Primer-probe combination for Streptococcus pneumoniae RPA-LFS detection method and its application
By combining RPA and LFS technology, specific primer probe combinations are designed to solve the problems of long detection time and false negative results in the prior art, and fast, accurate and instrument-free detection of Streptococcus pneumoniae is achieved.
Patent Information
- Application Number
- CN202210306348.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-25
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-03-25
AI Technical Summary
The prior art has problems such as long detection time, complex operation and prone to false negative results when detecting Streptococcus pneumoniae, which is difficult to meet the needs of fast and accurate diagnosis.
The recombinase polymerase isothermal amplification technology (RPA) combined with lateral flow band (LFS) technology is used to design a specific primer probe combination for rapid and sensitive detection of Streptococcus pneumoniae.
The detection is completed within 30 minutes at 37°C. It has high specificity and sensitivity. It can accurately detect 22 clinical isolates and 20 other common pathogens, and can conduct on-site testing without complex equipment.
Smart Images

Figure CN114657272B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the detection of Streptococcus pneumoniae, and in particular to a primer-probe combination for a Streptococcus pneumoniae RPA-LFS detection method and an application thereof. Background Art
[0002] Streptococcus pneumoniae (S. pneumoniae) is a Gram-positive, flagella-free bacterium that often forms pairs or short chains. Its outer polysaccharide capsule serves as the pathogenic basis. This bacterium is widely distributed in nature and often colonizes the mucosa of the human upper respiratory tract. It primarily targets immunocompromised individuals, such as children and the elderly. Infection can cause invasive diseases such as pneumonia, meningitis, and otitis media. Globally, pneumococcal infection causes extremely high morbidity and mortality each year. With the emergence of increasingly drug-resistant clinical isolates of S. pneumoniae, the prevention and treatment of pneumococcal infection has become increasingly difficult. Timely and accurate etiological diagnosis plays a crucial role in the selection of clinical therapeutic drugs and the development of treatment plans.
[0003] Early diagnosis of the pathogen and early reflection of clinical infection in patients is crucial for subsequent corrective treatment. However, the current gold standard method for detecting Streptococcus pneumoniae is phenotypic, involving culture, microscopy, and biochemical identification. The growth and identification of Streptococcus pneumoniae typically requires more than two days, and this method often has the disadvantages of long detection times, complex procedures, and a high risk of false negatives.
[0004] Currently, positive identification may often occur late in the course of infection; this delayed diagnosis may result in poor outcomes for patients infected with this pathogen. Therefore, the development and validation of rapid and accurate methods for the identification of S. pneumoniae are imperative. Several culture-independent methods have been developed for the detection of S. pneumoniae, including mass spectrometry, immunoassays, polymerase chain reaction (PCR), real-time PCR, polymerase spiral reaction (PSR), and loop-mediated isothermal amplification (LAMP); these S. pneumoniae identification tests can save considerable time compared to gold-standard culture methods. However, such assays, in turn, rely on skilled personnel or complex equipment, which may not be available in some cases.
[0005] Recombinase polymerase isothermal amplification (RPA) is a recombinase polymerase-mediated amplification technique that simulates in vivo DNA replication and can isothermally amplify target fragments at room temperature. This technique primarily relies on three enzymes: the recombinase proteins uvsX and uvsY encoded by T4 bacteriophage, the single-stranded binding protein gp32, and the Bsu DNA polymerase. The recombinase proteins bind to primers, forming DNA nucleoprotein filaments. The filaments bind to the matching DNA fragments, tightly binding and undergoing recombination. With the help of the single-stranded binding protein, the template DNA begins to unwind, and replication and extension proceed under the action of the Bsu DNA polymerase, exponentially amplifying the target region on the template. The entire process takes only 20-30 minutes at 37-42°C. Compared to PCR, it does not require high-temperature denaturation and low-temperature annealing, making the reaction simple, rapid, and efficient. Combining a lateral flow strip (LFS) coated with gold nanoparticles (AuNPs) with RPA allows for visual detection of labeled amplification products, allowing for semi-quantitative observation of color signals on the LFS with the naked eye. This technology further simplifies the detection process and enables on-site detection without the need for instrumentation. Summary of the Invention
[0006] The present invention uses RPA combined with LFS technology to establish a rapid and sensitive on-site detection method for Streptococcus pneumoniae.
[0007] The molecular targets used to identify S. pneumoniae include multiple genes, including the Spn9802 fragment (Abdeldaim, Olcén, Blomberg, and Herrmann, 2008), RecA gene (Zbinden, and Bloemberg, 2011), 16S rRNA gene (El Aila, et al., 2010), and virulence factor genes such as aerolysin (Ply) (Carvalho Mda et al., 2007; El Aila, et al., 2010). Although these targets have been shown to be useful for the detection of S. pneumoniae, their ability to unequivocally identify S. pneumoniae remains questionable. For example, PLY
[30] and Spn9802
[23] are both associated with false-negative results. The autolysin lytA gene is conserved among S. pneumoniae strains, has limited genetic variation (0.11-0.32%), has high sensitivity and specificity, and is present in almost all clinical isolates, so this gene was selected for the identification of S. pneumoniae.
[0008] The RPA assay demonstrated high specificity, with all 22 clinical isolates testing positive, while all 20 other common pathogens were negative. This demonstrates that our established RPA-LFS assay is capable of specifically detecting S. pneumoniae. Probit regression analysis was used to calculate the method's LOD (95% confidence interval). The results showed that the LOD of RPA-LFS for S. pneumoniae was 3.32 CFU per reaction, comparable to the LODs of other highly sensitive molecular detection methods.
[0009] The rational design of primers for detecting Streptococcus pneumoniae begins with a BLAST search of the lytA gene sequence. The primers only match Streptococcus pneumoniae. As shown in Table 1, five pairs of primers, lytA-1, lytA-2, lytA-3, lytA-4, and lytA-5, were designed with the lytA gene as the target sequence. Basic RPA reactions were performed using genomic DNA of a standard strain of Streptococcus pneumoniae as a template, and agarose gel electrophoresis was performed. The five primer sets from lytA-1 to lytA-5 all produced clear target bands with sizes of 456, 456, 456, 275, and 204 bp, respectively. Although there were no nonspecific amplification bands in the no-template control (NTC), primer dimers smaller than 100 bp still appeared. Primers lytA-2 and lytA-4 were able to amplify brighter target bands with fewer primer dimers. Therefore, we selected primer pairs lytA-2 and lytA-4 for further design of probes in subsequent RPA-LFS reactions.
[0010] Table 2 Primer and probe combinations
[0011]
[0012]
[0013] The mutated sites are underlined, and F and R represent forward and reverse primers, respectively.
[0014] Modification and determination of the optimal primer and probe combination for RPA-LFS
[0015] Probes P1 and P2 were designed within the sequences of lytA-2 and lytA-4, and RPA–LFS tests were performed to examine the amplification performance and false positives of the primer-probe combinations lytA-2 / F / R / P1 and lytA-4 / F / R / P2. Both primer-probe combinations provided correct positive signals (two visible red bands on both the test line and the control line), indicating that these two primer-probe combinations had good amplification performance. However, in the no-template control, they also showed a visible, weakened red band on the test line, indicating that both primer-probe combinations had false positive signals.
[0016] LFS specifically recognizes FITC- and biotin-labeled RPA products generated by the probe and reverse primer. Therefore, when designing RPA-LFS probes, the NTC signal should be completely suppressed. Previous studies have shown that the RPA reaction can tolerate some mismatches between the primer / probe and the template. Probe-reverse primer dimers were analyzed using Primer Premier 5 software, and mismatches (see underlined text) were added to replace sites with more than five consecutive bases or more than three bases at the 3' end. The sequences of the modified reverse primer (mR) and probe (mP) are listed in Table 2, with the replaced bases indicated in red. RPA-LFS assays were then performed using these modified probes and primers. When amplifying the lytA gene using S. pneumoniae genomic DNA, both primer-probe combinations showed no signal on the NTC assay line but a significant signal on the assay line containing S. pneumoniae genomic DNA. The lyt-2-F / mR / mP1 combination, which has fewer mismatches, is considered to perform better. Agarose gel electrophoresis analysis of the RPA amplification products revealed two distinct bands for both primer-probe combinations, representing the products of the forward-reverse primer and probe-reverse primer combinations, respectively. Overall, the optimal primer-probe combination was lyt-2-F / mR / mP1 for RPA-LFS detection of Streptococcus pneumoniae.
[0017] The beneficial effects achieved by the present invention are as follows: the present invention designs primer probes based on the autolysin gene (lytA) of Streptococcus pneumoniae, and completes the detection at 37°C within 30 minutes. The specificity of the method was verified by detecting 22 clinical isolates of Streptococcus pneumoniae and 20 other common pathogens. The sensitivity of the RPA-LFS method was tested 10 independent times, and the minimum detection limit was 3.32 colony-forming units (CFU) / reaction. Finally, the established RPA-LFS detection method for Streptococcus pneumoniae was tested on clinical specimens, and the test results were accurate and consistent compared with the PCR method. In summary, this study developed a rapid, sensitive and specific RPA-LFS detection method for Streptococcus pneumoniae, which has good application prospects in preliminary medical diagnosis in remote and resource-limited areas. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:
[0019] Figure 1 is the RPA primer set screening result;
[0020] Figure 2 is the performance of the primer-probe set tested using the RPA-LFS reaction;
[0021] Figure 3 It is the specific result of RPA-LFS test;
[0022] Figure 4 This is the result of determining the limit of detection (LOD) of the RPA-LFS detection method for Pneumococcus. DETAILED DESCRIPTION
[0023] The preferred embodiments of the present invention are described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.
[0024] Example
[0025] A RPA-LFS method for detecting S. pneumoniae was established using a standard strain of S. pneumoniae (ATCC 49619). Twenty-two clinical isolates of S. pneumoniae and 20 other common pathogens, including Escherichia coli, Haemophilus influenzae, Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Enterococcus faecalis, Enterococcus faecium, Morganella fultonii, Serratia marcescens, Burkholderia cepacia, Candida albicans, Candida glabrata, Stenotrophomonas maltophilia, Vibrio parahaemolyticus, Streptococcus lactis, Bacillus cereus, Salmonella typhimurium, coagulase-negative Staphylococci, and Bacillus mirabilis, were collected to validate the specificity of the RPA-LFS method.
[0026] Extraction of bacterial genomes
[0027] For reactions using purified genomic DNA as a template, genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China) and stored at -20°C until use. If bacterial culture was used as a template, bacterial DNA was extracted using the boiling method. Each colony was suspended in 50 μL of Tris-EDTA buffer and boiled for 10 minutes to completely release the bacterial genomic DNA.
[0028] Primer design for RPA reaction
[0029] Specific RPA primers were designed based on the lytA gene sequence of the Streptococcus pneumoniae species-specific autolysin using Primer-BLAST online design software from the National Center for Biotechnology Information (NCBI). Primer design parameters were: size set to 30-35 bp, product size set to 100-500 bp, GC content set to 20%-80%, Tm set to 50-100, and the organism was set to Streptococcus pneumoniae. All other parameters were used with default settings. Five primer pairs were selected for testing (General Biosystems Co., Ltd., Anhui, China).
[0030] RPA Program
[0031] RPA amplification was performed using the TwistAmp Liquid DNA amplification Kit (TwistDx Inc., Maidenhead, United Kingdom) to preliminarily screen the best forward and reverse primer pairs. Each 50 μL mixture contained 25 μL 2×Reaction buffer, 5 μL 10×Basice-mix, 2.5 μL 20×core mix, 2.1 μL upstream primer and 2.1 μL downstream primer (10 μM), 9.8 μL ddH2O, and 1 μL of the genome as a template. In order to ensure that all reaction systems reacted simultaneously, 2.5 μL of 280 mM magnesium acetate was added to the PCR tube cap, and the magnesium acetate in all reaction tubes was added to the reaction system at the same time by instantaneous centrifugation. After vortex centrifugation, the reaction system was immediately placed in a 37°C constant temperature heater and incubated for 30 minutes. The amplified product was purified using a DNA purification kit (Beijing Tiangen), and the amplification effect of the product was detected by 1.5% agarose gel electrophoresis.
[0032] RPA-LFS probe design
[0033] Like PCR amplification, PRA amplification requires a pair of forward and reverse primers. When using lateral flow strips (LFS) as an endpoint visual readout of the amplified DNA target, a probe is designed downstream of the forward primer. This probe is labeled with fluorescein isothiocyanate (FITC) at the 5' end, has a tetrahydrofuran (THF) site in the middle, and is capped at the ends. When a certain amount of product accumulates in the reaction system, the probe binds to the product. The Nfo enzyme in the reaction system then recognizes the [THF] site and cleaves it. Because Bsu polymerase has strand displacement activity, it displaces the DNA strand after the [THF] site, thereby initiating amplification. The resulting product is labeled with FITC on one end and biotin on the other.
[0034] Primer Premier 5 software was used to design a specific probe between the forward and reverse primer target sequences. Theoretically, the formation of a dimer structure between the probe and the reverse primer should be avoided as much as possible. The principles are as follows: (1) the probe size was 46-51 bp, the Tm was 57-80°C, and the GC content was 20-80%; (2) the maximum primer-dimer fraction was set to 9, the maximum hairpin fraction was 9, the maximum poly-X was set to 5, and other parameters were set to default values; (3) the 5' end was labeled with fluorescein isothiocyanate (FITC), the 3' end was blocked with a C3 spacer, and a base in the middle of the probe was replaced with tetrahydrofuran (THF). The THF site was preceded by at least 30 bp and followed by at least 15 bp; (4) the 5' end of the reverse primer was labeled with biotin.
[0035] RPA-LFS Program
[0036] use RPA-LFS experiments were performed using the DNA Amplification Kit. A total of 50 μL of the reaction system was added, in sequence, to a lyophilized tube containing the enzyme components: 29.5 μL of rehydration buffer, 12.2 μL of ddH₂O, 2.1 μL of upstream primer (10 μM), 2.1 μL of downstream primer (10 μM), and 0.6 μL of probe. To ensure simultaneous initiation of all reactions, 1 μL of template and 2.5 μL of 280 mM magnesium acetate were added to the cap of the tube. The reaction was then centrifuged briefly to allow the template and 280 mM magnesium acetate to be added simultaneously. The reaction was then centrifuged briefly and immediately incubated in a 37°C thermostat for 30 minutes. Then, 5 μL of the amplified product was visually detected by LFS (Ustar BioTechnologies Ltd., Hangzhou, China) within 5 minutes. Two red lines are displayed on the LFS: the control line (upper) and the test line (lower). A control line is present in every test to ensure the validity of the LFS, while the test line only allows for observation of a positive reaction.
[0037] Specificity Assay
[0038] The specificity of RPA-LFS for S. pneumoniae was evaluated using genomic DNA from 22 clinically isolated S. pneumoniae and 20 common pathogenic microorganisms.
[0039] Limit of Detection (LOD) Assay
[0040] Prepare 3×10 4 CFU / mL~3×10 -1RPA-LFS was performed on 10-fold serial dilutions of the S. pneumoniae genome at 10 CFU / mL. The limit of detection (LOD) of the method was determined by probabilistic regression analysis of 10 independent experiments.
[0041] Examination of clinical specimens
[0042] The concordance rate of RPA-LFS in clinical specimens was evaluated by comparison with traditional culture-biochemical methods and PCR. Clinical specimens were cultured on selective media, including blood agar, chocolate agar, and MacConkey agar, at 37°C for 18–48 hours. Bacterial identification was performed using a VITEK 2 instrument (bioMérieux, France), with additional biochemical testing performed as needed. PCR was also performed using primers designed based on the lytA gene. The concordance rate between the different methods was calculated as: {(number of positive samples by both methods + number of negative samples by both methods) / total number of samples} × 100%. The kappa index was determined to evaluate the test.
[0043] Figure 1 The figure shows the RPA primer set screening. Using the genomic DNA of the standard strain of Streptococcus pneumoniae as the template, the RPA method was used to screen the primer pairs lytA-1-5. The no-template control (NTC) of each primer set was used as a negative control. Equal volumes of amplified products (5 μL) were detected by 1.5% agarose gel electrophoresis. Figure 1 As shown in Figure 3 . In contrast, primers lytA-2 and lytA-4 amplified brighter target bands with fewer primer dimers. Therefore, we selected primer pairs lytA-2 and lytA-4 for further probe design in subsequent RPA-LFS reactions.
[0044] Figure 2 Performance of primer-probe sets tested using RPA-LFS reactions. Figure 2 Panel A shows the LFS test results for RPA amplification products before mismatches. Panel B shows the LFS test results for RPA amplification products after mismatches. Panel C shows the agarose gel results. The name of each primer-probe combination is indicated above the corresponding band. The NTC band is the no-template control for RPA. The positions of the test and control lines are marked to the right of the bars. Reactions were performed at 37°C for 30 minutes. This image represents the results of three independent experiments.
[0045] Depend on Figure 2 As can be seen, both primer-probe combinations provide correct positive signals (two visible red bands on both the test line and the control line), indicating that these two primer-probe combinations have good amplification performance. However, in the no-template control, they also show a visible weakened red band on the test line, indicating that both primer-probe combinations have false positive signals. Figure 2 When the lytA gene was amplified using genomic DNA from Streptococcus pneumoniae, both primer-probe combinations showed no signal on the NTC test line, but showed a clear signal on the test line containing genomic DNA from Streptococcus pneumoniae. Figure 2 At B, the lyt-2-F / mR / mP combination has fewer mismatched bases, so we believe that this combination has better performance. Analysis of the RPA amplification products by agarose gel electrophoresis showed that the amplification products of both primer-probe combinations had two clear bands, representing the products of the forward-reverse primer and the probe-reverse primer, respectively ( Figure 2 In the figure, the best primer-probe combination was lyt-2-F / mR / mP for RPA-LFS detection of Streptococcus pneumoniae.
[0046] Specificity analysis of RPA-LFS detection
[0047] To verify the inclusiveness and specificity of the primer-probe combination, RPA-LFS amplification was performed on 22 clinical isolates of Streptococcus pneumoniae and 20 other pathogens.
[0048] Figure 3 The specificity of the RPA-LFS assay is shown in Figure 1. Panel A shows the assay for a clinical isolate of Streptococcus pneumoniae, while panel B shows the assay for other common pathogens. Streptococcus pneumoniae (ATCC 49619) was used as a positive control. The species name of each bacterial species is indicated at the top of each band. The NTC band is a no-template control. Reactions were performed at 37°C for 30 minutes.
[0049] like Figure 3 As shown in center A, when isolated genomic DNA from Streptococcus pneumoniae was used as a template, a clear positive signal appeared on the test line. However, when genomic DNA from other common respiratory pathogens was used as a template, no bands appeared on the test line. These results demonstrate that the established RPA-LFS detection system has good specificity for Streptococcus pneumoniae and has no cross-reactions with other pathogens.
[0050] To evaluate the detection limit of the RPA-LFS assay, we used 10-fold dilutions of inactivated Pneumococcal culture as templates, which corresponded to a bacterial count of 3 × 10 4 CFU to 3 × 10 -1 CFU (1 μL in a 50 μL reaction volume) was assessed. Figure 4Figure 1 shows the limit of detection (LOD) of the RPA-LFS assay for pneumococci. Panel A shows the LOD of the established RPA-LFS assay for pneumococci determined from 10 independent assays using serial dilutions of pneumococcal genomic DNA, equivalent to 10⁴ to 10⁻¹ CFU. The image shows the results of the RPA-LFS assay, with the top of the bar graph indicating the amount of template. Panel B shows the group in which 10 ng of human genomic DNA was added in addition to gingivitis genomic DNA. Panel C shows probit regression analysis of data collected from the 10 replicates using SPSS software.
[0051] In 3×10 4 A clear red band can be seen on the CFU detection line. The signal weakens as the number of templates decreases. -1 CFU completely disappeared from the samples ( Figure 4 To test whether the system is resistant to interference from the human genome, 10 ng of human DNA and diluted pneumococcal genomic DNA were added to the RPA reaction. The detection sensitivity was not affected by human DNA ( Figure 4 When using a template equivalent to 3×100 CFU (9 positive results in 10 samples) or 3×10 -1 CFU (1 positive result in 10 samples), not all tests produced positive results. To more accurately confirm the LOD of the RPA-LFS test, probit regression analysis was performed on the data of 10 independent tests. Statistical analysis was performed using SPSS software. The LOD of each reaction was 3.32 CFU, with a probability of 95% ( Figure 4 (C in the middle).
[0052] To evaluate the clinical application of the established RPA-LFS detection system, 110 patient specimens were collected from the clinical laboratory of Lianyungang Second People's Hospital and tested using RPA-LFS, PCR, and culture-biochemical methods. As shown in the table below, 31 of the samples tested positive for S. pneumoniae using both RPA-LFS and PCR, while 30 of the 110 samples tested positive using culture-biochemical methods. The established RPA-LFS method achieved 100% concordance with the PCR method. The concordance between the RPA-LFS method and the traditional culture-biochemical method was 98.18%, with a calculated kappa index of 0.977, indicating no statistically significant difference between the two methods (p>0.05). These results demonstrate the feasibility and reliability of the highly specific and sensitive RPA-LFS for S. pneumoniae in patient clinical samples.
[0053]
[0054] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention. Sequence Listing <110> Lianyungang Second People's Hospital (Lianyungang Clinical Oncology Institute) <120> Primer-probe combination for RPA-LFS detection of Streptococcus pneumoniae and its application <141> 2022-03-25 <160> 16 <170> SIPOSequenceListing 1.0 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <400> 1 acagaatgaa gcggattatc actggcggaa aga 33 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <400> 2 ggataagggt caacgtggtc tgagtggttg tttg 34 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <400> 3 ccgtacagaa tgaagcggat tatcactggc g 31 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <400> 4 ggataagggt caacgtggtc tgagtggttg tttg 34 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <400> 5 cagaatgaag cggattatca ctggcggaaa g 31 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <400> 6 ccatttagca agatatggat aagggtcaac g 31 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <400> 7 cattgttggg aacggttgca tcatgcaggt a 31 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <400> 8 cgtggtctga gtggttgttt ggttggttat tcg 33 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 gcaggtttgc cgaaaacgct tgatacaggg 30 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <400> 10 catgcttaaa ctgctcacgg ctaatgcccc at 32 <210> 11 <211> 46 <212> DNA <213> Artificial Sequence <400> 11 aatctagcag atgaagcagg tttgccgaaa cgcttgatac agggac 46 <210> 12 <211> 46 <212> DNA <213> Artificial Sequence <400> 12 caatctagca gatgaagcag gtttgccgaa acgcttgata cagggc 46 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <400> 13 ggataagggt caacgtggtc tgagtggttg gttg 34 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <400> 14 cgtggtctga gtggttgttt ggttggttag tcg 33 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <400> 15 agtctagcag atgaagcagg tttgccgaaa cgctagatac agggac 46 <210> 16 <211> 46 <212> DNA <213> Artificial Sequence <400> 16 caatgtagct gatgaagcag gtttgctgaa acgcttgata cagggc 46
Claims
1. A primer-probe combination for the RPA-LFS detection method for Streptococcus pneumoniae, characterized in that: The primer-probe combination is lytA-2-F / mR / mP1, and its sequence is as follows: lytA-2-F: CCGTACAGAATGAAGCGGATTATCACTGGCG; lytA-2-mR: Biotin-GGATAAGGGTCAACGTGGTCTGAGTGGTTGGTTG; mP1: FITC-AGTCTAGCAGATGAAGCAGGTTTGCCGAAA[THF]CGCTAGATACAGGGA - / C3-spacer / .
2. Use of the primer-probe combination according to claim 1 in the preparation of a Streptococcus pneumoniae RPA-LFS detection kit.
Citation Information
Patent Citations
Specific forward and reverse primers and probe for vomiting-causing bacillus cereus, detection kit and application of detection kit
CN111996266A
Primers and probes for the detection of streptococcus pneumoniae
US20100234245A1