Method for increasing the concentration of nucleic acid amplification products and use thereof

Abstract

The present application belongs to the field of molecular biology. Specifically, the present application relates to a method for improving the efficiency of nucleic acid amplification and its application: through the improvement of reaction amplification efficiency specificity and other aspects, so as to be applied to sequencing and more scenarios.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology. Specifically, this invention relates to a method for improving nucleic acid amplification efficiency and its application. Background Technology

[0002] With the rapid development of bio-related industries and the large-scale application of new technologies, the diagnostic industry, which is closely related to people's health and well-being, has received increasing attention. While further promoting the advancement of diagnostic technology, it has also raised higher requirements.

[0003] In recent years, sequencing technology has been increasingly used in molecular diagnostics. Library construction, in particular, requires PCR amplification to ensure sample concentrations meet the requirements for sequencing. While PCR technology can exponentially amplify target fragments in a short time, it may also be accompanied by non-specific reactions and low amplification efficiency. Therefore, how to further improve nucleic acid amplification reactions to apply them to sequencing and other scenarios has become a pressing issue for researchers. Summary of the Invention

[0004] The purpose of this invention is to provide a method for improving nucleic acid amplification efficiency and its application.

[0005] In some embodiments, the present invention may include one or more of the following:

[0006] 1. A method for nucleic acid amplification, comprising the step of adding a template to a reaction system containing polidocanol and a DNA mismatch repair protein.

[0007] 2. According to the method described in Project 1, wherein the final concentration of polydextrose in the reaction system is 0.005-0.25 (w / v)%, and the final concentration of DNA mismatch repair protein in the reaction system is 0.05-5 μg / μL;

[0008] Optionally, the final concentration of polydextrose in the reaction system is 0.01-0.2 (w / v)%, and the final concentration of DNA mismatch repair protein in the reaction system is 0.05-2.5 μg / μL.

[0009] 3. The method according to any one of items 1-2, wherein the reaction system further contains at least one of gelatin, sodium hexametaphosphate, betaine, single-chain binding protein, dimethylformamide, and bile salt.

[0010] 4. According to the method described in Project 3, wherein,

[0011] The final concentration of gelatin in the reaction system is 0.005-0.5 (w / v)%.

[0012] Optionally, the final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5 (w / v)%.

[0013] Optionally, the final concentration of betaine in the reaction system is 0.005-0.25 (w / v)%.

[0014] Optionally, the final concentration of the single-chain binding protein in the reaction system is 2-10 ng / μL;

[0015] Optionally, the final concentration of dimethylformamide in the reaction system is 0.1-5 (w / v)%.

[0016] Optionally, the final concentration of bile salts in the reaction system is 0.005-0.25 (w / v)%.

[0017] 5. The method according to any one of items 1-4, wherein the reaction system further comprises DNA polymerase and Mg 2+ At least one of the following: dNTPs, primers, and buffer solutions.

[0018] 6. The method according to Project 5, wherein the DNA polymerase is a thermostable DNA polymerase.

[0019] 7. The method according to Project 1, wherein the nucleic acid amplification reaction can be a polymerase chain reaction.

[0020] 8. A composition wherein the composition is used to prepare the reaction system described in any one of items 1-7.

[0021] 9. A kit comprising the reaction system described in any one of items 1-7, or the composition described in item 8.

[0022] 10. The application of the method described in any one of items 1-7, the composition described in item 8, and the kit described in item 9 in nucleic acid amplification reactions. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1The agarose gel electrophoresis image shows the amplification products of adding three additive combinations (Example 26) to a multiplex PCR reaction system. In this case, each group of three lanes was performed with one replicate well for template addition and NTC (template-free control) for no template addition.

[0025] Figure 2 The sequencing parameters for the 20-fold amplification product in Example 29 are shown. Detailed Implementation

[0026] This invention provides a PCR amplification system for sequencing. By improving the system composition, the concentration of nucleic acid amplification products is increased, providing sufficient throughput for sequencing.

[0027] Non-specific reactions may occur during nucleic acid amplification reactions, leading to reduced synthesis of the target fragment, decreased specificity, and / or reduced amplification efficiency. In some embodiments, the present invention provides a method for nucleic acid amplification, comprising the step of adding a template to a reaction system containing polidocanol and DNA mismatch repair protein.

[0028] In some embodiments, the final concentration of polycaloethanol in the reaction system is 0.005-0.25 (w / v)%; in some embodiments, the final concentration of polycaloethanol in the reaction system is 0.01-0.2 (w / v)%; in some embodiments, the final concentration of polycaloethanol in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, but is not limited thereto.

[0029] In some embodiments, the final concentration of the DNA mismatch repair protein in the reaction system is 0.05-5 μg / μL; in some embodiments, the final concentration of the DNA mismatch repair protein in the reaction system is 0.05-2.5 μg / μL; in some embodiments, the final concentration of the DNA mismatch repair protein in the reaction system includes, for example, 0.05 μg / μL, 0.1 μg / μL, 0.125 μg / μL, 0.2 μg / μL, 0.5 μg / μL, 1 μg / μL, 1.5 μg / μL, 2 μg / μL, 2.5 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, but is not limited thereto.

[0030] In some implementations, the reaction system further contains at least one of gelatin, sodium hexametaphosphate, betaine, single-chain binding protein, dimethylformamide, and bile salts.

[0031] In some embodiments, the source of the gelatin is not limited; in other embodiments, the gelatin is selected from bovine gelatin, fish gelatin, and / or combinations thereof.

[0032] In some embodiments, the final concentration of gelatin in the reaction system is 0.005-0.5 (w / v)%; in some embodiments, the final concentration of gelatin in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, 0.3 (w / v)%, 0.35 (w / v)%, 0.4 (w / v)%, 0.45 (w / v)%, 0.5 (w / v)%, but is not limited thereto;

[0033] In some embodiments, the final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5 (w / v)%; in some embodiments, the final concentration of sodium hexametaphosphate in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, 0.3 (w / v)%, 0.35 (w / v)%, 0.4 (w / v)%, 0.45 (w / v)%, 0.5 (w / v)%, but is not limited thereto.

[0034] Betaine can be alkylamide betaine; it can be, for example, lauramide propyl betaine, cocamidopropyl betaine, octadecamidopropyl betaine, but is not limited to these.

[0035] In some embodiments, the final concentration of betaine in the reaction system is 0.005-0.25 (w / v)%; in some embodiments, the final concentration of betaine in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, but is not limited thereto;

[0036] In some embodiments, the final concentration of the single-chain binding protein in the reaction system is 2-10 ng / μL; in some embodiments, the final concentration of the single-chain binding protein in the reaction system includes, for example, 2 ng / μL, 3 ng / μL, 4 ng / μL, 5 ng / μL, 6 ng / μL, 7 ng / μL, 8 ng / μL, 9 ng / μL, 10 ng / μL, but is not limited thereto.

[0037] In some embodiments, the final concentration of dimethylformamide in the reaction system is 0.1-5 (w / v)%; in some embodiments, the final concentration of dimethylformamide in the reaction system includes, for example, 0.1 (w / v)%, 0.5 (w / v)%, 1 (w / v)%, 1.5 (w / v)%, 2 (w / v)%, 2.5 (w / v)%, 3 (w / v)%, 3.5 (w / v)%, 4 (w / v)%, 4.5 (w / v)%, 5 (w / v)%, but is not limited thereto.

[0038] Bile salts can be bile salts and / or deoxycholates; for example, sodium cholate.

[0039] In some embodiments, the final concentration of bile salt in the reaction system is 0.005-0.25 (w / v)%; in some embodiments, the final concentration of bile salt in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, but is not limited thereto.

[0040] In some embodiments, the reaction system of the present invention further comprises one or more polymerases. Such polymerases can be any enzyme capable of replicating DNA molecules. In some embodiments, the reaction system may comprise a DNA-dependent DNA polymerase, an enzyme for reverse transcription (RNA-dependent DNA polymerase), and / or a combination of both types of enzymes. In some embodiments, a combination of DNA-dependent DNA polymerases and / or a combination of RNA-dependent DNA polymerases may be present in the reaction system disclosed herein. In some embodiments, the polymerase used herein is a thermostable DNA polymerase. In some embodiments, the thermostable DNA polymerase used herein does not irreversibly inactivate when subjected to high temperatures for a period of time required to achieve single-stranded nucleic acid instability or double-stranded nucleic acid denaturation during nucleic acid amplification or PCR amplification. Irreversibility of an enzyme refers to a significant loss of enzyme activity. Thermostable DNA polymerases preferably do not irreversibly denature under conditions typically required for PCR amplification.

[0041] In some embodiments, the reaction system of the present invention further comprises Mg 2+The primer comprises at least one of dNTPs, primers, and buffer. Those skilled in the art can design oligonucleotide chains complementary to the template sequence as primers. In some embodiments, the primers are selected from conventional primers or degenerate primers. Conventional primers are generally used for nucleic acid amplification (e.g., PCR amplification) due to their relatively high specificity and simple structure. However, when amplifying unknown sequences, degenerate primers can only be designed based on conserved sequences. This presents difficulties for specific amplification. In some embodiments, the reaction system of the present invention may contain conventional primers. In some embodiments, the reaction system of the present invention may contain more complex degenerate primers with higher melting temperatures.

[0042] According to the teachings of the present invention, one or more additional components and / or additives may be incorporated into the reaction systems, methods, compositions, and kits of the present invention to optimize nucleic acid amplification. In some embodiments, the reaction system may contain additional components and / or additives (e.g., reagents for promoting or enhancing PCR) capable of promoting or enhancing nucleic acid amplification reactions. Additional components and / or additives may be other organic or inorganic compounds, other peptides, and non-peptide components. Such components and / or additives may include, but are not limited to, sulfur-containing compounds, acetate-containing compounds, dimethyl sulfoxide (DMSO), glycerol, tetramethylammonium chloride (TMAC), exoproteins, polyols, surfactants (e.g., Tween 20, NP-40, Triton X-100, and CHAPS), and crowding agents (e.g., Ficoll 70, glycogen, and PEG). Those skilled in the art will be able to identify the additional components and / or additives used in the reaction systems, methods, compositions, and kits of the present invention.

[0043] According to the teachings of the present invention, internal reference materials, quality control materials, and anti-contamination substances (e.g., uracil DNA glycosylation enzymes, RNases) can be incorporated into the reaction systems, methods, compositions, and kits of the present invention.

[0044] In some embodiments, the nucleic acid amplification of the present invention includes, but is not limited to, primer extension or polymerase chain reaction (PCR). In some embodiments, the nucleic acid amplification reaction may be a polymerase chain reaction. In some embodiments, the PCR is singlet PCR. In some embodiments, the PCR is multiplex PCR. As used herein, the term "singlet" or "singlet PCR" refers to an assay provided for amplifying a single product within a reaction vessel. Different primer pairs are used to initiate the product. A singlet reaction may further include a labeled probe specific to the amplified product, wherein the probe may be detectably labeled with a detectable portion such as a fluorescent dye. As used herein, the term "multiplex" or "multiplex PCR" refers to an assay provided for simultaneously amplifying two or more products within the same reaction vessel. Different primer pairs are used to initiate each product. A multiplex reaction may further include a labeled probe specific to each product, wherein the probe may be detectably labeled with different detectable portions. In some implementations, the nucleic acid amplification methods disclosed herein can be used for a wide range of assays, including the detection, quantification, and / or characterization of target nucleic acids, such as, but not limited to, single nucleotide polymorphisms (SNPs), microsatellite analysis and genotyping, copy number determination and variation analysis, assays for detecting gene expression, and assays for detecting small RNA expression.

[0045] In some implementations, the method for improving nucleic acid amplification reactions also includes the step of providing conditions that allow nucleic acid amplification reactions to occur.

[0046] In some embodiments, the compositions of the present invention include polidocanol and DNA mismatch repair protein; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and gelatin; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and sodium hexametaphosphate; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and betaine; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and single-stranded binding protein; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and dimethylformamide; in some embodiments, the compositions of the present invention include polidocanol, DNA mismatch repair protein, and bile salts. In some embodiments, the above compositions can improve nucleic acid amplification efficiency.

[0047] In some embodiments, the present invention provides a kit comprising the reaction system or composition of any of the embodiments. In some embodiments, the kit further comprises labeled probes specific for the detection of nucleic acid amplification (e.g., PCR amplification) products and / or DNA targets.

[0048] In some embodiments, the present invention also provides the use of reaction systems, methods, compositions, and kits comprising any of the embodiments in nucleic acid amplification reactions.

[0049] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are provided to illustrate implementation methods of the present invention and are not intended to limit the invention. The present invention may optionally include embodiments not shown in the embodiments.

[0050] I. Singleton PCR reaction (single additive)

[0051] 1. Template preparation

[0052] (1) Cell type: 293T cells;

[0053] (2) Cell collection: Aliquot the cell culture medium into 1.5mL centrifuge tubes, approximately 1×10⁻⁶ cells per tube. 6 One cell, centrifuged to remove the cell slurry;

[0054] (3) Human genome extraction: Extracted using TIANamp Genomic DNA Kit (centrifuge column type).

[0055] 2. Primers

[0056] A pair of primers targeting the β-Globin gene is provided for amplification, as shown below;

[0057] F–5'-TGCTGTTATGGGCAACCCTAA-3', sequence as shown in SEQ ID NO:1; R–5'-GAGCCAGGCCATCACTAAAGG-3', sequence as shown in SEQ ID NO:2.

[0058] 3. Target gene amplification

[0059] PCR reaction system: 0.5 μL Pfu DNA polymerase (5 U / μL), 2 mM MgCl2, 0.5 μL dNTP (10 mM), 2.5 μL 10-fold upstream and downstream primer mixture, 10 pg / 100 pg / 1 ng human genomic DNA, single-component additives, and ddH2O to a final volume of 25 μL.

[0060] PCR amplification program: 95℃, 2 min 30 s; (98℃, 20 s; 56℃, 20 s; 72℃, 30 s) × 35 cycles; 72℃, 3 min; 4℃, ∞.

[0061] 4. Detection of PCR amplification products

[0062] Example 1: No additives, control group.

[0063] Example 2: Add 0.05 (w / v)% fish gelatin to the singleton PCR reaction system.

[0064] Example 3: Add 0.5 (w / v)% L-arginine to the singleton PCR reaction system.

[0065] Example 4: Add 0.5 (w / v)% trehalose to the singleton PCR reaction system.

[0066] Example 5: Add 0.1 (w / v)% polydextrose to a singleton PCR reaction system.

[0067] Example 6: Add 0.01 (w / v)% CAB-35 to the singleton PCR reaction system.

[0068] Example 7: Add 50 mM TMAC to the singleton PCR reaction system.

[0069] Example 8: Add 1 μg / μL casein to the singleton PCR reaction system.

[0070] Example 9: Add 5 ng / μL SSB to the singleton PCR reaction system.

[0071] Example 10: Add 0.125 μg / μL MutS to the singleton PCR reaction system.

[0072] Example 11: Add 2 (w / v)% DMF to the singleton PCR reaction system.

[0073] Example 12: Add 0.1 (w / v)% gold nanoparticles to a singleton PCR reaction system.

[0074] Example 13: Add 0.25 (w / v)% sodium cholate to a singleton PCR reaction system.

[0075] The amplification effects of adding a single additive (at the optimal dosage) to the singleton PCR reaction system are shown in Table 1: considering both amplification efficiency and specificity, fish gelatin, podocarboxylic acid, TMAC, SSB, and MutS have a promoting effect.

[0076] Table 1. Amplification Results of Examples 2-13

[0077]

[0078] Examples 2-13 were compared with the control group without additives. " / " indicates that there was basically no effect; "-" indicates an inhibitory effect; "+" indicates a promoting effect; and more symbols indicate a greater degree of effect.

[0079] II. Multiplex PCR Reaction System (Two Combinations of Additives)

[0080] 1. Template preparation

[0081] (1) Cell type: 293T cells;

[0082] (2) Cell collection: Aliquot the cell culture medium into 1.5mL centrifuge tubes, approximately 1×10⁻⁶ cells per tube. 6 One cell, centrifuged to remove the cell slurry;

[0083] (3) Human genome extraction: Extracted using TIANamp Genomic DNA Kit (centrifuge column type).

[0084] 2. Primers: 20 pairs of primers were used, with sequences as shown in SEQ ID NO:3-42.

[0085] 3. Target gene amplification

[0086] PCR reaction system: 0.5 μL Pfu DNA polymerase (5 U / μL), 2 mM MgCl2, 0.5 μL dNTP (10 mM), 2.5 μL 10-fold upstream and downstream primer mixture, 100 ng human genomic DNA, single-component / two-component / three-component additives, and ddH2O to a final volume of 20 μL.

[0087] PCR amplification program: 98℃, 20 min; (98℃, 15 s; 65℃, 10 min; 68℃, 1 min; 72℃, 1 min) × 6 cycles; (98℃, 15 s; 68℃, 1 min; 72℃, 1 min) × 28 cycles; 72℃, 10 min; 4℃, ∞.

[0088] 4. Detection of PCR amplification products

[0089] Example 14: No additives, control group.

[0090] Example 15: Add 0.05 (w / v)% fish gelatin + 0.1 (w / v)% podocalcitonin to a multiplex PCR reaction system.

[0091] Example 16: Add 0.05 (w / v)% fish gelatin + 50 mM TMAC to a multiplex PCR reaction system.

[0092] Example 17: Add 0.05 (w / v)% fish gelatin + 5 ng / μL SSB to a multiplex PCR reaction system.

[0093] Example 18: Add 0.05 (w / v)% fish gelatin + 0.125 μg / μL MutS to a multiplex PCR reaction system.

[0094] Example 19: Add 0.1 (w / v)% polydextrose + 50 mM TMAC to the multiplex PCR reaction system.

[0095] Example 20: Add 0.1 (w / v)% podocalcitonin + 5 ng / μL SSB to a multiplex PCR reaction system.

[0096] Example 21: Add 0.1 (w / v)% polidocanol + 0.125 μg / μL moltS to a multiplex PCR reaction system.

[0097] Example 22: Add 50mM TMAC + 5ng / μL SSB to the multiplex PCR reaction system.

[0098] Example 23: Add 50mM TMAC + 0.125μg / μL MutS to the multiplex PCR reaction system.

[0099] Example 24: Add 5 ng / μL SSB + 0.125 μg / μL MutS to the multiplex PCR reaction system.

[0100] In the following two additive combination experiments, single additives that promoted amplification were selected for combination. Among them, the combination of polidocanol and MutS showed the best amplification effect (see Table 2); other combinations, such as polidocanol and TMAC, did not show a synergistic promoting effect in parallel experiments.

[0101] Table 2. Amplification Results of Examples 15-24

[0102] Example Amplification efficiency Specificity fifteen ++ + sixteen + ++ Seventeen ++ + eighteen + ++ nineteen ++ + twenty ++ + Twenty-one ++++ +++ Twenty-two ++ ++ Twenty-three ++ ++ Twenty-four ++ ++

[0103] Examples 15-24 were compared with the control group without additives. "+" indicates a promoting effect; an increase in the number of symbols indicates a deeper degree.

[0104] III. Multiplex PCR Reaction System (Three-Combination Additives)

[0105] Other components were added to the two combinations of polydextrose and MutS, and the three additive combinations were tested on 20 / 65 / 181 primers to confirm whether the additive combinations promoted different multiplex systems. The 20-polyp amplification products were purified and recovered by 1.0× magnetic beads and then sent for sequencing analysis.

[0106] Example 25: No additives, control group.

[0107] Example 26: Add 0.1 (w / v)% podocalciferol + 0.125 μg / μL MutS + 0.05 (w / v)% fish gelatin (combination one) to the multiplex PCR reaction system.

[0108] Example 27: Add 0.1 (w / v)% polidocanol + 0.125 μg / μL MutS + 0.05 (w / v)% sodium hexametaphosphate (combination 2) to the multiplex PCR reaction system.

[0109] Example 28: Add 0.1 (w / v)% polidocanol + 0.125 μg / μL MutS + 0.01 (w / v)% CAB-35 (combination three) to the multiplex PCR reaction system.

[0110] Example 29: Add 0.1 (w / v)% podocalcitonin + 0.125 μg / μL moldes + 5 ng / μL SSB (combination four) to the multiplex PCR reaction system.

[0111] Example 30: Add 0.1 (w / v)% podocalcitonin + 0.125 μg / μL MutS + 2 (w / v)% DMF (combination five) to the multiplex PCR reaction system.

[0112] Example 31: Add 0.1 (w / v)% polidocanol + 0.125 μg / μL MutS + 0.25 (w / v)% sodium cholate (combination six) to the multiplex PCR reaction system.

[0113] Analysis of the sequencing results of the 20-fold amplification products revealed that using the above combination significantly improved amplification efficiency and specificity. Compared to the control group without additives, the positive detection rate was significantly improved, reaching 100%, while the control group's detection rate was only 75%. The agarose gel electrophoresis image of the 20 / 65 / 181-fold primer combination is shown below. Figure 1 Sequencing parameters of the combined 20-fold amplification product are as follows: Figure 2 .

[0114] Example 32: Replace the Pfu DNA polymerase in the multiplex PCR reaction system of Example 21 with 0.5 μL Taq DNA polymerase (5 U / μL).

[0115] Example 33: Add 0.005 (w / v)% podocalcitonin + 2.5 μg / μL moltS to a multiplex PCR reaction system.

[0116] Example 34: Add 0.2 (w / v)% podocalcitonin + 0.05 μg / μL moltS to the multiplex PCR reaction system.

[0117] Example 35: Add 0.25 (w / v)% podocalcitonin + 0.05 μg / μL moltS to a multiplex PCR reaction system.

[0118] Example 36: Add 0.01 (w / v)% podocalcitonin + 5 μg / μL MutS to a multiplex PCR reaction system.

[0119] Replacing the additives (concentration) and / or DNA polymerase in the reaction system will result in essentially the same amplification-promoting effect.

[0120] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. sequence list <110> Guangdong Feipeng Biotechnology Co., Ltd. Feipeng Biotechnology Co., Ltd. <120> A method for increasing the concentration of nucleic acid amplification products and its application <160> 42 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Primer() <400> 1 tgctgttatg ggcaacccta a 21 <210> 2 <211> twenty one <212> DNA <213> Primer() <400> 2 gagccaggcc atcactaaag g 21 <210> 3 <211> 25 <212> DNA <213> Primer() <400> 3 ccaataacac ttcagacttc ggatg 25 <210> 4 <211> 25 <212> DNA <213> Primer() <400> 4 tgtttacgct tatcctcttg ttgtg 25 <210> 5 <211> 25 <212> DNA <213> Primer() <400> 5 gcattgagga agggttggtt ttaaa 25 <210> 6 <211> 25 <212> DNA <213> Primer() <400> 6 catgttgctt tgtgtctgtg tactt 25 <210> 7 <211> 25 <212> DNA <213> Primer() <400> 7 tgggtgtttt gctatttttg gagtt 25 <210> 8 <211> 25 <212> DNA <213> Primer() <400> 8 aaacagttgt aagccagtga atctg 25 <210> 9 <211> twenty two <212> DNA <213> Primer() <400> 9 tgagggtcaa gcattccata cc 22 <210> 10 <211> 25 <212> DNA <213> Primer() <400> 10 gcagttagag gatgaacatt ccatc 25 <210> 11 <211> 25 <212> DNA <213> Primer() <400> 11 tgagtctcag atgtgactta taggg 25 <210> 12 <211> 25 <212> DNA <213> Primer() <400> 12 gagaacgcca ttagaacatc agaag 25 <210> 13 <211> 25 <212> DNA <213> Primer() <400> 13 gaaaacttac tgatcgtgac tgcag 25 <210> 14 <211> twenty one <212> DNA <213> Primer() <400> 14 ccctatcatg gggaaagcct c 21 <210> 15 <211> 25 <212> DNA <213> Primer() <400> 15 ggcaggaaat gagtctaatg agtct 25 <210> 16 <211> 25 <212> DNA <213> Primer() <400> 16 gtgccttttt catcagttgc atttt 25 <210> 17 <211> 25 <212> DNA <213> Primer() <400> 17 caagccaaac cgcctaatta taaga 25 <210> 18 <211> 25 <212> DNA <213> Primer() <400> 18 ttgtaaagct tttgtgtgtt ctgct 25 <210> 19 <211> twenty four <212> DNA <213> Primer() <400> 19 caagagacag tagggaggca tttc 24 <210> 20 <211> 25 <212> DNA <213> Primer() <400> 20 aggtggcagg atattgaagtttcta 25 <210> twenty one <211> 25 <212> DNA <213> Primer() <400> twenty one caggtaatta aaactgggga aaggc 25 <210> twenty two <211> 25 <212> DNA <213> Primer() <400> twenty two tttacacttg aaaacctgga gtcac 25 <210> twenty three <211> 25 <212> DNA <213> Primer() <400> twenty three aaactaaaac ccatgtgagc caaat 25 <210> twenty four <211> twenty three <212> DNA <213> Primer() <400> twenty four atcaggaagg tggctctctg aag 23 <210> 25 <211> 25 <212> DNA <213> Primer() <400> 25 aaaggaaagg aaattgctcc tgatg 25 <210> 26 <211> twenty one <212> DNA <213> Primer() <400> 26 gacctgggag acgtctcttt t 21 <210> 27 <211> 25 <212> DNA <213> Primer() <400> 27 aagttgtgag aagaacacag aggaa 25 <210> 28 <211> 25 <212> DNA <213> Primer() <400> 28 ctagtgaagtctccagggtcttaag 25 <210> 29 <211> 25 <212> DNA <213> Primer() <400> 29 aaacaaaagc aaacaaacca aggtg 25 <210> 30 <211> twenty two <212> DNA <213> Primer() <400> 30 atcctggtct ccaaggcaaa at 22 <210> 31 <211> 25 <212> DNA <213> Primer() <400> 31 gatacacagt cctaaccact tgagt 25 <210> 32 <211> 25 <212> DNA <213> Primer() <400> 32 agcagaaact aaacattgtc actgg 25 <210> 33 <211> 25 <212> DNA <213> Primer() <400> 33 cccaatccaa tcatctttgc tcttt 25 <210> 34 <211> 25 <212> DNA <213> Primer() <400> 34 aaactgaccttggatggaatggaaa 25 <210> 35 <211> 25 <212> DNA <213> Primer() <400> 35 ccatggggat tgtcttctaa tttgg 25 <210> 36 <211> 25 <212> DNA <213> Primer() <400> 36 gctggaacat ttgcttttct caaaa 25 <210> 37 <211> 25 <212> DNA <213> Primer() <400> 37 gtaggagaca cagtagcaga gagag 25 <210> 38 <211> 25 <212> DNA <213> Primer() <400> 38 cagtgcatgg aattttggaa acttc 25 <210> 39 <211> 25 <212> DNA <213> Primer() <400> 39 agctgctaaa tcagtctgtt aactt 25 <210> 40 <211> twenty two <212> DNA <213> Primer() <400> 40 agaaagcaca gtcttcaggg ag 22 <210> 41 <211> 25 <212> DNA <213> Primer() <400> 41 tcaaatctga ctggtagaaa tgcct 25 <210> 42 <211> 25 <212> DNA <213> Primer() <400> 42 gctaaggctg cagtaagatt agaaa 25

Claims

1. A method for nucleic acid amplification, characterized in that, The process includes adding a template to a reaction system containing polidocanol and DNA mismatch repair protein; wherein the final concentration of polidocanol in the reaction system is 0.005-0.25% (w / v)%, and the final concentration of DNA mismatch repair protein in the reaction system is 0.05-5 μg / μL; the reaction system also contains DNA polymerase and Mg... 2+ The nucleic acid amplification consists of dNTPs, primers, and buffer; the amplification is performed using polymerase chain reaction (PCR).

2. The method according to claim 1, characterized in that, The final concentration of polidocanol in the reaction system was 0.01-0.2 (w / v)%, and the final concentration of DNA mismatch repair protein in the reaction system was 0.05-2.5 μg / μL.

3. The method according to any one of claims 1-2, characterized in that, The reaction system further contains at least one of gelatin, sodium hexametaphosphate, betaine, single-chain binding protein, dimethylformamide, and bile salts.

4. The method according to claim 3, characterized in that, The final concentration of gelatin in the reaction system is 0.005-0.5 (w / v)%.

5. The method according to claim 3, characterized in that, The final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5 (w / v)%.

6. The method according to claim 3, characterized in that, The final concentration of betaine in the reaction system is 0.005-0.25 (w / v)%.

7. The method according to claim 3, characterized in that, The final concentration of the single-chain binding protein in the reaction system was 2-10 ng / μL.

8. The method according to claim 3, characterized in that, The final concentration of dimethylformamide in the reaction system is 0.1-5 (w / v)%.

9. The method according to claim 3, characterized in that, The final concentration of bile salts in the reaction system is 0.005-0.25 (w / v)%.

10. The method according to claim 1, characterized in that, The DNA polymerase is a thermostable DNA polymerase.

11. A reagent combination for nucleic acid amplification, characterized in that, The reagent combination contains polidocanol and DNA mismatch repair protein; and the final concentration of polidocanol in the reagent combination is 0.005-0.25% (w / v)%, and the final concentration of DNA mismatch repair protein in the reagent combination is 0.05-5 μg / μL. The reagent combination also contains DNA polymerase and Mg. 2+ The nucleic acid amplification consists of dNTPs, primers, and buffer; the amplification is performed using polymerase chain reaction (PCR).

12. The reagent combination according to claim 11, characterized in that, The final concentration of polidocanol in the reagent combination is 0.01-0.2 (w / v)%, and the final concentration of DNA mismatch repair protein in the reagent combination is 0.05-2.5 μg / μL.

13. The reagent combination according to any one of claims 11-12, characterized in that, The reagent combination further contains at least one of gelatin, sodium hexametaphosphate, betaine, single-chain binding protein, dimethylformamide, and bile salts.

14. The reagent combination according to claim 13, characterized in that, The final concentration of gelatin in the reagent combination is 0.005-0.5 (w / v)%.

15. The reagent combination according to claim 13, characterized in that, The final concentration of sodium hexametaphosphate in the reagent combination is 0.005-0.5 (w / v)%.

16. The reagent combination according to claim 13, characterized in that, The final concentration of betaine in the reagent combination is 0.005-0.25 (w / v)%.

17. The reagent combination according to claim 13, characterized in that, The final concentration of the single-chain binding protein in the reagent combination is 2-10 ng / μL.

18. The reagent combination according to claim 13, characterized in that, The final concentration of dimethylformamide in the reagent combination is 0.1-5 (w / v)%.

19. The reagent combination according to claim 13, characterized in that, The final concentration of bile salts in the reagent combination is 0.005-0.25 (w / v)%.

20. The reagent combination according to claim 11, characterized in that, The DNA polymerase is a thermostable DNA polymerase.

21. A reagent kit, characterized in that, It comprises the reagent combination according to any one of claims 11-20.

22. The use of the method of any one of claims 1-10, the reagent combination of any one of claims 11-20, or the kit of claim 21 in nucleic acid amplification.

Images