SSR primers for identifying rhododendron hybrids and their applications

Abstract

The present invention discloses SSR primers for identifying Rhododendron hybrids and their applications. The SSR primers include the first pair of SSR primer sequences or the second pair of SSR primer sequences: The first pair of SSR primer sequences: forward primer sequence FPr1 (5'-3'): CCATTGCACCAAGAGACAGA; reverse primer sequence RPr1 (5'-3'): GTACCTCCATTCCCCCTTGT; The second pair of SSR primer sequences: forward primer sequence FPr2 (5'-3'): TTGTGCATTCTCTAGGCACG; reverse primer sequence RPr2 (5'-3'): GACAAGAAAACCACCCGAAA. These primers can clearly distinguish between Rhododendron championiae, Rhododendron latoucheae, and the hybrid of Rhododendron championiae × Rhododendron latoucheae, realizing the early identification of Rhododendron championiae, Rhododendron latoucheae, and the hybrid of Rhododendron championiae × Rhododendron latoucheae. These primers can accurately obtain the size of the target DNA fragment, and the detection results are stable, accurate, and efficient, and are suitable for the detection and analysis of a large number of Rhododendron championiae, Rhododendron latoucheae, and the hybrid of Rhododendron championiae × Rhododendron latoucheae.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to an SSR primer for identifying rhododendron hybrids and an application thereof. Background Art

[0002] Rhododendron championiae and Rhododendron latoucheae belong to the Ericaceae family, Rhododendron subgenus Azaleastrum. Their corollas are 3-4 cm long, with pale pink to lavender or white flowers and a light fragrance. They are ornamental and worthy of development in horticulture. However, research on these two species is limited, and they are rarely cultivated in the market. No cultivars have been developed, and each wild individual has a different genetic background, leaving them undeveloped.

[0003] Simple Sequence Repeats (SSRs) are a type of tandem repeat sequence consisting of several nucleotides (usually 1-6) as repeating units, and are dozens of nucleotides long. These sequences are conserved and exist in large quantities in the genomes of organisms, but they can vary between individuals, resulting in polymorphism at the locus. Currently, the method of using SSR marker technology to identify hybrids is widely used in many plants and animals. However, due to the differences in species, each species has its own specific primers, and there is still a need to explore and find SSR primers suitable for species hybrid identification. For example:

[0004] Chinese patent application CN202111218054.1 discloses a primer, a kit, and a detection method for interspecies identification between cultivated eggplant and wild eggplant. It uses genome resequencing technology to obtain a primer for interspecies identification between cultivated eggplant and wild eggplant. The forward primer DFR1046F is 5'TGCTT AATCTGGTCCCATGA 3'; the reverse primer DFR1046R is 5'TTTCAGAAATG TAAGGTAAAAAGAGT 3'; this primer pair can quickly distinguish cultivated eggplant from three wild eggplants.

[0005] Chinese patent ZL201910146189.8 discloses an SSR molecular marker for identifying hybrids of Xinyu grapes and Kyoho grapes and its application. Hybrids of Xinyu grape and Kyoho grape were screened by five pairs of SSR marker primers (VMC7h3, Scu15vv, Vchr13a, UDV-088 and VrZAG67). The primers were as follows: the nucleotide sequence of VMC7h3 was TCAGATATTGAAGAACACCACA and ACTAGAAAATGCACAATCTCCC; the nucleotide sequence of Scu15vv was GCCTATGTGCCAGACCAAAAAC and TTGGAAGTAGCCAGCCCAACCTTC; the nucleotide sequence of Vchr13a was TGGCAGAGCAAATGAATCAA and TTGGATGGATTGGAATGACC; the nucleotide sequence of UDV-088 was CCATGCACACACGCACAT and CCACCAAACAAGTGGAGGTT; the nucleotide sequence of VrZAG67 was ACCTGGCCCGACTCCTCTTGTATGC and TCCTGCCGGCGATAACCAAGCTATG; true hybrids could be identified.

[0006] Chinese patent ZL201810663507.3 discloses a method and primers for rapidly identifying the purity of hybrid seeds of the watermelon variety 'E Xigua 16'. The primer pair for rapid seed purity identification of the watermelon variety 'E Xigua 16' is: forward primer sequence EXGF: 5'-CATTTCCGTTTCCATTTTCTTCAC-3'; reverse primer sequence EXGR: 5'-AAGTAACATCAAGCGATTCGCCAT-3'. Using these SSR primers, seed purity identification can be completed within 5-6 days. These methods are accurate, stable, simple, rapid, low-cost, and readily scalable, offering a viable alternative to traditional methods for identifying new watermelon hybrids.

[0007] Chinese patent ZL202011143112.4 discloses a method for rapid identification of hybrids between the greater leucorhinus and walleye. The SSR primer pair used for identification is Primer1-F: 5'-TGATGGTGGTGGTGGAGATG and Primer1-R: 5'-TGCACAGTTCCACTGAGTGT. This method can effectively identify hybrids from the early seedling stage, ensuring the purity of the fry and providing strong technical support for the promotion and application of new salt- and alkali-tolerant varieties.

[0008] SSR markers are widely distributed across species. One of the characteristics of SSR markers is their high polymorphism, meaning that each individual may have multiple different alleles. Therefore, it is very difficult to screen for bands with low polymorphism and significant differences between different populations. Summary of the Invention

[0009] The present invention uses the method of artificial hybridization and wild azalea resources to successfully cultivate a hybrid of Rhododendron spicata × Rhododendron sibiricum for the first time. The hybrid can bloom after 5-7 years of cultivation. The hybrid is different from the parent in morphological characteristics, but it needs to be identified in combination with the various organs such as flowers, stems, leaves, and fruits to be determined as a hybrid, which takes a long time. At the same time, the hybrids of the hybrid combination of different parent individuals have no obvious phenotypic differences and are not easy to distinguish. In order to solve the above technical problems, the present invention provides an SSR primer for the identification of azalea hybrids, which is used to distinguish and identify Rhododendron spicata, Rhododendron sibiricum, and Rhododendron spicata × Rhododendron sibiricum hybrids, and can achieve accurate distinction.

[0010] An SSR primer for identifying a rhododendron hybrid comprises the following first pair of SSR primer sequences or second pair of SSR primer sequences:

[0011] The first pair of SSR primer sequences:

[0012] Forward primer sequence FPr1 (5'-3'): CCATTGCACCAAGAGACAGA (SEQ ID NO: 1);

[0013] Reverse primer sequence RPr1 (5'-3'): GTACCTCCATTCCCCCTTGT (SEQ ID NO: 2);

[0014] The second pair of SSR primer sequences:

[0015] Forward primer sequence FPr2 (5′-3′): TTGTGCATTCTCTAGGCACG (SEQ ID NO: 3);

[0016] Reverse primer sequence RPr2 (5'-3'): GACAAGAAAACCACCCGAAA (SEQ ID NO: 4).

[0017] In order to be suitable for fluorescence detectors, the SSR primers can be designed into fluorescent SSR marker primers by introducing fluorescent groups of different colors such as 6-carboxyfluorescein (FAM), hexachloro-6-methylfluorescein (HEX), 6-carboxytetramethylrhodamine (TAMRA), tetrachloro-6-carboxyfluorescein (TET), etc.

[0018] Optionally, the fluorescent SSR marker primer is one of a FAM fluorescent SSR marker primer, a HEX fluorescent SSR marker primer, a TAMRA fluorescent SSR marker primer, a TET fluorescent SSR marker primer, etc.

[0019] The position of the fluorescent group inserted into the SSR primer can be based on conventional operations in the art. Taking the first pair of primers labeled with FAM fluorescent SSR as an example, the primer sequences are as follows:

[0020] Forward primer sequence FPr1 (5′-3′): FAM-CCATTGCACCAAGAGACAGA;

[0021] Reverse primer sequence RPr1 (5'-3'): GTACCTCCATTCCCCCTTGT.

[0022] The identification of rhododendron hybrids includes the identification of spiny rhododendron, antler rhododendron, and hybrids of spiny rhododendron and antler rhododendron.

[0023] When the SSR primers include the first pair of SSR primer sequences, the identification of the azalea hybrids also includes the identification of hybrid combinations of different parental individuals of the hybrid of Rhododendron azalea × Rhododendron staghornensis. Since there are often differences between different individuals of Rhododendron azalea and different individuals of Rhododendron staghornensis, hybrids with different individuals of Rhododendron azalea and different individuals of Rhododendron staghornensis as parental combinations will have the problem of unclear phenotypic differences and can only be distinguished from a molecular perspective. Therefore, effectively identifying the parental combinations of hybrids with different individuals of Rhododendron azalea and different individuals of Rhododendron staghornensis as parental combinations is particularly important for the identification of new azalea hybrid varieties.

[0024] The present invention also provides the use of the SSR primers for identifying rhododendron hybrids in distinguishing Rhododendron spinulosum, Rhododendron serrata, and Rhododendron spinulosum×Rhododendron serrata hybrids.

[0025] When the SSR primers are the first pair of SSR primer sequences, the method for distinguishing the hybrid of Rhododendron australis × Rhododendron styracifolium includes distinguishing hybrid combinations of different parental individuals of the hybrid of Rhododendron australis × Rhododendron styracifolium. That is, the first pair of SSR primer sequences can accurately distinguish individuals of the two parents in the hybrid of Rhododendron australis and Rhododendron styracifolium.

[0026] Optionally, when the SSR primers are the first pair of SSR primer sequences, the hybrid combinations for distinguishing different parental individuals of the hybrid of Rhododendron azalea × Rhododendron styracosa include one or two of a hybrid combination of a first Rhododendron azalea with a 230bp specific band in the amplified band as a parent individual and a first Rhododendron styracosa with amplified bands of 243bp and 246bp as a parent individual, and a hybrid combination of a second Rhododendron azalea with amplified bands of 239bp and 249bp as a parent individual and a first Rhododendron styracosa with amplified bands of 243bp and 246bp as a parent individual.

[0027] Optionally, when the SSR primers are the first pair of SSR primer sequences, the spiny rhododendron includes a first spiny rhododendron with an amplified band of 230bp and / or a second spiny rhododendron with an amplified band of 239bp and 249bp; the stag-horn rhododendron includes a first stag-horn rhododendron with an amplified band of 243bp and 246bp; the hybrid of the spiny rhododendron and stag-horn rhododendron includes a hybrid of the first spiny rhododendron and the first stag-horn rhododendron with amplified bands of 230bp and 243bp and / or a hybrid of the second spiny rhododendron and the first stag-horn rhododendron with amplified bands of 243bp and 249bp. Alternatively, the stag-horn rhododendron includes other stag-horn rhododendrons with amplified bands of 239bp and 245bp. The hybrid of the spiny rhododendron and stag-horn rhododendron includes a hybrid with amplified bands of 230bp and 233bp.

[0028] When the SSR primers are the second pair of SSR primer sequences; the Rhododendron staghornensis includes the first Rhododendron staghornensis with amplified specific bands of 206bp and 210bp; the Rhododendron spicata includes the first Rhododendron spicata and / or the second Rhododendron spicata with amplified specific bands of 438bp, and the hybrid of Rhododendron spicata and Rhododendron spicata includes a hybrid with amplified specific bands of 214bp and 438bp.

[0029] The method for distinguishing Rhododendron spinulosum, Rhododendron sibiricum, and Rhododendron spinulosum × Rhododendron sibiricum hybrids using SSR primers comprises the following steps:

[0030] (a) extracting DNA from tender leaves of individual azaleas to be tested;

[0031] (b) using the DNA extracted in step (a) as a template, and performing PCR amplification using SSR primers identified in rhododendron hybrids;

[0032] (3) The PCR amplification products were detected by capillary electrophoresis to obtain the PCR amplification bands of the individual cuckoo to be tested;

[0033] The SSR primers are a first pair of SSR primer sequences, and the amplified bands with 243bp and 246bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 230bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 239bp and 249bp specific bands are from the second Rhododendron sibiricum, the amplified bands with 230bp and 243bp specific bands are from a hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum, and the amplified bands with 243bp and 249bp specific bands are from a hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum; or, the amplified bands with 239bp and 245bp specific bands are from another Rhododendron sibiricum individual different from the first Rhododendron sibiricum, and the amplified bands with 230bp and 233bp specific bands are from a hybrid;

[0034] Alternatively, the SSR primers are the second pair of SSR primer sequences, and the amplified bands with specific bands of 206bp and 210bp are for the first Rhododendron serrata, the amplified bands with specific bands of 438bp are for the first Rhododendron serrata and / or the second Rhododendron serrata, and the amplified bands with specific bands of 214bp and 438bp are for the hybrid.

[0035] The reagents used in the present invention are all prepared using commercially available products or existing preparation methods.

[0036] The present invention has the following advantages:

[0037] The specific SSR primers or specific fluorescent SSR marker primers of the present invention can clearly distinguish between hybrid combinations of different parental individuals of Rhododendron spicata, Rhododendron styracifolium, Rhododendron spicata × Rhododendron styracifolium hybrids, and even Rhododendron spicata × Rhododendron styracifolium hybrids, thereby enabling early identification of hybrid combinations of different parental individuals of Rhododendron spicata, Rhododendron styracifolium, Rhododendron spicata × Rhododendron styracifolium hybrids, and even Rhododendron spicata × Rhododendron styracifolium hybrids. This is of great significance in production and is an effective method for protecting new plant variety rights.

[0038] The specific SSR primers or specific fluorescent SSR marker primers of the present invention can accurately obtain the size of the target DNA fragment (accurate to 1bp), and the detection results are stable, accurate and efficient. They are suitable for the detection and analysis of large quantities of hybrid combinations of spiny rhododendrons, stag-horn rhododendrons, spiny rhododendrons×stag-horn rhododendrons hybrids, and even spiny rhododendrons×stag-horn rhododendrons hybrids with different parental individuals.

[0039] The present invention only uses the SSR primers of one parent, designs SSR primers through transcriptome sequencing technology, and preliminarily screens out SSR primers suitable for Rhododendron spinulosum; uses the preliminarily screened SSR primers to compare the PCR amplification results of Rhododendron sibiricum, Rhododendron spinulosum and their hybrids, and performs capillary electrophoresis test to obtain a specific SSR primer or specific fluorescent SSR marker primer for hybrid identification, and successfully constructs a standard DNA fingerprint for identifying Rhododendron spinulosum, Rhododendron sibiricum and their hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the capillary electrophoresis result of Rhododendron 1 in Example 1;

[0041] Figure 2 This is the capillary electrophoresis result of Rhododendron spinulosa 1 in Example 1;

[0042] Figure 3 This is the capillary electrophoresis result of Rhododendron spinulosa 2 in Example 1;

[0043] Figure 4 This is a capillary electrophoresis result of the hybrid of Rhododendron spinulosum 1×Rhododendron serrata 1 in Example 1;

[0044] Figure 5 This is a capillary electrophoresis result of the hybrid of Rhododendron spinulosum 2×Rhododendron serrata 1 in Example 1;

[0045] Figure 6 This is the capillary electrophoresis result of Rhododendron spinulosa 1 in Example 2;

[0046] Figure 7 This is the capillary electrophoresis result of Rhododendron truncatum Y in Example 2;

[0047] Figure 8 The capillary electrophoresis results of the hybrid in Example 2 are shown;

[0048] Figure 9 This is the capillary electrophoresis result of Rhododendron serrata 1 in Example 3;

[0049] Figure 10 This is the capillary electrophoresis result of Rhododendron spinulosa 1 in Example 3;

[0050] Figure 11 This is the capillary electrophoresis result of Rhododendron spinulosa 2 in Example 3;

[0051] Figure 12 This is the capillary electrophoresis result of the hybrid in Example 3. DETAILED DESCRIPTION

[0052] The present invention is described in further detail below with reference to the examples.

[0053] Example 1

[0054] (1) Hybrid breeding

[0055] Using two high-quality wild Rhododendron spicata plants, Rhododendron 1 (denoted as Rhododendron 1) and Rhododendron 2 (denoted as Rhododendron 2), as the female parents, and one wild Rhododendron staghorn plant, Rhododendron 1 (denoted as Rhododendron 1), as the male parent, artificial pollination was performed to produce two hybrid combinations: Rhododendron 1 × Rhododendron 1 and Rhododendron 2 × Rhododendron 1. Hybrid fruit was obtained from each of the two hybrid combinations. Seeds from each of the two hybrid combinations were collected and planted separately, resulting in hybrid seedlings (hybrids) from the two hybrid combinations. The hybrid seedlings flowered after six years of cultivation. Phenotypic identification of their flowers, stems, leaves, and fruits confirmed them as hybrids, a long process. However, the specific parental hybrid combinations of the hybrids could not be identified.

[0056] (2) Preliminary screening of SSR primers

[0057] During the flowering period of Rhododendron spinulosum in May, flowers of one Rhododendron spinulosum plant (any Rhododendron spinulosum individual) were randomly collected and stored in liquid nitrogen. The transcriptome of the Rhododendron spinulosum flowers was sequenced by BGI Genomics Co., Ltd. Based on the transcriptome data of Rhododendron spinulosum, single sequences (Unigene) larger than 1 kb obtained were subjected to SSR analysis using MISA software. SSR molecular marker primers were designed using Primer3 software, and SSR primers were screened.

[0058] During the leafing period of Rhododendron sibiricum in April and the leafing period of Rhododendron sibiricum and hybrids in June, young leaves of two female Rhododendron sibiricum 1 and Rhododendron sibiricum 2, one male Rhododendron sibiricum 1, and ten hybrids prepared in step (1) were collected as samples and stored in liquid nitrogen. Total DNA from each sample was extracted in the laboratory using the cetyltrimethylammonium bromide (CTAB) method. First, total DNA from Rhododendron sibiricum 1 (or Rhododendron sibiricum 2) sample was used as a DNA template to screen SSR primers.

[0059] A 10 μL reaction system was used for PCR amplification of SSR molecular markers. The 10 μL reaction system included: 1 μL 10× buffer, 1 μL 2.5 mmol / L dNTP, 0.1 μL 5 U / μL Taq DNA polymerase, 1 μL each of 10 μmol / L forward and reverse primers, and 1 μL 20-40 ng / μL DNA. The system was adjusted with sterile redistilled water to a final volume of 10 μL.

[0060] PCR amplification reaction program: pre-denaturation at 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, 54°C-56°C for 30 s, and 72°C for 60 s; and finally extension at 72°C for 5 min.

[0061] PCR amplification product detection: PCR amplification product identification was performed by preparing a 2% agarose gel (the percentage of grams of agarose gel to milliliters of 1×TAE buffer) with 1×TAE buffer. To 10 μL of the reaction system that had completed the PCR amplification reaction procedure, 2 μL of 6× loading buffer was added and mixed to serve as the PCR amplification product loading solution. 1×TAE buffer was used as the electrophoresis buffer. 4 μL of the PCR amplification product loading solution was added to each well. Electrophoresis was performed at a voltage of 200 V and a current of 300 mA for 0.5 h. Finally, the electrophoresis pattern was interpreted using a gel imaging system, and 20 pairs of SSR primers with clear amplification bands and good reproducibility were selected.

[0062] (3) Determination of SSR-specific primers

[0063] The total DNA of two female Rhododendron spinulosum samples, one male Rhododendron stylophorum sample, and ten hybrid samples were used as DNA templates to screen the 20 pairs of SSR primers screened initially. The reaction system, reaction procedure, and PCR amplification product detection were the same as step (2). A pair of SSR-specific primers was screened out. The sequences of the SSR primers were as follows: forward primer sequence FPr1 (5'-3'): CCATTGCACCAAGAGACAGA (SEQ ID NO: 1), and reverse primer sequence RPr1 (5'-3'): GTACCTCCATTCCCCCTTGT (SEQ ID NO: 2). The SSR-specific primers could distinguish all 13 individuals, including two female Rhododendron spinulosum, one male Rhododendron stylophorum, and ten hybrids.

[0064] (4) Capillary electrophoresis verification of SSR-specific primers

[0065] For this pair of SSR specific primers, FAM fluorescent primers were designed and PCR amplification was performed. The reaction system, reaction procedure and PCR amplification product detection were the same as step (2). The PCR products were detected by capillary electrophoresis to obtain the lengths of PCR amplification bands of 2 female parent Rhododendrons, 1 male parent Rhododendrons sutchuenensis and 10 hybrids. The amplified bands with lengths of 243 bp and 246 bp were from the male parent Rhododendrons sutchuenensis, the amplified band with lengths of 230 bp was from the female parent Rhododendrons 1, the amplified bands with lengths of 239 bp and 249 bp were from the female parent Rhododendrons 2, the amplified bands with lengths of 230 bp and 243 bp were from the hybrid of Rhododendrons 1×Rhododendrons 1, and the amplified bands with lengths of 243 bp and 249 bp were from the hybrid of Rhododendrons 2×Rhododendrons 1. The results showed that the use of this pair of SSR specific primers to verify the spiny-haired Rhododendron, Rhododendron sibiricum and the hybrids of spiny-haired Rhododendron and Rhododendron sibiricum could clearly distinguish the individuals of Rhododendron spiny-haired Rhododendron 1, Rhododendron spiny-haired Rhododendron 2, Rhododendron sibiricum 1, the hybrid of Rhododendron spiny-haired Rhododendron 1×Rhododendron sibiricum 1, and the hybrid combination of Rhododendron spiny-haired Rhododendron 2×Rhododendron sibiricum 1, and the specific parental individuals of the hybrids could be identified to achieve accurate distinction. The specific identification results are shown in Table 1.

[0066] Table 1 Capillary electrophoresis results of fluorescent SSR primers

[0067]

[0068]

[0069] Example 2

[0070] (1) Hybrid breeding

[0071] Using a single, superior wild Rhododendron spinulosum plant, designated "Rhododendron spinulosum 1," as the female parent and a single wild Rhododendron staghornii plant (any individual Rhododendron staghornii, designated "Rhododendron staghornii x") as the male parent, artificial pollination was performed to produce hybrid fruit from the hybrids. Seeds were collected and planted to create hybrid seedlings (hybrids). After six years of cultivation, the hybrids flowered. Phenotypic identification of their flowers, stems, leaves, and fruit confirmed them as hybrids, a process that took considerable time. However, the specific parental hybrid combination could not be determined.

[0072] (2) DNA extraction from young leaves of individual azaleas

[0073] During the leaf expansion period of Rhododendron sibiricum in April and the leaf expansion period of Rhododendron sibiricum and hybrids in June, young leaves of the female parent Rhododendron sibiricum 1, any Rhododendron sibiricum individual (denoted as Rhododendron sibiricum Y), and the hybrids in step (1) were collected and stored in liquid nitrogen. Total DNA of each sample was extracted in the laboratory using the CTAB method.

[0074] (3) Capillary electrophoresis verification of SSR-specific primers

[0075] The SSR-specific primers in Example 1 were used to design FAM fluorescent primers for PCR amplification. The reaction system, reaction procedure, and PCR amplification product detection were the same as step (2) in Example 1. The PCR products were detected by capillary electrophoresis to obtain the lengths of the PCR amplification bands of the female parent Rhododendron 1, Rhododendron Y, and 5 hybrids. The amplification band with a length of 230 bp was the female parent Rhododendron 1, the amplification bands with lengths of 230 bp and 233 bp were the hybrids, and the amplification bands with lengths of 239 bp and 245 bp were the Rhododendron Y. The amplification band length of Rhododendron Y did not have the specific bands of 243 bp and 246 bp, indicating that Rhododendron Y was another Rhododendron individual different from the first Rhododendron individual. The results showed that the use of this pair of SSR specific primers to verify the spiny-haired Rhododendron, Rhododendron sibiricum and the hybrid of Rhododendron sibiricum and Rhododendron sibiricum could distinguish the three types of Rhododendron sibiricum 1, Rhododendron sibiricum Y and the hybrid. It could clearly identify and distinguish the individuals of Rhododendron sibiricum 1 and Rhododendron sibiricum Y, but could not identify the specific hybrid combination of parental individuals of the hybrid. The specific identification results are shown in Table 2.

[0076] Table 2 Capillary electrophoresis results of fluorescent SSR primers

[0077]

[0078] Example 3

[0079] (1) Hybrid breeding

[0080] Using two high-quality wild Rhododendron spicata plants, Rhododendron 1 (denoted as Rhododendron 1) and Rhododendron 2 (denoted as Rhododendron 2), as the female parents, and one wild Rhododendron staghorn plant, Rhododendron 1 (denoted as Rhododendron 1), as the male parent, artificial pollination was performed to produce two hybrid combinations: Rhododendron 1 × Rhododendron 1 and Rhododendron 2 × Rhododendron 1. Hybrid fruit was obtained from each of the two hybrid combinations. Seeds from each of the two hybrid combinations were collected and planted separately, resulting in hybrid seedlings (hybrids) from the two hybrid combinations. The hybrid seedlings flowered after six years of cultivation. Phenotypic identification of their flowers, stems, leaves, and fruits confirmed them as hybrids, a long process. However, the specific parental hybrid combinations of the hybrids could not be identified.

[0081] (2) Preliminary screening of SSR primers

[0082] During the flowering period of Rhododendron spinulosum in May, flowers of one Rhododendron spinulosum plant (any Rhododendron spinulosum individual) were randomly collected and stored in liquid nitrogen. The transcriptome of the Rhododendron spinulosum flowers was sequenced by BGI Genomics Co., Ltd. Based on the transcriptome data of Rhododendron spinulosum, SSR analysis of Unigenes larger than 1 kb obtained by screening was performed using MISA software. SSR molecular marker primers were designed using Primer3 software, and SSR primers were screened.

[0083] During the leafing period of Rhododendron sibiricum in April and the leafing period of Rhododendron sibiricum and hybrids in June, young leaves of two female Rhododendron sibiricum (Rhododendron sibiricum 1 and Rhododendron sibiricum 2), one male Rhododendron sibiricum 1, and ten hybrids prepared in step (1) were collected as samples and stored in liquid nitrogen. Total DNA from each sample was extracted in the laboratory using the CTAB method. First, total DNA from Rhododendron sibiricum 1 (or Rhododendron sibiricum 2) was used as a DNA template to screen SSR primers.

[0084] A 10 μL reaction system was used for PCR amplification of SSR molecular markers. The 10 μL reaction system included: 10×Buffer 1 μL, 2.5 mmol / L dNTP 1 μL, 5 U / μL TaqDNA polymerase 0.1 μL, 10 μmol / L forward and reverse primers 1 μL each, and 20-40 ng / μL DNA 1 μL. The system was adjusted with sterile redistilled water to a final volume of 10 μL.

[0085] PCR amplification reaction program: pre-denaturation at 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, 54°C-56°C for 30 s, and 72°C for 60 s; and finally extension at 72°C for 5 min.

[0086] PCR amplification product detection: PCR amplification products were identified on a 2% agarose gel prepared with 1× TAE buffer. To 10 μL of the completed PCR amplification reaction, 2 μL of 6× loading buffer was added and mixed thoroughly as the PCR amplification product loading solution. 1× TAE buffer was used as the electrophoresis buffer. 4 μL of the PCR amplification product loading solution was added to each well. Electrophoresis was performed at 200 V and 300 mA for 0.5 h. Finally, the electrophoresis pattern was interpreted using a gel imaging system. Twenty pairs of SSR primers were screened for clear and reproducible amplification bands.

[0087] (3) Determination of SSR-specific primers

[0088] The total DNA of two female Rhododendron spinulosum samples, one male Rhododendron serrata sample, and ten hybrid samples were used as DNA templates to screen the 20 pairs of SSR primers screened initially. The reaction system, reaction procedure, and PCR amplification product detection were the same as step (2). A pair of SSR primers was screened, and the sequences of the SSR primers were as follows: forward primer sequence FPr2 (5'-3'): TTGTGCATTCTCTAGGCACG (SEQ ID NO: 3), and reverse primer sequence RPr2 (5'-3'): GACAAGAAAACCACCCGAAA (SEQ ID NO: 4).

[0089] This pair of SSR-specific primers can distinguish the three types of plants: the female parent Rhododendron spicata, the male parent Rhododendron spicata, and hybrids, but cannot distinguish different individuals of Rhododendron spicata or the specific hybrid combinations of hybrids.

[0090] (4) Capillary electrophoresis verification of SSR-specific primers

[0091] Based on the SSR-specific primers, FAM fluorescent primers were designed and PCR amplification was performed. The reaction system, reaction procedure, and PCR amplification product detection were the same as step (2). The PCR products were detected by capillary electrophoresis to obtain the lengths of PCR amplification bands of 2 female parent Rhododendrons, 1 male parent Rhododendrons serrata, and 10 hybrids. The amplification bands with lengths of 206 bp and 210 bp were male parent Rhododendrons serrata 1, the amplification bands with lengths of 438 bp were female parent Rhododendrons 1 and / or Rhododendrons 2, and the amplification bands with lengths of 214 bp and 438 bp were hybrids. The specific hybrid combination of the hybrids could not be identified. It was impossible to distinguish between different Rhododendrons individuals, and it was also impossible to distinguish the specific parental individual hybrid combinations of the Rhododendrons serrata × Rhododendrons serrata hybrids. The specific identification results are shown in Table 3.

[0092] Table 3 Capillary electrophoresis results of fluorescent SSR primers

[0093] female parent Band length bp Male parent Band length bp hybrid population Band length bp Rhododendron spinulosa 1 438 Rhododendron 1 206 210 Hybrid 1 214 438 Rhododendron spinulosa 2 438 Hybrid 2 214 438 Hybrid 3 214 438 Hybrid 4 214 438 Hybrid 5 214 438 Hybrid 6 214 438 Hybrid 7 214 438 Hybrid 8 214 438 Hybrid 9 214 438 Hybrid 10 214 438 Sequence Listing <110> Zhejiang Academy of Forestry <120> SSR primer for identification of rhododendron hybrids and its application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 ccattgcacc aagagacaga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gtacctccat tcccccttgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ttgtgcattc tctaggcacg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gacaagaaaa ccacccgaaa 20

Claims

1. An SSR primer for identifying rhododendron hybrids, characterized in that: The SSR primers include the following first pair of SSR primer sequences or second pair of SSR primer sequences: The first pair of SSR primer sequences: Forward primer sequence FPr1: 5′-CCATTGCACCAAGAGACAGA-3′; Reverse primer sequence RPr1: 5′-GTACCTCCATTCCCCCTTGT-3′; The second pair of SSR primer sequences: Forward primer sequence FPr2: 5′-TTGTGCATTCTCTAGGCACG-3′; Reverse primer sequence RPr2: 5′-GACAAGAAAACCACCCGAAA-3′; The azalea hybrids are identified as spiny-haired azalea, antler-shaped azalea, and the hybrids of spiny-haired azalea and antler-shaped azalea.

2. The SSR primer according to claim 1, characterized in that The SSR primer is a fluorescent SSR marker primer.

3. The SSR primer according to claim 2, characterized in that The fluorescent SSR marker primer is one of a FAM fluorescent SSR marker primer, a HEX fluorescent SSR marker primer, a TAMRA fluorescent SSR marker primer, and a TET fluorescent SSR marker primer.

4. Use of the SSR primers for identifying rhododendron hybrids according to any one of claims 1 to 3 in distinguishing Rhododendron spinulosum, Rhododendron sibiricum, and hybrids of Rhododendron spinulosum and Rhododendron sibiricum; The SSR primers are a first pair of SSR primer sequences, and the amplified bands with 243bp and 246bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 230bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 239bp and 249bp specific bands are from the second Rhododendron sibiricum, the amplified bands with 230bp and 243bp specific bands are from a hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum, and the amplified bands with 243bp and 249bp specific bands are from a hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum; or, the amplified bands with 239bp and 245bp specific bands are from another Rhododendron sibiricum individual different from the first Rhododendron sibiricum, and the amplified bands with 230bp and 233bp specific bands are from a hybrid of the first Rhododendron sibiricum and another Rhododendron sibiricum individual different from the first Rhododendron sibiricum with amplified bands with 239bp and 245bp specific bands; Alternatively, the SSR primers are the second pair of SSR primer sequences, and the amplified bands with specific bands of 206bp and 210bp are from the first Rhododendron sibiricum, the amplified bands with specific bands of 438bp are from the first Rhododendron sibiricum or the second Rhododendron sibiricum, and the amplified bands with specific bands of 214bp and 438bp are from the hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum or the hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum.

5. The use according to claim 4, characterized in that The hybrids for distinguishing Rhododendron spicata and Rhododendron styracifolium are hybrid combinations of different parental individuals for distinguishing Rhododendron spicata and Rhododendron styracifolium hybrids, and the SSR primers are the first pair of SSR primer sequences.

6. The use according to claim 5, characterized in that The azalea is the first azalea with a 230 bp specific band or the second azalea with a 239 bp and 249 bp specific bands; The azalea is the first azalea with amplified specific bands of 243 bp and 246 bp; The hybrid of Rhododendron australis and Rhododendron styracosa is a hybrid of Rhododendron australis and Rhododendron styracosa with amplified specific bands of 230bp and 243bp or a hybrid of Rhododendron australis and Rhododendron styracosa with amplified specific bands of 243bp and 249bp.

7. The use according to claim 4, characterized in that The SSR primers are the second pair of SSR primer sequences; the Rhododendron sibiricum is the first Rhododendron sibiricum with amplified specific bands of 206bp and 210bp; the Rhododendron sibiricum is the first Rhododendron sibiricum or the second Rhododendron sibiricum with amplified specific bands of 438bp, and the hybrid of Rhododendron sibiricum and Rhododendron sibiricum is the hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum or the hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum with amplified specific bands of 214bp and 438bp.

8. The use according to claim 4, characterized in that The distinction is made using a method that includes the following steps: (a) Extract DNA from young leaves of the individual Rhododendron species to be tested; (b) using the DNA extracted in step (a) as a template, PCR amplification was performed using SSR primers identified in rhododendron hybrids; (c) The PCR amplification products were detected by capillary electrophoresis to obtain the PCR amplification bands of the tested cuckoo individuals; The SSR primers are a first pair of SSR primer sequences, and the amplified bands with 243bp and 246bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 230bp specific bands are from the first Rhododendron sibiricum, the amplified bands with 239bp and 249bp specific bands are from the second Rhododendron sibiricum, the amplified bands with 230bp and 243bp specific bands are from a hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum, and the amplified bands with 243bp and 249bp specific bands are from a hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum; or, the amplified bands with 239bp and 245bp specific bands are from another Rhododendron sibiricum individual different from the first Rhododendron sibiricum, and the amplified bands with 230bp and 233bp specific bands are from a hybrid of the first Rhododendron sibiricum and another Rhododendron sibiricum individual different from the first Rhododendron sibiricum with amplified bands with 239bp and 245bp specific bands; Alternatively, the SSR primers are the second pair of SSR primer sequences, and the amplified bands with specific bands of 206bp and 210bp are from the first Rhododendron sibiricum, the amplified bands with specific bands of 438bp are from the first Rhododendron sibiricum or the second Rhododendron sibiricum, and the amplified bands with specific bands of 214bp and 438bp are from the hybrid of the first Rhododendron sibiricum and the first Rhododendron sibiricum or the hybrid of the second Rhododendron sibiricum and the first Rhododendron sibiricum.

Images