Biomarkers and their applications in type 2 diabetes mellitus combined with vascular inflammation

Abstract

This invention relates to the field of diabetic vascular inflammation, and particularly to a biomarker for vascular inflammation in type 2 diabetes and its application. The biomarker for vascular inflammation in type 2 diabetes is the MEF2D gene, which has the nucleotide sequence shown in SEQ ID NO.1. MEF2D is significantly downregulated in peripheral mononuclear macrophages and is significantly negatively correlated with vascular inflammation in type 2 diabetes, with a strong correlation. This indicates that the present invention demonstrates high specificity and accuracy of MEF2D in peripheral mononuclear macrophages in detecting vascular inflammation in type 2 diabetes; combined with the currently widely used qRT-PCR technique for nucleic acid micro-detection, the detection sensitivity is high. Therefore, MEF2D can serve as a biomarker for the early diagnosis of vascular inflammation in type 2 diabetes.

Description

Technical Field

[0001] The present invention relates to the field of diabetic vascular inflammation, and in particular to a biomarker for type 2 diabetes combined with vascular inflammation and application thereof. Background Art

[0002] Diabetes is a common disease that seriously threatens the health of the Chinese people. Common vascular complications of diabetes include atherosclerosis, vascular calcification, and other vascular complications. Studies have found that diabetic vascular inflammation is involved in the process of atherosclerosis and induces a variety of clinical complications. However, there are no obvious symptoms in the early stages of diabetic vascular inflammation. Although it can be diagnosed by imaging methods in the late stages, its universality is limited. Therefore, there is an urgent need to explore a rapid biomarker for diabetic vascular inflammation that can quickly screen patients in order to achieve early detection, early diagnosis, and early treatment. However, common inflammation-related markers cannot be used as markers for diabetic vascular inflammation. Summary of the invention

[0003] The purpose of the present invention is to provide a diabetic vascular inflammation biomarker and application thereof.

[0004] In order to solve the above technical problems, the technical solution of the present invention is as follows:

[0005] A biomarker for diabetic vascular inflammation, wherein the biomarker for diabetic vascular inflammation is the MEF2D gene, which has a nucleotide sequence as shown in SEQ ID NO.1.

[0006] The present invention also provides a PCR amplification primer, comprising an upstream primer and a downstream primer for specifically amplifying the above-mentioned diabetic vascular inflammation biomarker.

[0007] In one embodiment, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.2 (GGCTGTCGCTAGGCAATGTCAC), and the downstream primer has a nucleotide sequence as shown in SEQ ID NO.3 (CTGTGGCTGTGGCTGCTGTG).

[0008] The present invention also provides the use of the above-mentioned biomarkers of diabetic vascular inflammation and the above-mentioned PCR amplification primers in the preparation of products for diagnosing or detecting diabetic vascular inflammation.

[0009] In one embodiment, the product is a detection reagent, a test kit, a gene chip or a test strip.

[0010] The present invention also provides the use of the above-mentioned diabetic vascular inflammation biomarker and the above-mentioned PCR amplification primer in the preparation of a drug for preventing or treating diabetic vascular inflammation.

[0011] The present invention also provides a kit for detecting diabetic vascular inflammation, comprising PCR amplification primers as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] In one embodiment, the method further includes at least one of an internal reference gene, a primer for amplifying the internal reference gene, and a PCR amplification reagent.

[0013] Macrophages are distributed in a variety of tissues and organs and are important immune cells that maintain the dynamic balance of the microenvironment. Under pathological conditions, the infiltration of peripheral mononuclear macrophages is an important source of macrophages in tissues and organs. Studies by FernandezDM et al. and Feldmann K et al. found that macrophage infiltration is common in diseased vascular wall tissues, and they affect the physiological function of VSMCs by secreting active ingredients such as inflammatory factors and exosomes, thereby regulating the progression of vascular diseases.

[0014] The present invention analyzes the feasibility of MEF2D in peripheral mononuclear macrophages as a biomarker for type 2 diabetes combined with vascular inflammation from three aspects: specificity, accuracy, and sensitivity. MEF2D belongs to the MEF2 family, which mainly affects cell proliferation, differentiation, morphogenesis, survival, and apoptosis by regulating gene expression, and is expressed in various types of cells. The applicant also found that a high sugar environment promotes macrophage M1 polarization, but MEF2D expression decreases significantly, and overexpression / inhibition of expression of MEF2D can significantly inhibit / promote macrophage M1 polarization, indicating that MEF2D is significantly negatively correlated with macrophage M1 polarization. Further analysis at the clinical level found that there were no significant changes in peripheral mononuclear macrophages and inflammatory factors TNFα in patients with type 2 diabetes combined with vascular inflammation. It shows that inflammation-related factors cannot be used as biomarkers for type 2 diabetes combined with vascular inflammation. However, MEF2D in peripheral mononuclear macrophages is significantly downregulated, and is significantly negatively correlated with type 2 diabetes combined with vascular inflammation, and the correlation is strong. This shows that in the present invention, MEF2D in peripheral mononuclear macrophages has strong specificity and high accuracy with type 2 diabetes combined with vascular inflammation; combined with the currently common and popular nucleic acid micro-detection technology qRT-PCR, the detection sensitivity is high. Therefore, MEF2D can be used as a biomarker for the early diagnosis of type 2 diabetes combined with vascular inflammation.

[0015] The beneficial effects of the present invention are:

[0016] 1. The present invention detects the MEF2D level in peripheral mononuclear macrophages through qualitative and quantitative evaluation as a means of prediction, diagnosis and treatment prognosis evaluation of type 2 diabetes combined with vascular inflammation, thereby improving the sensitivity and specificity of early diagnosis of type 2 diabetes combined with vascular inflammation.

[0017] 2. The method of the present invention is sensitive, reliable, operable and non-invasive. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 qRT-PCR analysis of the effects of high glucose environment on macrophage MEF2D and iNOS

[0019] Figure 2 qRT-PCR analysis of the effects of MEF2D inhibition on M1 macrophages

[0020] Figure 3 qRT-PCR analysis of the effect of overexpression of MEF2D on M1 macrophages

[0021] Figure 4 The results of monocyte analysis were for patients with type 2 diabetes and type 2 diabetes with vascular inflammation;

[0022] Figure 5 Analysis of TNFα in patients with type 2 diabetes and type 2 diabetes with vascular inflammation;

[0023] Figure 6 CRP analysis for patients with type 2 diabetes and type 2 diabetes with vascular inflammation;

[0024] Figure 7 To analyze the expression of MEF2D in peripheral monocytes of patients with type 2 diabetes and type 2 diabetes with vascular inflammation;

[0025] Figure 8 To analyze the correlation between MEF2D in peripheral monocytes and type 2 diabetes mellitus combined with vascular inflammation. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0028] The following is a further detailed description of atherosclerosis molecular markers and their applications mainly in conjunction with specific implementation methods and drawings.

[0029] In each of the following examples, the main equipment and materials were obtained from the following companies:

[0030] Experimental Materials:

[0031] Source of experimental samples:

[0032] Patients with clinical diagnosis of type 2 diabetes and vascular inflammation in the First Affiliated Hospital of University of South China from July 2019 to June 2020 were selected, including 16 patients in the type 2 diabetes control group and 22 patients with type 2 diabetes and vascular inflammation. The data collection and blood sampling involved in the study were carried out with the informed consent of the subjects.

[0033] Experimental reagents:

[0034] Table 1 Main reagents

[0035]

[0036]

[0037] Statistical analysis:

[0038] The experimental data were expressed as mean ± SD. Non-paired t test was used for two groups of data, and one way ANOVA was used for multiple groups of data. At least p < 0.05 was considered statistically significant. GraphPad Prism 5 was used for drawing.

[0039] Example 1

[0040] The macrophage cell line RAW264.7 was cultured in DMEM complete medium (10% fetal bovine serum, 0.1% penicillin / streptomycin) with normal glucose (1.0 g / L) and high glucose (4.5 g / L) for 3 days (37°C, 5% CO 2 ).

[0041] 1. Detection method

[0042] The cells were collected and total RNA was extracted according to the kit instructions (Congwei Century, CW0584). The operation steps are as follows: resuspend the cell pellet with 1ml de Trizol, let it stand at room temperature for 5min, add 0.2ml chloroform, shake vigorously for 15s and let it stand at room temperature for 3min; after centrifugation at 12000rpm for 10min, transfer 0.4ml colorless aqueous phase to a new EP tube, add 0.5 times the volume of anhydrous ethanol and mix well; transfer the above-mentioned easy to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, add 0.5ml protein removal solution to the column, centrifuge at 4℃ and 12000rpm for 30s; add 0.5ml rinsing solution to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, repeat this step once; after centrifugation at 4℃ and 12000rpm for 2min, open the lid and let it stand at room temperature for 10min; add 30μl RNase-free water, let it stand at room temperature for 2min, and centrifuge at 4℃ and 12000rpm for 2min. The eluate is the total RNA solution, which is used for later use after the concentration is detected.

[0043] According to the instructions of Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific (China) Co., Ltd., N8080234), total RNA was reverse transcribed into cDNA. The operation steps are as follows: 0.5 μg of RNA was mixed with the reagents of the kit in proportion, and then reacted at 42°C for 1 hour and 70°C for 5 minutes. The resulting liquid is cDNA.

[0044] Next, the cDNA was used for qRT-PCR to analyze the expression of MEF2D and M1 macrophage marker gene nitric oxide synthase (iNOS), as follows:

[0045] The qPCR reaction was divided into three tubes, and PCR was performed simultaneously. The reagent components of each tube were as follows:

[0046] Table 1 Reagent components of the first tube

[0047] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse MEF2D forward primer (10 μM) 0.5 Mouse MEF2D reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0048] Table 2 Reagent components of the second tube

[0049] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse iNOS forward primer (10 μm) 0.5 Mouse iNOS reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0050] Table 3 Reagent components of the third tube

[0051] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse GAPDH forward primer (10 μM) 0.5 Mouse GAPDH reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0052] Among them, the forward primer sequence for amplifying mouse MEF2D is GGCTGGCACTAGGCAATGTCAC (SEQ ID NO.2), and the reverse primer sequence is CTGCTGTGGCTGTGGCTGTG (SEQ ID NO.3); the forward primer sequence for amplifying mouse iNOS is ACTCAGCCAAGCCCTCACCTAC (SEQ ID NO.4), and the reverse primer sequence is TCCAATCTCTGCCTATCCGTCTCG (SEQ ID NO.5). Mouse GAPDH is used as an internal reference gene, and the forward primer sequence is TGTTTCCTCGTCCCGTAG (SEQ ID NO.6), and the reverse primer sequence is CAATCTCCACTTTGCCACT (SEQ ID NO.7).

[0053] The PCR reaction procedure is as follows:

[0054] Stage 1: Pre-denaturation at 94°C for 30 seconds

[0055] Stage 2: PCR reaction (40 cycles)

[0056] Denaturation 94℃ 5sec

[0057] Annealing 60℃ 30sec

[0058] 2. Results Analysis

[0059] like Figure 1 As shown in the figure, compared with the normal glucose group, the expression of MEF2D in RAW26.7 cells in the high glucose group was significantly downregulated (p<0.05), while the expression of iNOS, a marker gene of M1 macrophages, was significantly upregulated (p<0.05). This shows that the high glucose environment induces macrophage M1 polarization and inhibits the expression of MEF2D.

[0060] Example 2

[0061] When the macrophage cell line RAW264.7 was cultured in DMEM complete culture medium (10% fetal bovine serum, 0.1% penicillin / streptomycin) until it occupied 70% of the culture dish, MEF2D siRNA transfection reagent (100 μl DMEM, 2 μl Lipofectamine 3000 (Thermo), 12 pmol si-MEF2D) was prepared and incubated at room temperature for 20 min, then mixed with the cells and incubated at 37°C, 5% CO 2 The cells were cultured for 24 h. The siRNA transfection reagent for the control group only included 100 μl DMEM and 2 μl Lipofectamine 3000 (Thermo), but did not include si-MEF2D.

[0062] 1. Detection method

[0063] The cells were collected and total RNA was extracted according to the kit instructions (Congwei Century, CW0584). The operation steps are as follows: resuspend the cell pellet with 1ml de Trizol, let it stand at room temperature for 5min, add 0.2ml chloroform, shake vigorously for 15s and let it stand at room temperature for 3min; after centrifugation at 12000rpm for 10min, transfer 0.4ml colorless aqueous phase to a new EP tube, add 0.5 times the volume of anhydrous ethanol and mix well; transfer the above-mentioned easy to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, add 0.5ml protein removal solution to the column, centrifuge at 4℃ and 12000rpm for 30s; add 0.5ml rinsing solution to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, repeat this step once; after centrifugation at 4℃ and 12000rpm for 2min, open the lid and let it stand at room temperature for 10min; add 30μl RNase-free water, let it stand at room temperature for 2min, and centrifuge at 4℃ and 12000rpm for 2min. The eluate is the total RNA solution, which is used for later use after the concentration is detected.

[0064] According to the instructions of Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific (China) Co., Ltd., N8080234), total RNA was reverse transcribed into cDNA. The operation steps are as follows: 0.5 μg of RNA was mixed with the reagents of the kit in proportion, and then reacted at 42°C for 1 hour and 70°C for 5 minutes. The resulting liquid is cDNA.

[0065] Next, the cDNA was used for qRT-PCR to analyze the expression of MEF2D and iNOS, as follows:

[0066] The qPCR reaction was divided into three tubes, and PCR was performed simultaneously. The reagent components of each tube were as follows:

[0067] Table 1 Reagent components of the first tube

[0068] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse MEF2D forward primer (10 μM) 0.5 Mouse MEF2D reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0069] Table 2 Reagent components of the second tube

[0070] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse iNOS forward primer (10 μm) 0.5 Mouse iNOS reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0071] Table 3 Reagent components of the second tube

[0072] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse GAPDH forward primer (10 μM) 0.5 Mouse GAPDH reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0073] Among them, the forward primer sequence for amplifying mouse MEF2D is GGCTGGCACTAGGCAATGTCAC (SEQ ID NO.2), and the reverse primer sequence is CTGCTGTGGCTGTGGCTGTG (SEQ ID NO.3); the forward primer sequence for amplifying mouse iNOS is ACTCAGCCAAGCCCTCACCTAC (SEQ ID NO.4), and the reverse primer sequence is TCCAATCTCTGCCTATCCGTCTCG (SEQ ID NO.5). Mouse GAPDH is used as an internal reference gene, and the forward primer sequence is TGTTTCCTCGTCCCGTAG (SEQ ID NO.6), and the reverse primer sequence is CAATCTCCACTTTGCCACT (SEQ ID NO.7).

[0074] The PCR reaction procedure is as follows:

[0075] Stage 1: Pre-denaturation at 94°C for 30 seconds

[0076] Stage 2: PCR reaction (40 cycles)

[0077] Denaturation 94℃ 5sec

[0078] Annealing 60℃ 30sec

[0079] 1. Results Analysis

[0080] like Figure 2 As shown in the figure, compared with the control group, the expression of MEF2D in RAW26.7 cells transfected with si-MEF2D was significantly downregulated (p<0.05), while the expression of iNOS was significantly upregulated (p<0.05). This indicates that inhibiting the expression of MEF2D can promote the M1 polarization of macrophages.

[0081] Example 3

[0082] When the macrophage cell line RAW264.7 was cultured in DMEM complete culture medium (10% fetal bovine serum, 0.1% penicillin / streptomycin) until it occupied 70% of the culture dish, MEF2D siRNA transfection reagent (100 μl DMEM, 2 μl Lipofectamine 3000 (Thermo), 1 ug MEF2D overexpression plasmid) was prepared and incubated at room temperature for 20 min, then mixed with the cells and incubated at 37°C, 5% CO 2 Culture for 48h.

[0083] 1. Detection method

[0084] The cells were collected and total RNA of monocytes was extracted according to the kit instructions (Cangwei Century Biotechnology Co., Ltd., CW0584). The operation steps are as follows: resuspend the cell pellet with 1ml de Trizol, let it stand at room temperature for 5min, add 0.2ml chloroform, shake vigorously for 15s and let it stand at room temperature for 3min; after centrifugation at 12000rpm for 10min, transfer 0.4ml colorless aqueous phase to a new EP tube, add 0.5 times the volume of anhydrous ethanol and mix well; transfer the above-mentioned easy to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, add 0.5ml protein removal solution to the column, centrifuge at 4℃ and 12000rpm for 30s; add 0.5ml rinsing solution to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, repeat this step once; centrifuge at 4℃ and 12000rpm for 2min, open the lid and let it stand at room temperature for 10min; add 30μl RNase-free water, let it stand at room temperature for 2min, centrifuge at 4℃ and 12000rpm for 2min. The eluate is the total RNA solution, which is used after the concentration is detected.

[0085] According to the instructions of Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific (China) Co., Ltd., N8080234), total RNA was reverse transcribed into cDNA. The operation steps are as follows: 0.5 μg of RNA was mixed with the reagents of the kit in proportion, and then reacted at 42°C for 1 hour and 70°C for 5 minutes. The resulting liquid is cDNA.

[0086] Next, the cDNA was used for qRT-PCR to analyze the expression of MEF2D and iNOS, as follows:

[0087] The qPCR reaction was divided into three tubes, and PCR was performed simultaneously. The reagent components of each tube were as follows:

[0088] Table 1 Reagent components of the first tube

[0089]

[0090]

[0091] Table 2 Reagent components of the second tube

[0092] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse iNOS forward primer (10 μm) 0.5 Mouse iNOS reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0093] Table 3 Reagent components of the second tube

[0094] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Mouse GAPDH forward primer (10 μM) 0.5 Mouse GAPDH reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0095] Among them, the forward primer sequence for amplifying mouse MEF2D is GGCTGGCACTAGGCAATGTCAC (SEQ ID NO.2), and the reverse primer sequence is CTGCTGTGGCTGTGGCTGTG (SEQ ID NO.3); the forward primer sequence for amplifying mouse iNOS is ACTCAGCCAAGCCCTCACCTAC (SEQ ID NO.4), and the reverse primer sequence is TCCAATCTCTGCCTATCCGTCTCG (SEQ ID NO.5). Mouse GAPDH is used as an internal reference gene, and the forward primer sequence is TGTTTCCTCGTCCCGTAG (SEQ ID NO.6), and the reverse primer sequence is CAATCTCCACTTTGCCACT (SEQ ID NO.7).

[0096] The reaction procedure is as follows:

[0097] Stage 1: Pre-denaturation at 94°C for 30 seconds

[0098] Stage 2: PCR reaction (40 cycles)

[0099] Denaturation 94℃ 5sec

[0100] Annealing 60℃ 30sec

[0101] 2. Results Analysis

[0102] like Figure 3 As shown in the figure, compared with the empty plasmid group, the expression of MEF2D in RAW26.7 cells transfected with MEF2D plasmid was significantly increased (p<0.01), while the expression of iNOS was significantly upregulated (p<0.01). This shows that overexpression of MEF2D can inhibit the M1 polarization of macrophages.

[0103] Example 4

[0104] Detection of monocyte / macrophage number and related factors

[0105] Detection method:

[0106] 2 ml of anticoagulated peripheral blood was collected from the patient using EDTA anticoagulation tubes, and 0.5 ml of anticoagulated blood was used for routine blood analysis to detect the number of monocytes / macrophages. The rest was used for further analysis.

[0107] 2 ml of the patient's procoagulant blood was collected through a procoagulant tube, centrifuged at 3000 rpm for 10 minutes, and the serum was directly aspirated with a pipette. The TNFα level in the serum was detected by the human TNF detection ELISA kit (Wuhan Boster Bioengineering Co., Ltd., EK0525). The operation steps are: add 10μl of serum and 100μl of sample diluent to the ELISA plate well at one time, incubate at 37°C for 90 minutes; tap the well plate liquid against absorbent paper to remove the well plate liquid, add 100μl of anti-human TNFα antibody, incubate at 37°C for 60 minutes; tap the well plate liquid against absorbent paper to remove the well plate liquid, add 100μl of washing solution, soak for 1 minute, tap the well plate liquid against absorbent paper to remove the well plate liquid, and repeat three times; add 90μl of TMB colorimetric solution to each well, react at 37°C in the dark for 20 minutes, and then add 100μl of TMB stop solution. OD 450nm Detect the absorbance value.

[0108] Results Analysis

[0109] like Figure 4 As shown in Figure 2, blood routine test analysis found that the number of peripheral monocytes / macrophages in patients with type 2 diabetes was 0.6±0.3×10 9 / L, the number of peripheral monocytes / macrophages in patients with type 2 diabetes and vascular inflammation was 0.6±0.2×10 9 / L, and there was no significant difference between the two.

[0110] like Figure 5 As shown in the figure, ELISA analysis found that the serum TNFɑ concentration in patients with type 2 diabetes was 16.8±0.6pg / ml, and the serum TNFɑ concentration in patients with type 2 diabetes and vascular inflammation was 16.6±1.0pg / ml, and there was no significant difference between the two.

[0111] like Figure 6 As shown, the serum CRP concentration in patients with type 2 diabetes was 31.2±66.8 mg / L, and the serum CRP concentration in patients with type 2 diabetes and vascular inflammation was 12.5±23.4 mg / L, and there was no significant difference between the two.

[0112] The serum TNFɑ and CRP concentrations in normal people were not significantly different from those in the other two groups. Therefore, common inflammatory factors in the blood cannot be used as markers for patients with type 2 diabetes and vascular inflammation.

[0113] Example 5

[0114] Detection Methods

[0115] The remaining anticoagulated blood in Example 1 was centrifuged at 1000 rpm for 5 min, and the blood cell pellet was resuspended in 1 ml of PBS. The mononuclear cells were separated according to the instructions of the human peripheral mononuclear cell separation solution (Beijing Solebow Technology Co., Ltd., P8680). The operation steps are as follows: slowly spread the blood cell suspension on the liquid surface of the pre-filled reagent A and reagent D, and centrifuge at 1800 rpm for 20 min; transfer the mononuclear cell layer to a new centrifuge tube, resuspend it with 5 times the volume of PBS, centrifuge at 1500 rpm for 5 min, and collect the cell pellet for subsequent experiments.

[0116] The above cell pellet was used to extract total RNA of monocytes according to the kit instructions (CW0584, Kangwei Century Biotechnology Co., Ltd.). The operation steps are as follows: resuspend the cell pellet with 1ml de Trizol, let it stand at room temperature for 5min, add 0.2ml chloroform, shake vigorously for 15s and let it stand at room temperature for 3min; after centrifugation at 12000rpm for 10min, transfer 0.4ml colorless aqueous phase to a new EP tube, add 0.5 times the volume of anhydrous ethanol and mix well; transfer the above-mentioned easy to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, add 0.5ml protein removal solution to the column, centrifuge at 4℃ and 12000rpm for 30s; add 0.5ml rinsing solution to the adsorption column, centrifuge at 4℃ and 12000rpm for 30s, repeat this step once; centrifuge at 4℃ and 12000rpm for 2min, open the lid and let it stand at room temperature for 10min; add 30μl RNase-free water, let it stand at room temperature for 2min, centrifuge at 4℃ and 12000rpm for 2min. The eluate is the total RNA solution, which is used after the concentration is detected.

[0117] According to the instructions of Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific (China) Co., Ltd., N8080234), total RNA was reverse transcribed into cDNA. The operation steps are as follows: 0.5 μg of RNA was mixed with the reagents of the kit in proportion, and then reacted at 42°C for 1 hour and 70°C for 5 minutes. The resulting liquid is cDNA.

[0118] Next, the above cDNA was used for qRT-PCR to detect MEF2D expression as follows:

[0119] The qPCR reaction was divided into two tubes, and the system of each tube was as follows:

[0120] Table 4 Reagent components of the first tube

[0121] Reagent components Volume (μl) 2×TB Green(takara) 5 cDNA 0.5 Forward primer (10 μm) 0.5 Reverse primer (10 μM) 0.5 <![CDATA[ddH 2 The]]> 3.5

[0122] Table 5 Reagent components of the second tube

[0123]

[0124]

[0125] The forward primer sequence of MEF2D amplification was GGCTGTCGCTAGGCAATGTCAC (SEQ ID NO. 2), and the reverse primer sequence was CTGTGGCTGTGGCTGCTGTG (SEQ ID NO. 3). GAPDH was used as the internal reference gene, and the internal reference gene forward primer sequence was TCTGATTTGGTCGTATTGGG (SEQ ID NO. 6), and the internal reference gene reverse primer sequence was TTTAGGGTAGTGGTAGAAGG (SEQ ID NO. 7).

[0126] The reaction procedure is as follows

[0127] Stage 1: Pre-denaturation at 94°C for 30 seconds

[0128] Stage 2: PCR reaction (40 cycles)

[0129] Denaturation 94℃ 5sec

[0130] Annealing 60℃ 30sec

[0131] Results Analysis

[0132] like Figure 7 As shown, qRT-PCR analysis found that MEF2D in peripheral monocytes of patients with T2D vascular inflammation was significantly reduced compared with T2D patients. MEF2D was significantly downregulated in peripheral mononuclear macrophages and was significantly negatively correlated with type 2 diabetes combined with vascular inflammation, and the correlation was strong. This suggests that MEF2D can be used as a biomarker for predicting and detecting type 2 diabetes combined with vascular inflammation.

[0133] Example 6

[0134] Analytical methods

[0135] The correlation between the data of the type 2 diabetes group and the type 2 diabetes combined with vascular inflammation group and MEF2D was analyzed by Spearman correlation. The receiver operating characteristic (ROC) curve was constructed by GraphPad Prism software to analyze the accuracy of MEF2D in peripheral mononuclear cells in predicting and detecting type 2 diabetes combined with vascular inflammation.

[0136] Results Analysis

[0137] like Figure 8As shown in the results, MEF2D expression in peripheral monocytes / macrophages was significantly correlated with patients with type 2 diabetes combined with vascular inflammation (r=0.802, p<0.01), suggesting that this indicator can be used as a biomarker for the early diagnosis of patients with type 2 diabetes combined with vascular inflammation. The area under the ROC curve was 0.6543, which was in a relatively credible interval. Compared with the indifferent results of peripheral inflammatory factors TNFα and CRP, the sensitivity was qualitatively improved.

[0138] In summary, MEF2D is significantly downregulated in peripheral mononuclear macrophages, and is significantly negatively correlated with type 2 diabetes combined with vascular inflammation, and the correlation is strong, which can better reflect the progression of type 2 diabetes combined with vascular inflammation. Therefore, it can be used as a clinical diagnostic molecular marker for type 2 diabetes combined with vascular inflammation, and used in the preparation of related products for diagnosis or detection of type 2 diabetes combined with vascular inflammation, thereby enriching the diagnosis and detection methods of type 2 diabetes combined with vascular inflammation. The overexpression / inhibition of type 2 diabetes combined with vascular inflammation can significantly inhibit / promote macrophage M1 polarization, thereby effectively inhibiting type 2 diabetes combined with vascular inflammation. Therefore, it can also be used as a molecular drug target to inhibit the formation and development of type 2 diabetes combined with vascular inflammation, providing a new experimental theoretical basis and direction for further studying the pathogenesis of type 2 diabetes combined with vascular inflammation and exploring its preventive and therapeutic drugs.

[0139] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0140] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. SEQUENCE LISTING <110> The First Affiliated Hospital of University of South China <120> Biomarkers and their applications in type 2 diabetes mellitus combined with vascular inflammation <130> 1 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 1545 <212> DNA <213> Synthetic <400> 1 atggggagga aaaagattca gatccagcga atcaccgacg agcggaaccg acaggtgact 60 ttcaccaagc ggaagtttgg cctgatgaag aaggcgtatg agctgagcgt gctatgtgac 120 tgcgagatcg cactcatcat cttcaaccac tccaacaagc tgttccagta cgccagcacc 180 gacatggaca aggtgctgct caagtacacg gagtacaatg agccacacga gagccgcacc 240 aacgccgaca tcatcgagac cctgaggaag aagggcttca acggctgcga cagccccgag 300 cccgacgggg aggactcgct ggaacagagc cccctgctgg aggacaagta ccgacgcgcc 360 agcgaggagc tcgacgggct cttccggcgc tatgggtcaa ctgtcccggc ccccaacttt 420 gccatgcctg tcacggtgcc cgtgtccaat cagagctcac tgcagttcag caatcccagc 480 ggctccctgg tcaccccttc cctggtgaca tcatccctca cggacccgcg gctcctgtcc 540 ccccagcagc cagcactaca gaggaacagt gtgtctcctg gcctgcccca gcggccagct 600 agtgcggggg ccatgctggg gggtgacctg aacagtgcta acggagcctg ccccagccct 660 gttgggaatg gctacgtcag tgctcgggct tcccctggcc tcctccctgt ggccaatggc 720 aacagcctaa acaaggtcat ccctgccaag tctccacccc cacctaccca cagcacccag 780 cttggagccc ccagccgcaa gcccgacctg cgagtcatca cttcccaggc aggaaagggg 840 ttaatgcatc acttgaacaa tgcccagcgc cttggggtct cccagtctac tcattcgctc 900 accaccccag tggtttctgt ggcaacgccg agtttactca gccagggcct ccccttctct 960 tccatgccca ctgcctacaa cacagattac cagttgacca gtgcagagct ctcctcctta 1020 ccagccttta gttcacctgg ggggctgtcg ctaggcaatg tcactgcctg gcaacagcca 1080 cagcagcccc agcagccgca gcagccacag cctccacagc agcagccacc gcagccacag 1140 cagccacagc cacagcagcc tcagcagccg caacagccac ctcagcaaca gtcccacctg 1200 gtccctgtat ctctcagcaa cctcatcccg ggcagccccc tgccccacgt gggtgctgcc 1260 ctcacagtca ccacccaccc ccacatcagc atcaagtcag aaccggtgtc cccaagccgt 1320 gagcgcagcc ctgcgcctcc ccctccagct gtgttcccag ctgcccgccc tgagcctggc 1380 gatggtctca gcagcccagc cgggggatcc tatgagacgg gagaccggga tgacggacgg 1440 ggggacttcg ggcccacact gggcctgctg cgcccagccc cagagcctga ggctgagggc 1500 tcagctgtga agaggatgcg gcttgatacc tggacattaa agtga 1545 <210> 2 <211> 22 <212> DNA <213> Synthetic <400> 2 ggctgtcgct aggcaatgtc ac 22 <210> 3 <211> 20 <212> DNA <213> Synthetic <400> 3 ctgtggctgt ggctgctgtg 20 <210> 4 <211> 22 <212> DNA <213> Synthetic <400> 4 actcagccaa gccctcacct ac 22 <210> 5 <211> 24 <212> DNA <213> Synthetic <400> 5 tccaatctct gcctatccgt ctcg 24 <210> 6 <211> 18 <212> DNA <213> Synthetic <400> 6 tgtttcctcg tcccgtag 18 <210> 7 <211> 19 <212> DNA <213> Synthesis <400> 7 caatctccac tttgccact 19

Claims

1. Application of PCR amplification primers in the preparation of products for diagnosing type 2 diabetes combined with vascular inflammation; the PCR amplification primers are upstream primers and downstream primers for quantitatively detecting the expression level of biomarkers of type 2 diabetes combined with vascular inflammation in peripheral mononuclear macrophages; the biomarker of diabetes combined with vascular inflammation is the MEF2D gene, which has a nucleotide sequence as shown in SEQID NO.

1.

2. The use according to claim 1, characterized in that: The upstream primer is a nucleotide sequence as shown in SEQ ID NO.2, and the downstream primer is a nucleotide sequence as shown in SEQ ID NO.

3.

3. The use according to claim 1, characterized in that: The product is a detection reagent or a test kit.

Images