Molecular marker co-segregated with the female character of momordica charantia, primer and application thereof

By developing molecular markers and primer pairs that co-segregate with the all-female trait of bitter gourd, the problem of the cumbersome and time-consuming process of breeding all-female lines of bitter gourd has been solved, enabling early identification and determination in seeds or seedlings, and improving the breeding efficiency and selection accuracy of all-female lines.

CN114854901BActive Publication Date: 2025-11-07SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210712090.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-22
Publication Date
2025-11-07
Estimated Expiration
2042-06-22

AI Technical Summary

Technical Problem

In existing technologies, the process of breeding all-female lines of bitter gourd is cumbersome, time-consuming, and labor-intensive, making it difficult to identify and determine early in the seed or seedling stage.

Method used

Molecular markers co-isolated with the all-female trait of bitter melon were developed, and the CAPS_1_144 primer pair was designed. The all-female trait of bitter melon was detected by PCR amplification and enzyme digestion, and 6% polyacrylamide gel electrophoresis was used.

Benefits of technology

This technology enables early identification of the all-female trait in bitter gourd plants at the seed or seedling stage, improving the breeding efficiency of all-female lines and reducing the cost of hybrid seed production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114854901B_ABST
    Figure CN114854901B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of vegetable molecular breeding, and relates to a molecular marker co-segregated with a balsam pear gynoecy, primers and application thereof. The application develops a CAPS molecular marker co-segregated with the balsam pear gynoecy, provides amplification primers of the molecular marker co-segregated with the balsam pear gynoecy, and can determine the balsam pear gynoecy at the balsam pear seed or seedling stage, assist selection of the balsam pear gynoecy, improve balsam pear gynoecy breeding efficiency, finally reduce the cost of balsam pear hybrid first-generation seed production, and solve the problems of the prior art, such as complicated process, time-consuming and laborious, etc. in balsam pear gynoecy breeding by using a conventional field breeding method.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of vegetable molecular breeding, and relates to development and application of a molecular marker co-segregated with a whole female trait of Momordica charantia. BACKGROUND

[0002] Momordica charantia L. is an annual climbing herbaceous plant of Cucurbitaceae Momordica, which originates from tropical Africa and is widely distributed in Africa and Asia. Momordica charantia is a monoecious androecious plant, and in the production process of the first hybrid generation seeds, it is necessary to isolate by bagging, which is time-consuming and laborious. The use of whole female line for seed production can not only eliminate artificial bagging and reduce seed production cost, but also improve the purity of the first hybrid generation, and is an ideal way for Momordica charantia hybrid seed production.

[0003] At present, the breeding of Momordica charantia whole female line still adopts the conventional field conversion method, that is, the whole female trait is first introduced into a material with excellent traits by artificial hybridization. Since the whole female trait is recessive inheritance, each hybridization (backcrossing) needs to be selfed to separate out a single plant with the whole female phenotype. The whole conversion process is complicated, time-consuming and labor-intensive. By developing a molecular marker co-segregated with the whole female gene of Momordica charantia, early identification and determination of the whole female trait of Momordica charantia plants at the seed or seedling stage can be realized, which will greatly improve the breeding efficiency of Momordica charantia whole female line. SUMMARY

[0004] In order to solve the above-mentioned problems of the conventional field conversion method for breeding Momordica charantia whole female line, the present application aims to provide a molecular marker co-segregated with the whole female trait of Momordica charantia, a primer pair for amplifying the molecular marker, a method for identifying the whole female trait of Momordica charantia, a kit, and application of the molecular marker or primer pair. By developing a molecular marker co-segregated with the whole female gene of Momordica charantia, early identification and determination of the whole female trait of Momordica charantia plants at the seed or seedling stage can be realized, which will greatly improve the breeding efficiency of Momordica charantia whole female line.

[0005] The specific scheme adopted by the present application is as follows:

[0006] A molecular marker co-segregated with the whole female trait of Momordica charantia, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1.

[0007] Further, there is a SNP mutation C / A at the 265th position of the nucleotide sequence of the molecular marker, and the SNP mutation is located at the position of 21,144,412 of chromosome 1 of Momordica charantia.

[0008] The application provides a primer pair for amplifying the above-mentioned molecular marker, which comprises: a CAPS_1_144-forward primer: 5'-CCTTTAGGTTATTCACGGGACA-3',

[0009] a CAPS_1_144-reverse primer: 5'-AACTCTTCACTCCATGTCATGT-3'.

[0010] The application further provides a method for identifying the gynoecy of Momordica charantia, which comprises the following steps:

[0011] S1. extracting genomic DNA of fresh young true leaf tissue of Momordica charantia;

[0012] S2. using the primer pair to perform PCR amplification on the genomic DNA of the young true leaf tissue of Momordica charantia as a template, and performing enzyme cutting on the PCR product by using a fast endonuclease HinP1I;

[0013] S3. detecting the result band by using 6% polyacrylamide gel electrophoresis, and determining the gynoecy of Momordica charantia according to the detection result.

[0014] Further, if the result is two bands of 265bp and 188bp, it is determined as gynoecy; if the result is one band of 452bp, or three bands of 452bp, 265bp and 188bp, it is determined as monoecy.

[0015] The application further provides the primer pair for identifying the gynoecy of Momordica charantia.

[0016] The application further provides application of the molecular marker or the primer pair in any one of the following (A)-(D):

[0017] (A), for identifying the gynoecy of Momordica charantia;

[0018] (B), for breeding or assisting in breeding the gynoecy of Momordica charantia;

[0019] (C), for preparing a product for identifying the gynoecy of Momordica charantia;

[0020] (D), for preparing a product for breeding or assisting in breeding the gynoecy of Momordica charantia.

[0021] Compared with the prior art, the application has the following beneficial effects:

[0022] 1. The application designs primers according to the reference genome sequence of Momordica charantia and resequencing data of 'S156' and 8-201', first, PCR amplification is carried out on the gynoecious line 'S156' and the common selfing line '8-201', and then the polymorphism of the primers is determined, then, genotyping is carried out on the F2 population of 'S156' x '8-201' by using the polymorphic primers, and linkage analysis is carried out in combination with the female phenotype of each single plant of the F2 population of 'S156' x '8-201', and a molecular marker co-segregated with the gynoecious trait of Momordica charantia is developed.

[0023] 2. The application develops one CAPS molecular marker co-segregated with the gynoecious trait of Momordica charantia, which can determine the gynoecy of Momordica charantia according to the genotyping result of the molecular marker at the seed or seedling stage, can assist the selection of the gynoecious trait of Momordica charantia, improve the breeding efficiency of the gynoecious line of Momordica charantia, and ultimately reduce the cost of hybrid seed production of Momordica charantia, and solve the defects of the prior art, such as complicated process, time-consuming and laborious, etc., in the breeding of the gynoecious line of Momordica charantia by using the conventional field breeding method.

[0024] 3. The application further provides an amplification primer of the molecular marker co-segregated with the gynoecious trait of Momordica charantia, which has the characteristics of convenient detection, rapidness, stable amplification, high accuracy and the like.

[0025] 4. The application can quickly and simply determine the gynoecious trait of Momordica charantia through simple steps, provides new technical support for the breeding of the gynoecious line of Momordica charantia, and is beneficial to improving the accuracy and selection efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Figure 1 is a part of the genotyping result of CAPS_1_144 molecular marker on S156 x 8-201 F2, wherein G represents a gynoecious plant, M represents a plant with separate male and female flowers on the same plant, a represents the band type of the gynoecious line female parent 'S156', b represents the band type of the female separate male and female flower parent '8-201', and h represents a heterozygous (F1) band type. DETAILED DESCRIPTION

[0027] The content of the application will be further described in combination with specific examples, but should not be understood as a limitation to the application.

[0028] Unless specifically indicated, the technical means used in the examples are conventional means familiar to those skilled in the art. Unless specifically indicated, the reagents, methods and equipment used in the application are conventional reagents, methods and equipment in the technical field.

[0029] The gynoecious line 'S156' and the common selfing line '8-201' used in the examples of the application are highly homozygous selfing lines obtained through multiple generations of selfing.

[0030] Example 1 Development of a molecular marker co-segregating with the gynoecy trait of Momordica charantia.

[0031] (I) Plant material

[0032] The gynoecy line 'S156' and the common monoecy line '8-201' were used as the female and male parents, respectively, to produce F1 and F2 populations. In the spring of 2019, 'S156', '8-201', F1 (n = 24) and F2 (n = 291) were planted in the Zengcheng Experimental Base of South China Agricultural University, and were managed with conventional fertilization and irrigation.

[0033] (II) Female identification

[0034] When the plants reached the flowering stage, the sex of each flower on each node of the main vine of each plant was investigated from the first flower to the 40th node. Plants with all female flowers were identified as gynoecy plants, and the rest were monoecy plants. The results showed that all 24 F1 plants were monoecy plants, and among the 291 F2 plants, 228 were monoecy plants and 63 were gynoecy plants. Chi-square test showed that the ratio of monoecy plants to gynoecy plants in the F2 population was 3:1 (χ2=1.73, P < 0.05), indicating that the gynoecy trait was controlled by a single recessive gene. 2

[0035] (III) DNA extraction

[0036] (1) Weigh 1.0 g of fresh young true leaves, grind them into powder in liquid nitrogen, and then quickly transfer the frozen powder to a 10 mL centrifuge tube.

[0037] (2) Add 4 mL of 65°C preheated CTAB extraction buffer and mix well (65°C incubation for 45 min, with gentle shaking for 3-5 times during the incubation).

[0038] (3) After slight cooling, add an equal volume (4 mL) of phenol:chloroform:isopropanol (25:24:1) and mix gently for 5 min.

[0039] (4) Centrifuge at 12000 rpm for 5 min at 4°C.

[0040] (5) Transfer the supernatant to another new 10 mL centrifuge tube and add an equal volume of chloroform:isopropanol (24:1), and mix well by inverting the tube.

[0041] (6) Centrifuge at 12000 rpm for 5 min at 4°C, and transfer the supernatant to another new 10 mL centrifuge tube.

[0042] (7) Add 2 / 3 volume of pre-cooled isopropanol and mix gently, and place at 4°C for 30 min or longer.​

[0043] (8) 4℃, 12000 rpm, 10 min, discard supernatant.

[0044] (9) Wash the precipitate with 75% ethanol twice, aspirate the droplets, and then air dry.

[0045] (10) Add 200 μL of 1x TE to dissolve the DNA, add RNase, and place in a 37℃ incubator for 3 h to remove RNA; store the DNA solution in a -20℃ refrigerator.

[0046] (IV) PCR amplification system, procedure, and product detection

[0047] The PCR amplification system was 1 μL of DNA (50 ng / μL), 1 μl of F-primer (1 μM / L), 1 μl of R-primer (1 μM / L), 2 μl of 10x Taq Buffer, 1.5 μl of MgCl2 (25 mM / L), 0.5 μL of dNTP (10 mM / L), and 0.2 ul of Taq enzyme (5 U / μL) and 12.8 μl of ddH2O; the PCR procedure was 95℃ for 5 min, 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 72℃ for 10 min, with 36 cycles set for steps 2-4; the PCR product was electrophoresed using 6% polyacrylamide gel.

[0048] (V) Polymorphic primer analysis

[0049] According to the initial positioning results of the whole female gene of Momordica charantia (Cui et al., 2018) and the resequencing results of ‘S156’ and ‘8-201’, PCR primers were designed in the 17.62 Mb-21.14 Mb region of chromosome 1 of Momordica charantia with reference to the reference genome sequence of Momordica charantia. The PCR primers were amplified in ‘S156’ and ‘8-201’, and the results confirmed that the DNA fragments amplified by CAPS_1_144 primers had polymorphisms after being digested by HinP1I in ‘S156’ and ‘8-201’. The CAPS_1_144 primer information is shown in Table 1 below.

[0050] Table 1: Primer information

[0051]

[0052] (VI) Development of co-segregation markers for the whole female gene of Momordica charantia

[0053] The PCR amplification was performed on 291 single plants of 'S156' x '8-201' F2 population by using CAPS_1_144, and the products were subjected to polyacrylamide gel electrophoresis after being digested by HinP1I to obtain F2 marker typing. The results showed that the CAPS_1_144 molecular marker genotype was completely co-segregated with the complete female trait in the 291 single plants of the F2 separation population of Momordica charantia (Table 2).

[0054] Table 2: Genotyping results of CAPS_1_144 molecular marker in F2 population.

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061] The position of the molecular marker CAPS_1_144 on chromosome 1 of Momordica charantia is: CAPS_1_144: MC01:21,144,108…MC01:21,144,599.

[0062] The sequence of the molecular marker CAPS_1_144 is:

[0063] CCTTTAGGTTATTCACGGGACATTATCCTTTCATAAATCAGGGGTATATCAAATATATACC

[0064] TCGTATATCAAATATATACCCAGTATATATACTGTCTCGATTACATGAAATAACCTTGGATA

[0065] TTTAGTTTATTGGATTTTGGACAATGCAATGCTATGAATTCAACAACAAATTTATTGAAT

[0066] AAAACTTTATTGAATATACATTCGTGTTTACACAAAATACAAACTACGAGTTTAGGGCAACACACCGAACACATCGTTGGG[M]GCGTTTTTTGTTAGGAGCTAGAGTTTGTTTTAAA TGTGGCAAGGAAGGACACATTGATAGAAATTGCCATGAGGACAACACCCCAGTTGATG CAAAAGAGCCTACTAATATGAACCAATCAACTTTACCTAAGTAGACTTGAAAATATGAC AAACTTTAGTCATTACATGACATGGAGTGAAGAGTT. Wherein, M in the sequence is SNP site C ('S156', specific nucleotide sequence is shown as SEQ ID NO: 1) or A ('8-201', specific nucleotide sequence is shown as SEQ ID NO: 02).

[0067] It should be noted that the above-mentioned embodiments should be understood as illustrative rather than limiting the scope of protection of the present application, and the scope of protection of the present application is subject to the claims. For those skilled in the art, some non-essential improvements and adjustments of the present application without departing from the spirit and scope of the present application still belong to the protection scope of the present application. SEQUENCE LISTING <110> South China Agricultural University <120> Molecular marker, primer and application thereof co-segregated with bitter gourd gynoecy <130> 1 <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 452 <212> DNA <213> 'S156' <400> 1 cctttaggtt attcacggga cattatcctt tcataaatca ggggtatatc aaatatatac 60 ctcgtatatc aaatatatac ccagtatata tactgtctcg attacatgaa ataaccttgg 120 atatttagtt tattggattt tggacaatgc aatgctatga attcaacaac aaatttattg 180 aataaaactt tattgaatat acattcgtgt ttacacaaaa tacaaactac gagtttaggg 240 caacacaccg aacacatcgt tgggcgcgtt ttttgttagg agctagagtt tgttttaaat 300 gtggcaagga aggacacatt gatagaaatt gccatgagga caacacccca gttgatgcaa 360 aagagcctac tatatgaac caatcaactt tacctaagta gacttgaaaa tatgacaaac 420 tttagtcatt acatgacatg gagtgaagag tt 452 <210> 2 <211> 452 <212> DNA <213> '8‑201' <400> 2 cctttaggtt attcacggga cattatcctt tcataaatca ggggtatatc aaatatatac 60 ctcgtatatc aaatatatac ccagtatata tactgtctcg attacatgaa ataaccttgg 120 atatttagtt tattggattt tggacaatgc aatgctatga attcaacaac aaatttattg 180 aataaaactt tattgaatat acattcgtgt ttacacaaaa tacaaactac gagtttaggg 240 caacacaccg aacacatcgt tgggagcgtt tttgttagg agctagagtt tgttttaaat 300 gtggcaagga aggacacatt gatagaaatt gccatgagga caacacccca gttgatgcaa 360 aagagcctac taatatgaac caatcaactt tacctaagta gacttgaaaa tatgacaaac 420 tttagtcatt acatgacatg gagtgaagag tt 452 <210> 3 <211> 22 <212> DNA <213> Artificial <400> 3 cctttaggtt attcacggga ca 22 <210> 4 <211> 22 <212> DNA <213> Artificial <400> 4 aactcttcac tccatgtcat gt 22

Claims

1. A molecular marker co-segregating with the fully female trait of Momordica charantia, characterized in that: The nucleotide sequence of the molecular marker is: CCTTTAGGTTATTCACGGGACATTATCCTTTCATAAATCAGGGGTATATCAAATATATACCTCGTATATCAAATATATACCCAGTATATATACTGTCTCGATTACATGAAATAACCTTGGATATTTAGTTTATTGGATTTTGGACAATGCAATGCTATGAATTCAACAACAAATTTATTGAATAAAACTTTATTGAATATACATTCGTGTTTACACAAAATACAAACTACGAGTTTAGGGCAACACACCGAACACATCGTTGGG[M]GCGTTTTTTGTTAGGAGCTAGAGTTTGTTTTAAATGTGGCAAGGAAGGACACATTGATAGAAATTGCCATGAGGACAACACCCCAGTTGATG CAAAAGAGCCTACTAATATGAACCAATCAACTTTACCTAAGTAGACTTGAAAATATGAC AAACTTTAGTCATTACATGACATGGAGTGAAGAGTT, wherein M in the sequence is SNP site C or A.

2. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pair comprises: a CAPS_1_144-forward primer: 5'-CCTTTAGGTTATTCACGGGACA-3', a CAPS_1_144-reverse primer: 5'-AACTCTTCACTCCATGTCATGT-3'.

3. A method for identifying the all-female trait of bitter melon, characterized in that, The method comprises the following steps: S1. extracting genomic DNA from fresh bitter gourd young true leaf tissue; S2. using the primer pair of claim 2 to perform PCR amplification with the genomic DNA of the bitter gourd young true leaf tissue as a template, and performing enzyme digestion on the PCR product with fast endonuclease HinP1I; S3. detecting the result band by polyacrylamide gel electrophoresis, and determining the bitter gourd gynoecy trait according to the detection result; if the result is two bands of 265 bp and 188 bp, it is determined as the gynoecy trait; if the result is one band of 452 bp, or three bands of 452 bp, 265 bp and 188 bp respectively, it is determined as the monoecy trait; the bitter gourd varieties are the gynoecy line 'S156' and the common selfing line '8-201' and their hybrid offspring.

4. A kit for identifying the parthenocarpic trait in Momordica charantia, characterized in that, The kit comprises the primer pair of claim 2; and the bitter gourd varieties are the gynoecy line 'S156' and the common selfing line '8-201' and their hybrid offspring.

5. The molecular marker of claim 1 or the primer pair of claim 2 is applied in any one of (A)-(D) as follows: (A), for identifying the gynoecy trait of bitter gourd; (B), for breeding or assisting in breeding the gynoecy line of bitter gourd; (C), for preparing a product for identifying the gynoecy trait of bitter gourd; (D), for preparing a product for breeding or assisting in breeding the gynoecy line of bitter gourd. (D) products for breeding or assisting breeding of a full female line of Momordica charantia L. The Momordica charantia L. varieties are full female line 'S156' and common selfing line '8-201' and their hybrid offspring.

Citation Information

Patent Citations

  • Humanized immunoglobulin loci

    CN103205436A

  • Indel molecular marker closely linked with all-female characters of towel gourds and application of Indel molecular marker

    CN112251529A