Modified yeast cells overexpressing selected endogenous proteins

Abstract

The strains and methods of the present invention relate to yeast cells that overproduce selected endogenous proteins having a high amino acid content of selected amino acids. The yeast can be used in conventional bioethanol production facilities to produce alcohol and increased amounts of selected amino acids, thereby improving the quality and commercial value of fermentation products and co-products such as animal feed ingredients.

Description

Technical Field

[0001] The strains and methods of the present invention relate to yeast cells that overproduce selected endogenous proteins having a high amino acid content of selected amino acids. The yeast can be used in conventional bioethanol production facilities to produce alcohol and increased amounts of selected amino acids, thereby improving the quality and commercial value of fermentation products and co-products such as animal feed ingredients. Background Art

[0002] Many countries produce fuel alcohol from fermentable substrates such as corn starch, sugar cane, cassava, and molasses. In the United States alone, fuel ethanol production approached 15 billion gallons in 2015, according to the Renewable Fuels Association (Washington, D.C., USA).

[0003] In addition to producing about 2.8 gallons of ethanol, a bushel (56 pounds) of corn processed in a dry-milling ethanol plant also produces about 17.5 pounds of animal feed. Animal feed is usually in the form of distillers dried grains with solute (DDGS), and represents the corn part that is exhausted of starch plus the biomass of yeast for fermentation. By unit weight, DDGS is more nutritious to animals than unprocessed corn because it is richer in protein and fat. In addition to DDGS, dry-milling ethanol plants can also produce other protein-rich corn products and co-products for animal feed applications.

[0004] Traditionally, lysine, histidine, isoleucine, leucine, valine, methionine, phenylalanine, threonine and tryptophan have been classified as the essential amino acids for non-ruminants. Cysteine ​​and tyrosine can be synthesized from methionine and phenylalanine respectively, but these two precursors are all essential amino acids. If these amino acids can not be supplied in sufficient quantity in DDGS to meet the feed conversion expectation, then these amino acids must be supplemented. Especially, synthetic lysine can mean an important cost of animal feed.

[0005] There exists a need to improve or maintain methods of producing alcohol from starch-containing feedstocks while increasing the nutritional value of the animal feed co-products. Summary of the invention

[0006] Compositions and methods involving yeast cells that overproduce selected endogenous proteins having high amino acid content of selected amino acids are described. The yeast can be used in conventional bioethanol production facilities to produce alcohol and increased amounts of selected amino acids, thereby improving the quality and commercial value of fermentation products and co-products such as animal feed ingredients. Aspects and embodiments of the compositions and methods are described in the following independently numbered paragraphs.

[0007] 1. In one aspect, a microorganism for use in preparing a food or feed composition is provided, the microorganism comprising a genetic modification that increases the expression of an endogenous gene encoding a protein having an elevated ratio of pre-selected amino acids relative to the total amino acid content of the protein, wherein the pre-selected amino acids confer a nutritional benefit to the food or feed composition compared to an otherwise identical food or feed composition comprising an otherwise identical microorganism lacking the genetic modification, or a product derived therefrom.

[0008] 2. In some embodiments of the microorganism as described in paragraph 1, the endogenous gene naturally exists in the microorganism before the introduction of the genetic modification.

[0009] 3. In some embodiments of the microorganism as described in paragraph 1 or 2, the genetic modification is the introduction of an expression cassette comprising an additional copy of the endogenous gene.

[0010] 4. In some embodiments of the microorganism as described in paragraph 1 or 2, the genetic modification is the introduction of a stronger promoter, which is operably linked to the endogenous gene.

[0011] 5. In some embodiments of the microorganism as described in paragraph 1 or 2, the genetic modification is the deletion of a naturally occurring negative regulator of expression of the endogenous gene, or wherein the genetic modification increases the expression of a naturally occurring positive regulator of expression of the endogenous gene.

[0012] 6. In some embodiments of the microorganism of any of paragraphs 1-5, the increased ratio of the preselected amino acid relative to the total amino acid content of the protein is at least 1.2 compared to the ratio of the preselected amino acid relative to the total amino acid content of all proteins produced by the microorganism.

[0013] 7. In some embodiments of the microorganism of any of paragraphs 1-6, the organism is an ethanologen.

[0014] 8. In some embodiments of the microorganism of any of paragraphs 1-7, the organism is a Saccharomyces species.

[0015] 9. In some embodiments of the microorganism of any of paragraphs 1-8, the microorganism does not contain an exogenous gene encoding a protein introduced for the purpose of conferring a nutritional benefit to the food or feed composition, the protein having an elevated ratio of preselected amino acids relative to the total amino acid content of the protein.

[0016] 10. In some embodiments of the microorganism of any of paragraphs 1-9, the cell further comprises an exogenous gene encoding a carbohydrate processing enzyme, one or more genes of a phosphoketolase pathway, an alteration in the glycerol pathway and / or the acetyl-CoA pathway, or an alternative pathway for producing ethanol.

[0017] 11. In another aspect, a method for improving the nutritional value of a microorganism, or a product derived therefrom, in a food or feed composition is provided, the method comprising introducing into the microorganism a genetic modification that increases the expression of an endogenous gene encoding a protein having an elevated ratio of preselected amino acids relative to the total amino acid content of the protein, wherein the preselected amino acids confer a nutritional benefit to the food or feed composition compared to an otherwise identical food or feed composition comprising the otherwise identical microorganism or product derived therefrom lacking the genetic modification.

[0018] 12. In some embodiments of the method of paragraph 11, the endogenous gene naturally exists in the microorganism before introducing the genetic modification.

[0019] 13. In some embodiments of the method of paragraph 11 or 12, the genetic modification is the introduction of an expression cassette comprising an additional copy of the endogenous gene.

[0020] 14. In some embodiments of the method described in paragraphs 11 or 12, the genetic modification is the introduction of a stronger promoter, which is operably linked to the endogenous gene.

[0021] 15. In some embodiments of the methods described in paragraphs 11 or 12, the genetic modification is the deletion of a naturally occurring negative regulator of expression of the endogenous gene, or wherein the genetic modification increases the expression of a naturally occurring positive regulator of expression of the endogenous gene.

[0022] 16. In some embodiments of the method of any of paragraphs 11-15, the increased ratio of the preselected amino acid relative to the total amino acid content of the protein is at least 1.2 compared to the ratio of the preselected amino acid relative to the total amino acid content of all proteins produced by the microorganism.

[0023] 17. In some embodiments of the method of any of paragraphs 11-16, the microorganism is an ethanologen.

[0024] 18. In some embodiments of the method of any of paragraphs 11-17, the organism is a Saccharomyces species.

[0025] 19. In some embodiments of the method of any of paragraphs 11-18, the microorganism does not contain an exogenous gene encoding a protein introduced for the purpose of conferring a nutritional benefit to the food or feed composition, the protein having an elevated ratio of preselected amino acids relative to the total amino acid content of the protein.

[0026] 20. In some embodiments of the method of any of paragraphs 11-19, the cell further comprises an exogenous gene encoding a carbohydrate processing enzyme, one or more genes of the phosphoketolase pathway, an alteration in the glycerol pathway and / or the acetyl-CoA pathway, or an alternative pathway for producing ethanol.

[0027] These and other aspects and embodiments of the modified cells and methods of the invention will be apparent from the description, including any drawings. DETAILED DESCRIPTION

[0028] I. Overview

[0029] Methods involving yeast with genetic mutations are described, the methods involving yeast cells that overproduce a selected endogenous protein having a high amino acid content of a selected amino acid. The yeast can be used in conventional bioethanol production facilities to produce alcohol and increased amounts of selected amino acids, thereby improving the quality and commercial value of fermentation products and co-products such as animal feed ingredients.

[0030] II. Definitions

[0031] Before describing the strains and methods of the present invention in detail, the following terms are defined for clarity. Undefined terms shall be consistent with the ordinary meanings of these terms used in the relevant art.

[0032] As used herein, "alcohol" refers to an organic compound in which a hydroxyl functional group (-OH) is bonded to a saturated carbon atom.

[0033] As used herein, "yeast cells", "yeast strains", or simply "yeast" refer to organisms from the phyla Ascomycota and Basidiomycota. An exemplary yeast is a budding yeast from the order Saccharomycetales. A specific example of yeast is a species of the genus Saccharomyces, including but not limited to S. cerevisiae. Yeast includes organisms used to produce fuel alcohols as well as organisms used to produce drinkable alcohols, including specialty and proprietary yeast strains used to prepare unique flavored beer, wine, and other fermented beverages.

[0034] As used herein, the phrase "variant yeast cell," "modified yeast cell," or similar phrases (see above) refers to yeast that includes the genetic modifications and features described herein. Variant / modified yeast does not include naturally occurring yeast.

[0035] As used herein, the phrase "substantially inactive" or similar phrases means that the specified activity is either undetectable in the mixture or is present in an amount that does not interfere with the intended purpose of the mixture.

[0036] As used herein, the terms "polypeptide" and "protein" (and their respective plural forms) are used interchangeably and refer to polymers of any length comprising amino acid residues linked by peptide bonds. Conventional one-letter or three-letter codes for amino acid residues are used herein, and all sequences are presented from the N-terminal to the C-terminal direction. The polymer can be linear or branched, it can contain modified amino acids, and it can be interrupted by non-amino acids. The term also encompasses amino acid polymers modified naturally or by intervention (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component). Also included within the definition are, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids, etc.) and other modifications known in the art.

[0037] As used herein, an "endogenous" gene or protein originates from within the system in question (e.g., yeast cell). Such a gene or protein occurs naturally without human intervention. As used herein, an endogenous gene or protein is considered endogenous even if it may be overexpressed if some amount of the gene or protein occurs naturally.

[0038] As used herein, an "exogenous" gene or protein originates from outside the system (e.g., yeast cell) in question. Such a gene or protein does not occur naturally and must be introduced, e.g., by human intervention. As used herein, even though an expression cassette may be introduced to overproduce an endogenous gene or protein, if some amount is naturally occurring, the gene or protein is not considered to be exogenous.

[0039] As used herein, proteins that are functionally and / or structurally similar are considered "related proteins". Such proteins may be derived from organisms of different genera and / or species, or even organisms of different classes (e.g., bacteria and fungi). Related proteins also encompass homologs determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.

[0040] As used herein, the term "homologous protein" refers to a protein with similar activity and / or structure to a reference protein. This is not intended to mean that homologues are necessarily evolutionarily related. Therefore, the term is intended to encompass one or more enzymes that are identical, similar, or corresponding (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify homologues with similar quaternary, tertiary and / or primary structures to the reference protein. In some embodiments, homologous proteins induce similar one or more immune responses as reference proteins. In some embodiments, homologous proteins are engineered to produce enzymes with one or more desired activities.

[0041] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al. (1984) Nucleic Acids Res. 12:387-95).

[0042] For example, PILEUP is a useful program for determining the level of sequence homology. PILEUP uses progressive, pairwise comparisons to create a multiple sequence alignment from a group of related sequences. It can also draw a tree showing the clustering relationship used to create the comparison. PILEUP uses a simplification of the progressive comparison method of Feng and Doolittle (Feng and Doolittle (1987) J.Mol.Evol. [Molecular Evolution Magazine] 35:351-60). The method is similar to the method described by Higgins and Sharp ((1989) CABIOS [Computer Applications in Biology] 5:151-53). Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and a weighted end gap. Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al. ((1990) J. Mol. Biol. 215:403-10) and Karlin et al. ((1993) Proc. Natl. Acad. Sci. USA 90:5873-87). A particularly useful BLAST program is the WU-BLAST-2 program (see, e.g., Altschul et al. (1996) Meth. Enzymol. 266:460-80). The parameters "W", "T", and "X" determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915), alignments (B) of 50, expectation (E) of 10, M'5, N'-4, and a comparison of both strands.

[0043] As used herein, in the context of at least two nucleic acids or polypeptides, the phrases "substantially similar" and "substantially identical" typically mean that a polynucleotide or polypeptide comprises a sequence having at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or higher identity compared to a reference (i.e., wild-type) sequence. The sequence identity percentages are calculated using the CLUSTAL W algorithm with default parameters. See Thompson et al. (1994) Nucleic Acids Res. [Nucleic Acids Research] 22: 4673-4680. The default parameters for the CLUSTAL W algorithm are:

[0044]

[0045]

[0046] Another indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ in conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, e.g., where the two peptides differ only in conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of moderate to high stringency).

[0047] As used herein, the term "gene" is synonymous with the term "allele" and refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are typically haploid, so a single copy of a given gene (i.e., a single allele) is sufficient to confer a given phenotype.

[0048] As used herein, the terms "wild type" and "native" are used interchangeably and refer to a gene, protein or strain as found in nature.

[0049] As used herein, the term "target protein" refers to a polypeptide that is desired to be expressed in a modified yeast. Such proteins can be enzymes, substrate binding proteins, surfactant proteins, structural proteins, selective markers, etc., and can be expressed at high levels. The target protein is encoded by a modified endogenous gene or heterologous gene (i.e., target gene) relative to the parent strain. The target protein can be expressed intracellularly or as a secreted protein.

[0050] As used herein, the term "expressing a polypeptide" and similar terms refer to the cellular process by which the cell's translation machinery (eg, ribosomes) produces a polypeptide.

[0051] As used herein, "overexpressing a polypeptide," "overproducing a polypeptide," "increasing expression of a polypeptide," and similar terms refer to expressing a polypeptide at a level above normal as compared to that observed in a parental or "wild-type" cell that does not include the specified genetic modification.

[0052] As used herein, "expression cassette" refers to a DNA fragment comprising a promoter, an amino acid coding region, and a terminator (i.e., promoter:: amino acid coding region:: terminator) and other nucleic acid sequences required to allow the encoded polypeptide to be produced in a cell. The expression cassette can be exogenous (i.e., introduced into a cell) or endogenous (i.e., present in a cell).

[0053] As used herein, "deletion of a gene" refers to the removal of the gene from the genome of the host cell. When a gene includes a control element (e.g., an enhancer element) that is not immediately adjacent to the gene coding sequence, the deletion of the gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements (e.g., including but not limited to promoter and / or terminator sequences), but does not require the deletion of non-adjacent control elements.

[0054] As used herein, "disruption of a gene" refers generally to any genetic or chemical manipulation (i.e., mutation) that substantially prevents a cell from producing a functional gene product (e.g., protein) in a host cell. Exemplary methods of disruption include complete or partial deletion of any part of a gene (including a polypeptide coding sequence, a promoter, an enhancer, or another regulatory element) or mutagenesis thereof, wherein mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations thereof, any of which substantially prevents the production of a functional gene product. Genes may also be destroyed using RNAi, antisense, or any other method for eliminating gene expression. Genes may be destroyed by deletion or genetic manipulation of non-adjacent control elements.

[0055] As used herein, the terms "genetic manipulation" and "genetic alteration" are used interchangeably and refer to changes / variations in a nucleic acid sequence. The changes may include, but are not limited to, substitution, deletion, insertion or chemical modification of at least one nucleic acid in a nucleic acid sequence.

[0056] As used herein, "major genetic determinant" refers to a gene or genetic manipulation thereof that is necessary and sufficient to confer a particular phenotype in the absence of other genes or genetic manipulations thereof. However, the fact that a particular gene is necessary and sufficient to confer a particular phenotype does not exclude the possibility that additional effects on the phenotype may be achieved through further genetic manipulations.

[0057] As used herein, a "functional polypeptide / protein" is a protein that has activity (e.g., enzymatic activity, binding activity, surface active properties, etc.) and has not been mutagenized, truncated, or otherwise modified to eliminate or reduce this activity. As noted, a functional polypeptide can be thermostable or thermolabile.

[0058] As used herein, "functional gene" is a gene that can be used by cell components to produce an active gene product (typically a protein). A functional gene is the opposite of a disrupted gene, and the disrupted gene is modified so that they cannot be used by cell components to produce an active gene product, or have a reduced ability to be used by cell components to produce an active gene product.

[0059] As used herein, a yeast cell has been "modified to prevent the production of a specified protein" if it has been genetically or chemically altered to prevent the production of a functional protein / polypeptide exhibiting an activity characteristic of a wild-type protein. Such modifications include, but are not limited to, deletion or disruption of a gene encoding a protein (as described herein), genetic modifications that render the encoded polypeptide lacking the aforementioned activity, genetic modifications that affect post-translational processing or stability, and combinations thereof.

[0060] As used herein, "fermentation broth" is the product of an ethanol production facility after fermentation with yeast but before distillation.

[0061] As used herein, "whole stillage" is the byproduct of an ethanol production facility after distillation.

[0062] As used herein, "thin stillage" is the liquid portion of whole stillage after separation of solid materials.

[0063] As used herein, "distillers grains (DG)" is the solid / slurry component of whole stillage.

[0064] As used herein, "distillers dried grains (DDG)" is DG that has been dried.

[0065] As used herein, "distillers dried grains with solubles (DDGS)" is DG that has been dried along with concentrated thin stillage to increase nutritional value.

[0066] As used herein, a "wet" distillation by-product contains at least 20% water by weight.

[0067] As used herein, a "dry" distillation by-product contains less than 20% water by weight.

[0068] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.

[0069] As used herein, "anaerobic fermentation" refers to growth in the absence of oxygen.

[0070] As used herein, the singular articles "a / an" and "the" include plural referents unless the context clearly indicates otherwise. All references cited herein are hereby incorporated by reference in their entirety. Unless otherwise stated, the following abbreviations / acronyms have the following meanings:

[0071] ℃ Celsius

[0072] DG Distillers Lees

[0073] DDG Dried Distillers Grains

[0074] DDGS Distillers Dried Grains with Dissolved Matter

[0075] DNA deoxyribonucleic acid

[0076] DP degree of polymerization

[0077] DS Dry Solids

[0078] EtOH

[0079] g or gm gram

[0080] g / L grams / liter

[0081] GA Glucoamylase

[0082] GAU / g DS Glucoamylase unit / gram dry solids

[0083] HPLC High Performance Liquid Chromatography

[0084] hr or h hours

[0085] kDa kilodaltons

[0086] M Moore

[0087] mg milligram

[0088] mL or ml milliliters

[0089] ml / min ml / min

[0090] mM millimole

[0091] N equivalent concentration

[0092] na Not applicable

[0093] PCR polymerase chain reaction

[0094] ppm parts per million

[0095] SAPU / g DS Protease Unit / g Dry Solids

[0096] SSCU / g DS Fungal α-amylase unit / g dry solid

[0097] Δ is associated with deletion

[0098] μg microgram

[0099] μL and μl microliter

[0100] μM and μm micromolar

[0101] III. Yeast cells expressing increased amounts of pre-selected endogenous proteins

[0102] U.S. Patent No. 7,309,602 describes a method for increasing the value of fermentation residues by introducing into yeast cells a recombinant expression vector encoding a polypeptide containing essential amino acids. Rational strategies for producing fermentation products or co-products containing increased amounts of valuable amino acids generally require extensive work to identify valuable proteins that are well expressed and well tolerated in yeast.

[0103] The compositions and methods of the present invention represent an improved strategy for producing valuable proteins. Rather than selecting an exogenous protein of interest that contains a high ratio of the amino acid of interest, knowledge of the amino acid content of endogenous yeast proteins is used to select proteins that can be overexpressed to produce similar results.

[0104] The amino acid content of every kind of protein produced by the organism of yeast saccharomyces cerevisiae can be measured using readily available information. As an example, it has been found that the average occurrence rate of lysine as the score in the total residue in all yeast saccharomyces cerevisiae proteins is 0.08 (or 8%), which is significantly greater than 5% when all amino acid residues are equally accounted for. Five lysine-rich proteins identified in this study are shown in Table 1. These proteins are rich in lysine, and if they are overexpressed, based on their annotations (see, below), it seems impossible to have toxicity to cells. The gene encoding the protein, the total length of the protein, the quantity of lysine residues and the lysine score (expressed as K / AA) have been specified.

[0105] Table 1. Selected lysine-rich proteins in Saccharomyces cerevisiae

[0106] protein Gene K / AA LOC1 YFR001W 0.200 MRPL24 YMR193W 0.151 BUD13 YGL174W 0.146 SYF2 YGR129W 0.144 SMB1 YER029C 0.142

[0107] Similar analyses can be performed for any pre-selected amino acids (most importantly those essential to animals).For the purposes of this study, data on the amino acid composition of 5,895 Saccharomyces cerevisiae proteins were compiled, allowing the identification of proteins enriched in any one or more selected amino acids.

[0108] In some embodiments, the ratio of the increase in the preselected amino acid in endogenous protein is at least 1.2, at least 1.4, at least 1.6, at least 1.8, or even at least 2.0, relative to the fraction of the selected amino acid as total amino acids, compared to the fraction of the amino acid in total cellular protein. In some embodiments, the amount of the preselected amino acid in endogenous protein is at least 20%, at least 40%, at least 60%, at least 80%, or even at least 100% higher relative to the amount of the preselected amino acid in total cellular protein.

[0109] In some embodiments, expression of an endogenous protein enriched in a selected amino acid produced by the modified cell is increased by at least 0.5-fold, at least 1.0-fold, at least 1.5-fold, at least 2.0-fold, at least 3.0-fold, or more compared to the amount of the endogenous protein enriched in the selected amino acid produced by a parent cell grown under the same conditions.

[0110] Preferably, increased endogenous protein expression enriched in selected amino acids is achieved by genetic manipulation using sequence-specific molecular biology techniques, which is in contrast to chemical mutagenesis, which generally does not target specific nucleic acid sequences. However, chemical mutagenesis is not excluded as a method for preparing modified yeast cells.

[0111] In some embodiments, the compositions and methods of the present invention involve introducing into a yeast cell a nucleic acid capable of directing overexpression or increased expression of an endogenous protein enriched in a selected amino acid. Specific methods include, but are not limited to (i) introducing an exogenous expression cassette for producing the polypeptide into a host cell, optionally with an endogenous expression cassette, (ii) replacing the exogenous expression cassette with an endogenous cassette that allows for the production of an increased amount of the polypeptide, (iii) modifying the promoter of the endogenous expression cassette to increase expression, (iv) increasing the copy number of the same or different cassette for overexpression of an endogenous polypeptide enriched in lysine, and / or (v) modifying any aspect of the host cell to increase the half-life of the polypeptide in the host cell.

[0112] In some embodiments, the modified parent cell already includes a gene of interest, such as a gene encoding a selectable marker, a carbohydrate processing enzyme, or other polypeptide. In some embodiments, the introduced gene is subsequently introduced into the modified cell.

[0113] In some embodiments, the modified parent cell already includes an engineered pathway of interest (such as the PKL pathway) that increases ethanol production, or any other pathway that increases alcohol production.

[0114] As exemplified, when the pre-selected amino acid is lysine, possible endogenous proteins include LOC1 (60S ribosomal subunit assembly / export protein), SMB1 (small nuclear ribonucleoprotein-associated protein), BUD13 (pre-mRNA-splicing factor), MRPL24 (mitochondrial ribosomal protein), and SYF2 (pre-mRNA-splicing factor).

[0115] The amino acid sequence of an exemplary LOC1 polypeptide is shown in SEQ ID NO: 2:

[0116]

[0117] The amino acid sequence of an exemplary SMB1 polypeptide is shown below in SEQ ID NO:4:

[0118]

[0119] The amino acid sequence of an exemplary BUD13 polypeptide is shown below in SEQ ID NO:6:

[0120]

[0121] In some embodiments of the compositions and methods of the present invention, the amino acid sequence of the LOC1, SMB1 or BUD13 polypeptide overexpressed in the modified yeast cell is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identical to SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

[0122] In some embodiments, the modified cells include additional genes or other modifications that increase lysine production.

[0123] IV. Combination Expression of Endogenous Proteins Enriched with Selected Amino Acids and Mutations Favoring Alcohol Production

[0124] In some embodiments, in addition to producing increased amounts of endogenous proteins enriched with selected amino acids, the modified yeast cells of the invention further comprise additional modifications that are beneficial for alcohol production.

[0125] In a specific embodiment, the modified yeast cell comprises an artificial or alternative ethanol production pathway resulting from the introduction of a heterologous phosphoketolase (PKL) gene, a heterologous phosphotransacetylase (PTA) gene, and a heterologous acetylated acetyl dehydrogenase (AADH) gene, as described in WO 2015148272 (Miasnikov et al.), which enzymes are introduced to channel carbon flux away from the glycerol pathway and towards the synthesis of acetyl-CoA, which is then converted to ethanol.

[0126] The modified cell may further include a mutation that results in a reduction in the native glycerol biosynthetic pathway, which is known to increase alcohol production. Methods for reducing the glycerol biosynthetic pathway in yeast are known and include, for example, reducing or eliminating endogenous NAD-dependent glycerol 3-phosphate dehydrogenase (GPD) or phosphoglycerol phosphatase (GPP) activity by disrupting one or more of the genes GPD1, GPD2, GPP1 and / or GPP2. See, for example, U.S. Pat. Nos. 9,175,270 (Elke et al.), 8,795,998 (Pronk et al.), and 8,956,851 (Argyros et al.).

[0127] The modified yeast may further be characterized by increased acetyl-CoA synthase (also known as acetyl-CoA ligase) activity (EC 6.2.1.1) to scavenge (i.e., capture) acetate produced by chemical or enzymatic hydrolysis of acetyl-phosphate (or present in the culture medium of the yeast for any other reason) and convert it to Ac-CoA. This avoids the adverse effects of acetate on yeast cell growth and may further contribute to increased alcohol production. Increasing acetyl-CoA synthase activity may be achieved by introducing a heterologous acetyl-CoA synthase gene into the cell, increasing the expression of an endogenous acetyl-CoA synthase gene, and the like. A particularly useful acetyl-CoA synthase for introduction into a cell may be obtained from Methanosaetaconcilii (UniProt / TrEMBL accession number: WP_013718460). Homologs of these enzymes, including enzymes having at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, and even at least 99% amino acid sequence identity to the above-mentioned acetyl-CoA synthase from M. consiliense, can also be used in the compositions and methods of the present invention.

[0128] In some embodiments, the modified cell may further include a gene encoding NAD + A heterologous gene for a protein that is dependent on acetylation of acetaldehyde dehydrogenase activity and / or a heterologous gene encoding a pyruvate formate lyase. The introduction of such a gene in combination with attenuation of the glycerol pathway is described, for example, in U.S. Pat. No. 8,795,998 (Pronk et al.).

[0129] In some embodiments, the modified yeast cells of the invention may further overexpress a sugar transporter-like (STL1) polypeptide (see, e.g., Ferreira et al. (2005) Mol Biol Cell 16:2068-76; et al. (2015) Mol Microbiol 97:541-59 and WO 2015023989 A1), thereby increasing ethanol production and reducing acetate.

[0130] In some embodiments, the modified yeast cells of the invention may further overexpress a poly(A) binding protein, such as PAB1, thereby increasing alcohol production and decreasing acetate production.

[0131] In some embodiments, the modified yeast cells of the present invention further comprise a butanol biosynthetic pathway. In some embodiments, the butanol biosynthetic pathway is an isobutanol biosynthetic pathway. In some embodiments, the isobutanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide that catalyzes the conversion of a substrate to a product selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3-dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde; and (e) isobutyraldehyde to isobutanol. In some embodiments, the isobutanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide having acetolactate synthase, ketoacid reductoisomerase, dihydroxyacid dehydratase, ketoisovalerate decarboxylase, and alcohol dehydrogenase activity.

[0132] In some embodiments, the modified yeast cell comprising a butanol biosynthetic pathway further comprises a modification in a polynucleotide encoding a polypeptide having pyruvate decarboxylase activity. In some embodiments, the yeast cell comprises a deletion, mutation, and / or substitution in an endogenous polynucleotide encoding a polypeptide having pyruvate decarboxylase activity. In some embodiments, the polypeptide having pyruvate decarboxylase activity is selected from the group consisting of: PDC1, PDC5, PDC6, and combinations thereof. In some embodiments, the yeast cell further comprises a deletion, mutation, and / or substitution in one or more endogenous polynucleotides encoding FRA2, ALD6, ADH1, GPD2, BDH1, and YMR226C.

[0133] V. Combination Expression of Endogenous Proteins Enriched with Selected Amino Acids and Other Beneficial Mutations

[0134] In some embodiments, in addition to producing increased amounts of endogenous proteins rich in selected amino acids, endogenous proteins rich in lysine (optionally in combination with genetic modifications that are beneficial to alcohol production), the modified yeast cells of the present invention further include any number of additional genes of interest encoding proteins of interest. Additional genes of interest may be introduced before, during, or after genetic manipulations that result in reduced feedback inhibition of lysine or increased alcohol production. Proteins of interest include selectable markers, carbohydrate processing enzymes, and other commercially relevant polypeptides, including but not limited to enzymes selected from the group consisting of: dehydrogenases, transketolases, phosphoketolase, transaldolase, epimerases, phytases, xylanases, β-glucanases, phosphatases, proteases, α-amylases, β-amylases, glucoamylases, pullulanases, isoamylases, cellulases, trehalases, lipases, pectinases, polyesterases, cutinases, oxidases, transferases, reductases, hemicellulases, mannanases, esterases, isomerases, pectinases, lactases, peroxidases, and laccases. The protein of interest can be secreted, glycosylated, and modified in other ways.

[0135] VI. Yeast Cells Suitable for Modification

[0136] Yeast is a unicellular eukaryotic microorganism classified as a member of the kingdom Fungi, and includes organisms from Ascomycota and Basidiomycota. Yeast that can be used for alcohol production includes, but is not limited to, species of Saccharomyces, including Saccharomyces cerevisiae, and Kluyveromyces, Lachancea, and Schizosaccharomyces species. Many yeast strains are commercially available, many of which have been selected or genetically engineered to obtain desired characteristics, such as high ethanol production, fast growth rate, etc. Many yeasts have been genetically engineered to produce heterologous enzymes or even include heterologous pathways.

[0137] VII. Substrates and conditions

[0138] The production of alcohol from many carbohydrate substrates (including but not limited to corn starch, sugar cane, cassava and molasses) is well known, as are the numerous variations and modifications of enzyme and chemical conditions and mechanical methods. It is believed that the compositions and methods of the present invention are fully compatible with such substrates and conditions.

[0139] There are many variations of ethanol production processes, including cold cooking or no cooking, processes involving liquefaction at or below gelatinization temperature, simultaneous saccharification and fermentation, fractionation, etc. It is contemplated that the above processes are compatible with the compositions and methods of the present invention.

[0140] VIII. Fermentation Products and Co-products

[0141] Typical alcohol fermentation products include organic compounds with hydroxyl functional groups (-OH) combined with carbon atoms. Exemplary alcohols include but are not limited to methanol, ethanol, n-propyl alcohol, isopropyl alcohol, n-butanol, isobutyl alcohol, n-pentanol, 2-pentanol, isopentanol and higher alcohols. The most commonly prepared fuel alcohols are ethanol and butanols.

[0142] A valuable byproduct (or co-product) of alcohol production (and particularly dry mill ethanol production) is an animal feed product, typically in the form of distillers dried grains (DDG) or, more commonly, distillers dried grains with solubles (DDGS). These animal feed products are in many ways more nutritious than the original feedstock for ethanol production because they are depleted of carbohydrates but enriched with amino acids from the feedstock and the fermenting organism (i.e., the ethanologen).

[0143] The specific amino acid composition of DDGS or other corn co-products is important to the quality of animal feed because some amino acids are far more important than others. Lysine is an essential amino acid for most farm animals and must be supplemented to maximize feed conversion if it is not adequately provided by DDG, DDGS or other fermentation co-products. Synthetic lysine is expensive and represents a significant cost in animal feed.

[0144] Since yeast represents an important component in post-fermentation products, the amino acid content of yeast significantly affects the amino acid content of fermentation broth, whole stillage, thin stillage, dried distiller's grains, dried distiller's grains with solubles, concentrated distiller's grains solubles or other protein-containing post-fermentation co-products. Substituting the yeast of the present invention for conventional yeast increases the amount of lysine in such post-fermentation products, thereby increasing their value as animal feed products.

[0145] Using the modified yeast of the present invention, an increase in lysine of at least 0.2 times, at least 0.5 times, at least 1.0 times, at least 1.2 times, at least 1.5 times, at least 1.7 times, at least 2.0 times, or more can be achieved.

[0146] These and other aspects and embodiments of the strains and methods of the invention will be clear to the skilled person in view of this specification.The following examples are intended to further illustrate but not limit the strains and methods.

[0147] Examples

[0148] Example 1: Selection of genes encoding endogenous lysine-rich proteins

[0149] The amino acid content of each protein encoded by the endogenous genes in the Saccharomyces cerevisiae genome was analyzed to identify natural proteins rich in lysine. It was found that the average occurrence rate of lysine as a fraction in the total residues (i.e., K / AA) in the protein was 0.08. Therefore, Saccharomyces cerevisiae proteins typically have an 8% lysine content, which is greater than the 5% when all amino acid residues are equally accounted for. The top five candidate genes for lysine overproduction are summarized in Table 2 below. These genes do not necessarily have the highest K / AA; however, based on public annotations, if overexpressed, these genes are very likely to be cell-tolerant.

[0150] Table 2. Selected lysine-rich proteins in Saccharomyces cerevisiae

[0151] Gene protein AA length K quantity K / AA YFR001W LOC1 205 41 0.200 YMR193W MRPL24 259 39 0.151 YGL174W BUD13 267 39 0.146 YGR129W SYF2 216 31 0.144 YER029C SMB1 197 28 0.142

[0152] At FERMAX TM The expression of each gene in Table 2 was determined at various times during aerobic growth of F. Gold (Martrex Inc., Minnesota, USA; abbreviated herein as "FG"), a well-known fermenting yeast used in the grain ethanol industry. RNA was prepared from a single sample according to the TRIzol method (Life-Tech, Rockville, MD). The RNA was then cleaned using the Qiagen RNeasy mini kit (Qiagen, Germantown, MD). cDNA was generated from the total mRNA of a single sample using a high-capacity cDNA reverse transcription kit from Applied Biosystems (ThermoFisher Scientific, Wilmington, Delaware). The cDNA of each sample prepared was sequenced using the shotgun method and then quantified relative to a single gene. The results reported in Table 3 are reads per kilobase million transcripts (RPK10M) and can be used to quantify the amount of each transcript in a sample.

[0153] Table 3. Lysine protein expression in FG

[0154]

[0155] Based on several factors, including the lysine content of the protein, expression level, full length of the gene, and ease of amplification by PCR, three genes were selected for further study, namely, (i) YFR001W encoding LOC1 (60S ribosomal subunit assembly / export protein), (ii) YER029C encoding SMB1 (small nuclear ribonucleoprotein-associated protein), and (iii) YGL174W encoding BUD13 (pre-mRNA splicing factor).

[0156] Example 2: Overproduction of lysine-rich proteins in yeast

[0157] Using standard molecular techniques, LOC1, BUD13 and SMB1 were overexpressed in FG using a strong promoter (FBA1) from an expression cassette inserted at a preselected locus. All procedures were based on the publicly available nucleic acid sequences of YFR001w, YER029c and YGL174w, which are provided below (5' to 3'):

[0158] >LOC1YFR001W SGDID:S000001897,chrVI:149110..149724(SEQ ID NO:1):

[0159] ATGGCACCAAAGAACCTTCTAAGAGACAAAATCTGAGAAGAGAAGTCGCACCAGAGGTGTTTCAAGATTCACAAGCTAGGAATCAACTAGCGAATGTTCCTCATCTTACCGAAATTCTGCCCAGCGTAAGCCTTCTAAAACCAAGGTTAAA AAAGAACAGTCTTTGGCTAGACTTTATGGTGCGAAGAAGGACAAGAAGGGGAAATATTCTGAGAAAGACTTGAATATTCCAACACTCAATAGAGCTATCGTTCCGGGTGTTAAAATAAGGAGGGGAAAGAAAGGTAAGAAATTCATTGCTGATA ACGACACTCTGACTTTAAACCGTTTAATAACAACTATTGGTGACAAGTACGACGATATAGCTGAGAGTAAGCTTGAAAAGGCTAGAAGATTAGAGAGATACGAGAATTGAAAAGAAAGGAAATTGAAAGAAAGGAAGCGCTTAAACAAGATAAACTAGAAGAAAAAAAAGACGAGATTAAAAAGAAGTCTTCTGTCGCAAGGACTATACGTAGAAAGAATAAACGTGATATGTTGAAAAGTGAAGCAAAAGCTAGTGAAAGTAAAACTGAAGGAAGGAAGGTAAAAAAAGTCTCATTTGCTCAATAG

[0160] >SMB1YER029C SGDID:S000000831,chrV:212587..213177(SEQ ID NO:3):

[0161] ATGAGCAAAATACAGGTGGCACATAGCAGCCGACTAGCCAACCTTATTGATTATAAGCTGAGGGTTCTCACTCAAGATGGCCGCGTTTACATCGGGCAATTGATGGCATTTGATAAACATATGAATTTAGTGTTGAATGAGTGTATAGAAGAGAGGGTACCCAAAACTCAACTAGATAAATTAAGACCGAGAAAAGATTCAAAAGATGGAACCACTTTGAACATCAAGGTAGAAAAAAGAGTGTTGGGACTGACTATACTAAGAGGAGAACAGATCTTATCCACAGTGGTGGAGGATAAGCCGCTACTATCCAAGAAGGAAAGACTAGTGAGAGATAAAAAGGAAAAGAAACAAGCGCAAAAGCAGACGAAACTAAGAAAAGAGAAAGAGAAAAAGCCGGGAAAGATCGCTAAACCTAACACGGCCAATGCGAAGCATACTAGTAGCAATTCTAGGGAGATTGCCCAACCATCGTCGAGCAGATACAATGGTGGCAACGATAATATCGGCGCAAATAGGTCGAGGTTTAATAATGAAGCGCCCCCTCAAACAAGGAAGTTTCAGCCCCCACCAGGTTTTAAAAGAAAATAA

[0162] >BUD13YGL174W SGDID:S000003142,chrVII:174545..175345(SEQ ID NO:5):

[0163] ATGGCATTGCATCAGTATTTATCAGAGACTTATGGGCCCACGAAACCCAAAAATAAGACGAAAAAGAAGAAGAAAGAGTCAAAATCAGACGCTAACTCAGACAAAACTTCTTTGATAGTAAAAGAACGGCTAAGTACACTGCAACAAGAACAGGAGAAGTCAGGAGTTGCTTCATTCAGCAAGTTTGACAAACAAAAAAGCAAGAATATATGGAAGAACCTGGAAACAAACGAGCTTTCCCATGCAATAACACATCCTTCCGCATCGTCAATTACTGGCAACGAAAGCAAGAACGATCTAAAGGAAATCAGGGCTCAAGAGCCACTTGTCACAGTAGCAGACAAATCGAAAACACGAAAAACCATATACAGAGACGCTCAAGGTCACAAGATTCAGGAAGATTCCAAGATAGACGATTCTAGTTTTAGTCGATCTAAATATGAAGATGAGAAAGCCGCGGAAAGAGAGCAATACCTGAAAAATTTGAATATGGGAGACGTGCAAAAGCTTGGAATAAATGTAGATGCACATGATAAGAAGAAAAATCAAACTGCCTCGAGTCTGACGATAGAAGACCCTGCAATAACATTTACACATGACAAAGAAAGAACTGTAAAAACATCTTTACTGGGCCGCAAGCTTTATGATAAGCCAGCACCTGAGAACAGGTTTGCCATTATGCCTGGGTCAAGATGGGACGGTGTCCACAGATCAAATGGCTTTGAAGAAAAATGGTTTGCTAAGCAAAATGAGATCAATGAGAAGAAAGTGCAAAGCTACACCCTACAGGAGGATTATTGA

[0164] The YFR001W gene encodes the 60S ribosomal subunit assembly / export protein LOC1 (UniProtKB - P43586), which is shown as SEQ ID NO:2 as follows:

[0165]

[0166] The YER029C gene encodes small nuclear ribonucleoprotein-associated protein B (SMB1; UniProtKB-P40018), which is shown in SEQ ID NO:4 below:

[0167]

[0168] The YGL174W gene encodes the pre-mRNA splicing factor CWC26 (BUD13; UniProtKB-P46947), which is shown in SEQ ID NO:6 below:

[0169]

[0170]

[0171] Insertion of the expression cassette at the jen1D locus was confirmed by colony PCR. The modified yeast strains were grown in non-selective medium to remove the plasmid that confers kanamycin resistance for selection of transformants, resulting in modified yeast that did not require growth supplements compared to the parent yeast. The three strains selected for further study are summarized in Table 4.

[0172] Table 4. Summary of endogenous protein overexpression strains

[0173] strains Gene protein <![CDATA[FG-LOC1 过 ]]> YFR001W LOC1 <![CDATA[FG-SMB1 过 ]]> YMR193W MRPL24 <![CDATA[FG-BUD13 过 ]]> YGL174W BUD13

[0174] Example 3: Lysine production by strains overexpressing lysine-rich proteins

[0175] After 24-48 hours of growth in minimal medium, yeast strains overexpressing LOC1, SMB1 or BUD13 were tested for their ability to produce lysine compared to a benchmark yeast strain that was wild type for the LOC1, SMB1 or BUD13 gene.

[0176] The FG-LOC1 was hydrolyzed with acid (6N HCl) at 110 °C. 过 、FG-SMB1 过 , and FG-BUD13 过The total protein produced by the parent FG strain was hydrolyzed for 24 hr (see, e.g., Otter, D. et al. (2012) British Journal of Nutrition 108: S230-S237) and after derivatization with o-phthalaldehyde, the protein lysine content. By HPLC (Agilent Technologies 1260), Eclipse Plus C18 columns (4.6x150mm, 3.5 microns) were used to detect the derivatized L-Lysine at 40°C in a gradient of phosphate buffer (pH 7.8) and acetonitrile: methanol: water (45: 45: 10). The calibration standards used for quantification include a known amount of L-Lysine or an amino acid standard mixture (Agilent Technologies) containing L-Lysine. The total lysine increase relative to the FG strain is reported in Table 5.

[0177] Table 5. Lysine produced by modified yeast and parent yeast

[0178] strains K / AA Multiple increase of K FG na 1.00 <![CDATA[FG-LOC1 过 ]]> 0.2 1.58 <![CDATA[FG-SMB1 过 ]]> 0.14 1.53 <![CDATA[FG-BUD13 过 ]]> 0.15 1.61

[0179] Yeast carrying overexpressed LOC1, BUD13, or SMB1 produced up to 1.6 times more protein lysine compared to unmodified reference strains.

[0180] Example 4: Bioavailable Lysine Content of Fermentation Co-Products Using Modified Yeast

[0181] Tested FG-LOC1 过 Total bioavailable lysine content of fermentation co-products compared to the benchmark strain FG. Liquefact (corn mash slurry) was prepared by adding 600 ppm urea, 0.124 SAPU / g ds acid fungal protease, 0.33 GAU / g ds variant Trichoderma reesei glucoamylase and 1.46 SSCU / g ds Aspergillus kawachii alpha-amylase, adjusted to pH 4.8 with sulfuric acid. 100 g of the prepared corn liquefact was mixed with FG-LOC1 过 Fermentation was performed with the FG strain or the benchmark at 32°C with shaking at 200 rpm. After 67 hours, the fermentation broth in duplicate fermentation bottles was collected in 800-mL beakers and placed in a shaking water bath at 95°C to evaporate the ethanol. The fermentation broth was allowed to incubate for approximately 3-5 hours, or until no significant ethanol was detected by HPLC.

[0182] The resulting material (i.e., whole stillage) was rotated at 6,000 rpm for 10 min. The supernatant (i.e., thin stillage) and the precipitate (i.e., wet cake) were collected. The wet cake was dried at 37°C until a dry solids content of about 33%-35% was reached. The thin stillage was weighed into a 600 mL beaker and placed in a 97°C shaking water bath to concentrate the contents by about 5 times (by weight) to produce a slurry. Water can be added back into the beaker to ensure that the sample is concentrated to an appropriate, equal degree. In order to make the fermentation co-product similar to the DDGS sample, the wet cake and the corresponding slurry were combined in a mass ratio of 2 to 1 (same as by weight). The DDGS was spread on a metal tray and dried in a 99°C oven for about 3 hours, occasionally mixing until dried to a dry solids content of> 90%.

[0183] To test bioavailable amino acids, DDGS samples were incubated with pepsin and pancreatin based on a previously reported method (Qiao, Y (2001), Routine techniques for monitoring the nutritional value of animal meals, Doctoral thesis at North Carolina State University). Briefly, 0.33 g of DDGS was added to a 20 mL scintillation vial with 3.33 mL of 0.05 M citrate buffer (pH 2) and approximately 0.012 g of pepsin (from porcine gastric mucosa) at >400 U / mg protein. The mixture was allowed to incubate at 38° C. with shaking at 200 rpm for approximately 24 hours. Thereafter, 5 mL of phosphate buffer (0.2 M, pH 11.5, containing 0.025% w / w sodium azide) and approximately 0.023 g of pancreatin (from porcine pancreas, 4 x UXP specification) were added to each vial. The vials were returned to the 38°C incubator (shaking at 200 rpm) for approximately 66 hours. After this time, samples were removed from each vial, spun down through a 0.2 μM filter, and analyzed for free amino acids by HPLC.

[0184] Compared with the lysine content in the fermentation co-product produced by fermentation using the parent FG strain, the lysine content in the fermentation co-product produced by using FG-LOC1 过 The fermentation co-product produced by the strain had 1.08 times more bioavailable lysine (ie, 8% more).

Claims

1. A microorganism for use in the preparation of a food or feed composition, the microorganism comprising a genetic modification that increases expression of an endogenous gene encoding a protein, wherein the protein comprises a preselected amino acid, wherein the preselected amino acid confers a nutritional benefit to the food or feed composition compared to an otherwise identical food or feed composition comprising an otherwise identical microorganism lacking the genetic modification or a product derived therefrom, wherein the microorganism is Saccharomyces cerevisiae, the preselected amino acid is lysine, and The endogenous gene encodes a protein selected from LOC1 shown in SEQ ID NO: 2, SMB1 shown in SEQ ID NO: 4, or BUD13 shown in SEQ ID NO:

6.

2. The microorganism of claim 1, wherein the endogenous gene is naturally present in the microorganism prior to introduction of the genetic modification.

3. The microorganism of claim 1, wherein the genetic modification is the introduction of an expression cassette comprising an additional copy of the endogenous gene.

4. The microorganism of claim 1, wherein the genetic modification is the introduction of a stronger promoter operably linked to the endogenous gene.

5. The microorganism of claim 1, wherein the genetic modification is a deletion of a naturally occurring negative regulator of expression of the endogenous gene, or wherein the genetic modification increases expression of a naturally occurring positive regulator of expression of the endogenous gene.

6. The microorganism according to claim 1, wherein The endogenous gene encodes the LOC1 protein shown in SEQ ID NO:

2.

7. The microorganism of claim 1, wherein the microorganism is an ethanologen.

8. The microorganism of claim 1, wherein the microorganism does not comprise an exogenous gene encoding a protein introduced for the purpose of conferring a nutritional benefit to the food or feed composition, wherein the protein encoded by the exogenous gene has an increased ratio of the preselected amino acid relative to the total amino acid content of the protein of at least 1.4 compared to the ratio of the preselected amino acid relative to the total amino acid content of all proteins produced by the microorganism.

9. The microorganism of any one of claims 1-8, wherein the microorganism further comprises exogenous genes encoding carbohydrate processing enzymes, one or more genes of the phosphoketolase pathway, alterations in the glycerol pathway and / or the acetyl-CoA pathway, or alternative pathways for producing ethanol.

10. A method for improving the nutritional value of a microorganism or a product derived therefrom in a food or feed composition, the method comprising introducing into the microorganism a genetic modification that increases expression of an endogenous gene encoding a protein, wherein the protein comprises a preselected amino acid, wherein the preselected amino acid confers a nutritional benefit to the food or feed composition compared to an otherwise identical food or feed composition comprising an otherwise identical microorganism or a product derived therefrom lacking the genetic modification, wherein the microorganism is Saccharomyces cerevisiae, the preselected amino acid is lysine, and The endogenous gene encodes a protein selected from LOC1 shown in SEQ ID NO: 2, SMB1 shown in SEQ ID NO: 4, or BUD13 shown in SEQ ID NO:

6.

11. The method of claim 10, wherein the endogenous gene is naturally present in the microorganism prior to introduction of the genetic modification.

12. The method of claim 10, wherein the genetic modification is the introduction of an expression cassette comprising an additional copy of the endogenous gene.

13. The method of claim 10, wherein the genetic modification is the introduction of a stronger promoter operably linked to the endogenous gene.

14. The method of claim 10, wherein the genetic modification is a deletion of a naturally occurring negative regulator of expression of the endogenous gene, or wherein the genetic modification increases expression of a naturally occurring positive regulator of expression of the endogenous gene.

15. The method of claim 10, wherein the endogenous gene encodes the LOC1 protein shown in SEQ ID NO:

2.

16. The method of claim 10, wherein the microorganism is an ethanologen.

17. The method of claim 10, wherein the microorganism does not comprise an exogenous gene encoding a protein introduced for the purpose of conferring a nutritional benefit to the food or feed composition, wherein the protein encoded by the exogenous gene has an elevated ratio of the preselected amino acid relative to the total amino acid content of the protein of at least 1.4 compared to the ratio of the preselected amino acid relative to the total amino acid content of all proteins produced by the microorganism.

18. The method of any one of claims 10-17, wherein the microorganism further comprises exogenous genes encoding carbohydrate processing enzymes, one or more genes of the phosphoketolase pathway, alterations in the glycerol pathway and / or the acetyl-CoA pathway, or an alternative pathway for producing ethanol.

Images