An optical biosensor for exosome detection based on double rolling circle separation

Through the biosensor based on the CRISPR system, the dual rolling ring amplification and HCR reaction are used to solve the problem of cumbersome and expensive operation of the exosome detection method, and a fast, simple and sensitive exosome detection is achieved.

CN114609104BActive Publication Date: 2025-07-25UNIV OF JINAN
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210241161.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-11
Publication Date
2025-07-25
Estimated Expiration
2042-03-11

AI Technical Summary

Technical Problem

The existing exosome detection methods are cumbersome and expensive, making it difficult to achieve fast and accurate detection.

Method used

Using biosensors based on the CRISPR system, the specific separation and signal amplification of exosomes are achieved through double rolling loop amplification and HCR reaction using nucleotide sequence templates CT1, CT2, Connector, DNA-chol, CP1, CP2, hairpin probes H1, H2, Reporter and Cas12a, T4 DNA ligase.

Benefits of technology

It realizes fast, simple and sensitive detection of exosomes, reduces operational complexity and cost, and improves detection specificity and sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114609104B_ABST
    Figure CN114609104B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biological detection technology, and specifically relates to a biosensor for detecting exosomes based on double rolling circle separation, comprising: template CT1 with nucleotide sequences shown in SEQ NO: 1-10, template CT2, Connector, DNA-chol, CP1, CP2, hairpin probe H1, hairpin probe H2, Reporter, crRNA, and Cas12a, T4 DNA ligase; the 3'-end of the DNA-chol is modified with cholesterol; the 5'-end and 3'-end of the Reporter are respectively connected with a fluorescent reporter group and a fluorescent quenching group. This sensor has the advantages of fast detection speed, simple operation, low price, low detection limit, high specificity, etc.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a biosensor for detecting exosomes based on double rolling circle separation and a preparation method thereof. Background Art

[0002] Exosomes are membranous vesicle bodies secreted by cells with a diameter of 30-100 nm and a density of 1.10-1.18 Kg / L. Exosomes can bind to recipient cells and participate in intercellular material exchange and information communication. Proteins, nucleic acids, small molecules, etc. related to tumors contained in exosomes all have the potential to become potential biomarkers. The content of exosomes secreted by tumor cells in blood is very high, with more than 10 9 exosomes per milliliter of blood. Using exosomes as biomarkers for detection will have higher sensitivity and contribute to the early detection of cancer. Common methods for detecting exosomes include Western blot, ELISA, etc., but the operations of these methods are too cumbersome, restricting the application of rapid exosome detection. Therefore, there is an urgent need for a simple and rapid analysis method to detect exosomes.

[0003] As an adaptive immune system, CRISPR-Cas has been found in recent years that Cas12a exhibits non-specific degradation, i.e., trans-cleavage activity, after specifically recognizing DNA, and is expected to become a rapid and accurate diagnostic tool. In recent years, DNA biosensing detection technology has received extensive attention due to its high sensitivity and specificity. In particular, the opto-biosensor among them has the advantages of high sensitivity and low price. Summary of the Invention

[0004] Aiming at the problems of cumbersome operation process and high price in the existing methods, a biosensor for detecting exosomes based on the CRISPR system with high specificity, high sensitivity, low cost and fast detection speed is provided.

[0005] To achieve the above object, the present invention adopts the following technical solutions.

[0006] A biosensor for detecting exosomes based on double rolling circle separation, comprising:

[0007] Template CT1, template CT2, Connector, DNA-chol, CP1, CP2, hairpin probe H1, hairpin probe H2, Reporter, crRNA, and Cas12a, T4 DNA ligase with nucleotide sequences as shown in SEQ ID NO: 1-10;

[0008] The 3'-end of the DNA-chol is modified with cholesterol;

[0009] The 5' end and 3' end of the reporter are connected to a fluorescent reporter group and a fluorescent quencher group respectively.

[0010] Preferably, the rolling circle template CT1, rolling circle template CT2 and T4 DNA ligase are replaced by RCA1 and RCA2, and the sequences of RCA1 and RCA2 are shown in SEQ ID NOs: 12-13.

[0011] A kit comprising the above biosensor.

[0012] Preferably, the kit further comprises a buffer solution.

[0013] A method for detecting exosomes using the above biosensor or kit comprises the following steps:

[0014] (1) The rolling circle template CT1 and the rolling circle template CT2 are mixed with primers respectively and prepared under the catalysis of T4 DNA ligase to form rolling circle 1 and rolling circle 2;

[0015] (2) Rolling circle 1 or rolling circle 2 is used to prepare RCA1 or RCA2 using dNTP as substrate under the catalysis of phi29 polymerase;

[0016] (3) Mix RCA1, RCA2, the sample to be tested or exosome standard, DNA-chol, and Connector, and adjust the pH to 6.0; then add hairpin probe H1, hairpin probe H2, Cas12a, crRNA, and Reporter, mix well, incubate, and detect fluorescence.

[0017] The sequence of the primer is shown in SEQ ID NO: 11.

[0018] The exosome extraction includes the following steps: MCF-7 cells are cultured at 37°C in a humidified air containing 5% CO2, and are passaged every four days. The culture medium is MEM 4.5g / L, 10% special grade fetal bovine serum FBS, and 1% antibiotics. Cell debris is centrifuged at 2000×g for 20 min, and the cell debris is removed from the culture medium. The cells are centrifuged at 10000×g for 45 min, filtered with a 0.20 μm syringe filter, and centrifuged at 10000×g (40000 rpm) for 150 min to obtain exosomes. The exosomes are then added to PBS and stored at -80°C for use. The antibiotics are 100 U / mL penicillin and 100 μg / mL streptomycin.

[0019] The detection principle of the present invention is as follows:

[0020] like Figure 1 As shown, the biosensor uses the following sequence:

[0021] CT1:

[0022] ATGAATATTATT TGATAATGAATATTA AAAAAAAAAA CCACCTAATCCCCCG AAAAAAAAAA TGATAA TGAATATTA AAAAAAAAAA CCACCTAATCCCCCG TATTATGATA

[0023] CT2:

[0024] ATGAATATTATT CACCCCGCGCCCACC AAAAAAAAAA CACCCCGCGCCCACC TATTATGATA

[0025] Connector:

[0026] ACCCCCGCTCCCCCC TTTTTTTT CCCCCCAATCCCACC

[0027] DNA-chol:

[0028] ATTATAAGTAATAGT-chol

[0029] CP1:

[0030] CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTTTTTTTTTTT CACATGACC C TAATTGA

[0031] CP2:

[0032] CATAAGACT GGTCATGTG TTTTTTTTTTTTTTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG

[0033] H1:

[0034] TCAATTAGAGTCTTAT G CTATTTAGATCGTTACGCTAACTATGATAGCATA AGACT

[0035] H2:

[0036] TATGCTATCATAGTTAGCGTAACGATCTAAATAGC TTATCAGACTTAGATCGTTACGCTAACTATGA

[0037] crRNA:

[0038] UAAUUUCUACUAAGUGUAGAUGAUCGUUACGCUAACUAUGA

[0039] Reporter:

[0040] FAM-TTATT-BHQ;

[0041] Primer:

[0042] AAT AAT ATT CAT TAT CAT AAT A;

[0043] RCA1:

[0044] TCAATTAGGGTCATGTGAAAAAAAAAAAAAAATAGCATTAGTGTCACGGGAGCGAGGTGGGGTG;

[0045] RCA2:

[0046] CAGGCCAACCCCCCATGACAACGTGGGACAGACGCAACCTCTGTAGTGAAAAAAAAAAAAAAACACATGACCAGTCTTATG;

[0047] Among them, the amplified product of the italic part in CT1 and DNA-chol are complementary sequences, the amplified product of the single-underlined part in CT1 and the single-underlined part of Connector are complementary sequences, the italic part of the CT2 amplified product and the italic part in Connector are complementary sequences, the bold parts in CP1 and CP2 are CD63 aptamer and EpCAM aptamer respectively, the italic parts in CP1 and CP2 are complementary sequences, the single-underlined parts in CP1 and CP2 serve as a toehold and are complementary to the single-underlined part in H1, the italic parts in H1 and H2 are complementary sequences, and the bold and italic part in H2 and the bold part in crRNA are complementary sequences.

[0048] DNA-chol hybridizes complementarily with RCA1 to form a double strand. When the target is present, exosomes are captured through cholesterol on the hybrid double strand to eliminate the influence of free proteins. Then, RCA1 and RCA2 are connected by Connector to wrap the exosomes for the purpose of separation again. The exosomes are released by lowering the pH; CP1 and CP2 recognize the proteins on the exosomes. The adjacent CP1 and CP2 are connected to each other. The single-underlined part therein serves as a toehold to open hairpin H1, and the opened H1 then opens H2. The double strand formed by H1 and H2 falls off and binds to the crRNA in Cas12a, activating the trans-cleavage activity of the Cas12a protein, cutting off the reporter, and restoring the fluorescence. A large number of target strands of the Cas12a protein are generated through the above infinite cycles to achieve signal amplification, thereby detecting exosomes by measuring the fluorescence intensity.

[0049] The present invention has the following advantages:

[0050] The biosensor of the present invention separates and screens exosomes through double rolling circle amplification products to reduce the influence of free proteins, further controls the release of exosomes through pH, and based on the specific recognition of nucleic acid aptamers and proteins on exosomes, through the proximity of CP1 and CP2 containing aptamers, the complementary parts of the two strands bind to each other, thus forming a trigger, and the trigger further opens H1, and H1 then opens H2, triggering the HCR reaction to generate a large number of double-stranded structures of H1 and H2 as the target strands of the Cas protein, activating its trans-cleavage activity, cutting off the reporter, and restoring the fluorescence, thereby constructing a biosensor. The sensor wraps and separates the extracted exosomes through cholesterol to reduce the influence of free proteins, and realizes specific detection through the specific recognition of nucleic acid aptamers and exosome proteins; through HCR, many target strands of the Cas protein are formed, and the cleavage activity of the Cas protein is used to amplify the detection signal, improving the detection sensitivity; the sensor is simply constructed and has advantages such as simple operation and fast reaction speed; the detection of the target is realized in a homogeneous phase, reducing the complexity of the operation and achieving rapid, simple, and sensitive detection of the target; the sensor is inexpensive and can realize rapid and accurate quantitative detection of exosomes. Description of the Drawings

[0051] Figure 1 This is the schematic diagram of the experiment;

[0052] Figure 2 This is the detection result diagram of the optimization of the H1 concentration;

[0053] Figure 3 This is the detection result diagram of the optimization of the H2 concentration;

[0054] Figure 4Optimize the test result graph for reaction time;

[0055] Figure 5 This is the result of exosome concentration detection. DETAILED DESCRIPTION

[0056] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0057] Example 1 Screening of H1 and H2 concentrations

[0058] (1) Exosome extraction

[0059] MCF-7 cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. The cells were passaged every four days. RPMI-1640 4.5 g / L, special grade fetal bovine serum (FBS), 1% antibiotics (100 U / mL penicillin and 100 μg / mL streptomycin), was used to culture the cells. To produce exosomes, cells were cultured in conditioned medium (10% FBS and 1% antibiotics) for three days and isolated using different ultracentrifugation methods. To isolate exosomes, cell debris was first removed from the culture medium by centrifugation at 2000×g for 20 min. Cell vesicles were isolated by centrifugation at 10000×g for 45 min. The exosomes containing supernatant were filtered using a 0.20 μm syringe filter. Finally, exosomes were harvested by centrifugation at 10000×g (40000 rpm) for 150 min. Exosomes were resuspended in PBS, pH 7.4, and stored at -80°C before use.

[0060] (2) Rolling ring preparation

[0061] Mix 19.5 μL sterile water, CT1 (3 μL, 100 μM), primer (3 μL, 100 μM) and 3 μL 10×T4 DNA ligase buffer, anneal at 95°C for 5 min, then slowly cool to room temperature, add 1.5 μL T4 DNA ligase, react at 16°C overnight, and terminate the reaction at 65°C for 10 min. Store the obtained rolling circle 1 at 4°C. Prepare rolling circle 2 in the same way.

[0062] (3) Preparation of RCA1 and RCA2:

[0063] Rolling circle 1 (2 μL, 10 μM), phi29 polymerase (2 μL, 10 U / μL), dNTP (1 μL, 10 mM), 2 μL 10× phi29 polymerase buffer and 13 μL sterile water were mixed and reacted at 37°C for 90 min. After the reaction was completed, the reaction was terminated by treating at 65°C for 10 min to obtain RCA1. RCA2 was prepared in the same way.

[0064] (4)Homogeneous reaction

[0065] Mix the extracted exosome sample (5 μL, 6 μg / mL), Connector (1.5 μL, 100 μM), DNA-chol (1.5 μL, 100 μM), 12.5 μL RCA1, 12.5 μL RCA2, 5 μL phi29 polymerase buffer and 12 μL sterile water, react for 30 min, centrifuge, rinse three times with PBS at pH 7.4, add PBS at pH 6.0 to release the encapsulated exosomes;

[0066] Then mix 25 μL of the above solution, CP1 (1.5 μL, 100 μM), CP2 (1.5 μL, 100 μM), H1 (1.5 μL, final concentrations are 1.8 μM, 2 μM, 2.2 μM, 2.4 μM, 2.6 μM, 2.8 μM respectively), H2 (1.5 μL, 100 μM), Cas12a (3 μL, 100 μM), crRNA (3 μL, 100 μM) and 3 μL sterile water, react at 37 °C for 60 min, then place the centrifuge tube in a 65 °C reaction for 10 min to terminate the reaction, and finally mix evenly with 60 μL sterile water;

[0067] (5)Fluorescence detection

[0068] Set the excitation wavelength to 485 nm and the emission wavelength to 520 nm to detect the fluorescence change of the system;

[0069] The results are shown in Figure 2 , and it can be seen from Figure 2 that the peak value of the detected fluorescence intensity increases with the increase of the concentration of H1. When the concentration exceeds 2.4 μM, the fluorescence intensity tends to be stable. Therefore, the optimal concentration of H1 is 2.4 μM.

[0070] Screen the optimal concentration of H2 by the same method. The results are shown in Figure 3 , and it can be seen from Figure 3 that the peak value of the detected fluorescence intensity increases with the increase of the concentration of H2. When the concentration exceeds 2.4 μM, the fluorescence intensity tends to be stable. Therefore, the optimal concentration of H2 is 2.4 μM.

[0071] Example 2 Screening of reaction time

[0072] Detection was carried out according to the method in Example 1, except that in step (4), H1 (1.5 μL, 100 μM), H2 (1.5 μL, 100 μM), and the reaction was carried out at 37 °C for 15 min, 30 min, 45 min, 60 min, 75 min, and 90 min;

[0073] The results are shown in Figure 4 , as can be seen from the figure, the peak value of the detected fluorescence intensity increases with the extension of time. When the time exceeds 90 min, the fluorescence intensity tends to be stable. Therefore, the optimal reaction time is 90 min.

[0074] Example 3 Detection of exosomes

[0075] (1) Exosome extraction

[0076] MCF-7 cells were cultured in a humidified atmosphere containing 5% CO2 at 37 °C. Subculture was performed every four days. RPMI-1640 4.5 g / L, fetal bovine serum (FBS) of special grade, 1% antibiotic (100 U / mL penicillin and 100 μg / mL streptomycin) were used to culture the cells. To produce exosomes, the cells were cultured in conditioned medium (10% FBS and 1% antibiotic) for three days and separated by different ultracentrifugation methods. To isolate exosomes, first, cell debris was centrifuged at 2000×g for 20 min to remove the cell debris from the medium. The cell vesicles were separated by centrifugation at 10000×g for 45 min. The exosomes containing the supernatant were filtered through a 0.20 μm syringe filter. Finally, the exosomes were obtained by centrifugation at 10000×g (40000 rpm) for 150 min. The exosomes were resuspended in PBS at pH 7.4 and stored at -80 °C before use.

[0077] (2) Rolling circle preparation

[0078] 19.5 μL of sterile water, CT1 (3 μL, 100 μM), primer (3 μL, 100 μM), and 3 μL of 10×T4 DNA ligase buffer were mixed, annealed at 95 °C for 5 min, then slowly cooled to room temperature, and then 1.5 μL of T4 DNA ligase was added. The reaction was carried out overnight at 16 °C, and then the reaction was terminated at 65 °C for 10 min. The prepared rolling circle 1 was stored at 4 °C; Rolling circle 2 was prepared in the same way;

[0079] (3) Preparation of RCA1 and RCA2:

[0080] Mix rolling circle 1 (2 μL, 10 μM), phi29 polymerase (2 μL, 10 U / μL), dNTP (1 μL, 10 mM), 2 μL of 10×phi29 polymerase buffer and 13 μL of sterile water, react at 37 °C for 90 min, and terminate the reaction by treating at 65 °C for 10 min after the reaction is completed to obtain RCA1; prepare RCA2 in the same way;

[0081] (4)Homogeneous reaction

[0082] Mix the extracted exosome samples (5 μL, 0 μg / mL, 1 μg / mL, 2 μg / mL, 3 μg / mL, 4 μg / mL, 5 μg / mL, 6 μg / mL), Connector (1.5 μL, 100 μM), DNA-chol (1.5 μL, 100 μM), 12.5 μL of RCA1 and 12.5 μL of RCA2, 5 μL of phi29 polymerase buffer and 12 μL of sterile water, react for 30 min, centrifuge, wash three times with PBS at pH 7.4, add PBS at pH 6.0 to release the encapsulated exosomes;

[0083] Then mix 25 μL of the above solution, CP1 (1.5 μL, 100 μM), CP2 (1.5 μL, 100 μM), H1 (1.5 μL, 2.4 μM), H2 (1.5 μL, 2.4 μM), Cas12a (3 μL, 100 μM), crRNA (3 μL, 100 μM) and 3 μL of sterile water, react at 37 °C for 60 min, then place the centrifuge tube in a 65 °C reaction for 10 min to terminate the reaction, and finally mix evenly with 60 μL of sterile water;

[0084] (5)Fluorescence detection

[0085] Set the excitation wavelength to 485 nm, the detection band to 500 - 650 nm, and record the fluorescence value at 520 nm;

[0086] The results are shown in Figure 5 , it can be seen from the figure that when the exosome concentration ranges from 0 to 6 μg / mL, the detected fluorescence signal increases with the increase of the target concentration. Calculate the regression equation y = 178.3203 + 105.65072x, R 2 = 0.993, and calculate the detection limit of this scheme to be 1 μg / mL from this. Sequence Listing <110> University of Jinan <120> An optical biosensor for exosome separation and detection based on double rolling circles <160> 13 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 112 <212> DNA <213> Artificial Sequence <400> 1 atgaatatta tttgataatg aatattaaaa aaaaaaacca cctaatcccc cgaaaaaaaa 60 aatgataatg aatattaaaa aaaaaaacca cctaatcccc cgtattatga ta 112 <210> 2 <211> 62 <212> DNA <213> Artificial Sequence <400> 2 atgaatatta ttcaccccgc gcccaccaaa aaaaaaacac cccgcgccca cctattatga 60 ta 62 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <400> 3 acccccgctc cccccttttt tttcccccca atcccacc 38 <210> 4 <211> 15 <212> DNA <213> Artificial Sequence <400> 4 attataagta atagt 15 <210> 5 <211> 64 <212> DNA <213> Artificial Sequence <400> 5 caccccacct cgctcccgtg acactaatgc tatttttttt tttttttcac atgaccctaa 60 ttga 64 <210> 6 <211> 81 <212> DNA <213> Artificial Sequence <400> 6 cataagactg gtcatgtgtt tttttttttt tttcactaca gaggttgcgt ctgtcccacg 60 ttgtcatggg gggttggcct g 81 <210> 7 <211> 56 <212> DNA <213> Artificial Sequence <400> 7 tcaattagag tcttatgcta tttagatcgt tacgctaact atgatagcat aagact 56 <210> 8 <211> 67 <212> DNA <213> Artificial Sequence <400> 8 tatgctatca tagttagcgt aacgatctaa atagcttatc agacttagat cgttacgcta 60 actatga 67 <210> 9 <211> 41 <212> RNA <213> Artificial Sequence <400> 9 uaauuucuac uaaguguaga ugaucguuac gcuaacuaug a 41 <210> 10 <211> 5 <212> DNA <213> Artificial Sequence <400> 10 ttatt 5 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <400> 11 aataatattc attatcataa ta 22 <210> 12 <211> 64 <212> DNA <213> Artificial Sequence <400> 12 tcaattaggg tcatgtgaaa aaaaaaaaaa aatagcatta gtgtcacggg agcgaggtgg 60 ggtg 64 <210> 13 <211> 81 <212> DNA <213> Artificial Sequence <400> 13 caggccaacc ccccatgaca acgtgggaca gacgcaacct ctgtagtgaa aaaaaaaaaa 60 aaacacatga ccagtcttat g 81

Claims

1. A biosensor for detecting exosomes based on double rolling circle separation, characterized in that, Comprising: Cas12a, Connector with nucleotide sequences as shown in SEQ ID NO: 3-10, SEQ ID NO: 12 and SEQ ID NO: 13, DNA-chol, CP1, CP2, hairpin probe H1, hairpin probe H2, crRNA, Reporter, circular RCA1 and circular RCA2; The 3'-end of the DNA-chol is modified with cholesterol; The 5'-end and 3'-end of the Reporter are respectively connected with a fluorescent reporter group and a fluorescent quenching group.

2. A kit comprising the biosensor according to claim 1.

3. The kit according to claim 2, wherein The kit further comprises a buffer solution.

Citation Information

Patent Citations

  • Fluorescent biosensor for detecting ochratoxin A as well as preparation method and application thereof

    CN109444102A

  • High-specificity exosome separation, detection and enrichment method

    CN111521782A