Rapid nucleic acid detection method and kit for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus

Abstract

The present invention discloses a rapid nucleic acid detection method and kit for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus. The method comprises the following steps: 1) nucleic acid extraction of the sample to be tested; 2) isothermal nucleic acid amplification: performing loop-mediated isothermal nucleic acid amplification on the nucleic acid of the nuc1 gene specific to Staphylococcus aureus or the mecA gene specific to methicillin-resistant Staphylococcus aureus; 3) detection of the amplification product: detecting the amplified nuc1 gene or mecA gene by using the CRISPR-Cas12a system. The present invention for the first time adopts the CRISPR-Cas12a fluorescence probe method to detect the nucleic acid of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, and has the advantages of high sensitivity, strong specificity, short time consumption, high throughput, and independence from large-scale experimental equipment, etc.; it can be conveniently used for the rapid grass-roots detection of the nucleic acid of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in grass-roots experiments and at the clinical front line.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method and kit for rapid detection of nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus. Background Art

[0002] Staphylococcus aureus, also known as Staphylococcus aureus or staphylococci, usually inhabits the human skin and can be found in the nasal cavities of about 25-30% of adults. When Staphylococcus aureus inhabits the human epidermis, it neither harms the host nor causes clinical symptoms. However, when there are wounds on the host's skin surface or during surgical operations, or when the body's own immunity is low, the inhabiting Staphylococcus aureus can cause infections. Staphylococci often cause local skin infections such as folliculitis, boils, and pustules, and can also lead to abscesses and spread to bone tissue (osteomyelitis), lungs (staphylococcal pneumonia), blood (bacteremia or sepsis), heart (endocarditis, which can damage heart valves), and other organs. Staphylococci can infect others by contacting the skin of patients or hosts or sharing contaminated utensils such as towels, razors, etc.

[0003] At present, the main bacteriological examination methods for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus are the drug susceptibility tests for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, Xpert MTB / RIF, fluorescence quantitative PCR melting curve method, and whole-genome sequencing method. The drug susceptibility test is still the "gold standard" for diagnosing Staphylococcus aureus and its methicillin resistance in many countries. However, since such tests take an excessively long time, usually more than twelve hours to produce results, it is not conducive to the early diagnosis and treatment of diseases. In addition, Xpert MTB / RIF and the fluorescence quantitative PCR melting curve method require specific instruments, have high sample requirements, average sensitivity, and expensive detection costs. The whole-genome sequencing method is time-consuming, has high requirements for instruments and equipment, high sample requirements, and high costs, and is not yet popular in most regions. This has brought great limitations to the clinical diagnosis of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus. Due to the lack of rapid and sensitive detection methods, a large number of patients with Staphylococcus aureus and methicillin-resistant Staphylococcus aureus diseases have not received timely and regular treatment, which has led to more serious bacterial infections. The delay in diagnosis is the main cause of death caused by Staphylococcus aureus and methicillin-resistant Staphylococcus aureus infections. Detecting Staphylococcus aureus and its methicillin resistance as soon as possible can effectively prevent the further deterioration of the infection. Therefore, early, rapid, and sensitive detection methods are particularly important. As a necessary condition for blocking the infection, the early diagnosis of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus urgently requires us to find more sensitive, specific, and cost-effective clinical detection methods for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, in order to eliminate the bacterial infections caused by Staphylococcus aureus and methicillin-resistant Staphylococcus aureus as early as possible through early detection, early diagnosis, and further targeted standardized treatment.

[0004] CRISPR-Cas (Clustered regularly interspaced short palindromic repeats, CRISPRs) is an adaptive immune system in bacteria. The Cas protein specifically binds to foreign nucleic acids under the guidance of a guide RNA complementary to the foreign nucleic acid, and then uses its nuclease activity to specifically cleave the foreign nucleic acid. Among them, CRISPR-Cas12a (Cpf1) belongs to the second family of Cas enzymes and can specifically cleave double-stranded DNA under the guidance of a guide RNA. The Cpf1 enzyme recognizes the protospacer adjacent motif (PAM) rich in thymine (T) nucleotides and cleaves the double-stranded DNA (dsDNA) complementary to the crRNA under the guidance of the CRISPR RNA (crRNA). When the Cas12a protein specifically recognizes and cleaves the target double-stranded DNA, it can induce a powerful non-specific single-stranded DNA (ssDNA) trans-cleavage activity, which can randomly cleave the surrounding non-specific single-stranded DNA.

[0005] Based on the above characteristics of Cas12a, it is expected to be applied to the construction of rapid detection methods for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, but no publicly reliable scheme has been seen yet. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a rapid nucleic acid detection method and kit for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in view of the deficiencies in the above-mentioned prior art.

[0007] To solve the above technical problem, the technical solution adopted by the present invention is: A rapid nucleic acid detection method for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, comprising the following steps:

[0008] 1) Nucleic acid extraction of the sample to be tested;

[0009] 2) Nucleic acid amplification:

[0010] Use an isothermal amplification system to perform loop-mediated isothermal amplification of the nucleic acid of the nuc1 gene specific to Staphylococcus aureus or the mecA gene specific to methicillin-resistant Staphylococcus aureus;

[0011] 3) Detection of the amplification product:

[0012] Use the CRISPR-Cas12a system to detect the amplified nuc1 gene or mecA gene. In the CRISPR-Cas12a system, the nuc1 gene is detected with nuc1-crRNA, and the mecA gene is detected with mecA-crRNA;

[0013] The sequence of nuc1-crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUAAUGGUAAAGAUAAAGUACA-3’;

[0014] The sequence of mecA-crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCCAAUAACUGCAUCAUCUUU-3’.

[0015] Preferably, in the step 2), the nucleic acid amplification is carried out by polymerase chain reaction, recombinase polymerase amplification or loop-mediated isothermal amplification of nucleic acid.

[0016] Preferably, in the step 2), the nucleic acid amplification is carried out by loop-mediated isothermal amplification of nucleic acid, and the isothermal amplification system of nucleic acid includes an amplification primer set for the nuc1 gene and an amplification primer set for the mecA gene;

[0017] The amplification primer set for the nuc1 gene includes:

[0018] nuc1-F3: 5’-TCGCTTGCTATGATTGTGG-3’;

[0019] nuc1-B3: 5’-ACATACGCCAATGTTCTACC-3’;

[0020] nuc1-FIP:

[0021] 5’-GTACAGTTTCATGATTCGTCCCGCCATCATTATTGTAGGTGT-3’;

[0022] nuc1-BIP:

[0023] 5’-TGTTCAAAGAGTTGTGGATGGTGTACAGGCGTATTCGGTT-3’;

[0024] nuc1-FLP: 5’-TTGAAAGGACCCGTATGATTCA-3’;

[0025] nuc1-BLP: 5’-GATACGCCAGAAACGGTGA-3’.

[0026] Preferably, the amplification primer set for the mecA gene includes:

[0027] mecA-F3: 5’-GGTACAAGATGATACCTTCGTT-3’;

[0028] mecA-B3: 5’-ATAGCAGTACCTGAGCCAT-3’;

[0029] mecA-FIP:

[0030] 5’-TCTTCAGAGTTAATGGGACCAAACAGAAAGTCGTAACTATCCTC-3’;

[0031] mecA-BIP:

[0032] 5’-AAGCTCCAACATGAAGATGGCTTGTATGTGCGATTGTATTGC-3’;

[0033] mecA-FLP: 5’-ACCTAATAGATGTGAAGTCGCT-3’;

[0034] mecA-BLP: 5’-CGTGTCACAATCGTTGACG-3’.

[0035] Preferably, the CRISPR-Cas12a system further includes LaCas12a and an ssDNA fluorescent probe, and the sequence of the ssDNA fluorescent probe is: 5’-6FAM-TTTATTT-3’-BHQ1.

[0036] In the step 1), nucleic acid extraction is carried out by an enzymatic method, a repeated freeze-thaw method, a boiling method, a magnetic bead method or an adsorption column method.

[0037] Preferably, in the step 1), nucleic acid extraction is carried out by an enzymatic method. The specific method is as follows: take the sample to be tested, centrifuge and remove the supernatant, add TE solution, mix well, centrifuge and remove the supernatant, add lysozyme and Triton X-100, mix well, react at 37 °C to obtain the nucleic acid extract of the sample to be tested.

[0038] Preferably, the step 2) includes: adding the nucleic acid extract obtained in the step 1) into a constant temperature amplification system, and carrying out a constant temperature reaction at 65 °C to amplify the nuc1 gene or the mecA gene.

[0039] Preferably, the constant temperature amplification system further includes Primer mix, Isothermo Buffer, Mg 2+ , dNTP, H2O and polymerase.

[0040] Preferably, the step 3) includes: adding the product amplified in the step 2) into the CRISPR-Cas12a system, mixing well and reacting at 37 °C, and detecting the fluorescence of the reaction, wherein the excitation wavelength is 485 nm and the emission wavelength is 520 nm.

[0041] Preferably, the CRISPR-Cas12a system includes LaCas12a, ssDNA fluorescent probe, nuc1-crRNA or mecA-crRNA, TOLO Buffer and H2O.

[0042] The present invention also provides a kit for rapid nucleic acid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, which includes the isothermal amplification system and CRISPR-Cas12a system as described above.

[0043] The beneficial effects of the present invention are as follows:

[0044] (1) By using the LAMP nucleic acid isothermal amplification technology and CRISPR-Cas12a specific nucleic acid fluorescence detection technology, the present invention can achieve high-sensitivity, high-specificity and rapid detection of the nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus; the present invention designs specific crRNAs for the unique nuc1 gene of Staphylococcus aureus and the unique mecA gene of methicillin-resistant Staphylococcus aureus respectively; to ensure the detection specificity, the designed crRNA sequences are retrieved from the NCBI nucleic acid database including genes of humans, animals, plants and microorganisms, etc., and it is determined that there is no high homology match.

[0045] (2) Based on LAMP nucleic acid isothermal amplification and CRISPR-Cas12a nucleic acid detection, the present invention constructs a kit for nucleic acid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus. Using this kit, only a common laboratory water bath or metal bath is needed to quickly detect the nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus; the present invention provides an accurate, rapid and simple detection method for grass-roots experiments and front-line clinics.

[0046] (3) The present invention discloses a series of reaction systems for nucleic acid extraction, LAMP nucleic acid isothermal amplification and CRISPR-Cas12a nucleic acid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus; the present invention first uses the CRISPR-Cas12a fluorescent probe method to detect the nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, and has the advantages of high sensitivity, strong specificity, short time consumption, high throughput, and independence from large-scale experimental equipment; these advantages make the nucleic acid detection method developed by the present invention based on the LAMP nucleic acid isothermal amplification technology and CRISPR-Cas12a specific nucleic acid fluorescence detection technology convenient for grass-roots rapid detection and identification diagnosis of the nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in grass-roots experiments and front-line clinics. Brief Description of the Drawings

[0047] Figure 1Schematic diagram of the method for rapid detection of nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus based on CRISPR-Cas12a of the present invention;

[0048] Figure 2 Results of detecting synthetic nuc1 gene and mecA gene using the CRISPR-Cas12a system in the examples of the present invention;

[0049] Figure 3 Results of detecting nuc1 gene and mecA gene after LAMP amplification using the CRISPR-Cas12a system in the examples of the present invention;

[0050] Figure 4 Results of nucleic acid detection of different concentrations of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus using the CRISPR-Cas12a system in the examples of the present invention;

[0051] Figure 5 Results of specific nucleic acid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus using the CRISPR-Cas12a system in the examples of the present invention. Detailed implementation manners

[0052] The following further describes the present invention in detail with reference to examples, so that those skilled in the art can implement it according to the description in the specification.

[0053] It should be understood that terms such as "having", "comprising", and "including" used herein do not exclude the presence or addition of one or more other elements or their combinations.

[0054] The present invention provides a method for rapid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus. The overall technical schematic diagram of the present invention is as shown in the appendix Figure 1 shown. First, inactivate the test sample to release the nucleic acids of the unique nuc1 gene of Staphylococcus aureus and the unique mecA gene of methicillin-resistant Staphylococcus aureus in the test sample; then, under constant temperature conditions, perform loop-mediated isothermal amplification (LAMP) on the nucleic acids of the nuc1 gene and mecA gene; then bind and cleave the target dsDNA (nuc1 gene or mecA gene) with the Cas12a-crRNA complex. At the same time, its trans-cleavage activity on ssDNA is activated to cleave the ssDNA fluorescent probe; after the ssDNA fluorescent probe is cleaved, the fluorescent reporter molecule is separated from the fluorescent quenching group, generating a fluorescent signal; by detecting the fluorescent signal, it can be determined whether the test sample contains Staphylococcus aureus or methicillin-resistant Staphylococcus aureus.

[0055] Specifically, a rapid nucleic acid detection method for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus of the present invention includes the following steps:

[0056] 1) Nucleic acid extraction of the sample to be tested: Take the sample to be tested, centrifuge and remove the supernatant, add TE solution, mix well, centrifuge and remove the supernatant, add lysozyme and Triton X-100, mix well, and react at 37 °C to obtain the nucleic acid extract of the sample to be tested.

[0057] 2) Isothermal nucleic acid amplification:

[0058] Add the nucleic acid extract obtained in step 1) to the isothermal amplification system, and perform an isothermal reaction at 65 °C to amplify the nuc1 gene specific to Staphylococcus aureus or the mecA gene specific to methicillin-resistant Staphylococcus aureus.

[0059] The isothermal amplification system includes an amplification primer set for the nuc1 gene, an amplification primer set for the mecA gene, Primer mix, Isothermo Buffer, Mg 2+ , dNTP, H2O, polymerase, etc.

[0060] 3) Detection of the amplification product:

[0061] Add the product amplified in step 2) to the CRISPR-Cas12a system, mix well and react at 37 °C, and detect the fluorescence of the reaction, where the excitation wavelength is 485 nm and the emission wavelength is 520 nm;

[0062] Use the CRISPR-Cas12a system to detect the amplified nuc1 gene or mecA gene. In the CRISPR-Cas12a system, the nuc1 gene is detected with nuc1-crRNA, and the mecA gene is detected with mecA-crRNA;

[0063] The CRISPR-Cas12a system also includes LaCas12a, ssDNA fluorescent probe, TOLO Buffer, H2O, etc.

[0064] The present invention also provides a rapid nucleic acid detection kit for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, including the above-mentioned isothermal amplification system and CRISPR-Cas12a system. Based on this kit, the rapid detection of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus can be achieved by using the above method.

[0065] The above is the overall concept of the present invention. The following provides more detailed embodiments to further illustrate the present invention.

[0066] Description of the source of reagents:

[0067] The Bst 3.0 DNA polymerase, 10X amplification buffer, and 100 mM MgSO4 required for the LAMP nucleic acid isothermal amplification reaction were purchased from Harbin Xinhai Gene Detection Co., Ltd. The 10 mM dNTP was purchased from Sangon Biotech (Shanghai) Co., Ltd. The amplification primers were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.; the nuc1 gene and mecA gene were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the crRNA and ssDNA-FQ were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.; conventional reagents such as lysozyme, NaCl, Triton X-100, Tris-HCl, EDTA, etc. were purchased from Sangon Biotech (Shanghai) Co., Ltd.; the LbCas12a protein and reaction buffer were purchased from Tolo Biotechnology Co., Ltd.

[0068] Example 1 Detection of synthetic nuc1 gene and mecA gene using the CRISPR-Cas12a system

[0069] 1-1. Artificial synthesis of nuc1 gene and mecA gene

[0070] In this example, the specific genes of Staphylococcus aureus nuc1 and methicillin-resistant Staphylococcus aureus mecA were synthesized by Sangon Biotech and cloned into the pUC57-kana vector. The sequence information of the nuc1 gene and mecA gene is shown in SEQ NO.1 and SEQ NO.2 in the following table, respectively.

[0071]

[0072]

[0073] 1-2. Preparation of crRNA

[0074] Design crRNAs targeting the nuc1 gene and mecA gene: nuc1-crRNA and mecA-crRNA, and submit them to Suzhou Genewiz Biotechnology Co., Ltd. for synthesizing RNA fragments. The sequence information is shown in the following table.

[0075]

[0076] 1-3. Preparation of ssDNA fluorescent probe

[0077] The specific sequence information of the ssDNA fluorescent probe is: 5’-6FAM-TTTATTT-3’-BHQ1, that is, ssDNA labeled with 6-carboxyfluorescein and the fluorescence quenching group BHQ1. It was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0078] 1-4. Use CRISPR-Cas12a system to detect nuc1 gene and mecA gene, using 20μL system, the components are as follows

[0079] Component Dosage sample 10 μL 10×TOLO Buffer 3 2 μL LaCas12a (0.5 μM) 1 μL crRNA (0.5 μM) 1 μL ssDNA-FQ (5 μM) 1 μL <![CDATA[H20(RNase free)]]> 5 μL

[0080] 1-5. Full wavelength microplate reader fluorescence detection

[0081] In the fluorescence detection of the microplate reader, CRISPR-Cas12a added 2μL10×TOLOBuffer 3, 1μL LaCas12a (0.5μM), 1μL nuc1-crRNA (0.5μM) or mecA-crRNA (0.5μM), 1μL ssDNA-FQ (5μM), 10μL dsDNA sample and 5μL H20 (RNase free) to the target gene detection system in sequence. After the components were mixed evenly, they were reacted at 37°C for 30 minutes. The full-wavelength microplate reader Synergy H1 was used to measure the fluorescence of the detection reaction, with an excitation wavelength of 485nm and an emission wavelength of 520nm. The fluorescence value at 30 minutes of reaction was read as the reaction value. For different concentrations of the nuc1 gene and mecA gene, the reaction detection results are as follows Figure 2 The results show that the detection sensitivity of the CRISPR-Cas12a system for nuc1 and mecA genes can reach 10 -9 M level, that is, nM level.

[0082] Example 2 Detection of nuc1 and mecA genes after LAMP amplification using CRISPR-Cas12a system

[0083] 2-1. Preparation of primers for LAMP nucleic acid isothermal amplification

[0084] According to the sequence information of nuc1 gene and mecA gene, the corresponding primer sets for amplification of nuc1 gene and mecA were designed and synthesized by Suzhou Hongxun Biotechnology Co., Ltd. The sequence information of the primers is shown in the following table.

[0085]

[0086]

[0087] 2-2. Amplification of nuc1 gene and mecA gene using LAMP nucleic acid isothermal amplification technology

[0088] A 25-μL reaction system was adopted, and the specific components and dosages were as follows. Among them, Primer mix was FIP / BIP (16 μM), F3 / B3 (2 μM), and FLP / BLP (4 μM). 2.5 μL of Primer mix, 2.5 μL of 10×Isothermo Buffer (Mg 2+ free), 2 μL of 100 mM Mg 2+ , 3.5 μL of dNTP (10 mM each), 3.5 μL of H2O, 10 μL of sample, and 1 μL of Bst 3.0 DNA / RNA Polymerase (8 U / μL) were added to the amplification reaction system in this order. After mixing all components evenly, the reaction was carried out at 65 °C for 60 min.

[0089] Component Dosage Primer mix 2.5 μL Bst 3.0 DNA / RNA Polymerase (8 U / μL) 1 μL <![CDATA[10×Isothermo Buffer (Mg 2+ free)]]> 2.5 μL <![CDATA[100mM Mg 2+ > 2 μL dNTP (10 mM each) 3.5 μL sample 10 μL <![CDATA[H2O]]> 3.5 μL

[0090] 2-3. Detection of nuc1 gene and mecA gene after LAMP amplification using the CRISPR-Cas12a system

[0091] Using 10 μL of the product after LAMP amplification as the detection object, CRISPR-Cas12a nucleic acid detection was carried out. Among them, the nuc1 gene was detected using nuc1-crRNA, and the mecA gene was detected using mecA-crRNA. The specific detection scheme was as shown in 1-5 of Example 1; for the different initial concentrations of the nuc1 gene and mecA gene, the reaction detection results were as Figure 3 shown; the results showed that after LAMP amplification, the detection sensitivity of the CRISPR-Cas12a system to the nuc1 gene and mecA gene could both reach 10 -18 M level, that is, aM level.

[0092] Example 3. Nucleic acid detection of different concentrations of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus using the CRISPR-Cas12a system

[0093] 3-1. Rapid nucleic acid extraction of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus

[0094] Take 1 mL of bacterial liquid, centrifuge at 8000 g for 2 minutes, remove 900 μL of the supernatant, add 900 μL of TE solution, mix well, centrifuge at 8000 g for 2 minutes, remove 920 μL of the supernatant, add 10 μL of 20 mg / mL lysozyme and 10 μL of 10% Triton X-100, mix well, and react at 37 °C for 15 minutes. The resulting solution is the rapid nucleic acid extraction solution.

[0095] 3-2. Isothermal amplification and detection of nucleic acids of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus

[0096] Using 10 μL of nucleic acid rapid extraction solution as the amplification template, nucleic acid isothermal amplification is carried out according to the method of 2-2 in Example 2. Among them, the amplification primer of the nuc1 gene is used to amplify the nucleic acid of Staphylococcus aureus, and the amplification primer of the mecA gene is used to amplify the nucleic acid of methicillin-resistant Staphylococcus aureus; after amplification, nucleic acid detection is carried out according to the method of 2-3; for different initial concentrations of Staphylococcus aureus (29213) or methicillin-resistant Staphylococcus aureus (43300), the reaction detection results are as Figure 4 shown; the results show that the method adopted in the present invention can achieve a detection sensitivity of 10 CFU / mL for both Staphylococcus aureus (29213) and methicillin-resistant Staphylococcus aureus (43300), and the sensitivity is very high.

[0097] Example 4 Specific nucleic acid detection of Staphylococcus aureus or methicillin-resistant Staphylococcus aureus using the CRISPR-Cas12a system

[0098] 4-1. In this embodiment, in order to detect whether the CRISPR-Cas12a system can perform specific nucleic acid detection on Staphylococcus aureus or methicillin-resistant Staphylococcus aureus, and whether Staphylococcus aureus or methicillin-resistant Staphylococcus aureus can be detected in the mixed bacterial solution, the following detections are carried out.

[0099] 4-2. Staphylococcus aureus (29213) or methicillin-resistant Staphylococcus aureus (43300) and Escherichia coli (25922) are mixed in different proportions to obtain test samples with the proportions of Staphylococcus aureus or methicillin-resistant Staphylococcus aureus being 100%, 10%, 5%, 1%, and 0% respectively. Nucleic acid extraction is carried out according to the method of 3-1 in Example 3, and nucleic acid amplification and nucleic acid detection are carried out according to the method of 3-2; for different proportions of Staphylococcus aureus (29213) or methicillin-resistant Staphylococcus aureus (43300) in the mixed bacterial solution, the reaction detection results are as Figure 4 shown (control is a bacteria-free blank control); the results show that the method adopted in the present invention has very high specificity for the detection of Staphylococcus aureus (29213) and methicillin-resistant Staphylococcus aureus (43300), and can detect 1% content of Staphylococcus aureus or methicillin-resistant Staphylococcus aureus.

[0100] Although the embodiments of the present invention have been disclosed as above, they are not limited to only the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the field, additional modifications can be easily made. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to specific details. Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences Title of Invention: Rapid Detection Method and Kit for Nucleic Acids of Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus Serial Number Name Sequence (5’ to 3’) SEQ No. 1 ATAAATCGCTTGCTATGATTGTGGTAGCCATCATTATTGTAGGTGTATTAGCATTTCAATTTATGAATCATACGGGTCCTTTCAAAAAGGGAACAAATCATGAAACTGTACAAGATTTAAATGGTAAAGATAAAGTACATGTTCAAAGAGTTGTGGATGGTGATACATTTATTGCAAATCAAAATGGTAAAGAAATTAAAGTTAGGCTTATAGGGGTTGATACGCCAGAAACGGTGAAACCGAATACGCCTGTACAACCATTTGGCAAAGAAGCATCGAATTATAGTAAGAAGACATTAACAAATCAAGATGTTTATTTAGAATATGATAAAGAAAAACAAGATCGCTATGGTAGAACATTGGCGTATGTATGGAT SEQ No. 2 GGATCAAAATTGGGTACAAGATGATACCTTCGTTCCACTTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGTCGTAACTATCCTCTAGGAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATGAAGATGTCCAACATGAAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGATGGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGGTACTGCTATCCACCCTC SEQ No. 3 UAAUUUCUACUAAGUGUAGAUAAUGGUAAAGAUAAAGUACA SEQ No. 4 UAAUUUCUACUAAGUGUAGAUCCAAUAACUGCAUCAUCUUU SEQ No. 5 TCGCTTGCTATGATTGTGG SEQ No. 6 ACATACGCCAATGTTCTACC SEQ No. 7 GTACAGTTTCATGATTCGTCCCGCCATCATTATTGTAGGTGT SEQ No. 8 TGTTCAAAGAGTTGTGGATGGTGTACAGGCGTATTCGGTT SEQ No. 9 TTGAAAGGACCCGTATGATTCA SEQ No. 10 GATACGCCAGAAACGGTGA SEQ No. 11 GGTACAAGATGATACCTTCGTT SEQ No. 12 ATAGCAGTACCTGAGCCAT SEQ No. 13 TCTTCAGAGTTAATGGGACCAAACAGAAAGTCGTAACTATCCTC SEQ No. 14 AAGCTCCAACATGAAGATGGCTTGTATGTGCGATTGTATTGC SEQ No. 15 ACCTAATAGATGTGAAGTCGCT SEQ No. 16 CGTGTCACAATCGTTGACG

Claims

1. A rapid nucleic acid detection method for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, characterized in that, It includes the following steps: 1) Nucleic acid extraction of the sample to be tested; 2) Nucleic acid amplification: Using a nucleic acid amplification system to amplify the nucleic acid of the nuc1 gene specific to Staphylococcus aureus or the mecA gene specific to methicillin-resistant Staphylococcus aureus; 3) Detection of the amplification product: Using the CRISPR-Cas12a system to detect the amplified nuc1 gene or mecA gene. In the CRISPR-Cas12a system, the nuc1 gene is detected with nuc1-crRNA, and the mecA gene is detected with mecA-crRNA; The sequence of nuc1-crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUAAUGGUAAAGAUAAAGUACA-3’; The sequence of mecA-crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCCAAUAACUGCAUCAUCUUU-3’; In step 2), loop-mediated isothermal nucleic acid amplification method is used for nucleic acid amplification. The nucleic acid amplification system includes an amplification primer set for the nuc1 gene and an amplification primer set for the mecA gene; The amplification primer set for the nuc1 gene includes: nuc1-F3: 5’-TCGCTTGCTATGATTGTGG-3’; nuc1-B3: 5’-ACATACGCCAATGTTCTACC-3’; nuc1-FIP: 5’-GTACAGTTTCATGATTCGTCCCGCCATCATTATTGTAGGTGT-3’; nuc1-BIP: 5’-TGTTCAAAGAGTTGTGGATGGTGTACAGGCGTATTCGGTT-3’; nuc1-FLP: 5’-TTGAAAGGACCCGTATGATTCA-3’; nuc1-BLP: 5’-GATACGCCAGAAACGGTGA-3’; The amplification primer set for the mecA gene includes: mecA-F3: 5’-GGTACAAGATGATACCTTCGTT-3’; mecA-B3: 5’-ATAGCAGTACCTGAGCCAT-3’; mecA-FIP: 5’-TCTTCAGAGTTAATGGGACCAAACAGAAAGTCGTAACTATCCTC-3’; mecA-BIP: 5’-AAGCTCCAACATGAAGATGGCTTGTATGTGCGATTGTATTGC-3’; mecA-FLP: 5’-ACCTAATAGATGTGAAGTCGCT-3’; mecA-BLP: 5’-CGTGTCACAATCGTTGACG-3’; The CRISPR-Cas12a system also includes LaCas12a and an ssDNA fluorescent probe, and the sequence of the ssDNA fluorescent probe is: 5'-6FAM-TTTATTT-3'-BHQ1; In the step 1), nucleic acid extraction is performed by enzymatic digestion. The specific method is as follows: Take the sample to be tested, centrifuge and remove the supernatant, add TE solution, mix well, centrifuge and remove the supernatant, add lysozyme and Triton X-100, mix well, react at 37 °C to obtain the nucleic acid extract of the sample to be tested; The isothermal amplification system also includes Primer mix, Isothermo Buffer, Mg 2+ , dNTP, H2O and polymerase; In the step 1), nucleic acid extraction is performed by enzymatic digestion; The step 2) includes: adding the nucleic acid extract obtained in the step 1) into a constant temperature amplification system, and performing a constant temperature reaction at 55-70 °C to amplify the nuc1 gene or the mecA gene; The step 3) includes: adding the product amplified in the step 2) into the CRISPR-Cas12a system, mixing evenly and reacting at 26-42 °C, and detecting the fluorescence of the reaction, wherein the excitation wavelength is 475-495 nm and the emission wavelength is 510-530 nm; Among them, the CRISPR-Cas12a system includes LaCas12a, an ssDNA fluorescent probe, nuc1-crRNA or mecA-crRNA, TOLO Buffer and H2O.

2. A rapid nucleic acid detection kit for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, characterized in that, It includes the nucleic acid amplification system and the CRISPR-Cas12a system as described in claim 1.

Images