A fluorescent biosensor for detecting chloramphenicol and a method for detecting chloramphenicol using the same

Abstract

The present invention relates to a fluorescent biosensor for detecting chloramphenicol, including raw materials: superparamagnetic Fe3O4@SiO2 nanoparticles, BSA-AuNCs, nucleic acid aptamer Apt, output chain, DNA1, DNA2, waste chain W, fuel chain F, HP1 hairpin, HP2 hairpin; the sequences of nucleic acid aptamer Apt, output chain, DNA1, DNA2, waste chain W and fuel chain F are shown in SEQ ID No.1-6, and the sequences of HP1 hairpin and HP2 hairpin are shown in SEQ ID No.7-8. The present invention utilizes the entropy-driven and catalytic hairpin self-assembly amplification strategy of DNA, and adopts Fe3O4@SiO2 as a superparamagnetic material for identifying and extracting a target object and the fluorescence intensity signal of BSA-AuNCs to detect chloramphenicol. The sensor has mild reaction conditions, fast reaction speed, high detection sensitivity, simple method and low cost.

Description

Technical Field

[0001] The invention belongs to the technical field of analysis and detection, and particularly relates to a fluorescent biosensor for detecting chloramphenicol and a method for detecting chloramphenicol using the same. Background Art

[0002] Chloramphenicol (CAP), also known as levomycin, is an amide antibiotic that can effectively inhibit pathogenic microorganisms such as anthrax bacteria, pneumococcus, streptococcus, listeria, staphylococcus, chlamydia, and rickettsia, and is widely used in the medical and health industry, livestock and poultry breeding industry, and agricultural production industry. However, CAP has significant toxic side effects on the human body, mainly manifested as: inhibiting bone marrow hematopoietic function, causing aplastic anemia, cytopenic anemia, thrombocytopenia, and granulocytopenia. As people pay more and more attention to health, highly sensitive detection of CAP is of great significance.

[0003] Because the concentration of chloramphenicol in the environmental medium of our life is relatively low, therefore the method for detecting its content is generally a micro or trace method, and several commonly used methods for detecting chloramphenicol have: high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-mass spectrometry) and liquid chromatography-tandem mass spectrometry (LC-MS / MS), and antibody-based technology. Although these detection techniques can detect the concentration content of chloramphenicol, the instrumentation required for detection is expensive and the operation steps are various. Therefore, it is urgent to develop a simple, fast, highly sensitive, low-cost, high-precision analytical method that can realize the rapid quantitative detection of chloramphenicol. Summary of the invention

[0004] The purpose of the present invention is to solve the above-mentioned deficiencies in the prior art and to provide a fluorescent biosensor for detecting chloramphenicol and a method for detecting chloramphenicol using the same.

[0005] Technical Solution

[0006] The present invention constructs a simple and highly sensitive fluorescent chemical biosensor. It uses the entropy-driven and catalytic hairpin self-assembly amplification strategy of DNA, Fe3O4@SiO2 as a superparamagnetic material for identifying and extracting targets, and the fluorescence intensity signal of BSA-AuNCs to detect chloramphenicol. This fluorescent chemical biosensor strategy benefits from the unique entropy-driven principle, and the number of base pairs of the DNA chain before and after the entropy-driven cyclic amplification reaction can remain unchanged. Therefore, interference from other nucleic acids and complex environments can be avoided, and good stability is shown. The specific scheme is as follows:

[0007] A fluorescent biosensor for detecting chloramphenicol, comprising raw materials: superparamagnetic Fe3O4@SiO2 nanoparticles, BSA-AuNCs (BSA modified nanogold clusters), nucleic acid aptamer Apt, output chain, DNA1, DNA2, waste chain W, fuel chain F, HP1 hairpin, HP2 hairpin;

[0008] The sequence of the nucleic acid aptamer Apt is shown in SEQ ID No. 1, the sequences of the output strand, DNA1, DNA2, waste strand W and fuel strand F are shown in SEQ ID No. 2-6, respectively, and the sequences of the HP1 hairpin and HP2 hairpin are shown in SEQ ID No. 7-8, respectively.

[0009] Furthermore, the preparation method of the superparamagnetic Fe3O4@SiO2 nanoparticles comprises the following steps:

[0010] 1) Weigh 1g NaOH and put it into a 100mL three-necked flask, add 10mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, react at 120℃ for 1h, then cool to 70℃ to obtain a NaOH / DEG solution, seal it and store it in a 65℃ oven;

[0011] 2) Add 0.288g acrylic resin and 0.065g ferric chloride to a three-necked flask, then add 15mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, heat to 220°C and stir to react for 1h, then add 1.8mL NaOH / DEG solution, react for 1h, cool to room temperature, add the reaction product to ethanol, centrifuge to remove the supernatant, wash the solid product and transfer it to a 10mL centrifuge tube, add water to 4mL, perform magnetic absorption, add the magnetic absorption product to 3mL water to obtain a ferroferric oxide dispersion;

[0012] 3) Pipette 20 mL of ethanol into a three-necked flask, and then ultrasonicate for 1 minute before rapidly dropping the ferroferric oxide dispersion. After the dropping is complete, react for 1 minute, then add 1 mL of ammonia water, and after reacting for 1 minute, add 60 microliters of tetraethoxysilane. After reacting for 30 minutes, centrifuge the obtained reaction solution and remove the supernatant. After washing, the obtained solid product is superparamagnetic Fe3O4@SiO2 nanoparticles, which are stored in 3-5 mL of ethanol.

[0013] Furthermore, the preparation method of BSA-AuNCs is as follows: under stirring, 5 mL of HAuCl4 aqueous solution with a temperature of 37°C and a concentration of 10 mM is added to 5 mL of BSA solution with a temperature of 37°C and a concentration of 50 mg / mL; after stirring for 2 minutes, 0.5 mL of 1 M NaOH solution is added, and the mixture is incubated at 37°C for 12 hours, and then placed in a dialysis membrane with a molecular weight cutoff of 10 kDa, and dialyzed with ultrapure water at room temperature with continuous stirring, the water is changed three times within 24 hours, and the contents of the dialysis membrane are collected, which is BSA-AuNCs.

[0014] The method for detecting chloramphenicol using the above fluorescent biosensor comprises the following steps:

[0015] (1) coupling the nucleic acid aptamer Apt to superparamagnetic Fe3O4@SiO2 nanoparticles to obtain Fe3O4@SiO2-Apt, mixing 40 μL of Fe3O4@SiO2-Apt, 40 μL of output chain and 280 μL of 10 mM PBS buffer at pH 7.4, adding 40 μL of chloramphenicol standard solution or test solution of a series of concentrations to the obtained mixture, respectively, and obtaining a series of No. 1 solutions after magnetic extraction;

[0016] (2) 10 μL of DNA1, DNA2 and waste chain W, all with a concentration of 10 μmol / L, were mixed evenly, heated at 95°C for 5 min, cooled to 4°C, then added with solution 1, reacted at 25°C for 2 h, then added with 10 μL of fuel chain F with a concentration of 5 μmol / L, reacted at 25°C for 2 h, and then added with 20 μL of 10 uM T-Hg 2+ -T hairpin structure and 20 μL, 10 uM HP2 hairpin, react at room temperature for 2 h, extract by magnetic force, add 200 μL BSA-AuNCs to the obtained solution, and detect the fluorescence intensity;

[0017] (3) Based on the series of chloramphenicol solutions and the corresponding fluorescence intensities, a standard curve of chloramphenicol concentration-fluorescence intensity is drawn to calculate the concentration of chloramphenicol in the test solution.

[0018] In step (2), T-Hg 2+ Preparation method of -T hairpin: 40 μL of 1uM HP1, 80 μL of 2.5uM Hg 2+ and 280 μL of 10 mM PBS buffer at pH 7.4 were mixed at room temperature to obtain T-Hg 2+ -T hairpin structure.

[0019] Further, in step (1), the preparation method of Fe3O4@SiO2-Apt is as follows: 500 μL Fe3O4@SiO2, 30mL ethanol and 50μL APTES (3-aminopropyltriethoxysilane) were mixed, nitrogen was introduced, and the mixture was heated at 80°C for 3h. The resulting product was washed with ethanol and water, respectively, to obtain Fe3O4@SiO2-NH2 particles, which were dispersed in 200μL water to obtain Fe3O4@SiO2 suspension. 200μL of 0.1mol / L EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) and 200μL of 0.1mol / L NHS (N-hydroxysuccinimide) were added to 20μL of 10μmol / L Apt solution, and the mixture was reacted at 25°C for 3h. Then, the Fe3O4@SiO2 suspension was added and the mixture was reacted at 25°C for 4h to obtain Fe3O4@SiO2-Apt.

[0020] Furthermore, in step (1), the concentration of the series of chloramphenicol standard solutions is 0-100 nM.

[0021] Furthermore, in step (2), when detecting the fluorescence intensity, the excitation wavelength is 370 nm.

[0022] Working mechanism of the fluorescent biosensor of the present invention:

[0023] When a low concentration of the detection target CAP is added to react for a certain period of time (Fe3O4@SiO2-Apt-output chain), a certain amount of output chain can be released, and the low concentration target output chain can effectively trigger the entropy-driven signal amplification system. Specifically, the (DNA1+waste chain W+DNA2) three-chain composite structure contains a part that is completely complementary to the output chain. It can combine with the output chain to produce (DNA1+waste chain W+output chain) and release (DNA2) to open (HP1) and release mercury ions. When the fuel chain F is introduced to completely combine with the support chain in the composite structure of (DNA1+waste chain W+output chain, the output chain is released, triggering a new round of entropy-driven signal amplification process. Because the number of base pairs in each amplification cycle of the entire system does not change, this is entropy-driven. The released DNA2 combines with HP1 to open HP1's T-Hg 2+ -T hairpin structure, releases free mercury ions, adds HP2, releases DNA2 on HP1, and continues to open HP1 to achieve the effect of releasing more mercury ions.

[0024] Beneficial effects of the present invention:

[0025] The present invention constructs a simple and highly sensitive fluorescent biosensor, which uses the entropy-driven and catalytic hairpin self-assembly amplification strategy of DNA, and uses Fe3O4@SiO2 as a superparamagnetic material for identifying and extracting the target and the fluorescence intensity signal of BSA-AuNCs to detect chloramphenicol. The sensor has mild reaction conditions, fast reaction speed, reduced operation complexity, high detection sensitivity, simple detection method, low cost, etc., and the noble metal nanoclusters used have excellent optical properties, good photostability and biocompatibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the fluorescence spectrum corresponding to chloramphenicol solution at different concentrations;

[0027] Figure 2 This is the standard curve of the fluorescent biosensor of the present invention for detecting chloramphenicol. DETAILED DESCRIPTION

[0028] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0029] Example 1

[0030] A fluorescent biosensor for detecting chloramphenicol, comprising raw materials: superparamagnetic Fe3O4@SiO2 nanoparticles, BSA-AuNCs (BSA modified nanogold clusters), nucleic acid aptamer Apt, output chain, DNA1, DNA2, waste chain W, fuel chain F, HP1 hairpin, HP2 hairpin;

[0031] The sequence of the nucleic acid aptamer Apt is shown in SEQ ID No. 1, the sequences of the output strand, DNA1, DNA2, waste strand W and fuel strand F are shown in SEQ ID No. 2-6, respectively, and the sequences of the HP1 hairpin and HP2 hairpin are shown in SEQ ID No. 7-8, respectively. The corresponding sequences are shown in Table 1:

[0032] Table 1

[0033]

[0034] The preparation method of the superparamagnetic Fe3O4@SiO2 nanoparticles comprises the following steps:

[0035] 1) Weigh 1g NaOH and put it into a 100mL three-necked flask, add 10mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, react at 120℃ for 1h, then cool to 70℃ to obtain a NaOH / DEG solution, seal it and store it in a 65℃ oven;

[0036] 2) Add 0.288g acrylic resin and 0.065g ferric chloride to a three-necked flask, then add 15mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, heat to 220°C and stir to react for 1h, then add 1.8mL NaOH / DEG solution, react for 1h, cool to room temperature, add the reaction product to ethanol, centrifuge at 8000r for 3min to remove the supernatant, wash the solid product and transfer it to a 10mL centrifuge tube, add water to 4mL, perform magnetic absorption, add the magnetic absorption product to 3mL water to obtain a ferroferric oxide dispersion;

[0037] 3) Pipette 20 mL of ethanol into a three-necked flask, and then ultrasonicate for 1 minute before rapidly dropping the ferroferric oxide dispersion. After the dropping is complete, react for 1 minute, then add 1 mL of ammonia water, and after reacting for 1 minute, add 60 microliters of tetraethoxysilane. After reacting for 30 minutes, centrifuge the obtained reaction solution and remove the supernatant. After washing, the obtained solid product is superparamagnetic Fe3O4@SiO2 nanoparticles, which are stored in 3-5 mL of ethanol.

[0038] The preparation method of the BSA-AuNCs is as follows: under stirring, 5 mL of a HAuCl4 aqueous solution with a temperature of 37° C. and a concentration of 10 mM is added to 5 mL of a BSA solution with a temperature of 37° C. and a concentration of 50 mg / mL; after stirring for 2 minutes, 0.5 mL of a 1 M NaOH solution is added, and the mixture is incubated at 37° C. for 12 hours; then, the mixture is placed in a dialysis membrane with a molecular weight cutoff of 10 kDa, and dialyzed with ultrapure water at room temperature with continuous stirring, the water is changed three times within 24 hours, and the contents of the dialysis membrane are collected, which is BSA-AuNCs.

[0039] Example 2

[0040] Detection of different concentrations of chloramphenicol:

[0041] (1) The nucleic acid aptamer Apt was coupled to superparamagnetic Fe3O4@SiO2 nanoparticles to obtain Fe3O4@SiO2-Apt, 40 μL of Fe3O4@SiO2-Apt, 40 μL of output chain and 280 μL of 10 mM PBS buffer at pH 7.4 were mixed, and 40 μL of a series of concentrations of chloramphenicol standard solutions (0, 500 pM, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 40 nM, 60 nM, 80 nM, 100 nM) were added to the obtained mixture, and a series of No. 1 solutions were obtained after magnetic extraction;

[0042] The preparation method of the Fe3O4@SiO2-Apt is as follows: 500 μL of Fe3O4@SiO2, 30 mL of ethanol and 50 μL of APTES (3-aminopropyltriethoxysilane) are mixed, nitrogen is introduced, and the mixture is heated at 80°C for 3 hours. The resulting product is washed twice with ethanol and water respectively to obtain Fe3O4@SiO2-NH2 particles, which are dispersed in 200 μL of water to obtain a Fe3O4@SiO2 suspension; 200 μL of 0.1 mol / L EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) and 200 μL of 0.1 mol / L NHS (N-hydroxysuccinimide) are added to 20 μL of 10 μmol / L Apt solution, the mixture is reacted at 25°C for 3 hours, and then the Fe3O4@SiO2 suspension is added, and the mixture is reacted at 25°C for 4 hours to obtain Fe3O4@SiO2-Apt.

[0043] (2) 10 μL of DNA1, DNA2 and waste chain W, all with a concentration of 10 μmol / L, were mixed evenly, heated at 95°C for 5 min, cooled to 4°C, then added with solution 1, reacted at 25°C for 2 h, then added with 10 μL of fuel chain F with a concentration of 5 μmol / L, reacted at 25°C for 2 h, and then added with 20 μL of 10 uM T-Hg 2+ -T hairpin structure and 20 μL, 10 uM HP2 hairpin, react at room temperature for 2 h, extract by magnetic force, add 200 μL BSA-AuNCs to the obtained solution, and detect the fluorescence intensity;

[0044] T-Hg 2+ Preparation method of -T hairpin: 40 μL of 1uM HP1, 80 μL of 2.5uM Hg 2+ and 280 μL of 10 mM PBS buffer at pH 7.4 were mixed at room temperature to obtain T-Hg 2+ -T hairpin structure;

[0045] (3) Based on the series of chloramphenicol solutions and the corresponding fluorescence intensities, a standard curve of chloramphenicol concentration-fluorescence intensity was drawn. The fluorescence spectra corresponding to chloramphenicol solutions at different concentrations are shown in Figure 1 , with fluorescence intensity as the ordinate (I-I0 as the ordinate, where I0 represents the fluorescence intensity without chloramphenicol, and I represents the fluorescence intensity corresponding to the chloramphenicol concentration), and the logarithm of the chloramphenicol concentration as the ordinate, a standard curve was obtained, see Figure 2 .

[0046] Example 3

[0047] Comparison of HPLC, GC-MS, DPV, LSV and the fluorescent biosensor of Example 1 of the present invention in detecting chloramphenicol solutions at different concentrations, the test results are shown in Table 2:

[0048] Table 2

[0049]

[0050] It can be seen from Table 2 that the fluorescent biosensor of Example 1 of the present invention has a lower detection limit.

[0051] Sequence Listing:

[0052] SEQ ID No.1

[0053] The sequence of nucleic acid aptamer Apt

[0054] acttcagtgagttgtcccacggtcggcgagtcggtggtag

[0055] SEQ ID No.2

[0056] Output chain sequence

[0057] ctaccaccgactcgacaagact

[0058] SEQ ID No.3

[0059] Sequence of DNA1

[0060] ctggtgtagaaactaccaccgactcgac

[0061] SEQ ID No.4

[0062] Sequence of DNA2

[0063] agtcttgtcgagtcggtggtagtttcgggaaattggggtag

[0064] SEQ ID No.5

[0065] Sequence of waste chain W

[0066] ctaccccaatttccc

[0067] SEQ ID No.6

[0068] Fuel Chain F Sequence

[0069] ctaccccaatttcccgaaactaccaccgactcgac

[0070] SEQ ID No.7

[0071] Sequence of HP1 hairpin

[0072] atcttttttggtggtagtttctacacttttttggtatt

[0073] SEQ ID No.8

[0074] Sequence of HP2 hairpin

[0075] ataccaaaaaagtgtagaaactacccacttttttgga Sequence Listing <110> Changzhou University <120> A fluorescent biosensor for detecting chloramphenicol and a method for detecting chloramphenicol using the same <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> DNA <213> Chloramphenicol <400> 1 acttcagtga gttgtcccac ggtcggcgag tcggtggtag 40 <210> 2 <211> twenty two <212> DNA <213> Chloramphenicol <400> 2 ctaccaccga ctcgacaaga ct 22 <210> 3 <211> 28 <212> DNA <213> Chloramphenicol <400> 3 ctggtgtaga aactaccacc gactcgac 28 <210> 4 <211> 41 <212> DNA <213> Chloramphenicol <400> 4 agtcttgtcg agtcggtggt agtttcggga aattggggta g 41 <210> 5 <211> 15 <212> DNA <213> Chloramphenicol <400> 5 ctaccccaat ttccc 15 <210> 6 <211> 35 <212> DNA <213> Chloramphenicol <400> 6 ctaccccaat ttcccgaaac taccaccgac tcgac 35 <210> 7 <211> 38 <212> DNA <213> Chloramphenicol <400> 7 atcttttttg gtggtagttt ctacactttt ttggtatt 38 <210> 8 <211> 36 <212> DNA <213> Chloramphenicol <400> 8 ataccaaaaa agtgtagaaa ctaccacttttttgga 36

Claims

1. A fluorescent biosensor for detecting chloramphenicol, characterized in that: Including raw materials: superparamagnetic Fe3O4@SiO2 nanoparticles, BSA-AuNCs, nucleic acid aptamer Apt, output chain, DNA1, DNA2, waste chain W, fuel chain F, HP1 hairpin, HP2 hairpin; The sequence of the nucleic acid aptamer Apt is shown in SEQ ID No. 1, the sequences of the output strand, DNA1, DNA2, waste strand W and fuel strand F are shown in SEQ ID No. 2-6, respectively, and the sequences of the HP1 hairpin and HP2 hairpin are shown in SEQ ID No. 7-8, respectively; The preparation method of the superparamagnetic Fe3O4@SiO2 nanoparticles comprises the following steps: 1) Weigh 1g NaOH and put it into a 100mL three-necked flask, add 10mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, react at 120℃ for 1h, then cool to 70℃ to obtain a NaOH / DEG solution, seal it and store it in a 65℃ oven; 2) Add 0.288 g acrylic resin and 0.065 g ferric chloride into a three-necked flask, then add 15 mL diethylene glycol, set up a condensing reflux device, pass nitrogen protection, heat to 220 ° C and stir to react for 1 hour, then add 1.8 mL NaOH / DEG solution, react for 1 hour, cool to room temperature, add the reaction product to ethanol, centrifuge at 8000 r for 3 min to remove the supernatant, wash the solid product and transfer it to a 10 mL centrifuge tube, add water to 4 mL, and magnetically absorb it. Add the magnetically absorbed product to 3 mL of water to obtain a ferroferric oxide dispersion; 3) Pipette 20 mL of ethanol into a three-necked flask, and then ultrasonicate for 1 minute before rapidly dropping the ferroferric oxide dispersion. After the addition is complete, react for 1 minute, then add 1 mL of ammonia water, and after reacting for 1 minute, add 60 microliters of tetraethoxysilane. After reacting for 30 minutes, centrifuge the obtained reaction solution and remove the supernatant. After washing the obtained solid product, it is superparamagnetic Fe3O4@SiO2 nanoparticles, which are stored in 3-5 mL of ethanol; The preparation method of the BSA-AuNCs is as follows: under stirring, 5 mL of HAuCl4 aqueous solution with a temperature of 37°C and a concentration of 10 mM is added to 5 mL of BSA solution with a temperature of 37°C and a concentration of 50 mg / mL, and after stirring for 2 minutes, 0.5 mL of 1M NaOH solution is added, and the mixture is incubated at 37°C for 12 hours, and then placed in a dialysis membrane with a molecular weight cutoff of 10 kDa, and dialyzed with ultrapure water at room temperature with continuous stirring, the water is changed three times within 24 hours, and the contents of the dialysis membrane are collected, which is BSA-AuNCs.

2. A method for detecting chloramphenicol using the fluorescent biosensor for detecting chloramphenicol according to claim 1, characterized in that: The steps include: (1) The nucleic acid aptamer Apt was coupled to superparamagnetic Fe3O4@SiO2 nanoparticles to obtain Fe3O4@SiO2-Apt. 40 μL of Fe3O4@SiO2-Apt, 40 μL of output chain and 280 μL of 10 mM PBS buffer at pH 7.4 were mixed. 40 μL of chloramphenicol standard solution or test solution of a series of concentrations were added to the obtained mixture respectively. After magnetic extraction, a series of No. 1 solutions were obtained. (2) Take 10 μL of DNA1, DNA2 and waste chain W, all with a concentration of 10 μmol / L, and mix them evenly. Heat at 95℃ for 5 min, cool to 4℃, then add solution 1, react at 25℃ for 2 h, then add 10 μL of fuel chain F with a concentration of 5 μmol / L, react at 25℃ for 2 h, and then add 20 μL of 10uM T-Hg 2+ -T hairpin structure and 20 μL, 10 uM HP2 hairpin, react at room temperature for 2 h, extract by magnetic force, add 200 μL BSA-AuNCs to the obtained solution, and detect the fluorescence intensity; (3) Based on the series of chloramphenicol solutions and the corresponding fluorescence intensities, a standard curve of chloramphenicol concentration-fluorescence intensity is drawn to calculate the concentration of chloramphenicol in the test solution; In step (2), T-Hg 2+ Preparation of -T hairpin: 40 μL of 1uM HP1, 80 μL of 2.5uM Hg 2+ and 280 μL of 10 mM PBS buffer at pH 7.4 were mixed at room temperature to obtain T-Hg 2+ -T hairpin structure.

3. The method according to claim 2, characterized in that In step (1), the preparation method of the Fe3O4@SiO2-Apt is as follows: 500 μL of Fe3O4@SiO2, 30 mL of ethanol and 50 μL of APTES are mixed, nitrogen is introduced, and the mixture is heated at 80°C for 3 h. The obtained product is washed with ethanol and water respectively to obtain Fe3O4@SiO2-NH2 particles, which are dispersed in 200 μL of water to obtain a Fe3O4@SiO2 suspension. 200 μL of 0.1 mol / L EDC and 200 μL of 0.1 mol / L NHS were added to 20 μL of 10 μmol / L Apt solution, and reacted at 25°C for 3 h. Then, Fe3O4@SiO2 suspension was added and reacted at 25°C for 4 h to obtain Fe3O4@SiO2-Apt.

4. The method according to claim 2, characterized in that In step (1), the concentration of the series of chloramphenicol standard solutions is 0-100 nM.

5. The method according to claim 2, 3 or 4, characterized in that: In step (2), when detecting the fluorescence intensity, the excitation wavelength is 370 nm.

Images