IRAP molecular marker primers and identification method for Shazikongxin plum germplasm based on retrotransposon

By designing IRAP molecular marker primers and PCR amplification systems, the problem of unclear identification of Shazikongxin plum germplasm resources was solved, and efficient and accurate germplasm identification and fingerprint map construction were achieved, supporting the preservation and breeding of excellent germplasm.

CN114854900BActive Publication Date: 2025-09-16GUIZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210693762.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-18
Publication Date
2025-09-16
Estimated Expiration
2042-06-18

AI Technical Summary

Technical Problem

The existing technology lacks efficient and accurate molecular identification methods, resulting in unclear identification of Shazikongxin plum germplasm resources, inconsistent fruit quality, damaged brand reputation, and irregular planting management leading to irregular seedling breeding, affecting economic benefits.

Method used

Develop IRAP molecular marker primers and identification methods based on retrotransposon sequences, and achieve efficient and accurate germplasm resource identification and fingerprint map construction by designing specific IRAP primers and PCR amplification systems.

Benefits of technology

It provides a molecular identification method with high heterogeneity identification level and good resolution. The results are accurate and reliable, and the operation is simple and fast. It is suitable for the identification of Shazikongxin plum germplasm resources, kinship identification and genetic diversity analysis, and supports the preservation and breeding of excellent germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114854900B_ABST
    Figure CN114854900B_ABST
Patent Text Reader

Abstract

The present invention discloses an IRAP molecular marker primer for identifying Shazikongxin plum germplasm based on retrotransposons, characterized in that the IRAP molecular marker primer is one or a mixture of Ty1-6, Ty1-7, Ty1-9, Ty1-15, Ty1-18, Ty1-20, Ty1-25, Ty3-2, Ty3-3, Ty3-5, Ty3-6, Ty3-9, Ty3-14, and Ty3-16. The present invention detects the retrotransposons at the molecular level based on their characteristics, resulting in more accurate and reliable results. The detection was repeated on dozens of Shazikongxin plum germplasms and the test results remained consistent, indicating that the results were accurate and reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and relates to developing IRAP primers using the RT sequence of a Li retrotransposon, establishing a PCR amplification system and its application. Background Art

[0002] The Shazikongxinli plum (Prunus salicina Lindl. cv. 'Shazikongxinli'), a member of the genus Prunus in the Rosaceae family, is a local specialty plum variety native to Yanhe County, Guizhou Province. Designated a National Geographical Indication Protected Product in 2006, it boasts a long history of cultivation and a unique flavor. Shazikongxinli has been a key project and pillar industry in Yanhe County, Guizhou Province. As of the end of 2021, the plantation area reached 45,000 mu (approximately 16,000 acres), with an annual output of over 20,000 tons and an economic benefit of 320 million yuan.

[0003] Currently, due to long-term human intervention and natural variation, micro-mutations of inferior genes have accumulated in Shazikongxin plum, causing some of the original excellent varieties to gradually weaken. In addition, when Yanhe County vigorously promoted the planting area of ​​Shazikongxin plum, it did not pay attention to the scientific management of the orchard, focusing on planting but not managing, or planting without managing. At the same time, there are problems such as non-standard seedling breeding and multiple sources. As a result, the current production of Shazikongxin plum has different fruit maturity periods and uneven fruit quality, which has damaged the brand reputation of Shazikongxin plum. At present, there are gaps in the identification of Shazikongxin plum germplasm resources and the construction of fingerprints. There is no clear identification technology. Therefore, it is necessary to develop an efficient and accurate molecular identification technology to provide services for the identification, preservation and new germplasm discovery of Shazikongxin plum's excellent germplasm.

[0004] IRAP (retrotransposon site amplified polymorphism) is a molecular marker based on the polymorphism between plant retrotransposon sequences. It has been widely used in germplasm resource identification, kinship identification and genetic diversity analysis. It has the advantages of high throughput, wide genome coverage, rich polymorphism and high heterogeneity. Summary of the Invention

[0005] The technical problem addressed by this invention is to provide a genetically-based identification method that demonstrates high heterogeneity identification, high resolution, stability, reliability, efficiency, and rapidity. This method can be directly applied to the identification of Shazikongxin Plum germplasm resources, fingerprint construction, kinship analysis, and genetic diversity analysis, providing an effective means for the preservation of superior germplasm, assisted breeding, and intellectual property protection. The key technologies addressed by this invention are the acquisition of highly efficient IRAP primers and the establishment of a PCR amplification system.

[0006] The technical solution of the present invention is: an IRAP molecular marker primer for identifying Shazikongxin plum germplasm based on retrotransposon and an identification method thereof, characterized in that the IRAP molecular marker primer is one of Ty1-6, Ty1-7, Ty1-9, Ty1-15, Ty1-18, Ty1-20, Ty1-25, Ty3-2, Ty3-3, Ty3-5, Ty3-6, Ty3-9, Ty3-14 and Ty3-16, or a mixture of more than one.

[0007] The IRAP molecular marker comprises the following steps:

[0008] S1, extract genomic DNA from young leaves of the tested Shazikongxin plum;

[0009] S2, IRAP primers were designed based on the RT sequences of Ty1-copia and Ty3-gypsy retrotransposons of P. li;

[0010] S3, take DNA from S1, amplify it by PCR reaction, and then perform preliminary screening of the designed primers by 1.5% agarose gel electrophoresis, and retain the IRAP primers with polymorphism and clear bands;

[0011] S4. Perform IRAP molecular marker analysis on all test materials using the IRAP primers obtained in the preliminary screening. Repeat 2-3 times for each primer, and determine the results based on the presence, number, and size of the amplified bands.

[0012] The optimal PCR reaction system in S3 was: 30 ng / μl template DNA 1.0 μl, primers 1.3 μl, PCR Mix 5.0 μl and 2.7 μl ddH2O.

[0013] The PCR reaction program described in S3 was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 51°C-58°C for 30 s, extension at 72°C for 1 min, for a total of 40 cycles, reaction at 72°C for another 10 min, and storage at 4°C.

[0014] The young leaves mentioned in S1 refer to leaves that are 15-20 days old and fresh or stored at -80°C.

[0015] The mix used in the PCR reaction in S3 included 0.4 mM Taq DNA polymerase, 0.4 mM dNTP, 4 mM MgCl2 and 0.4 mM conventional buffer.

[0016] The beneficial effects of the present invention are as follows: 1. The results are accurate and reliable: the traditional identification method of Shazikong Plum mainly detects from the aspect of botanical traits, which is greatly affected by the external environment and has significant errors. The present invention detects at the molecular level based on the characteristics of retrotransposons, and the results are more accurate and reliable; by testing dozens of Shazikong Plum germplasms, after multiple repetitions, the test results remain consistent, and the results are accurate and reliable.

[0017] 2. Easy and quick operation, not affected by time and space: Traditional botanical markers of Shazikongxin plum are easily restricted by seasonal and geographical factors, while the IRAP marker of the present invention only requires about 30 ng of DNA from the sample to be tested, and the test results can be obtained through ordinary PCR and conventional gel electrophoresis.

[0018] 3. Good polymorphism and high sensitivity of results: Through testing dozens of hollow plum germplasms, the polymorphism of IRAP primers is generally high and can efficiently identify different germplasms.

[0019] 4. The optimal system of 10μl IRAP-PCR was determined, which is economical and efficient and more suitable for the detection of IRAP markers in Shazikong Plum.

[0020] 5. The present invention develops hollow plum IRAP marker primers based on the retrotransposon sequence that is widely present in plant genomes. It can be effectively used for the identification of germplasm resources, kinship identification and fingerprint map construction of plum species or plum-related species, and provides practical reference significance for the protection of germplasm intellectual property rights and the auxiliary breeding of excellent germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The figure shows the orthogonal experimental results of the IRAP-PCR reaction system of 10 μl sand hollow plum, with a gradient of 3 PCR cycles; in the figure: (lanes 1-16 represent the PCR systems numbered 1-16 in Table 1 of the orthogonal experiment; M is a DNA marker);

[0022] Figure 2 The results of the initial screening by 1.5% agarose gel electrophoresis after PCR amplification with 14 IRAP primers; In the figure: (1-8 represent 8 different Shazikongxin plum germplasms; M is a DNA marker);

[0023] Figure 3 This is a detection diagram of primer Ty3-2 on 92 Shazikongxin plum germplasms; in the figure: (lane numbers correspond to the 92 Kongxin plum germplasm numbers; M is DNA marker);

[0024] Figure 4 This is a detection diagram of primer Ty3-5 on 92 Shazikongxin plum germplasms; in the figure: (lane numbers correspond to the 92 Kongxin plum germplasm numbers; M is DNA marker);

[0025] Figure 5 This is a detection diagram of primer Ty3-6 on 92 Shazikongxin plum germplasms; in the figure: (lane numbers correspond to the 92 Kongxin plum germplasm numbers; M is DNA Marker). DETAILED DESCRIPTION

[0026] In order to clearly and in detail explain the technical implementation scheme of the present invention, the following will be introduced in conjunction with the drawings in the embodiment of the present invention; this embodiment is only one of the embodiments of the present invention.

[0027] Example 1

[0028] 1. IRAP Primer Design

[0029] Multiple sequence alignments of the RT sequences of the Plum retrotransposons Ty1-copia and Ty3-gypsy (NCBI: KF278998-KF279023 and KF279024-KF279041) were performed using Clustal W to identify conserved regions. Unidirectional primers were then designed using the Primer 5.0 program. Primer design parameters included: primer length between 19 and 25 bp; CG content between 40% and 60%; annealing temperature (Tm) between 50 and 64°C; and primer dimers and hairpin structures were minimized. A total of 65 IRAP unidirectional primers were designed and synthesized by Shanghai Bioengineering.

[0030] 2.10 μl IRAP labeling PCR system establishment

[0031] Select an IRAP primer and design L16(4 3 ) Orthogonal experiments were performed to determine the main influencing factors of the 10 μl sand hollow plum IRAP-PCR reaction system, namely, Mix, primers, and template DNA dosage (Table 1), and three gradients were set for the number of PCR cycles: 30, 35, and 40 times.

[0032] Table 1: Orthogonal experiment table for Mix, primers and template DNA at four levels

[0033]

[0034] The results of the 10μl IRAP-PCR orthogonal experiment are as follows Figure 1 As shown, the selected amplification system is system 7: 30ng / μl template DNA 1.0μl, IRAP primers (10 -5 mol / L) 1.3 μl and Mix 5.0 μl, wherein the Mix contains 0.4 mM Taq DNA polymerase, 0.4 mM dNTP, and 4 mM MgCl2.

[0035] 2) PCR amplification procedure is as follows:

[0036]

[0037] 3. IRAP Primer Screening: Eight leaves aged 15-20 days were randomly selected for DNA extraction using the Tiangen DNAsecure Plant Kit. DNA was analyzed by 1% agarose gel electrophoresis and UV spectrophotometry. The DNA was then diluted to approximately 30 ng / μl in TE buffer and stored at -20°C.

[0038] The 65 designed IRAP primers were used as template DNA for PCR reaction. The 65 primers were then electrophoresed at 6 V / cm for 40 min in a 1.5% agarose gel containing green fluorescent nucleic acid dye. The primers were observed and stored in a gel imaging system. The IRAP primers with clear bands and good polymorphism were retained. Figure 2 shown.

[0039] The primers after screening are shown in the table below:

[0040] Table 2: IRAP primer sequence list

[0041]

[0042]

[0043] Example 2:

[0044] Through the preliminary screening of IRAP primers in Example 1, 14 primers with good polymorphism were retained. The screened IRAP primers were used to identify the test materials to be identified; primers Ty3-2, Ty3-5, and Ty3-6 are used as examples below.

[0045] 1. Primer related information.

[0046] Table 3: Primer related information

[0047] Primer number Primer sequences Annealing temperature Tm (℃) Ty3-2 GAATCGGTATCCATTGTCG 52.2 Ty3-5 CAACGCTCCAACTTCTTTC 52.3 Ty3-6 CCGCCCTTTCATTGACGACT 58.0

[0048] 2. Extraction of genomic DNA from Shazikongxin plum germplasm.

[0049] Ninety-two accessions of Plum shazikongxin were used as test materials, as shown in Table 4. DNA was extracted using the Tiangen DNAsecure Plant Kit. Quality and concentration were determined by 1% agarose gel electrophoresis and UV spectrophotometry. The DNA samples were diluted to approximately 30 ng / μl in TE buffer and stored at -20°C.

[0050] Table 4: Numbers and names of 92 Shazikongxin plum germplasms

[0051]

[0052]

[0053] 3. IRAP marker detection of test germplasm

[0054] According to the PCR reaction system and procedure determined in Example 1, 92 samples of Shazikongxin Plum were amplified by PCR using primers Ty3-2, Ty3-5, and Ty3-6. After electrophoresis on a 2% agarose gel, the images were stored in a gel imaging system.

[0055] 4. Data Processing and Analysis

[0056] The experiment was repeated 2-3 times for each IRAP primer, and only clear and reproducible bands were counted. The amplification of each primer band was counted, and the presence of a band at the same electrophoresis position was assigned a value of "1", while the absence was assigned a value of "0", to obtain the data matrix of each primer for each test material.

[0057] 5. Fingerprint construction

[0058] Different test germplasms have differences in the amplified bands between the same primer or several primers, which is polymorphism. By using the least primers to achieve the principle of identifying as many germplasms as possible, the core primers are determined, and then a unique fingerprint map of each Shazikongxinli germplasm is established to achieve the purpose of germplasm identification and preservation.

[0059] Taking the Ty3-2 marker primer as the core primer, the 0 / 1 data matrix obtained was used to construct fingerprints of 92 Shazikongxin Plum germplasms, and the results are shown in Table 5. Ty3-2 was able to identify a total of 86 Shazikongxin Plum germplasms, of which 6 Shazikongxin Plum germplasms, N38, S10, L1, L24, P2, and P3, could not be fully identified. These germplasms could be further identified by forming a core primer set with primers Ty3-2 and Ty3-5 or Ty3-6, obtaining the results shown in Table 6 or Table 7. A total of 14 IRAP primers were obtained in the present invention. Using any two or more of these 14 primers as core primers can fully identify the tested Shazikongxin Plum germplasms, obtaining a unique fingerprint for each germplasm.

[0060] Table 5 Fingerprints of 92 Shazikongxin plum germplasms labeled with primer Ty3-2

[0061]

[0062]

[0063] Table 6 Fingerprints of Ty3-2 and Ty3-5 marker primers of six Shazikongxin plum accessions

[0064]

[0065] Table 7 Fingerprints of Ty3-2 and Ty3-6 marker primers from six Shazikongxin plum accessions

[0066]

[0067] The above embodiment is only one of the specific embodiments of the present invention. There are other implementation methods of the present invention, all of which are within the scope of protection required by the present invention. <110> Guizhou University <120> IRAP molecular marker primers and identification method for Shazikongxin plum germplasm based on retrotransposon <160> 14 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 caaccacaag ggtatgaag 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 aaggaagtcc ctgtatggc 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ggtttgctgg ttgaagaagt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 agaaggcact ttacggattg 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <400> 5 aaggcagtgg aacaagaag 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 tcagacaatt cgcaggagg 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <400> 7 accagaaggg tttgttgaa 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 gaatcggtat ccattgtcg 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <400> 9 tggctatcac caagtctgc 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 caacgctcca acttctttc 19 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 ccgccctttc attgacgact 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <400> 12 accagcacat ccctaacct 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 cgaggattga tgacttgct 19 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <400> 14 cccatacatc cttcatcaca g 21

Claims

1. An IRAP molecular marker primer for identifying Shazikongxin plum germplasm based on retrotransposon, characterized by: The IRAP molecular marker primer is a combination of Ty3-2 and Ty3-5 or Ty3-6, the sequence of Ty3-2 is shown in SEQ ID NO: 8, the sequence of Ty3-5 is shown in SEQ ID NO: 10, and the sequence of Ty3-6 is shown in SEQ ID NO:

11.

2. The method for screening IRAP molecular marker primers for identifying Shazikongxin plum germplasm based on retrotransposon according to claim 1, characterized in that: It includes the following steps: S1, extract genomic DNA from young leaves of the tested Shazikongxin plum; S2, design IRAP primers based on the RT sequences of Ty1-copia and Ty3-gypsy retrotransposons of P. truncatum; the RT sequences of Ty1-copia and Ty3-gypsy retrotransposons of P. truncatum are NCBI: KF278998-KF279023 and KF279024-KF279041; S3, take DNA from S1, amplify it by PCR reaction, and then perform preliminary screening of the designed primers by 1.5% agarose gel electrophoresis, and retain the IRAP primers with polymorphism and clear bands; S4. Perform IRAP molecular marker analysis on all test materials using the IRAP primers obtained in the preliminary screening. Repeat 2-3 times for each primer, and determine the results based on the presence, number, and size of the amplified bands.

3. The method for screening IRAP molecular marker primers for identifying Shazikongxin plum germplasm based on retrotransposon according to claim 2, characterized in that: The PCR reaction system in S3 was: 1.0 μl of 30 ng / μl template DNA, 1.3 μl of primers, 5.0 μl of PCR Mix and 2.7 μl of ddH2O.

4. The method for screening IRAP molecular marker primers for identifying Shazikongxin plum germplasm based on retrotransposon according to claim 2, characterized in that: The PCR reaction program in S3 was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 51°C-58°C for 30 s, extension at 72°C for 1 min, for a total of 40 cycles, reaction at 72°C for another 10 min, and storage at 4°C.

5. The method for screening IRAP molecular marker primers for identifying Shazikongxin plum germplasm based on retrotransposon according to claim 2, characterized in that: The young leaves of Shazikongxin Plum described in S1 refer to leaves that are 15-20 days old and fresh or stored at -80°C.

6. The method for screening IRAP molecular marker primers for identifying Shazikongxin plum germplasm based on retrotransposon according to claim 3, characterized in that: The PCR Mix used in the PCR reaction in S3 included 0.4 mM Taq DNA polymerase, 0.4 mM dNTP, 4 mM MgCl2 and 0.4 mM normal buffer.

Citation Information

Patent Citations

  • Method for identifying masson pine seed quality by utilizing IRAP molecular marker

    CN104561276A

  • SCAR molecular marker for banana B genome identification and identification method thereof

    CN106048032A