Molecular markers, methods, primer pairs, kits and applications for identifying watermelon seed coat crack traits

Abstract

The invention discloses a molecular marker, method, primer pair, kit and application thereof for identifying crack traits of watermelon seed coat, belonging to the technical field of molecular marker-assisted breeding. In order to better identify the crack traits of watermelon seed coat, a chromosome segment and a molecular marker tightly linked to the crack traits of watermelon seed coat are obtained. The present invention provides a molecular marker tightly linked to the crack traits of watermelon seed coat, and the molecular marker has a change in an InDel site. The genomic DNA of watermelon seedlings is amplified by PCR using a primer pair, and the PCR product is detected by polyacrylamide gel electrophoresis, so as to distinguish whether the watermelon seed coat has crack traits. The above identification method is simple to operate and has high accuracy, and provides an effective molecular breeding tool for molecular identification of watermelon seed coat morphology.

Description

Technical Field

[0001] The invention relates to a molecular marker, a method, a primer pair, a kit and an application thereof for identifying watermelon seed coat crack traits, and belongs to the technical field of molecular marker-assisted breeding. Background Art

[0002] Watermelon (Citrullus lanatus) is an annual vine herbaceous plant of the genus Citrullus in the family Cucurbitaceae. It is widely cultivated in my country and around the world and is one of the important fruit vegetables in the world. In addition to the edible flesh of watermelon, its seeds and seed coat are rich in unsaturated fatty acids (mainly linoleic acid) that have health benefits and nutritional value for the human body. Linoleic acid has multiple functions such as lowering blood lipids, resisting thrombosis, and improving brain memory and attention, and has important health benefits for the human body. Therefore, studying the characteristics of watermelon seed coat is of great research value in watermelon breeding.

[0003] InDel molecular markers are molecular markers that produce fragment length polymorphism after PCR amplification due to the presence of missing or inserted sequences in nucleotide fragments. This type of marker is widely distributed in the genome, easy to operate, and the results are easy to observe. It has universal applicability in different materials of the same species. Summary of the invention

[0004] In order to better identify the watermelon seed coat crack trait, obtain the chromosome segment and molecular marker tightly linked to the watermelon seed coat crack trait, the present invention provides an InDel molecular marker tightly linked to the watermelon seed coat crack trait, the InDel molecular marker is a 117bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.1 and a 128bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.2; the SEQ ID NO.1 is tightly linked to the seed coat crack-free trait, and the SEQID NO.2 is tightly linked to the seed coat crack trait.

[0005] The present invention also provides an application of a primer pair in identifying crack characteristics of watermelon seed coat, wherein the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4. The application is to amplify watermelon genomic DNA using the primer pair to obtain an amplification product, and then identify whether the watermelon seed coat has cracks by detecting the amplification product.

[0006] It is further specified that the watermelon genomic DNA is taken from any one of the seedling stage, vine growth stage or fruiting stage.

[0007] It is further defined that in the application, the amplification product is detected by polyacrylamide gel electrophoresis. If the amplification product is a fragment of 117 bp, or contains two fragments of 117 bp and 128 bp at the same time, it is determined to have the trait of no crack in the seed coat; if the amplification product is a fragment of 128 bp, it is determined to have the trait of crack in the seed coat.

[0008] The present invention also provides a method for identifying crack characteristics of watermelon seed coat, comprising the following steps:

[0009] (1) extracting genomic DNA of the watermelon to be tested;

[0010] (2) using the genomic DNA obtained in step (1) as a template, performing PCR amplification using a primer pair to obtain a PCR product; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4;

[0011] (3) By detecting the PCR product, determine whether the watermelon seed coat has cracks.

[0012] It is further defined that the judgment method in step (3) is to use polyacrylamide gel electrophoresis to detect the PCR product. If the PCR product is a fragment of 117 bp, or contains two fragments of 117 bp and 128 bp at the same time, it is judged that the seed coat has no crack trait; if the PCR product is a fragment of 128 bp, it is judged that the seed coat has a crack trait.

[0013] The present invention also provides application of the method in auxiliary identification of watermelon seed coat crack traits, auxiliary breeding and screening of watermelon seed coat crack traits.

[0014] The present invention also provides a kit for identifying watermelon seed coat crack traits, the kit containing a primer pair; the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0015] The present invention also provides a method for using the kit, using the primer pair to amplify watermelon genomic DNA to obtain PCR products, and then using polyacrylamide gel electrophoresis to detect the PCR products.

[0016] The present invention also provides the application of the kit in auxiliary identification of watermelon seed coat crack traits, auxiliary breeding and screening of watermelon seed coat crack traits.

[0017] Beneficial effects of the present invention:

[0018] On the basis of clarifying the genetic law of watermelon seed crack trait, genome resequencing and BSA-seq technology were used to quickly obtain the chromosome segment closely linked to the watermelon seed crack trait. Through verification in the genetic population, InDel molecular markers were developed in the above chromosome segment. The markers are located in the positioning interval of Seed crack, a key gene of the watermelon seed crack trait, and are closely linked to the trait. By using the molecular marker-assisted selection method, the genomic DNA of the watermelon samples to be tested can be extracted at the watermelon seedling stage to perform molecular marker-assisted selection on the watermelon seed crack trait, which improves the accuracy and efficiency of breeding. The molecular marker can be applied to the molecular breeding of seed watermelons, providing an effective molecular breeding tool for the molecular identification of watermelon seed rind morphology.

[0019] The present invention designs primer pairs using molecular markers closely linked to the watermelon seed coat crack trait developed and obtained using parent resequencing data. Due to the polymorphism of short sequence insertion and deletion in the molecular marker fragments in different watermelon materials, PCR amplification is performed on the genomic DNA of watermelon seedlings by using the obtained primer pairs, and the size of the PCR product fragment is detected by polyacrylamide gel electrophoresis, so that whether the watermelon seed coat has the crack trait can be molecularly identified in the seedling stage. The identification method can realize the identification of the watermelon seed coat crack trait by extracting the genomic DNA of the watermelon sample to be tested in the seedling stage, is simple to operate, and has high breeding accuracy and efficiency, and provides an effective breeding tool and technology for watermelon seed coat morphology molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a map showing the location results of the key genes for watermelon seed coat cracking traits in Example 1;

[0021] Figure 2 This is the electrophoresis result of the primer pairs in Example 4 for detecting the PCR amplification products of materials with no cracks in the seed coat and materials with cracks in the seed coat, wherein lanes 1-10 are materials with smooth seed coat (117bp) in the F2 population, lanes 11-20 are materials with cracks in the seed coat (128bp) in the F2 population, lanes 21-28 are materials with smooth seed coat (containing both 117bp and 128bp) in the F2 population, lanes 29-34 are watermelon materials with smooth seed coat (117bp) in the natural population, lanes 35-42 are watermelon materials with cracks in the seed coat (128bp) in the natural population, and in the Marker lane, the two fragments are a 100bp fragment and a 250bp fragment, respectively. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments and drawings. Except for the contents specifically mentioned below, the processes, conditions, experimental methods and reagents for implementing the present invention are common knowledge in the art and conventional products on the market, and the present invention has no particular limitations.

[0023] Method for extraction of genomic DNA:

[0024] The genomic DNA extraction method was based on the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.), and was improved on this basis.

[0025] The specific steps are as follows:

[0026] ① Wash and dry the collected young true leaves with sterile water, take 0.2 g and put them into a 1.5 mL centrifuge tube, add liquid nitrogen and grind them into white powder, add 800 μL of 2% CTAB solution preheated at 65°C (2% CTAB, 100 mmol / L Tris-HCl pH = 8.0), 1.4 mol / L NaCl, 20 mmol / L EDTA pH = 8.0, 2% β-mercaptoethanol) and mix well, place in a 65°C water bath for 1 hour, and shake gently every 10 minutes.

[0027] ②Take out the centrifuge tube, wait for it to cool to room temperature, and centrifuge at 13000rpm for 10 minutes. Aspirate the supernatant and place it in a new centrifuge tube. To prevent mechanical shear force from damaging the DNA, the tip of the pipette used for transfer needs to be cut off with scissors in advance to expand the pipette port.

[0028] ③ Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0029] ④ Take out the centrifuge tube and use the same method as above to suck out 700 μL of supernatant with the pipette tip against the wall and place it in a new centrifuge tube.

[0030] ⑤ Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, gently shake the centrifuge tube to fully mix the solution, let it stand for 10 minutes, then centrifuge at 13000 rpm for 10 minutes.

[0031] ⑥ Aspirate 650 μL of supernatant and place it in a new tube, add 2 μL RNase (10 mg / mL), mix well, and place in a 37°C water bath for 2 hours.

[0032] ⑦ Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0033] ⑧ Aspirate 550 μL of supernatant from the tube and place it in a new tube. Add 550 μL of -20℃ pre-cooled isopropanol (add it to the tube wall). Close the tube cap tightly, turn it upside down several times, and place it in a -20℃ refrigerator for 60 minutes.

[0034] ⑨Take out the centrifuge tube and centrifuge it at 13000rpm for 10min. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.

[0035] ⑩ Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, add 200 μL ddH2O to dissolve, and store at -20°C for later use.

[0036] Example 1: Molecular markers tightly linked to watermelon seed coat crack traits and methods for obtaining the same

[0037] A. Selection of test materials: The test materials include female parents (seed coat without cracks) and male parents (seed coat with cracks), F1 generation and F2 generation populations.

[0038] The female parent material is: Cream of Saskatchewan (referred to as "COS"), a cultivated watermelon with no cracks on the seed coat;

[0039] The male parent material is: PI 192938, a cultivated watermelon with cracked seed coat;

[0040] The above maternal and paternal lines are published in Shi Liu, Zhongqi Gao, Xuezheng Wang, Feishi Luan, Zuyun Dai, Zhongzhou Yang, Qian Zhang. Nucleotide variation in the phytoenesynthase (ClPsy1) gene contributes to golden flesh in watermelon (Citrulluslanatus L.). Theor Appl Genet 135, 185–200 (2022). https: / / doi.org / 10.1007 / s00122-021-03958-0.

[0041] The F1 generation is: the F1 generation obtained by hybridizing the above two materials as parents;

[0042] The F2 generation population is: the F2 generation population obtained by self-pollination of the above-mentioned F1 generation, with a total of 219 plants.

[0043] B. Determination of seed coat characteristics of test materials: At maturity, watermelon fruits were harvested and seeds were collected. After drying, the seed coats of individual plants of each generation were investigated to see whether they had cracks.

[0044] According to the investigation results in step B, the F1 representative currently has no cracks in the seed coat. In the F2 generation, the segregation ratio of single plants with no cracks in the seed coat and those with cracks in the seed coat meets the segregation ratio of 3:1 after the chi-square test. In the two backcross generations, the two traits also meet the segregation ratio of 1:1 and 0:1 respectively, indicating that the watermelon seed coat crack trait is regulated by a single recessive gene.

[0045] C. Using BSA-seq and genetic linkage analysis methods, the chromosome segment tightly linked to the watermelon seed coat crack trait was obtained.

[0046] In the F2 generation, 20 plants with no cracks in the seed coat and 20 plants with cracks in the seed coat were selected, and DNA from each plant was extracted. After adjusting the DNA concentration to be consistent, equal amounts were mixed to construct gene pools for no cracks in the seed coat and cracks in the seed coat, and BSA-seq analysis was performed. Based on the results of BSA-seq analysis combined with the genome resequencing data of the two parents, InDel molecular markers were developed within the chromosome segment of the BSA-seq analysis results, and genetic linkage analysis was performed in the F2 generation to shorten the positioning interval. Finally, the key gene for the watermelon seed coat crack trait was located within the range of about 271.75Kb on chromosome 3 of the watermelon genome. Figure 1 This is the preliminary positioning result.

[0047] D. Candidate InDel marker development.

[0048] Based on the resequencing data of the two parents, molecular markers were developed, and genotyping was performed on each individual plant in the F2 generation segregating population and natural population. Combined with the phenotypic data, the consistency between the genotype and the phenotype was determined. The results showed that the change of an InDel site in this segment was closely linked to the smooth seed coat and cracked seed coat traits.

[0049] The molecular markers tightly linked to the watermelon seed coat crack trait obtained by the present invention are a 117bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.1 and a 128bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.2; the SEQ ID NO.1 is tightly linked to the seed coat crack-free trait, and the SEQ ID NO.2 is tightly linked to the seed coat crack trait.

[0050] SEQ ID NO.1:

[0051] TGGACCATTGATGCAAGTACTTAATTAGGAAAGGTAAATCAAAGTCAAATTATATCCACAGTGGAATTTGAGAAGTATTTCAATTTGGTTAT GAGAATGATTTGATAAGACTGGCCT

[0052] SEQ ID NO.2:

[0053] TGGACCATTGATGCAAGTACTTAAT TAGGAAAGGTAAATCAAAGTCAAATTATTGGAAATATATATCCACAGTGGAATTTGAGAAGTATTTCAATTTGGTTAT GAGAATGATTTGATAAGACTGGCCT

[0054] Example 2: Acquisition of primer pairs for identifying seed coat crack traits

[0055] The parental resequencing data were used to develop InDel molecular markers closely linked to the seed coat crack trait and design primer pairs.

[0056] The specific operation is as follows: within the preliminary positioning interval described in Example 1, primers are designed based on the InDel differences in the sequencing data of the two parents. The genomic DNA of each individual plant in the paternal, maternal, F1 generation and F2 generation populations in Example 1 is extracted respectively, and the genomic DNA of each individual plant in the paternal, maternal, F1 generation and F2 generation populations obtained is PCR amplified using primer pairs, and then the above respective PCR amplification products are detected.

[0057] The upstream primer sequence in the above primer pair is Watermelon seed crack-F (SEQ ID NO.3): 5'-TGGACCATTGATGCAAGTACTTAAT-3'

[0058] The downstream primer sequence is Watermelon seed crack-R (SEQ ID NO.4): 5'-AGGCCAGTCTTATCAAATCATTCTC-3'

[0059] Example 3: A method for identifying crack characteristics of watermelon seed coat

[0060] A method for identifying crack characteristics of watermelon seed coat, comprising the following steps:

[0061] (1) Extract genomic DNA from leaves or other tissues of the watermelon sample to be tested.

[0062] The identification method of the present invention can use watermelon seedlings at different stages as materials. In order not to affect the optimal period of subsequent growth, this embodiment uses leaves of watermelon seedlings (two leaves and one heart stage) as materials to extract DNA.

[0063] (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification is performed using a primer pair to obtain a PCR product; the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0064] (3) The PCR product was detected by polyacrylamide gel electrophoresis. If the amplified product was a fragment of 117 bp, or contained both fragments of 117 bp and 128 bp, it was determined that the seed coat had no cracks. If the amplified product was a fragment of 128 bp, it was determined that the seed coat had cracks.

[0065] The PCR reaction system is as follows: 1 μL of upstream and downstream primers (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10×PCR Buffer (containing Mg 2 +15mM), dNTP 0.15μL (concentration is 10mM), Taq enzyme 0.1μL (5U / μL), sterile deionized water 6.75μL;

[0066] The PCR reaction program was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C;

[0067] PCR product detection method: Take 2μL of PCR product, add 2μL Loading Buffer, mix well and spot into polyacrylamide gel, perform electrophoresis at 220V / 400mA for 50-60min.

[0068] The identification method of the present invention can be used to judge the crack characteristics of watermelon seed coat at the watermelon seedling stage, and the sampling time is about the two-leaf and one-heart period; while conventional breeding requires harvesting watermelon fruits and seeds at maturity, and then drying them to investigate whether the seed coat has cracks. It can be seen that the identification method of the present invention can effectively shorten the breeding time and speed up the breeding speed.

[0069] Example 4: Screening watermelon varieties with different seed coat crack traits using the obtained primer pairs

[0070] In order to determine the accuracy of the above molecular markers, primer pairs and identification methods in identifying the seed coat crack trait, samples of F2 watermelon seedlings and natural populations described in Example 1 were selected, and the seed coat crack trait of each sample was identified according to the identification method described in Example 3. The identification results are as follows: Figure 2 As shown, when the watermelon is mature, the watermelon fruits are harvested and the seeds are collected. After drying, the seed coat of each individual plant is investigated to see whether there are cracks.

[0071] Figure 2 In the present invention, lanes 1-10 are materials with smooth seed coat (117bp) in the F2 population, lanes 11-20 are materials with cracked seed coat (128bp) in the F2 population, lanes 21-28 are materials with smooth seed coat (containing both 117bp and 128bp) in the F2 population, lanes 29-34 are watermelon materials with smooth seed coat (117bp) in the natural population, lanes 35-42 are watermelon materials with cracked seed coat (128bp) in the natural population, and in the Marker lane, the two fragments are 100bp and 250bp, respectively. The identification results and the observation results of the watermelon seed coat crack trait show that the identification results of the seed coat crack trait are 100% consistent with the actual seed coat crack trait, thereby illustrating the feasibility and accuracy of the molecular markers, primer pairs and watermelon seed coat crack trait identification method of the present invention.

[0072] Example 5: A kit for identifying watermelon seed coat crack characteristics

[0073] A kit for identifying the number of ventricles in watermelon includes the following reagents: Watermelon seed crack-F (concentration is 2pM), Watermelon seed crack-R (concentration is 2pM), 10×PCR Buffer (containing Mg 2+ 15 mM), dNTP (concentration of 10 mM), Taq enzyme (5 U / μL) and sterile deionized water.

[0074] Example 6: Method for using a kit for identifying watermelon seed coat crack characteristics

[0075] (1) Extract the genomic DNA of the watermelon to be tested and adjust the genomic DNA concentration to 30 ng / μL.

[0076] (2) Add samples and reagents according to the following PCR system

[0077]

[0078] (3) PCR amplification was performed with the following procedure: pre-denaturation at 94°C for 7 min, denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 30 s, 30 cycles, extension at 72°C for 10 min, and storage at 4°C.

[0079] (4) The PCR product was detected by polyacrylamide gel electrophoresis, and the crack characteristics of the watermelon seed coat were determined based on the detection results. Specifically, if the amplified product was a fragment of 117 bp, or contained both fragments of 117 bp and 128 bp, the watermelon seed coat was determined to have a crack-free trait; if the amplified product was a fragment of 128 bp, the watermelon seed coat was determined to have a crack-free trait.

[0080] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims. SEQUENCE LISTING <110> Shandong Shouguang Sanmu Seedling Co., Ltd. Shandong Muskmelon Breeding Engineering Technology Research Center Co., Ltd. Northeast Agricultural University <120> Molecular markers, methods, primer pairs, kits and applications for identifying watermelon seed coat crack traits <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 117 <212> DNA <213> Citrullus lanatus <400> 1 tggaccattg atgcaagtac ttaattagga aaggtaaatc aaagtcaaat tatatccaca 60 gtggaatttg agaagtattt caatttggtt atgagaatga tttgataaga ctggcct 117 <210> 2 <211> 128 <212> DNA <213> Citrullus lanatus <400> 2 tggaccattg atgcaagtac ttaattagga aaggtaaatc aaagtcaaat tattggaaat 60 atatatccac agtggaattt gagaagtatt tcaatttggt tatgagaatg atttgataag 120 actggcct 128 <210> 3 <211> 25 <212> DNA <213> Synthesis <400> 3 tggaccattg atgcaagtac ttaat 25 <210> 4 <211> 25 <212> DNA <213> Synthesis <400> 4 aggccagtct tatcaaatca ttctc 25

Claims

1. An InDel molecular marker tightly linked to the watermelon seed coat crack trait, characterized in that: The InDel molecular marker is a 117 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.1 and a 128 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.2; the SEQ ID NO.1 is closely linked to the seed coat crack-free trait, and the SEQ ID NO.2 is closely linked to the seed coat crack trait.

2. The application of the primer pair in identifying the crack characteristics of watermelon seed coat is characterized in that: The primer pair includes an upstream primer whose nucleotide sequence is shown in SEQ ID NO.3 and a downstream primer whose nucleotide sequence is shown in SEQ ID NO.

4. The application is to use the primer pair to amplify watermelon genomic DNA to obtain an amplification product, and then detect the amplification product by polyacrylamide gel electrophoresis to identify whether the watermelon seed coat has cracks. If the amplification product is a fragment of 117 bp, or contains two fragments of 117 bp and 128 bp at the same time, it is determined that the seed coat has no crack trait; if the amplification product is a fragment of 128 bp, it is determined that the seed coat has a crack trait.

3. The use according to claim 2, characterized in that: The watermelon genomic DNA is taken from any one of the seedling stage, vine growth stage or fruiting stage.

4. A method for identifying crack characteristics of watermelon seed coat, characterized in that: The steps include: (1) Extracting genomic DNA from the watermelon to be tested; (2) using the genomic DNA obtained in step (1) as a template, and performing PCR amplification using a primer pair to obtain a PCR product; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; (3) The PCR product was detected by polyacrylamide gel electrophoresis to determine whether the watermelon seed coat had cracks. If the PCR product was a fragment of 117 bp, or contained both 117 bp and 128 bp, it was determined that the watermelon seed coat had no cracks. If the PCR product was a fragment of 128 bp, it was determined that the watermelon seed coat had cracks.

5. Application of the method according to claim 4 in auxiliary identification of watermelon seed coat crack traits, auxiliary breeding and screening of watermelon seed coat crack traits.

6. A kit for identifying crack characteristics of watermelon seed coat, characterized in that: The kit contains a primer pair; the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

4.

7. A method for using the kit according to claim 6, characterized in that: Amplifying watermelon genomic DNA using the primer pair to obtain a PCR product, and then detecting the PCR product using polyacrylamide gel electrophoresis. If the PCR product is a 117 bp fragment, or contains both 117 bp and 128 bp fragments, it is determined that the seed coat has a crack-free trait; If the PCR product is a fragment of 128 bp, it is judged to have the seed coat crack trait.

8. Use of the kit according to claim 6 in auxiliary identification of watermelon seed coat crack traits, auxiliary breeding and screening of watermelon seed coat crack traits.

Images