1-CAPS was used for identification. Co1Mod1-CAPS molecular marker includes F: CCACCCCAAACGTAAGGGATC; R: CAACTTAGCCAATACAATCCCAC, Co1Mod1-CAPS molecular marker is from Jo, Y. D., Ha, Y., Lee, JH. et al. Fine mapping of Restorer-of-fertility in pepper (Capsicum annuum L.) identified a candidate gene encoding a pentatricopeptide repeat (PPR)-containing protein. Theor Appl Genet 129, 2003-2017 (2016). https: / / doi.org / 10.1007 / s00122-016-2755-6. The identification results are shown in Table 1. Figure 5 As shown in Table 1, the electrophoresis results of 11 pepper commercial varieties are two bands, which is consistent with the phenotype of the hybrid fertile of the SNP site; but the electrophoresis result of pepper commercial variety F08 has only one band, indicating that the marker has no polymorphism at this site, which is inconsistent with the phenotype. Therefore, the published molecular marker cannot identify that the pepper hybrid commercial variety F08 is a material carrying male sterile restoration gene.
[0087] However, using the PR-dCAPS primer developed by the present application to identify the fertility of pepper F08, the electrophoresis result shows that the electrophoresis result of pepper variety F08 has only two bands of 186bp and 166bp, and the variety is identified as hybrid fertile, and the molecular marker and the phenotype fertility result are consistent, which are all hybrid fertile (F). Therefore, the development of PR-dCAPS primer enriches the molecular marker library of pepper fertility identification, and 12 pepper commercial varieties containing restoration genes can be detected.
[0088] The above fact cases only represent the technical solutions of the present application, not limit the experiments. Although we have improved the experimental scheme, scientists in the same field can still further improve the experimental scheme described above or make scientific equivalent replacement to the experimental steps. These changes do not make the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.
Claims
1. A molecular marker for identifying the restorer trait of pepper male sterility, characterized in that, The molecular marker is a dCAPS molecular marker developed based on a mutation site of the gene CaT2T06g03535, the mutation site is an A / T base mutation, and sequences of a primer pair of the dCAPS molecular marker are shown as SEQ ID NO. 1 and SEQ ID NO.
2.
2. A molecular marker for identifying the restorer trait of pepper male sterility, characterized in that, The molecular marker is a KASP molecular marker developed based on a mutation site of the gene CaT2T06g03535, the mutation site is an A / T base mutation, and the primer pair of the KASP molecular marker comprises a forward primer FAM, a forward primer HEX and a reverse universal primer, a sequence of the forward primer FAM is shown as SEQ ID NO. 3, a sequence of the forward primer HEX is shown as SEQ ID NO. 4, and a sequence of the reverse universal primer is shown as SEQ ID NO.
5.
3. The molecular marker of claim 2 is used for identifying genotyping of pepper varieties.
4. Use according to claim 3, characterized in that, The PCR reaction system for identifying genotyping is 240 μL of 2x KASP Mix, 0.48 μL of the forward primer FAM, 0.48 μL of the forward primer HEX and 1.44 μL of the reverse universal primer.
5. Use according to claim 3, characterized in that, The PCR reaction procedure for identifying genotyping is pre-denaturation at 94 ℃ for 10 min; in the first round of PCR amplification, denaturation at 95 ℃ for 15 s, annealing / extension at 61 ℃ for 1 min, 10 cycles, completion of allele recognition, and the reverse universal primer also binds and completes the entire PCR process; in the second round of PCR amplification, denaturation at 95 ℃ for 15 s, annealing / extension at 55 ℃ for 1 min, 35 cycles, completion of introducing the universal tag sequence into the PCR product corresponding to the SNP, and then the probe carrying fluorescence is added to the PCR product by binding to the DNA strand complementary to the tag; in the identification result, the homozygous genotype TT corresponds to the phenotype of pepper sterility, and the homozygous genotype AA and the heterozygous genotype AT both correspond to the phenotype of pepper fertility.
6. The molecular marker of claim 1 or 2 is used for identifying the male sterile restoration trait of pepper.
7. Use according to claim 6, characterized in that, The application comprises the following steps: (1) extracting total DNA of a pepper sample to be identified; (2) performing PCR reaction by using the molecular marker; (3) identifying the PCR product to screen pepper varieties, lines and single plants with male sterile restoration.
8. Use according to claim 7, characterized in that, The PCR reaction system using the dCAPS molecular marker is 12.5 μL of 2x Go Taq R Colorless Master Mix, 1 μL of the forward primer, 1 μL of the reverse primer, 2 μL of the DNA template and 8.5 μL of ddH2O.
9. Use according to claim 7, characterized in that, The PCR amplification procedure using the dCAPS molecular marker is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 30 s, 35 cycles; final extension at 72 ℃ for 5 min, and preservation at 4 ℃.
10. Use according to claim 7, characterized in that, In the step (3), when the electrophoresis result has only one band of 186 bp, the genotype of the SNP site is AA homozygous type, and the pepper fertility is fertile F type; when the electrophoresis result has only one band of 166 bp, the genotype of the SNP site is TT homozygous type, and the pepper fertility is sterile S type; when the electrophoresis result has two bands of 186 bp and 166 bp, the genotype of the SNP site is AT heterozygous type, and the pepper fertility is fertile heterozygous type.
Citation Information
Cited By
Indel molecular marker closely related to soluble sugar content of pepper fruits and application thereof
CN121406823A