IgG Antibody Composition and Method for Preparing the Same

By introducing hinge region resistance sequences into therapeutic IgG antibodies, the problem of endogenous IgG competitively inhibiting FcγR binding is solved, the binding of NK cell equivalent effector cells to antibodies is improved, antibody-dependent cytotoxicity is enhanced, and cancer treatment effect is improved.

CN114729058BActive Publication Date: 2025-08-01CITY OF HOPE
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202080070119.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-08-23
Filing Date
2020-08-24
Publication Date
2025-08-01
Estimated Expiration
2040-08-24

AI Technical Summary

Technical Problem

The concentration of endogenous IgG in human blood is high, and competitively inhibits the binding of therapeutic monoclonal antibodies to FcγRIIIA on the surface of NK cells, resulting in limited antibody-dependent cytotoxic effector function, affecting the cancer treatment effect.

Method used

By introducing hinge region resistance sequences into therapeutic IgG antibodies, it is resistant to IdeS proteases and enhances binding affinity with FcγR (CD16, CD32, CD64), releasing FcγR binding sites on the surface of NK cells, and improving the ADCC effect.

Benefits of technology

It enhances the binding of therapeutic IgG antibodies to NK cells, monocytes and macrophages, improves the killing efficiency of tumor cell targets, and enhances the effect of cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114729058B_ABST
    Figure CN114729058B_ABST
Patent Text Reader

Abstract

The present disclosure provides antibodies, recombinant proteins, and methods of using the same. The antibodies include, for example, immunoglobulin G (IgG) antibodies and recombinant proteins. The IgG antibodies include a Fab region and an Fc region linked by a hinge region, where the hinge region is resistant to protease cleavage. Additionally, the present disclosure particularly provides immunoglobulin G (IgG) antibodies and recombinant proteins. The IgG antibodies include a Fab region and an Fc region linked by a hinge region, and wherein the Fc region has a higher affinity for a ligand compared to wild-type Fc.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the priority benefit of U.S. Provisional Application No. 62 / 891,200, filed Aug. 23, 2019, which is hereby incorporated by reference in its entirety.

[0003] Statement of Rights to Inventions Made in the Course of Federally Sponsored Research and Development

[0004] This invention was made with government support under contract No. P01CA163205 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0005] Sequence Listing

[0006] This application contains a Sequence Listing that was created on Aug. 21, 2020 and electronically submitted as an ASCII text file named 048440-730001WO_SL.ST25.txt, which is 848 kilobytes in size and is hereby incorporated by reference in its entirety. BACKGROUND OF THE INVENTION

[0007] Antibody-dependent cell cytotoxicity (ADCC) represents a major mechanism by which immune cells recognize and eliminate pathogens or tumor cells following adaptive immunity or therapeutic monoclonal antibody (mAb) infusion. Natural killer (NK) cells are the major effectors of ADCC and express the low-affinity Fcγ receptor FcγRIIIA / CD16α (hereinafter referred to as CD16α). However, the concentration of endogenous IgG in human blood is 30-10 μM, which is approximately 100-fold higher than the dissociation constant (Kd) of the CD16α-IgG interaction. In fact, the evidence provided herein demonstrates that human NK cells are naturally coated with endogenous IgG, the excess of which competitively inhibits therapeutic mAbs, such as Rituxan, from binding to CD16α and inducing ADCC.

[0008] IdeS is an endopeptidase derived from Streptococcus pyogenes and specifically cleaves IgG at Gly249 in the lower hinge region of the IgG heavy chain, which is the region required for CD16α binding. IdeS cleavage of IgG abrogates IgG binding to FcγR and, thus, releases the binding site for FcγR from the NK cell surface. In past clinical trials, IdeS has been safely infused into patients, and IgG cleavage has been demonstrated in these patients (Jordan et al.). There remains a need for improved cancer therapeutic antibodies.

[0009] The present disclosure provides solutions to these and other problems in the art, among others. SUMMARY OF THE INVENTION

[0010] This document describes a strategy for enhancing the efficacy of therapeutic mAbs, which involves (1) making the mAbs resistant to IdeS, and (2) using IdeS to remove the binding of endogenous IgG to FcγRs. The in vitro data described herein demonstrate that this additional availability of FcγR binding sites on CD16α+ NK cells, monocytes and macrophages (CD16α and CD32α), and granulocytes (CD64) makes the binding of therapeutic mAbs more abundant and thus enhances the efficacy of therapeutic mAbs against tumor cell targets or other relevant targets through ADCC.

[0011] In one aspect, this document provides an immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region linked by a hinge region, wherein the hinge region is resistant to protease cleavage.

[0012] In one aspect, this document provides an immunoglobulin G (IgG) antibody, wherein the antibody comprises a Fab region and an Fc region linked by a hinge region, and wherein the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M.

[0013] In one aspect, this document provides a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and the recombinant protein is resistant to protease cleavage.

[0014] In one aspect, this document provides a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and the recombinant protein comprises an Fc region with a dissociation constant for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) from about 1×10 -5 M to about 1×10 -13 M.

[0015] In one aspect, this document provides an isolated nucleic acid encoding the recombinant protein described herein.

[0016] In one aspect, this document provides an expression vector comprising the isolated nucleic acid encoding the recombinant protein described herein.

[0017] In one aspect, this document provides a cell comprising the expression vector described herein.

[0018] On the one hand, the present disclosure provides anti-CD20 antibodies that comprise an antibody having CDR variants as set forth in Figure 14 .

[0019] On the one hand, the present disclosure provides a method of conjugating a ligand to a recombinant protein on the surface of a CHO cell, the method comprising contacting the ligand with a recombinant protein on the surface of a CHO cell, wherein the recombinant protein on the surface of the CHO cell comprises an epidermal growth factor receptor (EGFR) transmembrane domain and an immunoglobulin G (IgG) antibody. The EGFR transmembrane domain is fused to the C-terminus of the IgG antibody, the IgG antibody is capable of binding the ligand, and the CHO cell surface protein is resistant to cleavage by an IgG-specific protease or has a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0020] On the one hand, the present disclosure provides a method of treating cancer in a patient, the method comprising administering a therapeutic IgG antibody and an IgG-specific protease, wherein the therapeutic IgG antibody is resistant to the IgG-specific protease. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematically shows that human immune cells are naturally coated with endogenous IgG, which prevents interaction between a therapeutic mAb and FcγRs expressed on the surface of human immune cells. Thus, this limits the binding of the therapeutic mAb to FcγRs and thereby limits the efficacy of the therapeutic mAb.

[0022] Figure 2 Flow cytometry data are provided demonstrating that human NK cells are naturally coated with IgG molecules, which can be removed by incubation with the IdeS enzyme. Human peripheral blood mononuclear cells (PBMCs) were digested with IdeS at 37° C. for 30 minutes and stained with antibodies against lineage markers or against the Fc of human IgG. Note that CD3+ T cells do not express FcγRs and thus do not bind human IgG under any conditions.

[0023] Figure 3Schematically shows strategies for enhancing the efficiency of mAb therapy. Panel (a) shows that FcγRs on immune cells are typically occupied by endogenous IgG; panels (b) and (c) show that IdeS digestion can remove endogenous IgG and release the FcγR-binding sites of the infused therapeutic mAb, which is engineered to be resistant to IdeS and retain FcγR-binding function; (panels (c) and (d)); the infused therapeutic mAb can first bind to unoccupied FcγRs, as shown in panel (c), or can first bind to tumor-associated antigens expressed on cancer cells, as shown in panel (d). In either case, once antigen-mAb-FcγR crosslinking occurs, FcγR+ cells undergo immune activation, as shown in panel (f). The flow chart shows that the more FcγRs that are unoccupied and thus available for binding the therapeutic mAb, the more tumor cells are eliminated (panel (e)).

[0024] Figures 4A - 4E Shows flow cytometry density plots of the display of various functional IgG proteins on GFP+ Chinese hamster ovary (CHO) cells in the absence or presence of IgG-specific proteases (IdeS or IdeZ peptidase). Gray dots represent CHO cells treated with the control, and black dots represent CHO cells treated with IdeS or IdeZ peptidase, IgG-specific proteases that cleave the IgG hinge region and prevent IgG molecules from binding to Fc-γ receptors. Figure 4A Quantified the ability of mAbs that recognize the Fab portion of IgG to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom) that do not have a Fab portion. Figure 4B Quantified the ability of mAbs that recognize the Fc portion of IgG to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); importantly, this specific polyclonal mAb recognizes regions that are not cleaved by IdeS or IdeZ, and thus no cleavage was observed. Figure 4C Quantified the ability of soluble CD64 (FcγRI) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); Figure 4D Quantified the ability of soluble CD32a (FcγRIIa) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); Figure 4E Quantified the ability of soluble CD16a (FcγRIIIa) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom).

[0025] Figure 5Disclosed is the generation of a new lower hinge of IgG1Fc, which has enhanced binding affinity for CD16α and resistance to IdeS and IdeZ cleavage. Amino acids (AAs) were added stepwise to the N-terminus of IgG1Δ16 (SEQ ID NO:16) that does not bind CD16α. Clones that obtained CD16α binding were selected by stepwise linking of more AAs to increase the binding affinity.

[0026] Figure 6A -Panel B shows the stepwise acquisition of CD16α binding by sequential addition of amino acids (AAs) to the N-terminus of IgG1FcΔ16. Figure 6A Shown is the binding affinity of various matters of human IgG1FcΔ16 fused to the EGFR transmembrane helix domain and displayed as a type I membrane protein on the surface of CHO cells. Figure 6B Shown are individual plots of all positive clones when more AAs were added.

[0027] Figure 7 Shown are data collected from CHO cells transfected with rituximab-EGFR. The hinge region of rituximab consists of the wild-type (WT) hinge (ELLGGPS; SEQ ID NO:544) or one of two de novo IdeS / IdeZ-resistant hinges: EETCWDW, which has a higher affinity for FcγR CD16α than WT, or EDSCWDW, which has a lower affinity for FcγR CD16α than WT.

[0028] Figure 8 Shown is the binding affinity of various FcγRs for CHO cells expressing rituximab, the hinge portion of which is WT (ELLGGPS; SEQ ID NO:544) or has been engineered with a new de novo hinge region variant (EETCWDW, SEQ ID NO:545; or EDSCWDW, SEQ ID NO:546) using the methods described herein and Figure 7 as shown. The surface IgG expression and binding affinity of the resulting various FcγRs were quantified using the fluorescently labeled extracellular domain of FcγR indicated on the Y-axis and the fluorescently labeled anti-human Fc antibody on the X-axis. The upper left quadrant of each histogram indicates the FcγR binding affinity for each hinge portion.

[0029] Figure 9Representative examples are provided demonstrating the resistance of the novel hinge region (EETCWDW) to cleavage by IdeS / IdeZ. When stained with a fluorescently labeled anti-human Fc antibody, WT rituximab pre-incubated with IdeZ was no longer detectable on the surface of CD20(+) Daudi lymphoma cells (left histogram, dashed line), while EETCWDW rituximab remained detectable (right histogram, dashed line).

[0030] Figure 10 CHO cells transfected with trastuzumab-EGFR are shown. Trastuzumab contains its wild-type (WT) hinge portion or one of two de novo novel hinge portions, EETCWDW or EDSCWDW, which were engineered to replace the WT hinge region of trastuzumab using the same method described herein for rituximab. The surface IgG expression and binding affinity of the resulting various FcγRs were quantified using a fluorescently labeled extracellular domain of FcγR as indicated on the Y-axis and a fluorescently labeled anti-human Fc antibody on the X-axis. The upper left quadrant of each histogram indicates the FcγR binding affinity for each hinge portion.

[0031] Figure 11A -C shows the activity of rituximab variants. Figure 11A -B shows representative data comparing WT rituximab and "EETCWDW rituximab" in natural killer (NK) cell activation, and Figure 11C shows representative data comparing WT rituximab and "EETCWDW rituximab" in NK cell depletion of B cells. These experiments were performed in vitro in human whole blood over a 10-hour period in the absence ("control") or presence of IdeZ ("IdeZ"). IdeZ removes endogenous IgG bound to FcγRs (such as CD16α) on innate immune cells such as NK cells, monocytes, and granulocytes.

[0032] Figure 12 Shows how increased AB serum concentration in blood (and thus increased concentration of endogenous IgG) competes with EETCWDW rituximab for binding to NK cell FcγRIIIA (CD16α), thereby reducing NK cell activation.

[0033] Figure 13Data showing rituximab expressed as a rituximab-EGFR fusion protein on the surface of CHO cells. The x-axis shows fluorescently labeled anti-Fc mAb that can bind to CHO cells expressing IgG1-EGFR or rituximab-EGFR. The y-axis shows fluorescently labeled CD20 molecules that can bind to rituximab-EGFR. In the left histogram, CHO cells express IgG1 Fc-EGFR and thus bind on the x-axis but not on the y-axis. The middle histogram represents rituximab-EGFR and quantifies the affinity of rituximab for CD20. The right histogram shows the binding of fluorescently labeled CD20 molecules to rituximab (Line A) or to a hypothetical variant of rituximab with higher affinity for CD20 compared to the actual rituximab (Line B) or to a hypothetical variant of rituximab with lower affinity for CD20 compared to the actual rituximab (Line C). The right panel shows the expression of the CH2-CH3 fragment of Fc on the surface of CHO cells and thus no binding to human fluorescently labeled CD20 molecules.

[0034] Figure 14 Flow cytometry density plots demonstrating sequence-dependent rituximab target selection and corresponding sequences. Representative examples show multiple clones from a rituximab library consisting of CD20-binding variants and flow cytometry measurements of the binding affinity of each variant for fluorescently labeled CD20 molecules, as Figure 13 shown.

[0035] Figure 15 Demonstration of the gradual acquisition of IdeS resistance through single amino acid substitutions.

[0036] Figure 16 Demonstration of the binding of wild-type, L248E, and L248D hinge mutant rituximab to human FcγR. Wild-type or single amino acid mutants of rituximab (L248E and L248E) were expressed as type I membrane proteins on CHO cells and their expression and binding to human FcγR extracellular domains were tested using fluorescently labeled anti-human Fc. Detailed Description

[0037] I. Definitions

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In this specification and the following claims, reference will be made to a number of terms that shall be defined to have the following meanings:

[0039] As used herein, the term "antibody" is used in accordance with its ordinary and customary meaning and refers to a polypeptide encoded by an immunoglobulin gene or functional fragment thereof that specifically binds to and recognizes an antigen. The recognized immunoglobulin genes include the κ, λ, α, γ, δ, ε, and μ constant region genes, as well as numerous immunoglobulin variable region genes. Light chains are classified as κ or λ. Heavy chains are classified as γ, μ, α, δ, or ε, which in turn define the immunoglobulin classes IgG, IgM, IgA, IgD, and IgE, respectively. The term "antibody" also encompasses bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies.

[0040] As used herein, when referring to a protein or peptide, the terms "specifically (or selectively) binds" or "specifically (or selectively) immunoreactive with a protein or peptide" are used in accordance with their ordinary and customary meaning and refer to a binding reaction that identifies the presence of a protein, typically in a heterogeneous population of proteins and other biological products. Thus, under specified immunoassay conditions, the binding of a specified antibody to a particular protein is at least twice that of the background and more typically greater than 10- to 100-fold that of the background. Specific binding to an antibody under such conditions requires selection of an antibody that is specific for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that specifically immunoreact with the selected antigen and not with other proteins. This selection can be achieved by subtracting antibodies that cross-react with other molecules. A variety of immunoassay formats can be used to select antibodies that specifically immunoreact with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies that specifically immunoreact with a protein (see, e.g., Harlow and Lane, Using Antibodies, A Laboratory Manual (1998), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).

[0041] Examples of immunoglobulin (antibody) structural units include tetramers. Each tetramer is composed of two pairs of identical polypeptide chains, each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids, which is primarily responsible for antigen recognition. The term "variable heavy chain", "V H " or "VH" refers to the variable region of an immunoglobulin heavy chain and includes Fv, scFv, dsFv, or Fab; while the term "variable light chain", "V L " or "VL" refers to the variable region of an immunoglobulin light chain and includes Fv, scFv, dsFv, or Fab.

[0042] Examples of antibody functional fragments include, but are not limited to, whole antibody molecules, antibody fragments such as Fv, single-chain Fv (scFv), complementarity-determining regions (CDRs), V L (light chain variable region), V H (heavy chain variable region), Fab, F(ab)2', and any combination of these or any other functional portion of an immunoglobulin peptide capable of binding to a target antigen (see, e.g., Fundamental Immunology (F UNDAMENTAL I MMUNOLOGY ) (edited by Paul, 4th ed. 2001)). As will be appreciated by those skilled in the art, various antibody fragments can be obtained by a variety of methods, such as digesting whole antibodies with enzymes (such as pepsin); or de novo synthesis. Antibody fragments are generally synthesized de novo by chemical methods or using recombinant DNA methods. Thus, as used herein, the term antibody includes antibody fragments produced by modifying whole antibodies, or antibody fragments synthesized de novo using recombinant DNA methods (e.g., single-chain Fv) or antibody fragments identified using phage display libraries.

[0043] As used herein, the term "chimeric antibody" is used in its general and ordinary sense and refers to an antibody molecule in which (a) the constant region or a portion thereof is altered, replaced, or exchanged such that the antigen-binding site (variable region) is linked to a different or altered class, effector function, and / or species, or a completely different molecule that confers new properties to the chimeric antibody, such as the constant region of an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region or a portion thereof is altered, replaced, or exchanged with a variable region having a different or altered antigen specificity. Preferred antibodies of the invention and for use according to the invention include humanized and / or chimeric monoclonal antibodies.

[0044] As used herein, the term "therapeutic antibody" is used in its ordinary and customary sense and refers to an antibody that can be used to treat a disease. A therapeutic antibody can activate, inhibit, or alter the endogenous immune response to a particular cell or molecule. In embodiments, the therapeutic antibody is an antibody that can be used to treat cancer, inflammatory, and / or autoimmune diseases. In embodiments, the therapeutic antibody is an antibody that can be used to treat cancer. In embodiments, the therapeutic antibody is an IgG antibody and such embodiments may be referred to as therapeutic IgG or therapeutic IgG antibody. Examples of therapeutic antibodies include Abciximab, Adalimumab, Alemtuzumab, Alemtuzumab, Alirocumab, Arcitumomab, Atezolizumab, Avelumab, Basiliximab, Belimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Brentuximab, Brodalumab, Canakinumab, Capromab, Catumaxomab, Certolizumab pegol, Cetuximab, Daratumumab, Denosumab, Dinutuximab, Dupilumab, Durvalumab, Eculizumab, Efalizumab, Elotuzumab, Fanolesomab, Gemtuzumabozogamicin), Golimumab, Ibritumomab tiuxetan, Idarucizumab, Imiciromab, Infliximab, Ipilimumab, Mepolizumab, Muromonab-CD3, Natalizumab, Necitumumab, Nivolumab, Nofetumomab, Obiltoxaximab, Obinutuzumab, Ocrelizumab, Ofatumumab, Olaratumab, Omalizumab, Palivizumab, Panitumumab, Pembrolizumab, Pertuzumab, Ramucirumab, Ranibizumab, Raxibacumab, Reslizumab, Rituximab, Satumomab, Secukinumab, Siltuximab, Sulesomab, Tocilizumab, Tositumomab, Trastuzumab, Trastuzumab emtansine, Ustekinumab, Vedolizumab, Volocumab, and Votumumab.

[0045] As used herein, the term "rituximab" is used according to its ordinary and customary meaning and refers to a monoclonal antibody therapeutic agent that targets the CD20 antigen expressed on the surface of B cells and was invented by Genentech, Inc. It is also known by the brand names Rituxan (Genentech, Inc.), Rituxan Sc (Hoffman-LaRoche, Inc.), and the biosimilar Truxima (Celltiron, Cephalon, Inc.). The hinge region is designated by Kabat numbering as positions 246-252 and alternatively can be designated by, for example, the numbering used in US 7317091 as positions 233-239.

[0046] As used herein, the term "cancer" is used according to its ordinary and customary meaning and refers to all types of cancers, tumors, or malignancies found in mammals (e.g., humans), including leukemia, lymphoma, carcinoma, and sarcoma. Examples of cancers that can be treated with the compounds, compositions, or methods provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, head cancer, Hodgkin's Disease, and non-Hodgkin's lymphoma. Additional examples include thyroid cancer, cholangiocarcinoma, pancreatic cancer, cutaneous malignant melanoma, colon adenocarcinoma, rectal adenocarcinoma, gastric adenocarcinoma, esophageal cancer, head and neck squamous cell carcinoma, invasive breast cancer, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung cancer, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, essential thrombocythemia, Waldenström's macroglobulinemia, primary brain tumor, malignant insulinoma of the pancreas, malignant carcinoid, urinary bladder cancer, pre-cancerous skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, endocrine or exocrine pancreatic tumors, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, or prostate cancer.

[0047] The term "leukemia" is used according to its general and ordinary meaning and refers to a progressive, malignant disease of the blood-forming organs and is generally characterized by the deregulated proliferation and development of white blood cells and their precursors in the blood and bone marrow. Leukemias are typically clinically classified based on: (1) the duration and nature of the acute or chronic disease; (2) the type of cells involved; myeloid (myelogenous), lymphoid (lymphocytic), or monocytic; and (3) the increase or non-increase in the number of abnormal cells in the blood - leukemic or non-leukemic (sub-leukemic). Examples of leukemias that can be treated with the compounds or methods provided herein include, for example, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, aleukocytosis leukemia, basophilic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, cutaneous leukemia, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy cell leukemia, hemoblastic leukemia, hemocytoblast leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, aleukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, microgranulocytic leukemia, monocytic leukemia, myeloblastoid leukemia, myelocytic leukemia, myelogranulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, sub-leukemic leukemia, or undifferentiated cell leukemia.

[0048] "Patient" or "subject in need" is used according to its general and ordinary meaning and refers to a living organism that is suffering from or is susceptible to a disease or condition that can be treated by administration of a composition, compound, or method as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammals. In some embodiments, the patient is a human. In an embodiment, the subject has, has had, or is suspected of having cancer.

[0049] As used herein, the terms "control" or "control experiment" are used according to their ordinary and common meaning and refer to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment, except that the procedure, reagent, or variable of the experiment is omitted. In some cases, the control is used as a standard of comparison in evaluating the effect of the experiment. In some embodiments, the control is a measure of the activity of a protein in the absence of a compound as described herein (including in the examples and instances).

[0050] As used herein, the terms "treating" or "treatment" are used according to their ordinary and common meaning and refer to any indication of successful treatment or amelioration of an injury, disease, pathology, or condition, including any objective or subjective parameter, such as, elimination; remission; alleviation of symptoms or making the injury, pathology, or condition more tolerable to the patient; slowing the rate of degeneration or decline; or making the endpoint of degeneration less debilitating; improving the physical or mental health of the patient. Treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, a neuropsychiatric examination, and / or a psychiatric evaluation. The term "treatment" and its conjugates can include the prevention of an injury, pathology, condition, or disease. In an embodiment, treatment includes prevention. In an embodiment, treatment does not include prevention.

[0051] As used herein, the term "percent sequence identity" is used according to its ordinary and common meaning and is determined by comparing two optimally aligned sequences over a comparison window, wherein a portion of the polynucleotide sequence or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence for the optimal alignment of the two sequences (which does not include additions or deletions). The percentage is calculated by: determining the number of positions at which the same nucleic acid base or amino acid residue occurs in the two sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity.

[0052] As used herein, the terms "identical" or "identity" percentage are used according to their ordinary and common meaning and in the context of two or more nucleic acid or polypeptide sequences refer to two or more sequences that are identical or have a specified percentage of amino acid residues that are the same or nucleotides that are the same (i.e., when compared and aligned for maximum correspondence over a comparison window or specified region, about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over the specified region) as measured using the BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below or by manual alignment and visual inspection (see, e.g., the NCBI website http: / / www.ncbi.nlm.nih.gov / BLAST / etc.). Such sequences are then referred to as "substantially identical". This definition also relates to or can apply to the complement of a test sequence. The definition also encompasses sequences with deletions and / or additions, as well as sequences with substitutions. As described below, preferred algorithms can account for gaps, etc. Preferably, the identity exists over a region of at least about 25 amino acids or nucleotides, or more preferably over a region of 50 - 100 amino acids or nucleotides.

[0053] As used herein, the terms "affinity selection" or "affinity maturation" are used according to their ordinary and common meaning and refer to the process by which antibodies typically evolve from a reference antibody by mutation of one or more amino acid residues such that the activity against a target antigen is increased compared to the activity of the corresponding form of the reference antibody against the same target antigen. Thus, the evolved antibody is optimized compared to the reference antibody. The refined antibody can be selected by various biophysical and in vitro methods.

[0054] As used herein, the term "fusion protein" is used according to its ordinary and common meaning and refers to a polypeptide chain that is covalently linked and derived from two or more different proteins or genes.

[0055] As used herein, the terms "CD16 protein" or "CD16" or "FcγRIII" or "Fcγ receptor III" are used according to their ordinary and common meaning and refer to the receptor CD16 or cluster of differentiation 16 (CD16) in recombinant or naturally occurring form or any of its variants or homologs that maintain CD16 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to CD16). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the naturally occurring CD16 protein. In embodiments, the CD16 protein is substantially identical to the protein identified by UniProt reference number P08637 or a variant or homolog that is substantially the same as it. In embodiments, the CD~16 protein is substantially identical to the protein identified by UniProt reference number Q9ULV2 or a variant or homolog that is substantially the same as it. CD16 is a receptor for the IgG Fc region and mediates antibody-dependent cell cytotoxicity (ADCC).

[0056] As used herein, the terms "CD32 protein" or "CD32" or "FcγRII" or "Fcγ receptor II" are used according to their ordinary and common meaning and refer to the receptor CD32 or cluster of differentiation 32 (CD32) in recombinant or naturally occurring form or any of its variants or homologs that maintain CD32 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to CD32). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the naturally occurring CD32 protein. In embodiments, the CD32 protein is substantially identical to the protein identified by UniProt reference number P12318 or a variant or homolog that is substantially the same as it. In embodiments, the CD32 protein is substantially identical to the protein identified by UniProt reference number P31994 or a variant or homolog that is substantially the same as it. In embodiments, the CD32 protein is substantially identical to the protein identified by UniProt reference number P31995 or a variant or homolog that is substantially the same as it. CD32 is a receptor for the Fc region of complexed or aggregated IgG and mediates B cell activation, phagocytosis and endocytosis of immune complexes.

[0057] As used herein, the terms "CD64 protein" or "CD64" or "FcγRI" or "Fcγ receptor I" are used according to their ordinary and common meaning and refer to the receptor CD64 or cluster of differentiation 64 (CD64) in recombinant or naturally-occurring form or any of its variants or homologs that maintain CD64 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to CD64). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the naturally-occurring CD64 protein. In embodiments, the CD64 protein is substantially the same as the protein identified by UniProt reference number P****** or a variant or homolog that is substantially the same thereto. In embodiments, the CD64 protein is substantially the same as the protein identified by UniProt reference number Q****** or a variant or homolog that is substantially the same thereto. In embodiments, the CD64 protein is substantially the same as the protein identified by UniProt reference number P****** or a variant or homolog that is substantially the same thereto. CD****** is a high-affinity receptor that binds non-complexed immunoglobulins.

[0058] As used herein, the terms "EGFR protein" or "EGFR" or "HER1" are used according to their ordinary and common meaning and refer to the epidermal growth factor receptor (EGFR) in recombinant or natural form that is also known as ErbB-1 or HER1 in humans or any of its variants or homologs that maintain EGFR activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to EGFR). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the naturally-occurring EGFR protein. In embodiments, the EGFR protein is substantially the same as the protein identified by UniProt reference number P****** or a variant or homolog that is substantially the same thereto. EGFR is a receptor tyrosine kinase.

[0059] Please note that the "******" in the translated text where the UniProt reference numbers are partially masked should be replaced with the actual reference numbers in the original text for a complete and accurate translation.As used herein, the term "PDGFR protein" or "PDGFR" is used according to its ordinary and common meaning and refers to the platelet-derived growth factor receptor (PDGFR) in recombinant or native form or any of its variants or homologs that maintain PDGFR activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to PDGFR). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the native EGFR protein. In an embodiment, the PDGFR protein is substantially the same as the protein PDGFR-α identified by UniProt reference number P16234 or a variant or homolog that is substantially the same therewith. In an embodiment, the PDGFR protein is substantially the same as the protein PDGFR-β identified by UniProt reference number P09619 or a variant or homolog that is substantially the same therewith. PDGFR is a receptor tyrosine kinase.

[0060] As used herein, the term "HER-2 protein" or "HER2" or "human epidermal growth factor receptor 2" or "receptor tyrosine-protein kinase ERBB-2" or "ERBB2" or "proto-oncogene Neu" or "CD340" or "cluster of differentiation 340" is used according to its ordinary and common meaning and refers to the human epidermal growth factor receptor 2 (HER2) in recombinant or native form or any of its variants or homologs that maintain HER2 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to HER2). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the native HER2 protein. In an embodiment, the HER2 protein is substantially the same as the protein identified by UniProt reference number P04626 or a variant or homolog that is substantially the same therewith. HER2 is a receptor tyrosine kinase.

[0061] As used herein, the terms "HER-3 protein" or "HER3" or "human epidermal growth factor receptor 3" or "receptor tyrosine-protein kinase ERBB-3" or "ERBB3" or "proto-oncogene-like protein c-ErbB-3" are used according to their ordinary and common meaning and refer to human epidermal growth factor receptor 3 (HER3) in recombinant or native form or any of its variants or homologs that maintain HER3 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to HER3). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native HER3 protein. In an embodiment, the HER3 protein is substantially identical to the protein identified by UniProt reference number P21860 or a variant or homolog that is substantially the same as it. HER3 is a receptor tyrosine kinase.

[0062] As used herein, the terms "HER-4 protein" or "HER4" or "human epidermal growth factor receptor 4" or "receptor tyrosine-protein kinase ERBB-4" or "ERBB4" or "proto-oncogene-like protein c-ErbB-4" are used according to their ordinary and common meaning and refer to human epidermal growth factor receptor 4 (HER4) in recombinant or native form or any of its variants or homologs that maintain HER4 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to HER4). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native HER4 protein. In an embodiment, the HER4 protein is substantially identical to the protein identified by UniProt reference number Q15303 or a variant or homolog that is substantially the same as it. HER4 is a receptor tyrosine kinase.

[0063] As used herein, the terms "FGFR-1 protein" or "FGFR1" or "fibroblast growth factor receptor 1" or "basic fibroblast growth factor receptor" or "N-sam" or "proto-oncogene c-Fgr" are used according to their ordinary and common meaning and refer to fibroblast growth factor receptor 1 (FGFR1) in recombinant or native form or any of its variants or homologs that maintain FGFR1 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to FGFR1). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-amino acid contiguous portion) compared to the native FGFR1 protein. In an embodiment, the FGFR1 protein is substantially identical to the protein identified by UniProt reference number P11362 or a variant or homolog that is substantially the same as it. FGFR1 is a receptor tyrosine kinase.

[0064] As used herein, the terms "FGFR-2 protein" or "FGFR2" or "fibroblast growth factor receptor 2" or "keratinocyte growth factor receptor" or "K-sam" are used according to their ordinary and common meaning and refer to fibroblast growth factor receptor 2 (FGFR2) in recombinant or native form or any of its variants or homologs that maintain FGFR2 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to FGFR2). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-amino acid contiguous portion) compared to the native FGFR2 protein. In an embodiment, the FGFR2 protein is substantially identical to the protein identified by UniProt reference number P21802 or a variant or homolog that is substantially the same as it. FGFR2 is a receptor tyrosine kinase.

[0065] As used herein, the terms "FGFR-3 protein" or "FGFR3" or "fibroblast growth factor receptor 3" are used according to their ordinary and common meaning and refer to fibroblast growth factor receptor 3 (FGFR3) in recombinant or native form or any of its variants or homologs that maintain FGFR3 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to FGFR3). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native FGFR3 protein. In embodiments, the FGFR3 protein is substantially identical to the protein identified by UniProt reference number P22607 or a variant or homolog that is substantially the same as it. FGFR3 is a receptor tyrosine kinase.

[0066] As used herein, the terms "FGFR-4 protein" or "FGFR4" or "fibroblast growth factor receptor 4" are used according to their ordinary and common meaning and refer to fibroblast growth factor receptor 4 (FGFR4) in recombinant or native form or any of its variants or homologs that maintain FGFR4 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to FGFR4). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native FGFR4 protein. In embodiments, the FGFR4 protein is substantially identical to the protein identified by UniProt reference number P22455 or a variant or homolog that is substantially the same as it. FGFR4 is a receptor tyrosine kinase.

[0067] As used herein, the term "VEGFR-1 protein" or "VEGFR1" or "vascular endothelial growth factor receptor 1" is used according to its ordinary and common meaning and refers to vascular endothelial growth factor receptor 1 (VEGFR1) in recombinant or native form or any of its variants or homologs that maintain VEGFR1 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to VEGFR1). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the native VEGFR1 protein. In an embodiment, the VEGFR1 protein is substantially identical to the protein identified by UniProt reference number P17948 or a variant or homolog that is substantially the same as it. VEGFR1 is a receptor tyrosine kinase.

[0068] As used herein, the term "VEGFR-2 protein" or "VEGFR2" or "vascular endothelial growth factor receptor 2" is used according to its ordinary and common meaning and refers to vascular endothelial growth factor receptor 1 (VEGFR2) in recombinant or native form or any of its variants or homologs that maintain VEGFR2 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to VEGFR2). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the native VEGFR2 protein. In an embodiment, the VEGFR2 protein is substantially identical to the protein identified by UniProt reference number P35968 or a variant or homolog that is substantially the same as it. VEGFR2 is a receptor tyrosine kinase.

[0069] As used herein, the terms "VEGFR-3 protein" or "VEGFR3" or "vascular endothelial growth factor receptor 3" are used according to their ordinary and common meaning and refer to vascular endothelial growth factor receptor 1 (VEGFR3) in recombinant or native form or any of its variants or homologs that maintain VEGFR3 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to VEGFR3). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native VEGFR3 protein. In an embodiment, the VEGFR3 protein is substantially the same as the protein identified by UniProt reference number P35916 or a variant or homolog that is substantially the same as it. VEGFR3 is a receptor tyrosine kinase.

[0070] As used herein, the terms "NTRK1 protein" or "NTRK1" or "Trk-A" or "high affinity nerve growth factor receptor" or "neurotrophic tyrosine kinase receptor type 1" or "tropomyosin-related kinase A" are used according to their ordinary and common meaning and refer to high affinity nerve growth factor receptor (NTRK1) in recombinant or native form or any of its variants or homologs that maintain NTRK1 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to NTRK1). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150- or 200-consecutive amino acid portion) compared to the native NTKR1 protein. In an embodiment, the NTKR1 protein is substantially the same as the protein identified by UniProt reference number P04629 or a variant or homolog that is substantially the same as it. NTKR1 is a receptor tyrosine kinase.

[0071] As used herein, the terms "NTRK2 protein" or "NTRK2" or "Trk-B" or "BDNF / NT-3 growth factor receptor" or "brain-derived neurotrophic growth factor receptor" are used according to their ordinary and common meaning and refer to the oncogene BDNF / NT-3 growth factor receptor (NTRK2) in recombinant or naturally occurring form or any of its variants or homologs that maintain NTRK2 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to NTRK2). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the naturally occurring NTKR2 protein. In an embodiment, the NTKR2 protein is substantially identical to the protein identified by UniProt reference number Q16620 or a variant or homolog that is substantially the same as it. NTKR2 is a receptor tyrosine kinase.

[0072] As used herein, the terms "NTRK3 protein" or "NTRK3" or "Trk-C" or "NT-3 growth factor receptor" are used according to their ordinary and common meaning and refer to the NT-3 growth factor receptor (NTRK3) in recombinant or naturally occurring form or any of its variants or homologs that maintain NTRK3 activity (e.g., maintaining activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to NTRK3). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the naturally occurring NTKR3 protein. In an embodiment, the NTKR3 protein is substantially identical to the protein identified by UniProt reference number Q16628 or a variant or homolog that is substantially the same as it. NTKR3 is a receptor tyrosine kinase.

[0073] As used herein, the term "IGF1R protein" or "IGF1R" or "insulin-like growth factor receptor" is used according to its ordinary and common meaning and refers to the insulin-like growth factor receptor (IGF1R) in recombinant or native form or any of its variants or homologs that maintain IGF1R activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to IGF1R). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the native IGF1R protein. In embodiments, the IGF1R protein is substantially identical to the protein identified by UniProt reference number P08069 or a variant or homolog that is substantially the same as it. IGF1R is a receptor tyrosine kinase.

[0074] As used herein, the term "glutamyl endopeptidase V8" or "GluV8" or "SspA" or "endopeptidase Glu-C" or "V8 protease" or "staphylococcal serine protease" is used according to its ordinary and common meaning and refers to the SspA protein in recombinant or native form or any of its variants or homologs that maintain SspA activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to SspA). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the native SspA polypeptide. In embodiments, SspA is the protein identified by UniProt reference number P0C1U8 or a variant or homolog that is substantially the same as it. SspA is a serine protease that preferentially cleaves the peptide bond at the carboxyl terminus of glutamic acid and aspartic acid.

[0075] As used herein, the term "immunoglobulin domain" or "Ig-domain" is used according to its ordinary and common meaning and refers to either a recombinant or naturally occurring form of an Ig-domain or any of its variants or homologs that maintain the Ig-domain fold or three-dimensional structure. Ig domains belong to a protein fold family consisting of a two-layer sandwich of 7-9 antiparallel β-strands arranged into two β-sheets with a Greek key topology. The folding pattern typically consists of an (N-terminal β-hairpin in sheet 1)-(β-hairpin in sheet 2)-(β-strand in sheet 1)-(C-terminal β-hairpin in sheet 2) linkage. Immunoglobulin domains are a major component of antibodies and are also a large number of cell surface receptors, including receptor tyrosine kinases.

[0076] As used herein, the term "immunoglobulin G" or "IgG" is used according to its ordinary and common meaning and refers to either a recombinant or naturally occurring form of an IgG antibody protein or any of its variants or homologs that maintain IgG activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to IgG). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to a naturally occurring IgG polypeptide. IgG antibodies are composed of four separate chains (two identical light chains and two identical heavy chains) that form a homodimer (by inter-heavy chain disulfide bonds) of heterodimers (inter-light and heavy chain disulfide bonds) in a typical Y-shaped quaternary structure. The light chain contains a variable immunoglobulin domain (V L ) and a constant immunoglobulin domain (C L ). The heavy chain contains one variable immunoglobulin domain (V H ) and three constant immunoglobulin domains (C H 1, C H 2, C H 3). The variable domains form the antigen recognition surface of the IgG antibody. IgG has four functionally distinct subclasses, IgG1, IgG2, IgG3 and IgG4. IgG1 mediates thymus-dependent immune responses against polypeptide and protein antigens. IgG2 mediates immune responses against polysaccharide or carbohydrate antigens. IgG3 mediates high affinity responses against protein and polypeptide antigens. IgG4 plays a role in responses related to food allergies, but its function is largely unknown.

[0077] As used herein, the term "Fc region" or "fragment crystallizable region" is used in accordance with its general and ordinary meaning and refers to the tail region (C-terminus) of an antibody in any recombinant or naturally occurring form that interacts with cell surface receptors known as Fc receptors. The Fc region contains two heavy chain constant Ig domains in antibodies IgG, IgA, and IgD and three heavy chain constant Ig domains in antibodies IgE and IgM.

[0078] As used herein, the term "Fab region" or "antigen-binding fragment region" is used in accordance with its general and ordinary meaning and refers to the tail region (N-terminus) of an antibody in any recombinant or naturally occurring form that contains antigen recognition and binding sites. The Fab region typically contains one variable domain and one constant domain of both the light chain and the heavy chain in antibodies IgG, IgA, IgD, and IgE and IgM.

[0079] As used herein, the term "hinge region" is used in accordance with its general and ordinary meaning and refers to the region of an antibody in any recombinant or naturally occurring form that corresponds to the polypeptide sequence that links the Fab domains and the Fc domain in the antibody, and / or the sequence that links two single-chain variable fragments (scFv) from the light chain and the heavy chain at the N-terminus of the antibody.

[0080] As used herein, the term "pepsin" or "pepsinogen A" is used in accordance with its general and ordinary meaning and refers to any recombinant or naturally occurring form of the pepsin protein or a variant or homolog thereof that maintains pepsin activity (e.g., maintains activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to pepsin). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150-, or 200-amino acid contiguous portion) compared to the naturally occurring pepsin polypeptide. In an embodiment, pepsin is the protein identified by NCBI sequence reference GI:387013, its homolog, or a functional fragment.

[0081] As used herein, the term "cathepsin G" or "cathepsin G protease" is used according to its ordinary and common meaning and refers to cathepsin G protein in recombinant or naturally occurring form or any of its variants or homologs that maintain cathepsin G activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to cathepsin G). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the naturally occurring cathepsin G polypeptide. In an embodiment, cathepsin G is the protein identified by NCBI sequence reference GI:4503149, its homolog or functional fragment.

[0082] As used herein, the term "MMP3" or "MMP3 protease" is used according to its ordinary and common meaning and refers to matrix metalloproteinase 3 (MMP3) in recombinant or naturally occurring form or any of its variants or homologs that maintain MMP3 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to MMP3). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the naturally occurring MMP3 polypeptide. In an embodiment, MMP3 is the protein identified by NCBI sequence reference GI:77567646, its homolog or functional fragment.

[0083] As used herein, the term "MMP7" or "MMP7 protease" is used according to its ordinary and common meaning and refers to matrix metalloproteinase 7 (MMP7) in recombinant or naturally occurring form or any of its variants or homologs that maintain MMP7 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to MMP7). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 consecutive amino acid portion) compared to the naturally occurring MMP7 polypeptide. In an embodiment, MMP7 is the protein identified by NCBI sequence reference GI:116861, its homolog or functional fragment.

[0084] As used herein, the term "MMP12" or "MMP12 protease" is used according to its ordinary and common meaning and refers to matrix metalloproteinase 9 (MMP12) in recombinant or naturally occurring form or any of its variants or homologs that maintain MMP12 activity (e.g., maintain activity within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to MMP12). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150-, or 200-consecutive amino acid portion) compared to the naturally occurring MMP12 polypeptide. In an embodiment, MMP12 is the protein identified by NCBI sequence reference GI:73858572, its homolog, or a functional fragment.

[0085] As used herein, the term "type I transmembrane protein" is used according to its ordinary and common meaning and refers to any membrane protein in recombinant or naturally occurring form that contains a single-pass transmembrane region, wherein the N-terminus of the protein is localized to the extracellular surface.

[0086] As used herein, the term "CHO cell" or "Chinese hamster ovary cell" is used according to its ordinary and common meaning and refers to any epithelial cell line derived from the Chinese hamster ovary.

[0087] As used herein, the term "Kabat numbering" or "Kabat position" is used according to its ordinary and common meaning and refers to a scheme for numbering amino acid residues in antibodies based on the variable regions. This scheme is useful in comparing these variable regions between antibodies. In an embodiment, according to other numbering systems, the L248 position of the anti-CD20 antibody rituximab correlates with L325 of the antibody sequence.

[0088] As used herein, the term "expression vector" or "expression construct" is used according to its simple and common meaning and refers to any recombinant or naturally occurring form of a bacterial plasmid, bacmid, or virus or its variants or homologs used to express a target gene of interest as a protein product. The target of interest can be any gene of interest, including genes encoding naturally occurring proteins, any portion of a naturally occurring protein or a modified variant, chimeric proteins, tagged proteins, or de novo designed protein sequences. The expression vector must contain elements necessary for gene expression, including but not limited to a promoter sequence, ribosome binding sequence, start codon, target sequence of interest, and stop codon. The expression vector can be modified by any genetic engineering process or technique, including but not limited to polymerase chain reaction (PCR), restriction endonuclease digestion and DNA ligation, Gibson cloning, and CRISPR-related gene editing.

[0089] As used herein, the term "surface display" is used in its ordinary and common meaning and refers to the process in which a cellular system is used to express a protein or peptide on the cell surface. The cellular system can be prokaryotic or eukaryotic and can include bacteria, yeast, insect, and mammalian cells. Surface display is achieved by expressing the protein of interest as a fusion protein, which generally contains a protein endogenously expressed in the selected cellular system and a partial or full sequence of the protein of interest.

[0090] As used herein, the term "cytotoxicity" is used in its ordinary and common meaning and refers to the property of being toxic to cells.

[0091] As used herein, the terms "antibody-dependent cytotoxicity", "ADCC", and "antibody-dependent cell-mediated cytotoxicity" are used in their plain and ordinary meaning and refer to the immune mechanism by which effector cells bearing Fc receptors can recognize and kill antibody-coated target cells that express tumor or pathogen-derived antigens on their surface.

[0092] As used herein, the terms "antibody-dependent cell phagocytosis" and "ADCP" are used in their ordinary and common meaning and refer to the mechanism by which antibody-opsonized target cells activate Fc receptors on the surface of macrophages to induce phagocytosis, resulting in the uptake and degradation of the target cells. Macrophage Fc receptors refer to all classes of Fcγ receptors.

[0093] As used herein, the terms "adaptive immune response", "acquired immune system", and "specific immune system" are used in their ordinary and common meaning and refer to the subsystem of the entire immune system that consists of specialized systemic cells and processes for eliminating a designated target. The target is designated by immune memory identification. Immune memory is created when the immune system encounters an immune attack previously and retains its record.

[0094] As used herein, the term "dissociation constant" or "Kd" is used in its ordinary and common meaning and refers to a specific type of equilibrium constant that measures the tendency of two molecules to associate with each other. In biochemistry, the dissociation constant is used to describe the relative affinity between a protein and a ligand, such as the affinity of an antibody for an antigen. Generally, the dissociation constant Kd can be described by the equation

[0095]

[0096] where [P] is the molar concentration of the protein, [L] is the molar concentration of the ligand, and [PL] is the molar concentration of the protein-ligand complex.

[0097] II. Antibodies

[0098] On the one hand, the present disclosure provides an immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region linked by a hinge region, wherein the hinge region is resistant to protease cleavage.

[0099] In embodiments, the IgG antibody is selected from IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, and IgG4 antibodies. In an embodiment, the IgG antibody is an IgG1 antibody. In an embodiment, the IgG antibody is an IgG2 antibody. In an embodiment, the IgG antibody is an IgG3 antibody. In an embodiment, the IgG antibody is an IgG4 antibody.

[0100] In embodiments, the hinge region is resistant to protease cleavage. In an embodiment, resistance to protease cleavage means that the protease cannot cleave the antibody at the amino acid sequence within the hinge region. In an embodiment, the amino acid sequence of the hinge region confers resistance to protease cleavage. In an embodiment, the resistance to protease cleavage is related to a native or wild-type hinge region sequence. In an embodiment, the native or wild-type hinge sequence is an amino acid sequencing comprising ELLGGPS (SEQ ID NO: 544). In an embodiment, the resistance to protease cleavage is related to a known sequence control. In an embodiment, the known sequence is an amino acid sequence comprising ELLGGPS (SEQ ID NO: 544) that is sensitive to cleavage by IgG endopeptidase. In an embodiment, the human IgG2 hinge region comprising the amino acid sequence PVAGPS is resistant to IgG endopeptidase cleavage and can be used as a negative control. In an embodiment, using a specific known assay, the resistance to protease cleavage is higher than a certain threshold level. In an embodiment, the assay can be enzyme digestion of IgG and SDS-PAGE and Coomassie staining to determine the molecular weight of the digestion fragments.

[0101] In an embodiment, the hinge region comprises a protease-resistant sequence. In an embodiment, according to the Kabat numbering, the sequence is between amino acid positions 246 to 252. In an embodiment, the sequence is the position corresponding to Kabat positions 246 to 252. In an embodiment, the protease-resistant sequence has a length of two or more amino acids. In an embodiment, the protease-resistant sequence has a length of three amino acids. In an embodiment, the protease-resistant sequence has a length of four amino acids. In an embodiment, the protease-resistant sequence has a length of five amino acids. In an embodiment, the protease-resistant sequence has a length of six amino acids. In an embodiment, the protease-resistant sequence has a length of seven amino acids. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:545. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:546. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:547.

[0102] In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10-6 M to approximately 1×10 -9 M, approximately 1×10 -6 M to approximately 1×10 -8 M, approximately 1×10 -6 M to approximately 1×10 -7 M, approximately 1×10 -7 M to approximately 1×10 -13 M, approximately 1×10 -7 M to approximately 1×10 -12 M, approximately 1×10 -7 M to approximately 1×10 -11 M, approximately 1×10 -7 M to approximately 1×10 -10 M, approximately 1×10 -7 M to approximately 1×10 -9 M, approximately 1×10 -7 M to approximately 1×10 -8 M, approximately 1×10 -8 M to approximately 1×10 -13 M, approximately 1×10 -8 M to approximately 1×10 -12 M, approximately 1×10 -8 M to approximately 1×10 -11 M, approximately 1×10 -8 M to approximately 1×10 -10 M, approximately 1×10 -8 M to approximately 1×10 -9 M, approximately 1×10 -9 M to approximately 1×10 -13 M, approximately 1×10 -9 M to approximately 1×10 -12 M, approximately 1×10 -9 M to approximately 1×10 -11 M, approximately 1×10 -9 M to approximately 1×10 -10 M, approximately 1×10 -10 M to approximately 1×10 -13 M, approximately 1×10 -10 M to approximately 1×10 -12 M, approximately 1×10 - 10 M to approximately 1×10 -11 M, approximately 1×10 -11 M to approximately 1×10 -13 M, approximately 1×10 -11 M to approximately 1×10 -12 M or approximately 1×10 -12 M to approximately 1×10 -13M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 - 8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M, or about 1×10 -13 M.

[0103] In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD32 (FcγRII) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for CD32 (FcγRII) is from about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 - 10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10-12 M or about 1×10 -13 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -5 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -6 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -7 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -8 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -9 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -10 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -11 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -12 In the examples, the dissociation constant of the Fc region of the IgG antibodies described herein for CD32 (FcγRII) is about 1×10 -13 M.

[0104] In the examples, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 M. In the examples, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 In an embodiment, the dissociation constant of the Fc region for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5M to approximately 1×10 -7 M, approximately 1×10 -5 M to approximately 1×10 -6 M, approximately 1×10 -6 M to approximately 1×10 -13 M, approximately 1×10 -6 M to approximately 1×10 -12 M, approximately 1×10 -6 M to approximately 1×10 -11 M, approximately 1×10 -6 M to approximately 1×10 -10 M, approximately 1×10 -6 M to approximately 1×10 -9 M, approximately 1×10 -6 M to approximately 1×10 -8 M, approximately 1×10 -6 M to approximately 1×10 -7 M, approximately 1×10 -7 M to approximately 1×10 -13 M, approximately 1×10 -7 M to approximately 1×10 -12 M, approximately 1×10 -7 M to approximately 1×10 -11 M, approximately 1×10 -7 M to approximately 1×10 -10 M, approximately 1×10 -7 M to approximately 1×10 -9 M, approximately 1×10 -7 M to approximately 1×10 -8 M, approximately 1×10 -8 M to approximately 1×10 -13 M, approximately 1×10 -8 M to approximately 1×10 -12 M, approximately 1×10 -8 M to approximately 1×10 -11 M, approximately 1×10 -8 M to approximately 1×10 -10 M, approximately 1×10 -8 M to approximately 1×10 -9 M, approximately 1×10 -9 M to approximately 1×10 -13 M, approximately 1×10 -9 M to approximately 1×10 -12 M, approximately 1×10 -9 M to approximately 1×10 -11 M, approximately 1×10 -9 M to approximately 1×10 - 10 M, approximately 1×10 -10 M to approximately 1×10 -13 M, approximately 1×10-10 M to approximately 1×10 -12 M, approximately 1×10 -10 M to approximately 1×10 -11 M, approximately 1×10 -11 M to approximately 1×10 -13 M, approximately 1×10 -11 M to approximately 1×10 -12 M or approximately 1×10 -12 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -5 M, approximately 1×10 -6 M, approximately 1×10 -7 M, approximately 1×10 -8 M, approximately 1×10 -9 M, approximately 1×10 -10 M, approximately 1×10 -11 M, approximately 1×10 -12 M or approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is approximately 1×10 -13 M.

[0105] In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the said Fc region for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -12 M, from about 1×10 -5 M to about 1×10 -11 M, from about 1×10 -5 M to about 1×10 -10 M, from about 1×10 -5 M to about 1×10 -9 M, from about 1×10 -5 M to about 1×10 - 8 M, from about 1×10 -5 M to about 1×10 -7 M, from about 1×10 -5 M to about 1×10 -6 M, from about 1×10 -6 M to about 1×10 -13 M, from about 1×10 - 6 M to about 1×10 -12 M, from about 1×10 -6 M to about 1×10 -11 M, from about 1×10 -6 M to about 1×10 -10 M, from about 1×10 -6 M to about 1×10 -9 M, from about 1×10 -6 M to about 1×10 -8 M, from about 1×10 -6 M to about 1×10 -7 M, from about 1×10 -7 M to about 1×10 -13 M, from about 1×10 -7 M to about 1×10 -12 M, from about 1×10 -7 M to about 1×10 -11 M, from about 1×10 -7 M to about 1×10 -10 M, from about 1×10 -7 M to about 1×10 -9 M, from about 1×10 -7 M to about 1×10 -8M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -7M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -13 M.

[0106] In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease. In an embodiment, the protease is an IgG-specific protease. In an embodiment, the protease is an IgG endopeptidase. In an embodiment, the IgG endopeptidase is selected from IdeS and IdeZ. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeS protease. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeZ protease.

[0107] In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the amino acid sequence of ELLGGPS (SEQ ID NO: 544). In an embodiment, the protease specific for the ELLGGPS amino acid sequence includes but is not limited to pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0108] In one aspect, provided herein are immunoglobulin G (IgG) antibodies, wherein the antibody comprises a Fab region and an Fc region linked by a hinge region, wherein the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M.

[0109] In an embodiment, the IgG antibody is selected from IgG1 antibody, IgG2 antibody, IgG3 antibody, and IgG4 antibody. In an embodiment, the IgG antibody is an IgG1 antibody. In an embodiment, the IgG antibody is an IgG2 antibody. In an embodiment, the IgG antibody is an IgG3 antibody. In an embodiment, the IgG antibody is an IgG4 antibody.

[0110] In an embodiment, the Fc region of the IgG antibody described herein has a dissociation constant for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -12 M, about 1×10-5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×1� -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 U -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10-9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 - 10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 - 8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M.

[0111] In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD32 (FcγRII) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for CD32 (FcγRII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 - 10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10-12 M, about 1 × 10 -10 M to about 1 × 10 -11 M, about 1 × 10 -11 M to about 1 × 10 -13 M, about 1 × 10 -11 M to about 1 × 10 -12 M or about 1 × 10 -12 M to about 1 × 10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -5 M, about 1 × 10 -6 M, about 1 × 10 -7 M, about 1 × 10 -8 M, about 1 × 10[[ID=2*]] -9 M, about 1 × 10 -10 M, about 1 × 10 -11 M, about 1 × 10 -12 M or about 1 × 10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1 × 10 -13 M.

[0112] In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1 × 10-5 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is from approximately 1×10 -5 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the said Fc region for CD16 (FcγRIII) is from approximately 1×10 -5 M to approximately 1×10 -12 M, approximately 1×10 -5 M to approximately 1×10 -11 M, approximately 1×10 -5 M to approximately 1×10 -10 M, approximately 1×10 -5 M to approximately 1×10 -9 M, approximately 1×10 -5 M to approximately 1×10 -8 M, approximately 1×10 -5 M to approximately 1×10 -7 M, approximately 1×10 -5 M to approximately 1×10 -6 M, approximately 1×10 -6 M to approximately 1×10 -13 M, approximately 1×10 -6 M to approximately 1×10 -12 M, approximately 1×10 -6 M to approximately 1×10 -11 M, approximately 1×10 -6 M to approximately 1×10 -10 M, approximately 1×10 -6 M to approximately 1×10 -9 M, approximately 1×10 -6 M to approximately 1×10 -8 M, approximately 1×10 -6 M to approximately 1×10 -7 M, approximately 1×10 -7 M to approximately 1×10 -13 M, approximately 1×10 -7 M to approximately 1×10 -12 M, approximately 1×10 -7 M to approximately 1×10 -11 M, approximately 1×10 -7 M to approximately 1×10 -10 M, approximately 1×10 -7 M to approximately 1×10 -9 M, approximately 1×10 -7 M to approximately 1×10 -8 M, approximately 1×10 -8 M to approximately 1×10 -13 M, approximately 1×10 -8M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 - 10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -7M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -13 M.

[0113] In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the said Fc region for CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 - 8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 - 6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10-6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -13 M.

[0114] In embodiments, compared to wild-type Fc, the Fc region comprises one or more amino acid substitutions that confer higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, compared to wild-type Fc, the Fc region comprises one or more amino acid substitutions that confer higher binding affinity for CD32 (FcγRII). In embodiments, compared to wild-type Fc, the Fc region comprises one or more amino acid substitutions that confer higher binding affinity for CD16 (FcγRIII). In embodiments, compared to wild-type Fc, the Fc region comprises one or more amino acid substitutions that confer higher binding affinity for CD64 (FcγRI).

[0115] In embodiments, compared to wild-type Fc, the Fc region comprises one or more amino acid substitutions that confer higher binding affinity for CD16 (FcγRIII) and are selected from S252D, I351E, and A349L according to Kabat numbering. In embodiments, the Fc region comprises the S252D amino acid substitution. In embodiments, the Fc region comprises the I351E amino acid substitution. In embodiments, the Fc region comprises the A349L amino acid substitution. In embodiments, the Fc region comprises the S252D and I351E amino acid substitutions. In embodiments, the Fc region comprises the S252D, I351E, and A349L amino acid substitutions.

[0116] In embodiments, the dissociation constant of the Fc region of the IgG antibody for CD32 (FcγRII) is from about 1×10 -5 M to about 1×10 -13 M. In embodiments, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is from about 1×10 -5 M to about 1×10 -13 M. In embodiments, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M.

[0117] In embodiments, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease. In embodiments, the protease is an IgG-specific protease. In embodiments, the IgG-specific protease is selected from IdeS and IdeZ. In embodiments, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeS protease. In embodiments, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeZ protease.

[0118] In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the ELLGGPS amino acid sequence (SEQ ID NO: 544). In an embodiment, the protease specific for the ELLGGPS amino acid sequence includes but is not limited to pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0119] In an embodiment, the hinge region comprises a protease-resistant sequence. In an embodiment, according to Kabat numbering, the sequence is between amino acid positions 246 and 252. In an embodiment, the sequence is between positions corresponding to Kabat positions 246 to 252. In an embodiment, the protease-resistant sequence has a length of two or more amino acids. In an embodiment, the protease-resistant sequence has a length of three amino acids. In an embodiment, the protease-resistant sequence has a length of four amino acids. In an embodiment, the protease-resistant sequence has a length of five amino acids. In an embodiment, the protease-resistant sequence has a length of six amino acids. In an embodiment, the protease-resistant sequence has a length of seven amino acids. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO: 545. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO: 546. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO: 547.

[0120] III. Recombinant Protein

[0121] In one aspect, the present disclosure provides a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein is resistant to protease cleavage.

[0122] In an embodiment, the type I transmembrane domain is capable of dimerization. In an embodiment, the type I transmembrane domain is selected from the transmembrane domains of EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor. In an embodiment, the type I transmembrane domain is the EGFR transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-α transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-β transmembrane domain. In an embodiment, the type I transmembrane domain is the HER2 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER3 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER4 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR4 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-A transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-B transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-C transmembrane domain. In an embodiment, the type I transmembrane domain is the insulin receptor transmembrane domain.

[0123] In an embodiment, the recombinant protein comprises an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In an embodiment, the IgG antibody is an IgG1 antibody. In an embodiment, the IgG antibody is an IgG2 antibody. In an embodiment, the IgG antibody is an IgG3 antibody. In an embodiment, the IgG antibody is an IgG4 antibody.

[0124] In an embodiment of the recombinant protein provided herein, the IgG antibody comprises an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region. In an embodiment, the IgG antibody comprises an Fc (fragment crystallizable) region. In an embodiment, the IgG antibody comprises a Fab (garment crystallization) region. In an embodiment, the IgG antibody comprises an Fc (antigen-binding fragment) region. In an embodiment, the recombinant protein, wherein the IgG antibody comprises a hinge region.

[0125] In the embodiments of the recombinant protein provided herein, the hinge region comprises a protease-resistant sequence. In an embodiment, according to Kabat numbering, the sequence is between amino acid positions 246 to 252. In an embodiment, the sequence is between positions corresponding to Kabat positions 246 to 252. In an embodiment, the protease-resistant sequence has a length of two or more amino acids. In an embodiment, the protease-resistant sequence has a length of three amino acids. In an embodiment, the protease-resistant sequence has a length of four amino acids. In an embodiment, the protease-resistant sequence has a length of five amino acids. In an embodiment, the protease-resistant sequence has a length of six amino acids. In an embodiment, the protease-resistant sequence has a length of seven amino acids. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:546. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:545. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:547.

[0126] In the embodiments of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10-10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 - 12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M, or about 1×10 -13 M.

[0127] In an embodiment of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody for CD32 (FcγRII) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for CD32 (FcγRII) is from about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10-7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 - 10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 ... M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10-12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 - 8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -13 M.

[0128] In an embodiment of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the said Fc region for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 - 10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 - 11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 - 12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10- 13 M.

[0129] In the examples of the recombinant proteins provided herein, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M. In the examples, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M. In the examples, the dissociation constant of the said Fc region for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 - 9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 - 7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7M to approximately 1×10 -9 M, approximately 1×10 -7 M to approximately 1×10 -8 M, approximately 1×10 -8 M to approximately 1×10 -13 M, approximately 1×10 -8 M to approximately 1×10 -12 M, approximately 1×10 -8 M to approximately 1×10 -11 M, approximately 1×10 -8 M to approximately 1×10 -10 M, approximately 1×10 -8 M to approximately 1×10 -9 M, approximately 1×10 -9 M to approximately 1×10 -13 M, approximately 1×10 -9 M to approximately 1×10 -12 M, approximately 1×10 -9 M to approximately 1×10 -11 M, approximately 1×10 -9 M to approximately 1×10 -10 M, approximately 1×10 -10 M to approximately 1×10 -13 M, approximately 1×10 -10 M to approximately 1×10 -12 M, approximately 1×10 -10 M to approximately 1×10 -11 M, approximately 1×10 -11 M to approximately 1×10 -13 M, approximately 1×10 -11 M to approximately 1×10 -12 M or approximately 1×10 -12 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is approximately 1×10 - 5 M, approximately 1×10 -6 M, approximately 1×10 -7 M, approximately 1×10 -8 M, approximately 1×10 -9 M, approximately 1×10 -10 M, approximately 1×10 -11 M, approximately 1×10 -12 M or approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is approximately 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is approximately 1×10-6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 - 7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -13 M.

[0130] In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease. In an embodiment, the protease is an IgG-specific protease. In an embodiment, the IgG-specific protease is selected from IdeS and IdeZ. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by IdeS protease. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by IdeZ protease.

[0131] In the embodiments of the recombinant protein provided herein, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the ELLGGPS amino acid sequence (SEQ ID NO: 544). In an embodiment, the protease specific for the ELLGGPS amino acid sequence includes, but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0132] In one aspect, the present disclosure provides a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein has a dissociation constant of about 1×10 -5 M to about 1×10 -13 M for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0133] In an embodiment, the type I transmembrane domain is capable of dimerization. In an embodiment, the type I transmembrane domain is selected from the transmembrane domains of EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor. In an embodiment, the type I transmembrane domain is the EGFR transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-α transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-β transmembrane domain. In an embodiment, the type I transmembrane domain is the HER2 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER3 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER4 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR4 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-A transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-B transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-C transmembrane domain. In an embodiment, the type I transmembrane domain is the insulin receptor transmembrane domain.

[0134] In an embodiment, the recombinant protein comprises an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In an embodiment, the IgG antibody is an IgG1 antibody. In an embodiment, the IgG antibody is an IgG2 antibody. In an embodiment, the IgG antibody is an IgG3 antibody. In an embodiment, the IgG antibody is an IgG4 antibody.

[0135] In an embodiment of the recombinant protein provided herein, the IgG antibody comprises an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region. In an embodiment, the IgG antibody comprises an Fc (fragment crystallizable) region. In an embodiment, the IgG antibody comprises a Fab (costume crystallizable) region. In an embodiment, the IgG antibody comprises an Fc (antigen-binding fragment) region. In an embodiment, the recombinant protein, wherein the IgG antibody comprises a hinge region.

[0136] In the examples of the recombinant proteins provided herein, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In the examples, the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10-8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 - 12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M.

[0137] In an embodiment of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody for CD32 (FcγRII) is about 1×10 -5 M to about 1×10 -13In an embodiment, the dissociation constant of the Fc region for CD32 (FcγRII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10-8 M to approximately 1×10 -9 M, approximately 1×10 -9 M to approximately 1×10 -13 M, approximately 1×10 -9 M to approximately 1×10 -12 M, approximately 1×10 -9 M to approximately 1×10 -11 M, approximately 1×10 -9 M to approximately 1×10 -10 M, approximately 1×10 -10 M to approximately 1×10 -13 M, approximately 1×10 -10 M to approximately 1×10 -12 M, approximately 1×10 - 10 M to approximately 1×10 -11 M, approximately 1×10 -11 M to approximately 1×10 -13 M, approximately 1×10 -11 M to approximately 1×10 -12 M or approximately 1×10 -12 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 -5 M, approximately 1×10 -6 M, approximately 1×10 -7 M, approximately 1×10 -8 M, approximately 1×10 -9 M, approximately 1×10 -10 M, approximately 1×10 -11 M, approximately 1×10 -12 M or approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 - 8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is approximately 1×10 -9M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD32 (FcγRII) is about 1×10 -13 M.

[0138] In an embodiment of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the said Fc region for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 - 10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10-9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 - 11 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 - 12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD16 (FcγRIII) is about 1×10 - 13 M.

[0139] In an embodiment of the recombinant protein provided herein, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody for CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region for CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10-10 M, about 1×10 -5 M to about 1×10 - 9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 - 7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 - 5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 - 7 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -11M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the IgG antibody described herein for CD64 (FcγRI) is about 1×10 -13 M.

[0140] In an embodiment of the recombinant protein provided herein, the hinge region comprises a protease-resistant sequence. In an embodiment, according to Kabat numbering, the sequence is between amino acid positions 246 to 252. In an embodiment, the sequence is between positions corresponding to Kabat positions 246 to 252. In an embodiment, the protease-resistant sequence has a length of two or more amino acids. In an embodiment, the protease-resistant sequence has a length of three amino acids. In an embodiment, the protease-resistant sequence has a length of four amino acids. In an embodiment, the protease-resistant sequence has a length of five amino acids. In an embodiment, the protease-resistant sequence has a length of six amino acids. In an embodiment, the protease-resistant sequence has a length of seven amino acids. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:546. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:545. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:547.

[0141] In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease. In an embodiment, the protease is an IgG-specific protease. In an embodiment, the IgG-specific protease is selected from IdeS and IdeZ. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by IdeS protease. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by IdeZ protease.

[0142] In an embodiment, the length of the IgG antibody hinge region is two amino acids and comprises an amino acid sequence of DW, YD, QW, QE, PW, QD, or DD. In an embodiment, the length of the IgG antibody hinge region is three amino acids and comprises an amino acid sequence of XDW, XDW, XYD, XQW, XQE, XPW, XQD, or XDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is four amino acids and comprises an amino acid sequence of XXDW, XXDW, XXYD, XXQW, XXQE, XXPW, XXQD, or XXDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is five amino acids and comprises an amino acid sequence of XXXDW, XXXYD, XXXQW, XXXQE, XXXPW, XXXQD, or XXXDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is six amino acids and comprises an amino acid sequence of XXXXDW, XXXXYD, XXXXQW, XXXXQE, XXXXPW, XXXXQD, or XXXXDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is seven amino acids and comprises an amino acid sequence of XXXXXDW, XXXXXYD, XXXXXQW, XXXXXQE, XXXXXPW, XXXXXQD, or XXXXXDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is eight amino acids and comprises an amino acid sequence of XXXXXXDW, XXXXXXYD, XXXXXXQW, XXXXXXQE, XXXXXXPW, XXXXXXQD, or XXXXXXDD, where X is any amino acid. In an embodiment, the length of the IgG antibody hinge region is nine amino acids and comprises an amino acid sequence of XXXXXXXDW, XXXXXXXYD, XXXXXXXQW, XXXXXXXQE, XXXXXXXPW, XXXXXXXQD, or XXXXXXXDD, where X is any amino acid. In an embodiment, the IgG antibody hinge region comprises an amino acid sequence of XCWDW, XXCWDW, XXXCWDW, XXXXXCWDW, XXXXXCWDW, XXXXXXCWDW, XXXXXXXCWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW, EDSCWDW, EETCWDD, or EETQWDD, where X is any amino acid.

[0143] In an embodiment, the IgG antibody hinge region comprises DW, YD, QW, QE, PW, QD, DD, CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW (SEQ ID NO:545), EDSCWDW (SEQ ID NO:547), EETCWDD, EETCWSW (SEQ ID NO:547), EETQWDD. In some aspects, the variant or homolog has one, two, three, four, five, or six amino acid sequence identities.

[0144] In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of any one of the following: abciximab, adalimumab, alemtuzumab, alemtuzumab, alirocumab, asimadoline, atezolizumab, avelumab, basiliximab, belimumab, besilesomab, bevacizumab, bevacizumab, belotuzumab, brentuximab vedotin, brodalumab, canakinumab, carotuximab, catumaxomab, certolizumab pegol, cetuximab, datumumab, denosumab, datopotamab deruxtecan, dupilumab, durvalumab, eculizumab, efalizumab, elotuzumab, farletuzumab, gemtuzumab ozogamicin, golimumab, ibritumomab tiuxetan, idarucizumab, inotuzumab ozogamicin, infliximab, ipilimumab, mepolizumab, muromonab-CD3, natalizumab, necitumumab, nivolumab, remosozumab, ocrelizumab, obinutuzumab, orencizumab, ofatumumab, orlatumumab, omalizumab, palivizumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, ranibizumab, reslizumab, rituximab, satumomab pendetide, secukinumab, siltuximab, solanezumab, tocilizumab, tositumomab, trastuzumab, trastuzumab deruxtecan, ustekinumab, vedolizumab, volociximab, and voltuximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of abciximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of adalimumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of alemtuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of alemtuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of alirocumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of asimadoline. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of atezolizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of avelumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of basiliximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of belimumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of besilesomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of bevacizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of belotuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of brentuximab vedotin. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of brodalumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of canakinumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of carotuximab.In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of catumaxomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of certolizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of cetuximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of dacetuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of denosumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of daratumumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of dupilumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of durvalumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of eculizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of efalizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of elotuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of faralimomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of gemtuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of golimumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ibritumomab tiuxetan. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of idarucizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of infliximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ipilimumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of mepolizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of muromonab-CD3. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of natalizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of necitumumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of nivolumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of remolimumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of otlertuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of obinutuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of oregovomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ofatumumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of orlatumumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of omalizumab.In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of palivizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of panitumumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of pembrolizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of pertuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ramucirumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ranibizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of reslizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of rituximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of satumomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of secukinumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of siltuximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of sotrovimab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of tocilizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of tositumomab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of trastuzumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of trastuzumab emtansine. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of ustekinumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of vedolizumab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of volociximab. In an embodiment, the IgG antibody comprises a Fab region identical to the Fab region of voltumumab.

[0145] In the examples of recombinant proteins provided herein, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the ELLGGPS amino acid sequence (SEQ ID NO: 544). In an example, the ELLGGPS amino acid sequence-specific protease includes but is not limited to pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an example, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0146] IV. Anti-CD20 Antibody

[0147] In one aspect, provided herein is an anti-CD20 antibody that comprises a complementarity-determining region (CDR) encoded by a nucleic acid sequence of any one of SEQ ID Nos: 551-588.

[0148] In an example, provided herein is an anti-CD20 antibody that binds to CD20 or an antigenic fragment thereof, wherein the antibody comprises a complementarity-determining region (CDR) and is encoded by Figure 14The nucleic acid sequences shown (also reproduced in Tables 1, 2, and 3). In embodiments, provided herein is an anti-CD20 antibody that binds to CD20 or an antigenic fragment thereof, wherein the antibody comprises complementarity-determining regions (CDRs) having the amino acid sequences shown in Tables 1, 2, and 3. In embodiments, provided herein is an anti-CD20 antibody that binds to CD20 or an antigenic fragment thereof, wherein the antibody comprises complementarity-determining regions (CDRs) having any one of the amino acid sequences of SEQ ID No: 589-629 or 633-635. In embodiments, provided herein is an antibody that binds to CD20 or an antigenic fragment thereof and has a higher binding affinity for CD20 compared to unmutated rituximab (a CD20-binding antibody). In embodiments, provided herein is an antibody that binds to CD20 or an antigenic fragment thereof and has a higher binding affinity for CD20 and comprises a protease-resistant hinge region when compared to unmutated rituximab (a CD20-binding antibody). In embodiments, provided herein is an antibody that binds to CD20 or an antigenic fragment thereof and has a higher binding affinity for CD20 compared to unmutated rituximab (a CD20-binding antibody) and comprises heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3.

[0149] In embodiments, the anti-CD20 antibody comprises heavy chain CDR1 encoded by the nucleotide sequence of TATACCGGGGAAGCGGTATAAC (SEQ ID NO: 551). In embodiments, the anti-CD20 antibody further comprises heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549) and heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further comprises light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is designated P01A09 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCGGGGAAGCGGTATAAC (SEQ ID NO: 551).

[0150] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTGKRYN (SEQ ID NO:592). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such anti-CD20 antibody is designated as P01A09 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGKRYN (SEQ ID NO:592).

[0151] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTGTTTTAGGTATAAC (SEQ ID NO:552). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such anti-CD20 antibody is designated as P01B01 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCTGTTTTAGGTATAAC (SEQ ID NO:552).

[0152] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTCFRYN (SEQ ID NO:593). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated as P01B01 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTCFRYN (SEQ ID NO:593).

[0153] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAATTCGTTTG (SEQ ID NO:553). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated as P02C12 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCTTCACAATTCGTTTG (SEQ ID NO:553).

[0154] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTFTIRL (SEQ ID NO:594). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated P02C12 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTIRL (SEQ ID NO:594).

[0155] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCGGGCGTTTTTATAAC (SEQ ID NO:554). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated P02F01 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCGGGCGTTTTTATAAC (SEQ ID NO:554).

[0156] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTGRFYN (SEQ ID NO:595). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P02F01 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGRFYN (SEQ ID NO:595).

[0157] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCAGTTGGATGTATAAC (SEQ ID NO:555). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P03A05 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCAGTTGGATGTATAAC (SEQ ID NO:555).

[0158] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTSWMYN (SEQ ID NO:596). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated P03A05 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTSWMYN (SEQ ID NO:596).

[0159] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TGGTTGTGGACAAGCTATAAC (SEQ ID NO:556). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated P05B09 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TGGTTGTGGACAAGCTATAAC (SEQ ID NO:556).

[0160] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of WLWTSYN (SEQ ID NO:597). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated as P05B09 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is WLWTSYN (SEQ ID NO:597).

[0161] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTGGGGGATTTATAAC (SEQ ID NO:557). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated as P05H07 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCTGGGGGATTTATAAC (SEQ ID NO:557).

[0162] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTWGIYN (SEQ ID NO:598). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated as P05H07 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTWGIYN (SEQ ID NO:598).

[0163] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGGTATAAT (SEQ ID NO:558). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated as P04A02 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCTTCACAAGGTATAAT (SEQ ID NO:558).

[0164] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTFTRYN (SEQ ID NO:599). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P04A02 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTRYN (SEQ ID NO:599).

[0165] In an embodiment, the antibody or antigen fragment thereof that binds CD20 sequentially comprises: CDR1 encoded by the nucleotide sequence of TATACCTTCACATTTCCTTAT (SEQ ID NO:559). In an embodiment, the anti-CD20 antibody further comprises heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549) and heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P05F06 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCTTCACATTTCCTTAT (SEQ ID NO:559).

[0166] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTFTFPY (SEQ ID NO: 600). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P05F06 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTFPY (SEQ ID NO: 600).

[0167] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCGGTATTCGGTATAAC (SEQ ID NO: 560). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P07C04 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by the nucleotide sequence of TATACCGGTATTCGGTATAAC (SEQ ID NO: 560).

[0168] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR1 amino acid sequence of YTGIRYN (SEQ ID NO: 601). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such anti-CD20 antibody is designated as P07C04 and is further described in the description of Table 1 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGIRYN (SEQ ID NO: 601).

[0169] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such anti-CD20 antibody is designated as P04D06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561).

[0170] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGLYL (SEQ ID NO:602). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P04D06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGLYL (SEQ ID NO:602).

[0171] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCACGCTGCTG (SEQ ID NO:562). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P04F01 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCACGCTGCTG (SEQ ID NO:562).

[0172] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGTLL (SEQ ID NO: 603). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated as P04F01 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTLL (SEQ ID NO: 603).

[0173] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCCATATGGGG (SEQ ID NO: 563). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated as P04F02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCCATATGGGG (SEQ ID NO: 563).

[0174] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGHMG (SEQ ID NO: 604). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated P04F02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGHMG (SEQ ID NO: 604).

[0175] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCATGCTTTGG (SEQ ID NO: 564). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated P04G03 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCATGCTTTGG (SEQ ID NO: 564).

[0176] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 amino acid sequence of IYPGMLW (SEQ ID NO: 605). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated P04G03 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGMLW (SEQ ID NO: 605).

[0177] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCGCTGTTTCG (SEQ ID NO: 565). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated P04H06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCGCTGTTTCG (SEQ ID NO: 565).

[0178] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of YTFTSYN (SEQ ID NO:589). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P04H06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGAVS (SEQ ID NO:606).

[0179] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCACTCATAAG (SEQ ID NO:566). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P04H07 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCACTCATAAG (SEQ ID NO:566).

[0180] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGTHK (SEQ ID NO: 607). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated P04H07 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is f IYPGTHK (SEQ ID NO: 607).

[0181] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCACTCAGTCT (SEQ ID NO: 567). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated P06A06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCACTCAGTCT (SEQ ID NO: 567).

[0182] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGTQS (SEQ ID NO:608). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P06A06 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTQS (SEQ ID NO:608).

[0183] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAATGCGGAT (SEQ ID NO:568). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P06B11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCAATGCGGAT (SEQ ID NO:568).

[0184] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGNAD (SEQ ID NO: 609). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06B11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGNAD (SEQ ID NO: 609).

[0185] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAGTTTTGAG (SEQ ID NO: 569). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P06H01 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCAGTTTTGAG (SEQ ID NO: 569).

[0186] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGSFE (SEQ ID NO: 610). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06H01 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSFE (SEQ ID NO: 610).

[0187] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCACGTTTCTT (SEQ ID NO: 570). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P04D09 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCACGTTTCTT (SEQ ID NO: 570).

[0188] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGTFL (SEQ ID NO: 611). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P04D09 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTFL (SEQ ID NO: 611).

[0189] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGTTACGGGCGAT (SEQ ID NO: 571). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P05A03 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGTTACGGGCGAT (SEQ ID NO: 571).

[0190] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPVTGD (SEQ ID NO:612). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated P05A03 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPVTGD (SEQ ID NO:612).

[0191] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGTATCTGGGCGAT (SEQ ID NO:572). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated P05A12 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGTATCTGGGCGAT (SEQ ID NO:572).

[0192] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGLYL (SEQ ID NO:602). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO:591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P05A12 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPYLGD (SEQ ID NO:613).

[0193] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of TTTATCCGTGGAATGGCGAT (SEQ ID NO:573). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO:550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P05B02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGTGGAATGGCGAT (SEQ ID NO:573).

[0194] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPWNGD (SEQ ID NO: 614). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated P05B02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPWNGD (SEQ ID NO: 614).

[0195] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated P06B04 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCTCTGTGGGGCGAT (SEQ ID NO: 574).

[0196] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPLWGD (SEQ ID NO: 615). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06B04 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPLWGD (SEQ ID NO: 615).

[0197] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAGTAGTCGT (SEQ ID NO: 575). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P06B11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCAGTAGTCGT (SEQ ID NO: 575).

[0198] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGSSR (SEQ ID NO: 616). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06B11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSSR (SEQ ID NO: 616).

[0199] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCACTTTTCGT (SEQ ID NO: 576). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P06H05 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCACTTTTCGT (SEQ ID NO: 576).

[0200] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGTFR (SEQ ID NO: 617). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06H05 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTFR (SEQ ID NO: 617).

[0201] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCGTTGGTCGG (SEQ ID NO: 577). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P06H11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCGTTGGTCGG (SEQ ID NO: 577).

[0202] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGVGR (SEQ ID NO: 618). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P06H11 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGVGR (SEQ ID NO: 618).

[0203] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCTCTCAGGCG (SEQ ID NO: 578). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P07F02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCTCTCAGGCG (SEQ ID NO: 578).

[0204] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGSEA (SEQ ID NO: 619). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P07F02 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSEA (SEQ ID NO: 619).

[0205] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAGTAATATG (SEQ ID NO: 579). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P07F10 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCAGTAATATG (SEQ ID NO: 579).

[0206] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGSNM (SEQ ID NO: 620). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is referred to as P07F10 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSNM (SEQ ID NO: 620).

[0207] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCGCTTTTCTT (SEQ ID NO: 580). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is referred to as P08B05 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by the nucleotide sequence of ATTTATCCGGGCGCTTTTCTT (SEQ ID NO: 580).

[0208] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR2 amino acid sequence of IYPGAFL (SEQ ID NO: 621). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, this anti-CD20 antibody is designated P08B05 and is further described in the description of Table 2 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGAFL (SEQ ID NO: 621).

[0209] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR3 encoded by the nucleotide sequence of CAGTCTATTTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 581). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, this anti-CD20 antibody is designated P07C02 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CAGTCTATTTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 581).

[0210] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of QSIYYGGDWYFN (SEQ ID NO: 622). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated as P07C02 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is QSIYYGGDWYFN (SEQ ID NO: 622).

[0211] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCTGATTGCT (SEQ ID NO: 582). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated as P07H08 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCTGATTGCT (SEQ ID NO: 582).

[0212] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTYYGGDWLIA (SEQ ID NO: 623). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is referred to as P07H08 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWLIA (SEQ ID NO: 623).

[0213] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCGTGGCGGGGGGCGATTGGTATTTTAA (SEQ ID NO: 583). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is referred to as P07H10 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCGTGGCGGGGGGCGATTGGTATTTTAA (SEQ ID NO: 583).

[0214] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTVAGGDWYFN (SEQ ID NO: 624). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated as P07H10 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTVAGGDWYFN (SEQ ID NO: 624).

[0215] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCGGTGGCGG (SEQ ID NO: 584). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated as P08A01 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCGGTGGCGG (SEQ ID NO: 584).

[0216] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTYYGGDWRWR (SEQ ID NO:625). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, such an anti-CD20 antibody is designated P08A01 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWRWR (SEQ ID NO:625).

[0217] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGGTTTTGGTATTTTAAC (SEQ ID NO:585). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, such an anti-CD20 antibody is designated P08B11 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGGTTTTGGTATTTTAAC (SEQ ID NO:585).

[0218] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTYYGGFWYFN (SEQ ID NO: 626). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P08B11 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGFWYFN (SEQ ID NO: 626).

[0219] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTCTTGGGCT (SEQ ID NO: 586). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P08G02 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTCTTGGGCT (SEQ ID NO: 586).

[0220] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR3 amino acid sequence of QSIYYGGDWYFN (SEQ ID NO: 622). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and the heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P08G02 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWSWA (SEQ ID NO: 627).

[0221] In an embodiment, the anti-CD20 antibody comprises the heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCATGTGTAAGGGCGATTGGTATTTTAAC (SEQ ID NO: 587). In an embodiment, the anti-CD20 antibody further comprises the heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548) and the heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In an embodiment, the anti-CD20 antibody further comprises the light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In an embodiment, such an anti-CD20 antibody is designated P07A06 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCATGTGTAAGGGCGATTGGTATTTTAAC (SEQ ID NO: 587).

[0222] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTMCKGDWYFN (SEQ ID NO:628). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO:589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO:590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO:633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO:634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO:635). In an embodiment, this anti-CD20 antibody is designated P07A06 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTMCKGDWYFN (SEQ ID NO:628).

[0223] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 encoded by the nucleotide sequence of CGCAGCACCATGTTGGGTGGCGATTGGTATTTTAAC (SEQ ID NO:588). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 encoded by the nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO:548) and a heavy chain CDR2 encoded by the nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO:549). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 encoded by the nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO:630), a light chain CDR2 encoded by the nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO:631), and a light chain CDR3 encoded by the nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO:632). In an embodiment, this anti-CD20 antibody is designated P08E05 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody is encoded by a nucleic acid sequence encoding the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by the nucleotide sequence of CGCAGCACCATGTTGGGTGGCGATTGGTATTTTAAC (SEQ ID NO:588).

[0224] In an embodiment, the anti-CD20 antibody comprises a heavy chain CDR3 amino acid sequence of RSTMLGGDWYFN (SEQ ID NO: 629). In an embodiment, the anti-CD20 antibody further comprises a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589) and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In an embodiment, the anti-CD20 antibody further comprises a light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), a light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and a light chain CDR3 amino acid sequence of WTSNPP (SEQ ID NO: 635). In an embodiment, such an anti-CD20 antibody is designated P08E05 and is further described in the description of Table 3 below. In an embodiment, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTMLGGDWYFN (SEQ ID NO: 629).

[0225] IV. Expression System

[0226] In one aspect, provided herein is an isolated nucleic acid encoding a recombinant protein as described herein.

[0227] In an embodiment, provided herein is an isolated nucleic acid encoding a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein is resistant to protease cleavage. In an embodiment, provided herein is an isolated nucleic acid encoding a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein comprises a dissociation constant of about 1×10 -5 M to about 1×10 -13 M for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0228] In an embodiment, provided herein is an expression vector comprising a nucleic acid isolated encoding a recombinant protein, the recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein is resistant to protease cleavage. In an embodiment, provided herein is an expression vector comprising a nucleic acid isolated encoding a recombinant protein, the recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein has a dissociation constant of about 1×10 -5 M to about 1×10 -13 M for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0229] In an embodiment, provided herein is a cell comprising the described expression vector. Specifically, provided herein is an expression vector, and the cell comprises the expression vector, the expression vector comprising a nucleic acid isolated encoding a recombinant protein, the recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein is resistant to protease cleavage. Specifically, provided herein is a cell comprising the expression vector, the expression vector comprising a nucleic acid isolated encoding a recombinant protein, the recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the recombinant protein has a dissociation constant of about 1×10 -5 M to about 1×10 -13 M for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In an embodiment, the cell is a mammalian cell. In an embodiment, the mammalian cell is a Chinese hamster ovary (CHO) cell. In an embodiment, the IgG antibody encoded by the described expression vector is expressed on the cell surface. In an embodiment, the IgG antibody encoded by the described expression vector is expressed on the surface of a Chinese hamster ovary (CHO) cell.

[0230] V. Methods of Use

[0231] On the one hand, the present disclosure provides a method for binding a ligand to a cell surface recombinant protein, the method comprising contacting the ligand with the cell surface recombinant protein, wherein the cell surface recombinant protein comprises a type I transmembrane domain and an immunoglobulin G (IgG) antibody, wherein the type I transmembrane domain is fused to the C-terminus of the IgG antibody, and wherein the IgG antibody is capable of binding the ligand, and further wherein the cell surface protein is resistant to protease cleavage or has a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0232] In an embodiment of the method for binding a ligand to a cell surface protein, the cell is a CHO cell. In an embodiment of the method for binding a ligand to a CHO cell surface protein, the protein is a recombinant protein as described herein. In an embodiment of the method for binding a ligand to a CHO cell surface protein, the surface protein is a recombinant protein comprising a type I transmembrane domain and an immunoglobulin G (IgG) antibody, and wherein the transmembrane domain is fused to the C-terminus of the IgG antibody. In an embodiment of the method for binding a ligand to a CHO cell surface protein, the recombinant protein is resistant to protease cleavage. In an embodiment of the method for binding a ligand to a CHO cell surface protein, the recombinant protein has a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0233] In an embodiment of a method of binding a ligand to a cell surface protein, the type I transmembrane domain is capable of dimerizing. In an embodiment, the type I transmembrane domain is selected from the group consisting of the transmembrane domains of EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor. In an embodiment, the type I transmembrane domain is the EGFR transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-α transmembrane domain. In an embodiment, the type I transmembrane domain is the PDGFR-β transmembrane domain. In an embodiment, the type I transmembrane domain is the HER2 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER3 transmembrane domain. In an embodiment, the type I transmembrane domain is the HER4 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the FGFR4 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR1 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR2 transmembrane domain. In an embodiment, the type I transmembrane domain is the VEGFR3 transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-A transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-B transmembrane domain. In an embodiment, the type I transmembrane domain is the Trk-C transmembrane domain. In an embodiment, the type I transmembrane domain is the insulin receptor transmembrane domain.

[0234] In an embodiment of a method of binding a ligand to a cell surface protein, the recombinant protein comprises an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In an embodiment, the IgG antibody is an IgG1 antibody. In an embodiment, the IgG antibody is an IgG2 antibody. In an embodiment, the IgG antibody is an IgG3 antibody. In an embodiment, the IgG antibody is an IgG4 antibody.

[0235] In an embodiment of a method of binding a ligand to a cell surface protein, the IgG antibody comprises a protease resistance sequence that is resistant to cleavage by a protease. In an embodiment, the protease is an IgG-specific protease. In an embodiment, the IgG-specific protease is selected from IdeS and IdeZ. In an embodiment, the IgG antibody comprises a protease resistance sequence that is resistant to cleavage by the IdeS protease. In an embodiment, the IgG antibody comprises a protease resistance sequence that is resistant to cleavage by the IdeZ protease.

[0236] In an embodiment of a method of binding a ligand to a cell surface protein, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the ELLGGPS amino acid sequence (SEQ ID NO: 544). In an embodiment, the protease specific for the ELLGGPS amino acid sequence includes but is not limited to pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an embodiment, the IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0237] In an embodiment of a method of binding a ligand to a CHO cell surface protein, the recombinant protein has a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI), and as described above, the recombinant protein comprises an Fc region having a dissociation constant of about 1×10 -5 M to about 1×10 -13 M for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0238] In one aspect, provided herein is a method of treating cancer in a patient, the method comprising administering a therapeutic IgG antibody and an IgG-specific protease, wherein the therapeutic IgG antibody is resistant to the IgG-specific protease.

[0239] Embodiments of the method of treating cancer comprise a therapeutic IgG antibody, wherein the therapeutic IgG antibody for treating cancer is an antibody having any of the antibody properties described herein.

[0240] Embodiments of methods for treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibodies include IgG antibodies selected from IgG1, IgG2, IgG3, and IgG4. In embodiments, the therapeutic IgG antibody is an IgG1 antibody. In embodiments, the therapeutic IgG antibody is an IgG2 antibody. In embodiments, the therapeutic IgG antibody is an IgG3 antibody. In embodiments, the IgG antibody is an IgG4 antibody.

[0241] Embodiments of methods for treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibody comprises an Fc (crystallizable fragment) region, a Fab (antigen binding fragment) region, and a hinge region. In embodiments, the therapeutic IgG antibody comprises an Fc (crystallizable fragment) region. In embodiments, the therapeutic IgG antibody comprises a Fab (crystallizable fragment) region. In embodiments, the therapeutic IgG antibody comprises an Fc (antigen binding fragment) region. In embodiments, the therapeutic IgG antibody comprises a hinge region.

[0242] Examples of methods for treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibody comprises a Fab region identical to the Fab region of any one of the following: abciximab, adalimumab, alemtuzumab, alemtuzumab, alirocumab, asimadoline, atezolizumab, avelumab, basiliximab, belimumab, besilesomab, bevacizumab, bevacizumab, belotuzumab, brentuximab vedotin, brodalumab, canakinumab, carotuximab, catumaxomab, certolizumab pegol, cetuximab, datumumab, denosumab, dacarbazine, dupilumab, durvalumab, eculizumab, efalizumab, elotuzumab, falotuzumab, gemtuzumab ozogamicin, golimumab, ibritumomab tiuxetan, idarucizumab, infliximab, ipilimumab, mepolizumab, muromonab-CD3, natalizumab, necitumumab, nivolumab, remosozumab, ocrelizumab, obinutuzumab, oregovomab, ofatumumab, orlatumumab, omalizumab, palivizumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, ranibizumab, resibizumab, rituximab, satumomab pendetide, secukinumab, siltuximab, solanezumab, tocilizumab, tositumomab, trastuzumab, trastuzumab emtansine, ustekinumab, vedolizumab, volociximab, and voltomumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of abciximab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of adalimumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of alemtuzumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of alemtuzumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of alirocumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of asimadoline. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of atezolizumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of avelumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of basiliximab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of belimumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of besilesomab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of bevacizumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of belotuzumab. In an example, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of brentuximab vedotin.In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of brodalumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of canakinumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of carotegrast. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of catumaxomab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of certolizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of cetuximab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of datumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of denosumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of daratumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of dupilumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of durvalumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of eculizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of efalizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of elotuzumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of faricimab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of gemtuzumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of golimumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ibritumomab tiuxetan. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of idarucizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of infliximab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ipilimumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of mepolizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of muromonab-CD3. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of natalizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of necitumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of nivolumab.In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ofatumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of obinutuzumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ocrelizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ofatumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of omalizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of palivizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of panitumumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of pembrolizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of pertuzumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ramucirumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ranibizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of reslizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of rituximab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of satumomab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of secukinumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of siltuximab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of thiotepa. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of tocilizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of tositumomab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of trastuzumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of trastuzumab emtansine. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of ustekinumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of vedolizumab. In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of volutumab.In an embodiment, the therapeutic IgG antibody comprises a Fab region identical to the Fab region of voltumumab.

[0243] An embodiment of a method of treating cancer comprises a therapeutic IgG antibody, wherein the therapeutic IgG antibody comprises a hinge region, and the hinge region comprises a protease-resistant sequence. In an embodiment, according to Kabat numbering, the sequence is between amino acid positions 246 to 252. In an embodiment, the sequence is between positions corresponding to Kabat positions 246 to 252. In an embodiment, the protease-resistant sequence has a length of two or more amino acids. In an embodiment, the protease-resistant sequence has a length of three amino acids. In an embodiment, the protease-resistant sequence has a length of four amino acids. In an embodiment, the protease-resistant sequence has a length of five amino acids. In an embodiment, the protease-resistant sequence has a length of six amino acids. In an embodiment, the protease-resistant sequence has a length of seven amino acids. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:546. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:545. In an embodiment, the protease-resistant sequence comprises the amino acids of SEQ ID NO:547.

[0244] Examples of methods for treating cancer include therapeutic IgG antibodies, wherein the length of the hinge region of the therapeutic IgG antibody is two amino acids and comprises an amino acid sequence of DW, YD, QW, QE, PW, QD or DD. In an example, the length of the hinge region of the therapeutic IgG antibody is three amino acids and comprises an amino acid sequence of XDW, XDW, XYD, XQW, XQE, XPW, XQD or XDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is four amino acids and comprises an amino acid sequence of XXDW, XXDW, XXYD, XXQW, XXQE, XXPW, XXQD or XXDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is five amino acids and comprises an amino acid sequence of XXXDW, XXXYD, XXXQW, XXXQE, XXXPW, XXXQD or XXXDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is six amino acids and comprises an amino acid sequence of XXXXDW, XXXXYD, XXXXQW, XXXXQE, XXXXPW, XXXXQD or XXXXDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is seven amino acids and comprises an amino acid sequence of XXXXXDW, XXXXXYD, XXXXXQW, XXXXXQE, XXXXXPW, XXXXXQD or XXXXXDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is eight amino acids and comprises an amino acid sequence of XXXXXXDW, XXXXXXYD, XXXXXXQW, XXXXXXQE, XXXXXXPW, XXXXXXQD or XXXXXXDD, where X is any amino acid. In an example, the length of the hinge region of the therapeutic IgG antibody is nine amino acids and comprises an amino acid sequence of XXXXXXXDW, XXXXXXXYD, XXXXXXXQW, XXXXXXXQE, XXXXXXXPW, XXXXXXXQD or XXXXXXXDD, where X is any amino acid. In an example, the hinge region of the therapeutic IgG antibody comprises an amino acid sequence of XCWDW, XXCWDW, XXXCWDW, XXXXXCWDW, XXXXXCWDW, XXXXXXCWDW, XXXXXXXCWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW, EDSCWDW, EETCWDD or EETQWDD, where X is any amino acid.

[0245] Examples of methods of treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibody comprises a hinge region, and the hinge region comprises DW, YD, QW, QE, PW, QD, DD, CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW (SEQ ID NO:545), EDSCWDW (SEQ ID NO:547), EETCWDD, EETCWSW (SEQ ID NO:547), EETQWDD. In some aspects, the variant or homolog has one, two, three, four, five, or six amino acid sequence identities.

[0246] Examples of methods of treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease. In an example, the protease is an IgG-specific protease. In an example, the IgG-specific protease is selected from IdeS and IdeZ. In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeS protease. In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by the IdeZ protease.

[0247] Examples of methods of treating cancer include therapeutic IgG antibodies, wherein the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by a protease specific for the ELLGGPS amino acid sequence (SEQ ID NO:544). In an example, the ELLGGPS amino acid sequence-specific protease includes but is not limited to pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by pepsin. In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 7 (MMP7). In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase 3 (MMP3). In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by matrix metalloproteinase (MMP12). In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by cathepsin G. In an example, the therapeutic IgG antibody comprises a protease-resistant sequence that is resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

[0248] Examples of methods for treating cancer include therapeutic IgG antibodies, wherein the dissociation constant of the Fc region of the therapeutic IgG antibody for one or more of CD20, CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M. RI). In the examples, the dissociation constant of the Fc region of the therapeutic IgG antibody for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 - 13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 - 11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the therapeutic IgG antibody for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M, about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or about 1×10 -13 M.

[0249] An embodiment of a method of treating cancer comprises a therapeutic IgG antibody, wherein the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10-5 M to about 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10-8 M to approximately 1 × 10 -10 M, approximately 1 × 10 -8 M to approximately 1 × 10 -9 M, approximately 1 × 10 -9 M to approximately 1 × 10 -13 M, approximately 1 × 10 -9 M to approximately 1 × 10 -12 M, approximately 1 × 10 -9 M to approximately 1 × 10 -11 M, approximately 1 × 10 -9 M to approximately 1 × 10 -10 M, approximately 1 × 10 -10 M to approximately 1 × 10 -13 M, approximately 1 × 10 -10 M to approximately 1 × 10 -12 M, approximately 1 × 10 -10 M to approximately 1 × 10 -11 M, approximately 1 × 10 -11 M to approximately 1 × 10 -13 M, approximately 1 × 10 -11 M to approximately 1 × 10 -12 M or approximately 1 × 10 -12 M to approximately 1 × 10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -5 M, approximately 1 × 10 -6 M, approximately 1 × 10 -7 M, approximately 1 × 10 -8 M, approximately 1 × 10 -9 M, approximately 1 × 10 -10 M, approximately 1 × 10 -11 M, approximately 1 × 10 -12 M or approximately 1 × 10 -13 M. In an embodiment, the dissociation constant of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -5 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -6 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -7 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -8 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is approximately 1 × 10 -9In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10 -10 In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10 -11 In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10 -12 In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD32 (FcγRII) is about 1×10 -13 M.

[0250] An embodiment of a method for treating cancer comprises a therapeutic IgG antibody, wherein the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -13 In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M to about 1×10 -12 M, about 1×10 -5 M to about 1×10 -11 M, about 1×10 -5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 - 8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 - 6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10-6 M to about 1×10 -8 M, about 1×10 -6 M to about 1×10 -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about 1×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 -9 M to about 1×10 -11 M, about 1×10 -9 M to about 1×10 -10 M, about 1×10 -10 M to about 1×10 -13 M, about 1×10 -10 M to about 1×10 -12 M, about 1×10 -10 M to about 1×10 -11 M, about 1×10 -11 M to about 1×10 -13 M, about 1×10 -11 M to about 1×10 -12 M or about 1×10 -12 M to about 1×10 -13 M. In the examples, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is about 1×10 -5 M, about 1×10 -6 M, about 1×10-7 M, approximately 1×10 -8 M, approximately 1×10 -9 M, approximately 1×10 -10 M, approximately 1×10 -11 M, approximately 1×10 -12 M or approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -12 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD16 (FcγRIII) is approximately 1×10 -13 M.

[0251] Examples of methods of treating cancer include a therapeutic IgG antibody, wherein the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is from approximately 1×10 -5 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is from approximately 1×10 -5 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is from approximately 1×10 -5 M to approximately 1×10 -12 M, approximately 1×10 -5 M to approximately 1×10 -11 M, approximately 1×10-5 M to about 1×10 -10 M, about 1×10 -5 M to about 1×10 -9 M, about 1×10 -5 M to about 1×10 -8 M, about 1×10 -5 M to about 1×10 -7 M, about 1×10 -5 M to about 1×10 -6 M, about 1×10 -6 M to about 1×10 -13 M, about 1×10 -6 M to about 1×10 -12 M, about 1×10 -6 M to about 1×10 -11 M, about 1×10 -6 M to about 1×10 -10 M, about 1×10 -6 M to about 1×10 -9 M, about 1×10 -6 M to about 1×1Q -8 M, about 1×10 -6 M to about 1×10[[ID=A6]] -7 M, about 1×10 -7 M to about 1×10 -13 M, about 1×10 -7 M to about 1×10 -12 M, about 1×10 -7 M to about 1×10 -11 M, about 1×10 -7 M to about 1×10 -10 M, about 1×10 -7 M to about 1×10 -9 M, about 1×10 -7 M to about 1×10 -8 M, about 1×10 -8 M to about 1×10 -13 M, about 1×10 -8 M to about 1×10 -12 M, about l×10 -8 M to about 1×10 -11 M, about 1×10 -8 M to about 1×10 -10 M, about 1×10 -8 M to about 1×10 -9 M, about 1×10 -9 M to about 1×10 -13 M, about 1×10 -9 M to about 1×10 -12 M, about 1×10 It should be noted that there seems to be a typo in the original text where "1×1Q" appears in line 41. It is assumed to be "1×10" for the translation. If this is incorrect, please adjust the translation accordingly based on the correct information.-9 M to approximately 1×10 -11 M, approximately 1×10 -9 M to approximately 1×10 -10 M, approximately 1×10 -10 M to approximately 1×10 -13 M, approximately 1×10 -10 M to approximately 1×10 -12 M, approximately 1×10 -10 M to approximately 1×10 -11 M, approximately 1×10 -11 M to approximately 1×10 -13 M, approximately 1×10 -11 M to approximately 1×10 -12 M or approximately 1×10 -12 M to approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -5 M, approximately 1×10 -6 M, approximately 1×10 -7 M, approximately 1×10 -8 M, approximately 1×10 -9 M, approximately 1×10 -10 M, approximately 1×10 -11 M, approximately 1×10 -12 M or approximately 1×10 -13 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -5 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -6 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -7 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -8 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -9 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -10 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -11 M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is approximately 1×10 -12M. In an embodiment, the dissociation constant of the Fc region of the therapeutic IgG antibody for CD64 (FcγRI) is about 1×10 -13 M.

[0252] In one aspect, the present disclosure provides a method of enhancing the efficacy of a therapeutic IgG antibody in a subject, the method comprising mutating the hinge region of the therapeutic IgG antibody to produce a variant of the therapeutic IgG antibody that is resistant to a protease according to any one of the various embodiments described herein.

[0253] In an embodiment of the method of enhancing the efficacy of a therapeutic IgG antibody in a subject, the therapeutic IgG antibody is resistant to a protease, wherein the protease is an IgG-specific protease. In an embodiment, the IgG-specific protease is selected from IdeS and IdeZ. In an embodiment, the IgG-specific protease is the IdeS protease. In an embodiment, the IgG-specific protease is the IdeZ protease. In an embodiment, the protease is specific for the ELLGGPS amino acid sequence (SEQ ID NO:544). In an embodiment, the ELLGGPS amino acid sequence-specific protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In an embodiment, the ELLGGPS amino acid sequence-specific protease is pepsin. In an embodiment, the ELLGGPS amino acid sequence-specific protease is matrix metalloproteinase 7 (MMP7). In an embodiment, the ELLGGPS amino acid sequence-specific protease is matrix metalloproteinase 3 (MMP3). In an embodiment, the ELLGGPS amino acid sequence-specific protease is matrix metalloproteinase (MMP12). In an embodiment, the ELLGGPS amino acid sequence-specific protease is cathepsin G. In an embodiment, the ELLGGPS amino acid sequence-specific protease is glutamyl endopeptidase V8 (GluV8).

[0254] In an embodiment of the method of enhancing the efficacy of a therapeutic IgG antibody in a subject, the therapeutic IgG antibody is any antibody as described above and herein. Further, the therapeutic IgG antibody is an antibody selected from Herceptin and any other IgG therapeutic mAb that relies on the binding of the Fc region of the IgG antibody to an FcγR of any innate immune cell (e.g., NK cell, monocyte, macrophage, dendritic cell, and granulocyte) to exert its efficacy.

[0255] The present disclosure further provides methods of using the proteins, antibodies, fusion proteins, antibody fragments, antigens, and Chinese hamster ovary (CHO) cells described herein. In some embodiments, the methods involve using the proteins, antibodies, fusion proteins, antibody fragments, antigens, and CHO cells to rapidly optimize antibody-antigen interactions by affinity selection. In some embodiments, the methods involve using the proteins, antibodies, fusion proteins, antibody fragments, antigens, and CHO cells described herein to enhance the efficacy of therapeutic antibodies, wherein some or all of the therapeutic effects are mediated by ADCC or ADCP.

[0256] In one aspect, the present disclosure provides methods of generating IgG antibodies having hinge regions resistant to IgG-specific proteases.

[0257] In one aspect, the present disclosure provides methods of generating IgG antibodies having hinge regions that are capable of binding CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with higher affinity.

[0258] In one aspect, the present disclosure provides methods of generating IgG antibodies having hinge regions that are capable of binding CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with lower affinity.

[0259] In one aspect, the present disclosure provides methods of generating IgG antibodies having hinge regions that are resistant to IgG-specific proteases and are capable of binding CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with higher affinity.

[0260] In one aspect, the present disclosure provides methods of generating IgG antibodies having hinge regions that are resistant to IgG-specific proteases and are capable of binding CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with lower affinity.

[0261] In one aspect, the present disclosure provides methods of generating IgG antibodies having different affinities for their specific antigens.

[0262] It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or variations thereof will be suggested to those skilled in the art and are intended to be within the spirit and scope of this application and the scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0263] P - Example

[0264] Example P-1. An immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region linked by a hinge region, wherein the hinge region is resistant to protease cleavage.

[0265] Example P-2. The IgG antibody according to Example 1, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

[0266] Example P-3. The IgG antibody according to any one of Examples 1 to 2, wherein the IgG antibody is an IgG1 antibody.

[0267] Example P-4. The IgG antibody according to any one of Examples 1 to 2, wherein the IgG antibody is an IgG2 antibody.

[0268] Example P-5. The IgG antibody according to any one of Examples 1 to 2, wherein the IgG antibody is an IgG3 antibody.

[0269] Example P-6. The IgG antibody according to any one of Examples 1 to 2, wherein the IgG antibody is an IgG4 antibody.

[0270] Example P-7. The IgG antibody according to Example 6, wherein the hinge region comprises a protease-resistant sequence between amino acid positions 246 and 252 according to Kabat's EU numbering.

[0271] Example P-8. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 2 or more amino acids in length.

[0272] Example P-9. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 3 amino acids in length.

[0273] Example P-10. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 4 amino acids in length.

[0274] Example P-11. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 5 amino acids in length.

[0275] Example P-12. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 6 amino acids in length.

[0276] Example P-13. The IgG antibody according to Example 7, wherein the protease-resistant sequence is 7 amino acids in length.

[0277] Example P-14. The IgG antibody according to Example 7, wherein the protease-resistant sequence comprises the amino acids of SEQ ID NO: 545.

[0278] Example P-15. The IgG antibody according to any one of Examples 1 to 14, wherein the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M.

[0279] Example P-16. The IgG antibody according to any one of Examples 1 to 15, wherein the dissociation constant of the Fc region for CD32 is about 1×10 -5 M to about 1×10 -13 M.

[0280] Example P-17. The IgG antibody according to any one of Examples 1 to 16, wherein the dissociation constant of the Fc region for CD16 is about 1×10 -5 M to about 1×10 -13 M.

[0281] Example P-18. The IgG antibody according to any one of Examples 1 to 17, wherein the dissociation constant of the Fc region for CD64 is about 1×10 -5 M to about 1×10 -13 M.

[0282] Example P-19. The IgG antibody according to any one of Examples 1 to 18, wherein the protease is an IgG-specific protease.

[0283] Example P-20. The IgG antibody according to Example 19, wherein the IgG-specific protease is selected from IdeS and IdeZ.

[0284] Example P-21. The IgG antibody according to Example 20, wherein the protease is IdeS.

[0285] Example P-22. The IgG antibody according to Example 20, wherein the protease is IdeZ.

[0286] Example P-23. The IgG antibody according to any one of Examples 1 to 18, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

[0287] Example P-24. An immunoglobulin G (IgG) antibody, wherein the antibody comprises a Fab region and an Fc region linked by a hinge region, and wherein the dissociation constant of the Fc region for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is from about 1×10 -5 M to about 1×10 -13 M.

[0288] Example P-25. The IgG antibody according to Example 24, wherein the Fc region comprises one or more amino acid substitutions that confer a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) compared to wild-type Fc.

[0289] Example P-26. The IgG antibody according to Example 25, wherein the Fc region comprises amino acid substitutions selected from S252D, I351E, and A349L according to the EU numbering of Kabat, and wherein the substitutions confer a higher binding affinity for CD16 (FcγRIII) compared to wild-type.

[0290] Example P-27. The IgG antibody according to Example 26, wherein the Fc region comprises the amino acid substitution S252D.

[0291] Example P-28. The IgG antibody according to Example 26, wherein the Fc region comprises the amino acid substitution I351E.

[0292] Example P-29. The IgG antibody according to Example 26, wherein the Fc region comprises the amino acid substitutions S252D and I351E.

[0293] Example P-30. The IgG antibody according to Example 26, wherein the Fc region comprises the amino acid substitutions S252D, I351E, and A349.

[0294] Example P-31. The IgG antibody according to any one of Examples 24 or 25, wherein the dissociation constant of the Fc region for CD32 is from about 1×10 -5 M to about 1×10 -13 M.

[0295] Example P-32. The IgG antibody according to any one of Examples 24 to 30, wherein the dissociation constant of the Fc region for CD16 is from about 1×10 -5 M to about 1×10 -13 M.

[0296] Example P-33. The IgG antibody according to any one of Examples 24 or 25, wherein the dissociation constant of the Fc region for CD64 is about 1×10 -5 M to about 1×10 -13 M.

[0297] Example P-34. The IgG antibody according to any one of Examples 24 to 33, wherein the antibody is resistant to protease cleavage.

[0298] Example P-35. The IgG antibody according to Example 34, wherein the protease is an IgG-specific protease.

[0299] Example P-36. The IgG antibody according to Example 35, wherein the IgG-specific protease is IdeS.

[0300] Example P-37. The IgG antibody according to Example 35, wherein the IgG-specific protease is IdeZ.

[0301] Example P-38. The IgG antibody according to Example 34, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

[0302] Example P-39. The IgG antibody according to any one of Examples 34 to 38, wherein the hinge region comprises a protease-resistant sequence at amino acid positions 246 to 252 according to Kabat's EU numbering and having a length of 2 or more amino acids.

[0303] Example P-40. The IgG antibody according to Example 39, wherein the protease-resistant sequence has a length of 3 amino acids.

[0304] Example P-41. The IgG antibody according to Example 39, wherein the protease-resistant sequence has a length of 4 amino acids.

[0305] Example P-42. The IgG antibody according to Example 39, wherein the protease-resistant sequence has a length of 5 amino acids.

[0306] Example P-43. The IgG antibody according to Example 39, wherein the protease-resistant sequence has a length of 6 amino acids.

[0307] Example P-44. The IgG antibody according to Example 39, wherein the protease-resistant sequence has a length of 7 amino acids.

[0308] Example P-45. The IgG antibody according to Example 39, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

[0309] Example P-46. A recombinant protein comprising:

[0310] a type I transmembrane domain; and

[0311] b. an immunoglobulin G (IgG) antibody;

[0312] wherein the transmembrane domain is fused to the C-terminus of the IgG antibody; and

[0313] wherein the recombinant protein is resistant to protease cleavage.

[0314] Example P-47. The recombinant protein according to Example 46, wherein the type I transmembrane domain is capable of dimerization.

[0315] Example P-48. The recombinant protein according to any one of claims 46 or 47, wherein the type I transmembrane domain is selected from the transmembrane domains of EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor.

[0316] Example P-49. The recombinant protein according to any one of Examples 46 to 48, wherein the type I transmembrane domain is the EGFR transmembrane domain.

[0317] Example P-50. The recombinant protein according to any one of Examples 46 to 49, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

[0318] Example P-51. The recombinant protein according to any one of Examples 46 to 49, wherein the IgG domain is an IgG1 antibody.

[0319] Example P-52. The recombinant protein according to any one of Examples 46 to 49, wherein the IgG domain is an IgG2 antibody.

[0320] Example P-53. The recombinant protein according to any one of Examples 46 to 49, wherein the IgG domain is an IgG3 antibody.

[0321] Example P-54. The recombinant protein according to any one of Examples 46 to 49, wherein the IgG domain is an IgG4 antibody.

[0322] Example P-55. The recombinant protein according to any one of Examples 46 to 54, wherein the IgG antibody comprises an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region.

[0323] Example P-56. The recombinant protein according to Example 55, wherein the IgG antibody comprises an Fc region.

[0324] Example P-57. The recombinant protein according to Example 55, wherein the IgG antibody comprises a hinge region.

[0325] Example P-58. The recombinant protein according to any one of Examples 55 to 57, wherein the hinge region comprises a protease-resistant sequence that is between amino acid positions 246 to 252 according to the EU numbering of Kabat and has a length of 2 or more amino acids.

[0326] Example P-59. The recombinant protein according to Example 58, wherein the protease-resistant sequence has a length of 3 amino acids.

[0327] Example P-60. The recombinant protein according to Example 58, wherein the protease-resistant sequence has a length of 4 amino acids.

[0328] Example P-61. The recombinant protein according to Example 58, wherein the protease-resistant sequence has a length of 5 amino acids.

[0329] Example P-62. The recombinant protein according to Example 58, wherein the protease-resistant sequence has a length of 6 amino acids.

[0330] Example P-63. The recombinant protein according to Example 58, wherein the protease-resistant sequence has a length of 7 amino acids.

[0331] Example P-64. The recombinant protein according to Example 58, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

[0332] Example P-65. The recombinant protein according to any one of Examples 46 to 64, wherein the recombinant protein comprises a dissociation constant for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) of about 1×10 -5 M to about 1×10 -13 M of the Fc region.

[0333] Example P-66. The recombinant protein according to any one of Examples 46 to 65, wherein the recombinant protein comprises a dissociation constant for CD32 of about 1×10-5 M to about 1 × 10 -13 M of the Fc region.

[0334] Example P-67. The recombinant protein according to any one of Examples 46 to 66, wherein the recombinant protein comprises a dissociation constant for CD16 of about 1 × 10 -5 M to about 1 × , -13 M of the Fc region.

[0335] Example P-68. The recombinant protein according to any one of Examples 46 to 67, wherein the recombinant protein comprises a dissociation constant for CD64 of about 1 × 10 -5 M to about 1 × 10 -13 M of the Fc region.

[0336] Example P-69. The recombinant protein according to any one of Examples 46 to 68, wherein the protease is an IgG-specific protease.

[0337] Example P-70. The recombinant protein according to Example 69, wherein the IgG-specific protease is selected from IdeS and IdeZ.

[0338] Example P-71. The recombinant protein according to Example 70, wherein the IgG-specific protease is IdeS.

[0339] Example P-72. The recombinant protein according to Example 70, wherein the IgG-specific protease is IdeZ.

[0340] Example P-73. The recombinant protein according to Example 69, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

[0341] Example P-74. A recombinant protein comprising:

[0342] a. A type I transmembrane domain; and

[0343] b. An immunoglobulin G (IgG) antibody;

[0344] wherein the transmembrane domain is fused to the C-terminus of the IgG antibody; and

[0345] wherein the recombinant protein comprises a dissociation constant for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) of about 1 × 10 -5 M to about 1 × 10 -13Fc region of M.

[0346] Example P-75. The recombinant protein according to Example 74, wherein the type I transmembrane domain is capable of dimerization.

[0347] Example P-76. The recombinant protein according to any one of Examples 74 or 75, wherein the type I transmembrane domain is selected from the transmembrane domains of EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor.

[0348] Example P-77. The recombinant protein according to any one of Examples 74 to 76, wherein the type I transmembrane domain is the EGFR transmembrane domain.

[0349] Example P-78. The recombinant protein according to any one of Examples 74 to 77, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

[0350] Example P-79. The recombinant protein according to any one of Examples 74 to 78, wherein the IgG domain is an IgG1 antibody.

[0351] Example P-80. The recombinant protein according to any one of Examples 74 to 78, wherein the IgG domain is an IgG2 antibody.

[0352] Example P-81. The recombinant protein according to any one of Examples 74 to 78, wherein the IgG domain is an IgG3 antibody.

[0353] Example P-82. The recombinant protein according to any one of Examples 74 to 78, wherein the IgG domain is an IgG4 antibody.

[0354] Example P-83. The recombinant protein according to any one of Examples 74 to 82, wherein compared to wild-type Fc, the Fc region comprises one or more amino acids that confer high binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0355] Example P-84. The recombinant protein according to any one of Examples 74 to 83, wherein the dissociation constant of the Fc region for CD32 is from about 1×10 -5 M to about 1×10 -13 M.

[0356] Example P-85. The recombinant protein according to any one of Examples 74 to 83, wherein the dissociation constant of the Fc region for CD16 is about 1×10 -5 M to about 1×10 -13 M.

[0357] Example P-86. The recombinant protein according to any one of Examples 74 to 83, wherein the dissociation constant of the Fc region for CD64 is about 1×10 -5 M to about 1×10 -13 M.

[0358] Example P-87. The recombinant protein according to any one of Examples 74 to 85, wherein the recombinant protein is resistant to protease cleavage.

[0359] Example P-88. The recombinant protein according to Example 87, wherein the protease is an IgG-specific protease.

[0360] Example P-89. The recombinant protein according to Example 88, wherein the IgG protease is IdeS.

[0361] Example P-90. The recombinant protein according to Example 88, wherein the IgG protease is IdeZ.

[0362] Example P-91. The recombinant protein according to Example 87, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

[0363] Example P-92. The recombinant protein according to any one of Examples 74 to 91, wherein the recombinant protein comprises a hinge region, and wherein the hinge region comprises a protease-resistant sequence at amino acid positions 246 to 252 according to the EU numbering of Kabat and having a length of 2 or more amino acids.

[0364] Example P-93. The recombinant protein according to Example 92, wherein the protease-resistant sequence has a length of 3 amino acids.

[0365] Example P-94. The recombinant protein according to Example 92, wherein the protease-resistant sequence has a length of 4 amino acids.

[0366] Example P-95. The recombinant protein according to Example 92, wherein the protease-resistant sequence has a length of 5 amino acids.

[0367] Example P-96. The recombinant protein according to Example 92, wherein the length of the protease-resistant sequence is 6 amino acids.

[0368] Example P-97. The recombinant protein according to Example 92, wherein the length of the protease-resistant sequence is 7 amino acids.

[0369] Example P-98. The recombinant protein according to Example 92, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

[0370] Example P-99. An isolated nucleic acid encoding the recombinant protein according to any one of Examples 46 to 98.

[0371] Example P-100. An expression vector comprising the nucleic acid according to Example 99.

[0372] Example P-101. A cell comprising the expression vector according to Example 100.

[0373] Example P-102. The cell according to Example 101, wherein the cell is a eukaryotic cell.

[0374] Example P-103. The cell according to Example 101 or 102, wherein the cell is a Chinese hamster ovary cell.

[0375] Example P-104. The cell according to any one of Examples 101 to 103, wherein an IgG antibody is expressed at the surface of the cell.

[0376] Example P-105. An anti-CD20 antibody comprising the CDRs as Figure 3 shown.

[0377] Example P-106. A method of binding a ligand to a recombinant protein on the surface of a CHO cell, the method comprising contacting the ligand with the recombinant protein on the surface of a CHO cell, wherein the recombinant protein on the surface of the CHO cell comprises:

[0378] i. The EGFR transmembrane domain; and

[0379] ii. An immunoglobulin G (IgG) antibody;

[0380] wherein the EGFR transmembrane domain is fused to the C-terminus of the IgG domain; and

[0381] wherein the IgG antibody is capable of binding the ligand; and

[0382] Wherein the CHO cell surface protein is resistant to cleavage by IgG-specific protease or has a higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

[0383] Example P-107. A method of treating cancer in a patient, the method comprising administering a therapeutic IgG antibody and an IgG-specific protease, wherein the therapeutic IgG antibody is resistant to the IgG-specific protease.

[0384] Example P-108. The method according to Example 107, wherein the dissociation constant of the therapeutic IgG antibody for one or more of CD20, CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) is about 1×10 -5 M to about 1×10 -13 M.

[0385] Example P-109. A method of enhancing the efficacy of a therapeutic IgG antibody in a subject, the method comprising administering an IgG-specific protease and a therapeutic IgG resistant to the IgG-specific protease to the subject.

[0386] Example P-110. The method according to Example 109, wherein the IgG-specific protease is selected from IdeS and IdeZ.

[0387] Examples

[0388] Example 1: IgG antibody and endopeptidase

[0389] Figure 1 Schematically shows that human immune cells are naturally coated with endogenous IgG, which prevents the interaction between the therapeutic mAb and FcγR expressed on the surface of human immune cells. Thus, this limits the binding of the therapeutic mAb to FcγR, thereby limiting the efficacy of the therapeutic mAb.

[0390] Figure 2 Flow cytometry data of... demonstrate that human NK cells are naturally coated with IgG molecules, which can be removed by incubation with IdeS enzyme. Human PBMCs were digested with IdeS at 37°C for 30 minutes and stained with antibodies against lineage markers or against the Fc of human IgG. Note that CD3+ T cells do not express FcγR and thus do not bind to human IgG under any conditions.

[0391] Figure 3Schematically shows strategies for enhancing the efficiency of mAb therapy. Panel (a) depicts that FcγRs on immune cells are typically occupied by endogenous IgG; panel (b) shows that IdeS digestion can remove endogenous IgG and release the FcγR-binding sites for the infused therapeutic mAb, which is engineered to be resistant to IdeS and retain FcγR-binding function; (c) shows that the infused therapeutic mAb can first bind to unoccupied FcγRs, or as depicted in panel (d), can first bind to tumor-associated antigens expressed on cancer cells. In either case, once antigen-mAb-FcγR crosslinking occurs, FcγR+ cells undergo immune activation (f). The flow chart shows that the more unoccupied FcγRs available for binding the therapeutic mAb, the more tumor cells are eliminated.

[0392] Example 2: Novel Therapeutic Antibody Screening and Engineering Platform

[0393] Many FDA-approved antibody therapeutics developed to date are produced in Chinese hamster ovary (CHO) cells because recombinant proteins produced by CHO cells have post-translational modifications that are compatible and bioactive in humans. Thus, CHO cells represent an ideal system for therapeutic antibody screening and engineering.

[0394] The experiments conducted herein aimed to develop a method for displaying full-length, fragments, or combinations of Ig- and / or Fc-containing fusion proteins on the surface of CHO cells.

[0395] A method was developed for selecting a subset of EGFR-TMH / mAb and EGFR-TMF / FcγR fusion proteins expressed on the surface of CHO cells by flow cytometry. Each IgG or Fc-containing molecule expressed on the surface of CHO cells is fully functional and behaves similarly to a similar soluble construct (with the EGFR-TMH portion removed) containing individual IgG domains, Fc domains, partial antibodies, partial receptors, full-length antibodies, or combinations of full-length antibodies or individual IgG / Fc domains. Flow cytometry was used as a method to study the different parts of these molecules and identify their physical and chemical properties for the applications of interest.

[0396] EGFR TMH (SEQ ID NO:6) was tested to optimize surface expression of IgG in CHO cells. As shown in the top row of Figure 4, the surface expression results of IgG-Fc with GFP reporter gene are presented. In the bottom row of Figure 4, the surface expression results of full-length rituximab with GFP marker are presented. The fluorescence of GFP on the X-axis is proportional to the surface density expression of Fc and rituximab on the surface of CHO cells. Each of these two IgG molecules expressed on the surface of CHO cells has the same function as soluble IgG, allowing the use of flow cytometry to study different parts of IgG. This eliminates the need to perform protein purification to optimize the binding characteristics of mAb to its cognate antigen and three classes of Fc-γ receptors (FcγR) expressed on the surface of innate immune effector cells.

[0397] Previous studies have scarcely touched on the hinge region of IgG because it is very flexible and the two hinges bind tightly and asymmetrically to FcγR. IgG1 FcΔ16 was prepared by deleting the WT hinge region sequence ELLGGPS. Amino acids were added to the N-terminus of IgG1FcΔ16, and variants that obtained CD16α binding were selected for the next round of modification. Several de novo hinge regions with higher affinity for FcγR compared to the original (or wild-type) hinge region were generated using the CHO cell display platform. It is important to note that this technology is also a platform technology because it can be used to modify any antibody with a known sequence to obtain variants with increased or decreased binding affinity for FcγR.

[0398] Figure 5 The generation of a new lower hinge of IgG1Fc with enhanced binding affinity for CD16α and resistance to IdeS and IdeZ cleavage is shown. Amino acids were added stepwise to the N-terminus of IgG1Δ16 (SEQ ID NO:16) that does not bind CD16α. Clones that obtained CD16α binding were selected by stepwise linking more amino acids to increase the binding affinity. A 7AA de novo hinge region that was found to be resistant to IdeS / Z and showed similar or higher binding affinity for CD16α compared to the wild-type sequence was transplanted into the mAb.

[0399] The wild-type lower hinge region of human IgG1 binds to FcγRIII CD16α with relatively low affinity (Figure 6). Panel (A) shows that human IgG1 FcΔ16 (SEQ ID NO:16) lacking the wild-type hinge (ELLGGPS; SEQ ID NO:544) loses binding to FcγRIII CD16. Four hundred (400) combinations of 2 amino acids were added to the N-terminus of human IgG1 FcΔ16, and their binding to CD16α and other FcγRs was measured individually. Among all the sequences that obtained CD16a binding, DW was selected for the next round of optimization, leading to the identification of CWDW, and subsequently other 6- and 7-AA sequences.

[0400] Figure 6 shows the stepwise acquisition of CD16α binding by sequential addition of AAs to the N-terminus of IgG1 FcΔ16. Figure 6A Shows the binding affinities of various constructs of human IgG1 FcΔ16 fused to the EGFR transmembrane helix domain and displayed as a type I membrane protein on the surface of CHO cells. Due to the lack of the hinge region, IgG1 FcΔ16 does not bind human CD16α. Four hundred 2-AA combinations were added to the N-terminus of IgG1 FcΔ16, and their binding to CD16a was measured individually by rapid flow cytometry analysis. The first two AAs, DW, were selected for further optimization, resulting in the identification of 4-AA, 6-AA, and 7-AA de novo hinges with increased CD16a binding, as shown. These experiments were performed in the presence of IdeS, demonstrating the resistance of the novel IgG1 hinge region to cleavage. Figure 6B Shows individual plots of all positive clones when more AAs were added.

[0401] Figure 7Data collected from CHO cells transfected with rituximab-EGFR are shown. The hinge region of rituximab consists of the wild-type (WT) hinge (ELLGGPS; SEQ ID NO:544) or one of two de novo IdeS / IdeZ-resistant hinges: EETCWDW, which has a higher affinity for FcγR CD16α than WT, or EDSCWDW, which has a lower affinity for FcγR CD16α than WT. Assessment of surface IgG1 expression on CHO cells was done using soluble fluorescently labeled CD16αVal176 binding and a fluorescently labeled anti-human Fc antibody (which binds to the Fc region unaffected by cleavage). CD16αVal176 and Phe176 are polymorphisms with different affinities for IgG1. The transfected CHO cells were incubated alone with medium (control, upper row) or digested with IdeZ at 37 °C for 30 minutes before staining (lower row). The binding affinity of IgG1 for CD16α is indicated in the upper left quadrant of each histogram. As shown in the lower row, incubation with IdeZ results in cleavage of the WT hinge (with loss of CD16α binding and affinity), while the de novo hinges are resistant to cleavage by IdeZ and thus retain binding and nearly the same affinity when compared to the upper row.

[0402] The de novo hinges can be transplanted into different antibodies and still retain the same IdeS / IdeZ resistance and improved FcγR binding ( Figure 8 、 Figure 10 ). Similar constructs can be generated to modify the binding of mAbs to the three classes of IgG FcγRs. It is well known that there are three classes of FcγRs: FcγRI (CD64) has the highest affinity and is present on granulocytes; FcγRII (CD32) has intermediate affinity and is present on monocytes and dendritic cells; FcγRIII (CD16) has lower affinity and is present on monocytes, macrophages, and natural killer cells. IgG contains two Fab arms, an Fc domain, and a flexible hinge region connecting the Fab arms to the Fc domain. Both the Fc domain and the hinge region of IgG contribute to binding to FcγRs (including CD64, CD32, CD16) expressed on innate immune effector cells and mediate target cell destruction by cellular means including antibody-dependent cell cytotoxicity (ADCC) and / or antibody-dependent cell phagocytosis (ADCP). Considerable efforts have been made to improve IgG-FcγR binding.

[0403] Figure 8 Shown are the binding affinities of various FcγRs for CHO cells expressing rituximab, the hinge portion of which is WT (ELLGGPS; SEQ ID NO:544) or has been generated using those described herein and Figure 7The method shown is engineered with new de novo hinge region variants (EETCWDW, SEQ ID NO:545 or EDSCWDW, SEQ ID NO:546). The surface IgG expression and binding affinity of the resulting various FcγRs are quantified using a fluorescently labeled FcγR extracellular domain as indicated on the Y-axis and a fluorescently labeled anti-human Fc antibody on the X-axis. The upper left quadrant of each histogram indicates the FcγR binding affinity for each hinge portion. It should be noted that compared to the WT (ELLGGPS, SEQ ID NO:544), the two new AA hinge regions (EETCWDW, SEQ ID NO:545 and EDSCWDW, SEQ ID NO:546) have significantly reduced affinity for CD16b and CD32a, but show higher affinity for CD16α and CD64.

[0404] Figure 9 Representative examples demonstrating the resistance of the novel hinge region (EETCWDW) to IdeS / IdeZ cleavage are provided. In this example, the anti-CD20 mAb rituximab either contains its wild-type (WT) hinge region or has been engineered to express the new (EETCWDW) hinge region. WT rituximab or EETCWDW rituximab is first incubated at 37 °C for 30 minutes in the presence or absence of the IdeZ protease. Next, CD20(+) Daudi lymphoma cells are incubated with the treated WT or novel (EETCWDW) rituximab, washed, and then stained with a fluorescently labeled anti-human Fc antibody. When stained with the fluorescently labeled anti-human Fc antibody, WT rituximab pre-incubated with IdeZ can no longer be detected on the surface of CD20(+) Daudi lymphoma cells (left histogram, dashed line), while EETCWDW rituximab can still be detected (right histogram, dashed line).

[0405] Example 3: Endopeptidase resistance hinge and FcγR binding

[0406] The selection of the FcγR binding properties and IdeS / IdeZ resistance of the EETCWDW hinge region and its variants represents a platform technology as highly reproducible results as those observed with the anti-CD20 mAb rituximab are obtained using a second unrelated therapeutic mAb, namely the anti-Her2 / neu mAb referred to as trastuzumab or When stained with the fluorescently labeled anti-human Fc antibody, WT rituximab pre-incubated with IdeZ can no longer be detected on the surface of CD20(+) Daudi lymphoma cells (left histogram, dashed line), while EETCWDW rituximab can still be detected (right histogram, dashed line). Figure 10Shows CHO cells transfected with trastuzumab-EGFR. Trastuzumab contains its wild-type (WT) hinge portion or one of two de novo new hinge portions EETCWDW (SEQ ID NO:545) or EDSCWDW (SEQ ID NO:546), and the new hinge portions are engineered to replace the WT hinge region of trastuzumab using the same method described herein for rituximab. When engineered with the same two new hinge regions, EETCWDW and EDSCWDW trastuzumab exhibit the same binding properties as those exhibited by rituximab, as Figure 8 shown. Specifically, compared to WT (ELLGGPS), two novel trastuzumab mAbs (EETCWDW or EDSCWDW) with AA hinge regions show significantly reduced affinity for CD16β and CD32α, but higher affinity for CD16α and CD64 than WT, and neither IdeZ nor IdeS shows cleavage (not shown). The surface IgG expression and binding affinity of the resulting various FcγRs were quantified using a fluorescently labeled extracellular domain of FcγR indicated on the Y-axis and a fluorescently labeled anti-human Fc antibody on the X-axis. The upper left quadrant of each histogram indicates the FcγR binding affinity for each hinge portion.

[0407] Figure 11 shows the activation of natural killer (NK) cells by staining for CD16 / CD62L and CD107α / CD69, respectively. The higher affinity of EETCWDW rituximab for CD16α (compared to WT rituximab) results in greater or stronger activation of NK cells. When CD16 of NK cells recognizes and binds EETCWDW rituximab bound to a B cell target, there is a greater downregulation of CD16α compared to CD16 of NK cells that recognize WT rituximab bound to a B cell target (compare Figure 11A the upper "control" row, lower left quadrant "WT" (45.2) vs. "EETCWDW" (80.5)). The same is true for CD62L, which is downregulated after NK cell activation. When NK cells recognize EETCWDW rituximab bound to a B cell target, there is a greater upregulation of CD107α compared to NK cells that recognize WT rituximab bound to a B cell target (compare Figure 11B the upper "control" row, upper right quadrant "WT" (35.3) vs. "EETCWDW" (62.8)). The same is true for CD69. Further, treatment with IdeZ actually abolishes the activation of NK cells by WT rituximab (compare Figure 11A the "control" row, lower left quadrant "WT" (45.2) vs. the lower "IdeZ" row, lower left quadrant "WT" (8.8); and compare ( Figure 11B)In the upper right quadrant of the "Control" row, "WT" (35.8) is against the "IdeZ" row below, and in the upper right quadrant, "WT" (1.9)). In contrast, treatment with IdeZ resulted in no or little reduction in the activation of NK cells by EETCWDW rituximab (compare Figure 11A the "Control" row, in the lower left quadrant, "EETCWDW" (80.5) against the "IdeZ" row below, and in the lower left quadrant, "EETCWDW" (80.5); and compare Figure 11B i...

Claims

1. An immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region linked by a hinge region, wherein the hinge region is resistant to protease cleavage, wherein the IgG antibody is an IgG1 antibody, and wherein the positions 246-252 of the hinge region according to Kabat numbering are substituted with an amino acid sequence consisting of: CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW or EDSCWDW.

2. The IgG antibody according to claim 1, wherein the dissociation constant of the Fc region for CD16a (FcγRIIIa) is 1×10 -5 M to 1×10 -13 M.

3. The IgG antibody according to claim 1, wherein the protease is an IgG-specific protease.

4. The IgG antibody according to claim 3, wherein the IgG-specific protease is selected from IdeS and IdeZ.

5. The IgG antibody according to claim 4, wherein the protease is IdeS.

6. The IgG antibody according to claim 4, wherein the protease is IdeZ.

7. The IgG antibody according to claim 1, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase 12 (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

8. A recombinant protein comprising: (i) a type I transmembrane domain; and (ii) an immunoglobulin G (IgG) antibody comprising a C-terminus; wherein the type I transmembrane domain is fused to the C-terminus of the IgG antibody; wherein the IgG antibody is an IgG1 antibody; and wherein the IgG antibody comprises a Fab region and an Fc region linked by a hinge region, wherein the hinge region is resistant to protease cleavage, and wherein the positions 246-252 of the hinge region according to Kabat numbering are substituted with an amino acid sequence consisting of: CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW or EDSCWDW.

9. The recombinant protein according to claim 8, wherein the type I transmembrane domain is capable of dimerization.

10. The recombinant protein according to claim 8, wherein the type I transmembrane domain is selected from EGFR, PDGFR-α, PDGFR-β, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and the insulin receptor transmembrane domain.

11. The recombinant protein according to claim 8, wherein the type I transmembrane domain is the EGFR transmembrane domain.

12. The recombinant protein according to claim 8, wherein the dissociation constant of the Fc region for CD16a (FcγRIIIa) is 1×10 -5 M to 1×10 -13 M.

13. The recombinant protein according to claim 8, wherein the protease is an IgG-specific protease.

14. The recombinant protein according to claim 13, wherein the IgG-specific protease is selected from IdeS and IdeZ.

15. The recombinant protein according to claim 14, wherein the IgG-specific protease is IdeS.

16. The recombinant protein according to claim 14, wherein the IgG-specific protease is IdeZ.

17. The recombinant protein according to claim 8, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase 12 (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

18. An isolated nucleic acid encoding the recombinant protein according to any one of claims 8-17.

19. An expression vector comprising the nucleic acid according to claim 18.

20. A cell comprising the expression vector according to claim 19.

21. The cell according to claim 20, wherein the cell is a eukaryotic cell.

22. The cell according to claim 20, wherein the cell is a Chinese hamster ovary cell.

23. The cell according to claim 20, wherein an IgG antibody is expressed at the surface of the cell.

24. The IgG antibody according to claim 1, wherein the IgG antibody is rituximab or trastuzumab.

25. The IgG antibody according to claim 24, wherein the IgG antibody is rituximab.

26. The IgG antibody according to claim 24, wherein the IgG antibody is trastuzumab.

27. The recombinant protein according to claim 8, wherein the IgG antibody is rituximab or trastuzumab.

28. The recombinant protein according to claim 27, wherein the IgG antibody is rituximab.

29. The recombinant protein according to claim 27, wherein the IgG antibody is trastuzumab.

Citation Information

Patent Citations

  • In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells

    US20020123057A1

  • Dress-form

    US233239A

  • Optimized Fc variants

    US7317091B2

  • Fc mutant of active protease resistance antibody

    CN103260640B