Reversible dynamic regulation biosensor and its application and method for reversible dynamic identification of nucleic acid detection results
By designing a reversible dynamic regulation biosensor and using hairpin probes and synergistic factor probes to regulate HCR reaction activity, the problem of false positive signals in nucleic acid detection is solved, high-sensitivity and high-accuracy nucleic acid detection is achieved, and sample demand and detection costs are reduced.
Patent Information
- Application Number
- CN202110169371.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-02-07
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2041-02-07
AI Technical Summary
Existing nucleic acid detection methods are prone to producing false positive signals, and multiple sampling and testing increase costs and patient suffering, require a large amount of samples, and lack detection accuracy and reliability.
A reversible dynamic regulation biosensor is designed, which includes a hairpin probe and a synergistic factor probe. The HCR reaction activity is regulated by the complementarity of the positive and negative synergistic factor probes to achieve reversible changes in the signal and identify false positive results of nucleic acid detection.
The sensitivity and accuracy of nucleic acid detection are improved, the sample requirement is reduced, repeated sampling is avoided through cyclic testing of the same sample, costs are reduced, and the accuracy and reliability of identifying false positive signals are improved.
Smart Images

Figure CN114908142B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection, and in particular to a reversible dynamic regulation biosensor and its application, as well as a method for reversibly and dynamically identifying nucleic acid detection results. Background Art
[0002] Due to its high sensitivity and specificity, nucleic acid testing has become one of the most widely used biological detection methods, playing a vital role in various fields, including medicine, scientific research, and criminal investigation. Currently, the most commonly used nucleic acid detection method is PCR. However, in practice, this method often generates false positive signals due to factors such as environmental contamination and cross-contamination between samples, compromising the accuracy and reliability of test results.
[0003] Currently, there are two main methods for eliminating false positive results in nucleic acid testing. One is to use different response signals when testing the same nucleic acid sample, such as simultaneously detecting electrochemical signals and spectral signals. However, this method cannot effectively avoid false positive signals caused by nonspecific interactions of signal probes or degradation of signal probes; the second is to reduce false positive results through multiple sampling and multiple testing methods. However, this method increases the cost of testing and is not applicable to situations with small sample quantities. In addition, for medical testing, multiple sampling and testing also increase the patient's pain and medical expenses.
[0004] Therefore, there is an urgent need to develop a method for detecting false positives in nucleic acids with high sensitivity and low sample requirements to improve the accuracy and practicality of nucleic acid testing. Summary of the Invention
[0005] The purpose of the present invention is to overcome the problems existing in the prior art, such as the difficulty in identifying false signals in the nucleic acid detection process or the need for multiple sampling and testing to avoid false positive results, resulting in high detection costs and large sample requirements. A reversible dynamically regulated biosensor is provided. The biosensor has the characteristics of high sensitivity and high accuracy when used for nucleic acid detection. The biosensor can also identify false positive signals in nucleic acid detection results with high sensitivity and high accuracy. When the biosensor is used to identify false positive signals of nucleic acid, cyclic repeated detection can be achieved through the same sample, avoiding the high cost and other problems caused by repeated sampling and testing. In addition, false positive signals of nucleic acid detection can be accurately identified even when the sample amount is small.
[0006] In order to achieve the above object, the present invention provides a reversible dynamic regulation biosensor, characterized in that the biosensor includes a hairpin probe and a cooperating factor probe;
[0007] Wherein, the hairpin probe includes a hairpin probe H1 and a hairpin probe H2 that exist independently of each other;
[0008] The synergistic factor probes include a positive synergistic factor probe and a negative synergistic factor probe, and the sequences of the positive synergistic factor probe and the negative synergistic factor probe are completely complementary;
[0009] The positive synergist probe and the negative synergist probe exist independently of each other.
[0010] The second aspect of the present invention provides the use of the above-mentioned biosensor in identifying nucleic acid test results, especially in identifying false positive nucleic acid test results.
[0011] A third aspect of the present invention provides a method for reversibly and dynamically identifying nucleic acid detection results, the method comprising the following steps:
[0012] (1) first mixing the target nucleic acid with the hairpin probes H1 and H2 to obtain a solution 1, and collecting a detection output signal 1 of the solution 1;
[0013] (2) performing a second mixing of solution 1 and one of the synergistic factor probes to obtain solution 2, and collecting a detection output signal 2 of solution 2;
[0014] (3) mixing solution 2 with another of the synergistic factor probes for a third time to obtain solution 3, and collecting a detection output signal 3 of solution 3;
[0015] (4) Compare the detection output signal 1, the detection output signal 2, and the detection output signal 3. If the detection output signal intensities are different, the target nucleic acid detection result is positive. If the detection output signal intensities are the same, the target nucleic acid detection result is a false positive.
[0016] A fourth aspect of the present invention provides a kit for identifying false positive results of nucleic acid detection, wherein the kit comprises the reversible dynamic regulation biosensor as described above.
[0017] Through the above technical solutions, the biosensor and method provided by the present invention can accurately identify false positive signals in nucleic acid tests of small amounts of samples. The test results can be verified by repeated testing of the same sample, further improving the accuracy and reliability of false positive signal identification. Furthermore, by combining with nucleic acid aptamers, the biosensor and method provided by the present invention can also be applied to the screening and detection of other biomolecules, such as proteins, exosomes, cells, and disease markers. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the method for identifying false positive nucleic acid test results provided by the present invention;
[0019] Figure 2-3 The results of the optimization of the synergistic factor probe strength and the gel electrophoresis verification in Example 1 are as follows;
[0020] Figure 4 This is the result of optimizing the positive synergistic factor probe concentration in Example 1;
[0021] Figure 5 This is the result of optimizing the concentration of the negative synergist probe in Example 1;
[0022] Figure 6 This is the gel electrophoresis verification result of the optimization result of the positive and negative synergistic factor probe concentrations in Example 1;
[0023] Figure 7 This is the verification result of the reversible regulation of the biosensor provided by the present invention in Example 1;
[0024] Figure 8 is the reversible dynamic regulation target nucleic acid detection curve constructed in Example 1;
[0025] Figure 9-10 is the result of cyclic testing of the same sample in Example 1;
[0026] Figure 11 This is the result of identifying the false positive signal caused by the nonspecific interaction of the probe in Example 1;
[0027] Figure 12 This is the identification result of the false positive signal caused by probe degradation in Example 1;
[0028] Figure 13 The sensitivity and accuracy test results of the biosensor provided by the present invention in Example 1 are as follows;
[0029] Figure 14 Schematic diagram of the working principle of the biosensor prepared in Example 2;
[0030] Figure 15 This is the identification result of the false positive signal caused by the nonspecific interaction of the biosensor prepared in Example 2 with the probe. DETAILED DESCRIPTION
[0031] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.
[0032] In the present invention, unless otherwise specified, "initial state" refers to a state in which a hairpin probe is added to the system but no synergist probe is added to initiate HCR; "inhibited state" refers to a state in which a hairpin probe and a negative synergist probe are added to the system and HCR activity is inhibited; and "activated state" refers to a state in which a hairpin probe and a positive synergist probe are added to the system and HCR activity is enhanced (activated).
[0033] The inventor of the present invention has found in the process of research, can obtain cumulative signal by molecular recognition and hybridization reaction by chain hybridization reaction (hybridization chainreaction, HCR), selectively strengthen and detect target biomolecule (such as nucleic acid etc.).On the basis of HCR, according to the characteristic design synergistic factor probe of the hairpin probe adopted, further strengthen or weaken HCR hybridization activity, thus make detection signal (such as fluorescent signal, electric signal etc.) intensity change.And, the signal intensity change caused after this adding synergistic factor probe can only occur when there is target molecule in detection sample, and this characteristic makes it possible to be used for detecting and differentiating nucleic acid detection result false positive signal, thus improves accuracy and the credibility of nucleic acid detection result.In addition, the inventor of the present invention is also by ingenious design, synergistic factor probe is divided into fully complementary positive synergistic factor probe and negative synergistic factor probe, makes it possible to mutually " neutralize " in use, thus the false positive signal that originally must at least adopt three copies of samples to complete is differentiated and merged into a sample and can complete, greatly reduce the demand of sample, and by the taking turns adding of positive and negative synergistic factor probe can circulate reversibly and repeatedly detect, further improve the credibility of identification result.
[0034] In one aspect, the present invention provides a reversible dynamic regulation biosensor, the biosensor comprising a hairpin probe and a cooperating factor probe;
[0035] Wherein, the hairpin probe includes a hairpin probe H1 and a hairpin probe H2 that exist independently of each other;
[0036] The synergistic factor probes include a positive synergistic factor probe and a negative synergistic factor probe, and the sequences of the positive synergistic factor probe and the negative synergistic factor probe are completely complementary;
[0037] The positive synergist probe and the negative synergist probe exist independently of each other.
[0038] In the biosensor provided by the present invention, target nucleic acid and hairpin probe H1 and H2 hybridize, trigger HCR, so as to produce detection signal (such as fluorescent signal etc.).On this basis, if positive synergist probe is added in system, HCR reaction activity is improved, so that the detection signal of output is enhanced;If negative synergist probe is added in system, HCR reaction activity is reduced, so that the detection signal of output is weakened.In addition, due to the complete complementarity of the sequence of positive synergist probe and negative synergist probe, when these two synergist probes are added simultaneously in system, the two can be combined with each other, so as to "neutralize" the impact of synergist probe on HCR reaction activity. For example, after adding a hairpin probe to the sample, HCR is triggered, which is the initial HCR activity (initial state), and then a certain amount of positive synergist probe is added in the system so that the HCR system presents high reactivity (activated state), and then if an equal amount of negative synergist probe is added, the system will return to the initial HCR activity, and if an excessive amount of negative synergist probe (i.e., exceeding the positive synergist probe dosage) is added, the system will present low HCR activity (inhibited state), and vice versa. Therefore, the biosensor provided by the present invention can realize the purpose of reversibly identifying the detection result of the cycle by adjusting the amount of the added synergist probe.
[0039] In the biosensor provided herein, the hairpin probe can be any hairpin probe designed based on the characteristics of the target nucleic acid, using any existing probe design approach. According to a preferred embodiment of the present invention, the hairpin probe H1 comprises six components: H1a, H1b, H1c, H1d, H1e, and H1f. H1b and H1d complement each other to form a double strand, which serves as the stem of the H1 hairpin structure. H1c and H1e form the loop of the H1 hairpin structure. H1a and H1b are complementary to the target nucleic acid.
[0040] According to a preferred embodiment of the present invention, the hairpin probe H2 includes four parts: H2a', H2b', H2c' and H2d', wherein H2b' and H2d' complement each other to form a double strand as the stem of the H2 hairpin structure, and H2a' forms the loop of the H2 hairpin structure.
[0041] Preferably, the stem of the hairpin probe H1 and / or H2 has a length of 5-50 bp. The stems of the hairpin probes H1 and H2 have the same length.
[0042] Preferably, the number of bases in the loop of the hairpin probe H1 and / or H2 is 5-50 nt. The number of bases in the loop of the hairpin probe H1 and H2 may be the same or different.
[0043] According to a preferred embodiment of the present invention, H2a' and H2b' in the hairpin probe H2 are complementary to H1a and H1b in the hairpin probe H1, respectively.
[0044] According to a preferred embodiment of the present invention, H2c' and H2d' in the hairpin probe H2 are complementary to H1c and H1d in the hairpin probe H1, respectively.
[0045] In the biosensor provided herein, the hairpin probes H1 and H2 can be designed based on the characteristics of the target nucleic acid using any existing probe design approach, and their lengths can be adjusted based on actual conditions. For cost and stability considerations, the stem of the hairpin probes H1 and / or H2 is preferably 15-30 bp, preferably 18-22 bp. That is, the lengths of H1b, H1d, H2b', and H2d' are 15-30 nt, preferably 18-22 nt.
[0046] Preferably, in the hairpin probe H1, the length of H1e is 8-30 nt, preferably 10-20 nt.
[0047] Preferably, in the hairpin probe H1, the length of H1c is 4-10 nt, preferably 5-7 nt.
[0048] Preferably, in the hairpin probe H2, the length of H2c' is 4-10 nt, preferably 5-7 nt.
[0049] Preferably, in the hairpin probe H1, the length of H1f is 4-30 nt, preferably 5-10 nt.
[0050] Preferably, in the hairpin probe H1, the length of H1a is 4-10 nt, preferably 5-7 nt.
[0051] Preferably, in the hairpin probe H2, the length of H2a' is 4-10 nt, preferably 5-7 nt.
[0052] In the biosensor provided by the present invention, the synergist probe can be any synergist probe designed based on the characteristics of the target nucleic acid and the hairpin probe using any existing probe design ideas. Preferably, the synergist probe is 20-50 nt in length, preferably 24-28 nt in length.
[0053] According to a preferred embodiment of the present invention, the positive cooperating factor probe comprises two parts, A1 and A2.
[0054] Preferably, the sequences of A1 and H1e are complementary. When the positive synergist probe and the hairpin probe H1 are present in the system at the same time, A1 hybridizes with H1e in H1, thereby activating the activity of H1, increasing the HCR reaction activity and presenting an "activated state".
[0055] Preferably, A2 acts as a sticky end to hybridize with the negative cofactor, and a chain displacement reaction occurs to eliminate the activation effect of the positive cofactor.
[0056] According to a preferred embodiment of the present invention, the negative cooperating factor probe comprises two parts, I1 and I2.
[0057] Preferably, I2 is complementary to the sequences of H1a and H1e. When the negative cooperator probe and the hairpin probe H1 coexist in the system, I2 hybridizes with H1a and H1e, thereby inhibiting the activity of H1 and causing the HCR reaction activity to decrease, presenting an "inhibited state."
[0058] Preferably, I1 acts as a sticky end to hybridize with the positive cooperating factor to undergo a chain displacement reaction to eliminate the inhibitory effect of the negative cooperating factor.
[0059] According to a preferred embodiment of the present invention, the sequences of A1 and I1 are complementary.
[0060] According to a preferred embodiment of the present invention, the sequences of A2 and I2 are complementary.
[0061] According to a preferred embodiment of the present invention, a signal generating group and a signal quenching group may be respectively labeled at both ends of the hairpin probe H1.
[0062] Preferably, the signal generating group can generate at least one of a fluorescence signal, a surface plasmon resonance signal, an electrical signal, a colorimetric signal, and a Raman spectroscopy signal for detection. The signal quenching group can quench the above-mentioned signal generated by the signal generating group for detection.
[0063] According to a preferred embodiment of the present invention, the two ends of the hairpin probe H1 may be labeled with a fluorescent group and a quenching group, respectively.
[0064] Preferably, the fluorescent group is FAM.
[0065] Preferably, the quenching group is dabcy1.
[0066] According to a preferred embodiment of the present invention, the two ends of the hairpin probe H2 may be labeled with a signal generating group and a signal quenching group, respectively.
[0067] Preferably, the signal generating group can generate at least one of a fluorescence signal, a surface plasmon resonance signal, an electrical signal, a colorimetric signal, and a Raman spectroscopy signal for detection. The signal quenching group can quench the above-mentioned signal generated by the signal generating group for detection.
[0068] According to a preferred embodiment of the present invention, the two ends of the hairpin probe H2 may be labeled with a fluorescent group and a quenching group, respectively.
[0069] Preferably, the fluorescent group is FAM.
[0070] Preferably, the quenching group is dabcy1.
[0071] According to a preferred embodiment of the present invention, the signal generating group and signal quenching group labeled at both ends of the hairpin probe H1 may be the same as or different from the signal generating group and signal quenching group labeled at both ends of the hairpin probe H2. That is, the types of signal generating groups and signal quenching groups labeled at both ends of the hairpin probe H1 and the signal generating groups and signal quenching groups labeled at both ends of the hairpin probe H2 may be the same or different in terms of the type of signal generated, the type of signal generated, etc.
[0072] According to a preferred embodiment of the present invention, one of the hairpin probes H1 and H2 is optionally labeled with a signal generating group and a signal quenching group at both ends thereof, respectively.
[0073] Preferably, a signal generating group and a signal quenching group are labeled at both ends of the hairpin probe H2, respectively.
[0074] More preferably, the two ends of the hairpin probe H2 are labeled with a fluorescent group and a quenching group, respectively.
[0075] Further preferably, the fluorescent group is FAM.
[0076] Further preferably, the quenching group is dabcy1.
[0077] The hairpin probes and synergist probes used in the biosensor provided by the present invention can be any type of nucleic acid probes available in the art. According to a preferred embodiment of the present invention, the hairpin probe H1, hairpin probe H2, positive synergist probe, and negative synergist probe are selected from at least one of a DNA probe, an RNA probe, a locked nucleic acid (LNA) probe, or a peptide nucleic acid (PNA) probe. The hairpin probe H1, hairpin probe H2, positive synergist probe, and negative synergist probe are nucleic acid probes of the same type.
[0078] The biosensor provided by the present invention can be used to detect and identify false positive results of nucleic acid test results, thereby improving the accuracy and credibility of nucleic acid test results. In addition, the design of hairpin probes and synergistic factor probes for nucleic acid aptamers can also enable other biological molecules bound by nucleic acid aptamers to be identified by the biosensor provided by the present invention. For example, proteins (including enzymes, antigens, antibodies, etc.), exosomes, cells (such as cancer cells, etc.), disease markers, etc. bound by nucleic acid aptamers can all be identified by the biosensor provided by the present invention, especially for the identification of false positive results.
[0079] According to a particularly preferred embodiment of the present invention, when the nucleotide sequence of the target nucleic acid is as shown in SEQ ID NO: 1, the nucleotide sequence of the hairpin probe H1 is as shown in SEQ ID NO: 2, the nucleotide sequence of the hairpin probe H2 is as shown in SEQ ID NO: 3, the nucleotide sequence of the positive synergistic factor probe is as shown in SEQ ID NO: 4, and the nucleotide sequence of the negative synergistic factor probe is as shown in SEQ ID NO: 5.
[0080] A second aspect of the present invention provides the use of the biosensor described above in identifying nucleic acid test results, in particular, in identifying false positive nucleic acid test results.
[0081] A third aspect of the present invention provides a method for reversibly and dynamically identifying false positive nucleic acid test results using the aforementioned biosensor, the method comprising the following steps:
[0082] (1) first mixing the target nucleic acid with the hairpin probes H1 and H2 to obtain a solution 1, and collecting a detection output signal 1 of the solution 1;
[0083] (2) performing a second mixing of solution 1 and one of the synergistic factor probes to obtain solution 2, and collecting a detection output signal 2 of solution 2;
[0084] (3) mixing solution 2 with another of the synergistic factor probes for a third time to obtain solution 3, and collecting a detection output signal 3 of solution 3;
[0085] (4) Compare the detection output signal 1, the detection output signal 2, and the detection output signal 3. If the detection output signal intensities are different, the target nucleic acid detection result is positive. If the detection output signal intensities are the same, the target nucleic acid detection result is a false positive.
[0086] According to a preferred embodiment of the present invention, in step (1), the concentration of the target nucleic acid in the solution 1 is 1aM-10μM. In the method provided by the present invention, the concentration of the target nucleic acid is determined by the sensitivity of the detection method, that is, the type of the detection output signal. For example, when the detection output signal is a fluorescent signal, the concentration of the target nucleic acid can be 10fM-10μM. For another example, when a more sensitive detection method such as electrochemical sensing (i.e., the detection output signal is an electrical signal) is selected, the concentration of the target nucleic acid can be 1aM-10μM. The concentration of the hairpin probe H1 is 1nM-20μM, and the concentration of the hairpin probe H2 is 1nM-20μM. The concentrations of the hairpin probes H1 and H2 in the solution 1 are the same. It should be understood by those skilled in the art that the "target nucleic acid concentration" refers to the concentration of the target nucleic acid itself in the solution 1, that is, when the test sample is a non-nucleic acid sample such as a cell or tissue sample, the amount of the test sample in the solution 1 should be such that the concentration of the target nucleic acid released therefrom reaches a concentration greater than the detection sensitivity.
[0087] Preferably, in step (1), the target nucleic acid is selected from at least one of DNA, RNA, and a biomolecule that binds to a nucleic acid aptamer. The "biomolecule that binds to a nucleic acid aptamer" is as described above and will not be repeated here.
[0088] According to a preferred embodiment of the present invention, in step (1), the conditions for the first mixing include: temperature 15-35° C., time 0.5-2 h.
[0089] According to a preferred embodiment of the present invention, in step (2), the amount of the synergist probe used is such that the concentration of the synergist probe in the solution 2 is 1 nM-20 μM. It should be understood by those skilled in the art that the "one of the synergist probes" refers to any one of the positive synergist probe and the negative synergist probe.
[0090] According to a preferred embodiment of the present invention, in step (2), the conditions for the second mixing include: temperature 15-35° C., time 0.5-2 h, preferably 0.5-1 h.
[0091] According to a preferred embodiment of the present invention, in step (3), the amount of the synergist probe used is such that the concentration of the synergist probe in solution 3 is 1 nM-20 μM. It should be understood by those skilled in the art that the "another of the synergist probes" refers to selecting a different synergist probe in step (3) than in step (2), i.e., for example, when a positive synergist probe is selected in step (2), a negative synergist probe is selected in step (3). Vice versa.
[0092] Preferably, the amount of the synergist probe used in step (3) should be greater than or equal to the amount of the synergist probe used in step (2).
[0093] More preferably, the amount of the synergistic factor probe used in step (3) is greater than the amount of the synergistic factor probe used in step (2).
[0094] According to a preferred embodiment of the present invention, when a negative synergistic factor is selected in step (2), in step (3), the conditions of the third mixing include: temperature 15-35° C., time 0.5-2 h.
[0095] According to a preferred embodiment of the present invention, when a positive synergist is selected in step (2), in step (3), the conditions of the third mixing include: first mixing at a temperature of 90-100° C. for 2-30 min, and then mixing at 1-5° C. for 2-30 min. This is because the HCR activity in solution 2 is in an activated state, and the direct addition of a negative synergist cannot inhibit the hybridization reaction that has occurred (i.e., the addition of a negative synergist in the activated state cannot inhibit the HCR product from becoming shorter, while the addition of a positive synergist in the inhibited state can allow the HCR product that has occurred to continue to react and become longer), so it is necessary to combine the annealing process so that the negative synergist probe can play a role.
[0096] In the method provided by the present invention, when sample is positive sample (i.e. containing target nucleic acid in sample), by the interaction of positive and negative synergistic factors in step (2) and step (3), the synergistic factor probe is made to change the promotion / inhibition of HCR activity, so that the detection signal (such as fluorescent signal, electric signal etc.) produced changes; and when sample is false positive sample (i.e. not containing target nucleic acid in sample but producing positive signal due to reasons such as probe non-specific interaction, probe decomposition), the synergistic factor probe will not make detection signal change for the change of HCR reaction activity. Whether sample is changed is judged to be false positive by detection signal. Therefore, in the method provided by the present invention, there is no particular requirement for the consumption of the synergistic factor probe used in step (2) and step (3), as long as the purpose of making HCR reaction activity change can be reached.
[0097] According to a preferred embodiment of the present invention, the amount of the synergistic factor probe used in step (3) is greater than or equal to the amount of the synergistic factor probe used in step (2).
[0098] The method provided by the present invention can identify any false positive results of nucleic acid detection caused by the causes of false positive signals in the prior art. According to a preferred embodiment of the present invention, wherein, in step (4), the false positive signal is derived from non-specific interaction of probe molecules and / or degradation of probe molecules.
[0099] By adjusting the labeling groups at both ends of the hairpin probe, any detection output signal currently available in the art for nucleic acid detection can be adapted for identification using the methods provided herein. Preferably, the detection output signal in steps (2)-(4) is selected from at least one of a fluorescence signal, a surface plasmon resonance signal, an electrical signal, a colorimetric signal, and a Raman spectroscopy signal.
[0100] According to a preferred embodiment of the present invention, the method further comprises repeating steps (3) and (4) to further verify the accuracy of the result. Figure 1 The schematic diagram of the method provided by the present invention is shown in FIG. Figure 1 It can be seen from the content that the repetition of steps (3) and (4) realizes the dynamic reversible regulation of false positive signal results in nucleic acid detection results by the method provided by the present invention, thereby making the identification results of false positive signals by the method provided by the present invention more accurate and reliable.
[0101] The solutions 1-3 used in the method provided by the present invention can be any buffer solution currently available in the art that is suitable for HCR, for example, a buffer (salt) solution with a pH of 5-10 and a concentration of 1-1000 mM.
[0102] Preferably, the solution can be a SPSC solution. The SPSC solution comprises: 40-60 mM Na2HSO4 and / or 40-60 mM NaH2SO4, 0.8-1.2 M NaCl, and a pH of 7-8. When both Na2HSO4 and NaH2SO4 are present in the SPSC solution, their concentrations are calculated based on the total salt concentration in the solution and the pH of the solution or obtained by looking up a table.
[0103] A fourth aspect of the present invention provides a kit for identifying false positive results of nucleic acid detection, wherein the kit comprises the reversible dynamic regulation biosensor as described above.
[0104] According to a preferred embodiment of the present invention, the biosensor in the kit comprises a hairpin probe and a cooperating factor probe.
[0105] Preferably, the hairpin probe and the synergistic factor probe are separately packaged and used in the kit.
[0106] More preferably, the hairpin probes include a hairpin probe H1 and a hairpin probe H2 that exist independently of each other, are packaged and used separately.
[0107] More preferably, the synergist probes include a positive synergist probe and a negative synergist probe that exist independently of each other, are packaged and used separately.
[0108] According to a preferred embodiment of the present invention, the kit may further include a solution required for detecting and identifying false positive signals in nucleic acid detection results, such as a buffer solution (such as SPSC solution).
[0109] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.
[0110] The probe molecules used in the following examples were designed based on the target nucleic acid and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The concentrations of the probes and target nucleic acids were quantified by UV spectrophotometry and adjusted with SPSC buffer.
[0111] The pH value of the SPSC buffer used in the following examples is 7.5, and its composition is: 50mM Na2HSO4 / NaH2SO4, 1MNaCl.
[0112] Example 1
[0113] The purpose of this example is to illustrate the dynamic reversible cycle regulation detection of target nucleic acid by the biosensor provided by the present invention.
[0114] 1. Preparation of biosensors
[0115] Based on the sequence characteristics of the target nucleic acid, hairpin probes H1 and H2 as well as positive and negative synergistic factor probes were designed on the basis of the classic hybridization chain reaction sequence. The specific sequences are shown in Table 1.
[0116] Table 1
[0117]
[0118] *In hairpin probe H2, the FAM group is attached to the underlined base" T ", the dabcy1 group is attached to the underlined base" T "superior.
[0119] 2. Optimization of positive synergistic factor probe length
[0120] Because the length of the positive cooperator probe is correlated with its hybridization ability with the H1 probe and detection sensitivity, the length of the positive cooperator probe was adjusted based on the target nucleic acid and hairpin probe sequences in Table 1. Positive coordinator probes of different lengths were designed (see Table 2 for details) to determine the optimal length of the positive coordinator probe. The negative cooperator probe sequence in Table 1 was used without corresponding length optimization.
[0121] Table 2
[0122] sequence name Sequence number Probe length Nucleotide sequence (5'-3') Positive cofactor probe 2 SEQ ID NO:6 8 GTATGAGC Positive cofactor probe 3 SEQ ID NO:7 11 GTCGTATGAGC Positive cofactor probe 4 SEQ ID NO:8 14 ATGGTCGTATGAGC
[0123] The positive synergist probes 2-4 (concentration 1 μM) in Table 2 and the hairpin probes H1 and H2 (concentration 5 nM) in Table 1 were used to detect the target nucleic acid (concentration 10 nM) in Table 1. The changes in the fluorescence signal intensity were detected by a Hitachi F7000 fluorescence spectrometer, and the detection results of the samples in the initial state of HCR were used as a control. Figure 2 .
[0124] The above fluorescence detection results were verified by gel electrophoresis. The specific method is: the positive synergistic factor probes 2-4 (concentration 1μM) in Table 2 and the hairpin probes H1 and H2 (concentration 1μM) in Table 1 were used to detect the target nucleic acid (concentration 100nM) in Table 1, and the analysis samples were separated by the DYY-6D Sanheng multi-purpose electrophoresis instrument of Beijing Liuyi Biotechnology Co., Ltd., and the raw material and reaction product band signals were detected by the Gel Doc XR+ gel imager of Bio-Rad, and the synergistic regulatory effects of positive synergistic factor probes of different lengths were compared. The results are shown in detail. Figure 3 .
[0125] according to Figure 2 and Figure 3 It can be seen that the positive synergist probe with a sequence length of 11 nt (positive synergist probe 3) has the best effect on promoting HCR reaction activity, the collected fluorescence signal is the strongest, and it has the highest sensitivity when used for identification of nucleic acid detection results.
[0126] 3. Optimization of synergistic factor probe concentration
[0127] Using the target nucleic acids (concentration 10 nM) listed in Table 1, the hairpin probes and synergist probes listed in Table 1 were used. By setting up different concentration gradients of the synergist probes and comparing their detection signal-to-noise ratios, the optimal concentration of the synergist probe in the detection system was determined. The specific method was the same as the method for optimizing the length of the positive synergist probe in fluorescence detection described above.
[0128] The concentration optimization results of the positive synergist probe are detailed in Figure 4 ,in Figure 4 A to Figure 4 Panel E shows the test results for positive synergistic factors of 50 nM, 100 nM, 200 nM, 500 nM, and 1000 nM, respectively. By comparison, it can be clearly seen that the HCR activation effect increases with the increase in the concentration of the positive synergistic factor. When the positive synergistic factor concentration increases from 50 nM to 1000 nM, the nucleic acid detection signal-to-noise ratio increases from 5.45 to 9.51. The signal-to-noise ratio of 5.45 is the initial signal-to-noise ratio.
[0129] The concentration optimization results of negative cooperating factor probes are detailed in Figure 5,in Figure 5 A to Figure 5 E shows the detection results when the negative synergistic factor is 50nM, 100nM, 200nM, 500nM, and 1000nM, respectively. By comparison, it can be clearly seen that the HCR inhibition effect increases with the increase of the negative synergistic factor concentration. When the negative synergistic factor concentration increases from 50nM to 1000nM, the nucleic acid detection signal-to-noise ratio decreases from 5.45 to 1.41.
[0130] The above detection results were verified by gel electrophoresis, which was the same method used in the aforementioned gel electrophoresis verification of the results of fluorescence detection of the optimization of the positive synergist probe length.
[0131] The results are shown in Figure 6 .from Figure 6 As can be seen from Figure A, as the concentration ratio of H1 to the positive synergist changes from 1:0 to 1:10, the HCR product gradually increases; on the contrary, as the concentration ratio of H1 to the negative synergist changes from 1:0 to 1:10, the HCR product gradually decreases.
[0132] 4. Verification of reversible regulation
[0133] By adding different amounts of synergistic factor probes into the system, the dynamic reversible regulation performance of the biosensor provided by the present invention was verified. The results are detailed in Figure 7 .
[0134] Figure 7 Figure A shows the change in HCR activity in the system when 1 μM positive synergist is added to the system to make the system present an HCR activated state. Two minutes later, 1 μM negative synergist probe, 2 μM negative synergist probe, and no negative synergist probe are added respectively. It can be seen that when an amount of negative synergist equal to the positive synergist is added, the HCR activity in the system recovers from the activated state to the initial state. If an excessive amount of negative synergist probe is added, the HCR activity in the system will enter the inhibitory state from the activated state.
[0135] Figure 7 B shows the change in HCR activity in the system when 1 μM negative synergist probe is added to the system to make the system present an HCR inhibition state. Two minutes later, 1 μM positive synergist probe, 2 μM positive synergist probe, and no positive synergist probe are added respectively. It can be seen that when an amount of positive synergist equal to the negative synergist is added, the HCR activity in the system recovers from the inhibition state to the initial state. If an excessive amount of positive synergist probe is added, the HCR activity will enter the activation state from the inhibition state.
[0136] Figure 7 C and Figure 7D shows the changes in fluorescence signals during the reversible multiple transitions of HCR from the inhibition state to the activation state during real-time fluorescence monitoring.
[0137] Figure 7 E shows the fluorescence signal changes caused by multiple transitions of HCR from the inhibition state to the initial state, to the activation state, and then back to the initial state and inhibition state.
[0138] 5. Construct a reversible dynamic control target nucleic acid detection curve
[0139] Method for constructing a reversible dynamic regulation target nucleic acid detection curve:
[0140] If the sample size is large, the following method can be used to construct the curve:
[0141] The sample was divided into three parts and tested with three H1 activity states respectively, and true and false positives were determined based on the fluorescence intensity.
[0142] Taking the starting point as the initial state as an example, the hairpin probes H1 and H2 (5 nM) in Table 1 were used to detect the target nucleic acids in Table 1 (different concentration gradients were set from 10 fM to 10 μM). The fluorescence signal intensity was detected by a Hitachi F7000 fluorescence spectrometer, and a detection curve showing the change in fluorescence intensity with the target nucleic acid concentration was constructed. By adding a positive synergist (1 μM) and a negative synergist (1 μM), target nucleic acid detection curves for the activated state and the inhibited state were constructed, respectively. When the other two active states were used as the starting point, except for the different starting states, all other operations were the same (annealing treatment was required when the starting point was the activated state).
[0143] If the sample size is small, the following two methods can be used to construct the curve:
[0144] (1) The starting point is the inhibition state: the negative synergist probe (concentration 1 μM) in Table 1 and the hairpin probes H1 and H2 (concentration 5 nM) in Table 1 are used to detect the target nucleic acid (concentration 10 fM-10 μM) in Table 1, and the fluorescence signal intensity is detected by a fluorescence spectrometer of the Hitachi F7000 model. 1 μM of the positive synergist probe is added to each target nucleic acid concentration sample and the fluorescence intensity is measured. Then, 1 μM of the positive synergist probe is continued to be added and the fluorescence intensity is measured. Three H1 active state target nucleic acid detection curves are constructed respectively.
[0145] (2) The starting point is the activated state: the positive synergist probe (concentration 1 μM) in Table 1 and the hairpin probes H1 and H2 (concentration 5 nM) in Table 1 are used to detect the target nucleic acid (concentration 10 fM-10 μM) in Table 1. The detection sample is annealed at high temperature. After the reaction, the fluorescence signal intensity is detected by a fluorescence spectrometer of Hitachi F7000 model. 1 μM negative synergist probe is added to each target nucleic acid concentration sample and the detection sample is annealed at high temperature to measure the fluorescence intensity. Then, 1 μM negative synergist probe is added and annealed at high temperature to measure the fluorescence intensity. Three H1 active state target nucleic acid detection curves are constructed respectively.
[0146] The results are shown in Figure 8 . Figure 8 A shows the nucleic acid detection curve when only the hairpin probe is added in the initial state without adding the coordination factor probe (middle curve), and the nucleic acid detection curve after adding the positive synergist and the negative synergist (left and right curves respectively). Figure 8 B is the gel electrophoresis verification result of the curve.
[0147] Figure 8 C shows the nucleic acid detection curves when the hairpin probe and the negative cofactor probe are added in the initial state (right curve), and the nucleic acid detection curves after adding equal and excess positive cofactors (middle and left curves, respectively). Figure 8 D is the gel electrophoresis verification result of the curve.
[0148] Figure 8 E shows the nucleic acid detection curves when the hairpin probe and the positive co-factor probe are added in the initial state (left curve), and the nucleic acid detection curves after adding equal and excess negative co-factors (middle and right curves, respectively). Figure 8 F is the gel electrophoresis verification result of this curve.
[0149] 6. Cyclic test results of the same sample
[0150] Unless otherwise specified in the following experiments, the target nucleic acid and biosensor sequences used are detailed in Table 1.
[0151] (1) Repeat the test five times for a target nucleic acid sample with a concentration of 100 nM.
[0152] The specific method is as follows: 100nM of the target nucleic acid sample in Table 1 is added to the positive synergist probe (concentration 1μM) in Table 1 and the hairpin probes H1 and H2 (concentration 5nM) in Table 1. The test sample is annealed at high temperature. After the reaction is completed, the first fluorescence intensity is measured by Hitachi F7000 fluorescence spectrometer. 1μM of the negative synergist probe is added to the test sample and the test sample is annealed at high temperature. After the reaction is completed, the second fluorescence intensity is measured. Then, 1μM of the negative synergist probe is added and annealed at high temperature. After the reaction is completed, the third fluorescence intensity is measured. Then, 1μM of the positive synergist probe is added. After the reaction is completed, the fourth fluorescence intensity is measured. Then, 1μM of the positive synergist probe is added. After the reaction is completed, the fifth fluorescence intensity is measured. See the test results for details. Figure 9 .
[0153] (2) Repeat the detection three times for the target nucleic acid at a concentration of 100 pM.
[0154] The specific method is as follows: the negative synergist probe (concentration 1μM) and the hairpin probes H1 and H2 (5nM) in Table 1 are used to detect 100nM of the target nucleic acid in Table 1. After the reaction is completed, the first fluorescence intensity is measured by a fluorescence spectrometer of Hitachi F7000 model. 1μM of the positive synergist probe is added to the test sample. After the reaction is completed, the second fluorescence intensity is measured. Then, 1μM of the positive synergist probe is added. After the reaction is completed, the third fluorescence intensity is measured. The test results are detailed in Figure 10 .
[0155] 7. False positive signal identification
[0156] In the following experiment, the standard process for determining disease markers in actual medical testing is simulated, and 1pM is defined as the threshold for positive and negative signals. Only when the response signal shows that the sample concentration is ≥1pM is the detection output signal of the sample defined as a "positive signal", otherwise it is a "negative signal".
[0157] (1) Identification of false positive signals caused by nonspecific interactions of probes
[0158] The complementary sequence C-H2 of the hairpin probe H2 (nucleotide sequence: CCCAGAGCAGAATTCAGCCAAACCCATCTCGGTTTGGCTGAATTCTGC, SEQ ID NO: 9) was introduced. The hybridization of H2 and C-H2 would trigger an enhancement of the fluorescence signal, which was used to simulate the false positive signal generated by the nonspecific interaction of the probe molecules.
[0159] The specific method is:
[0160] This experiment simulates the detection situation when there are sufficient samples. The process is as follows: Figure 11 B. The specific method is:
[0161] Control group: C-H2 with a concentration of 200 pM was used as the test sample and divided into three equal parts. Biosensors containing no synergistic factor probe, positive synergistic factor probe, and negative synergistic factor probe were added to the three parts respectively, and their fluorescence signals were detected.
[0162] Experimental group I: The treatment method is the same as the control group, except that the test sample is replaced with 3pM target nucleic acid.
[0163] Experimental group II: The treatment method is the same as the control group, except that the test sample is replaced with a mixed solution of 500fM target nucleic acid and 200pM C-H2 solution.
[0164] The results are shown in Figure 11 .
[0165] Figure 11 C shows the test results of the control group, in which the fluorescence values of the three tests were very different and almost unchanged, indicating that the sample did not contain the target nucleic acid. Figure 11 The fluorescence intensity in A showed that the signal intensity of the control group reached the positive standard, so it was determined to be a false positive sample.
[0166] Figure 11 D shows the test results of experimental group I, in which the fluorescence values of the three tests differ significantly, indicating that the sample contains the target nucleic acid. Figure 11 The fluorescence intensity and target nucleic acid concentration in A determined that the target nucleic acid concentration in experimental group I reached the positive standard, and thus it was determined to be a positive sample.
[0167] Figure 11 E shows the test results of experimental group II, in which the fluorescence values of the three tests differ significantly, indicating that the sample contains the target nucleic acid. Figure 11 The fluorescence intensity and target nucleic acid concentration in A determined that the target nucleic acid concentration in experimental group II did not meet the positive standard and was therefore determined to be a negative sample.
[0168] (2) Identification of false positive signals caused by probe degradation
[0169] EcoRI (purchased from Shanghai Pumai Biotechnology Co., Ltd., brand NEB) was used to cleave the GAATTC double-stranded partial sequence in the hairpin probe H2 to simulate the situation where the probe molecule degradation causes a false positive signal.
[0170] This experiment simulates the detection situation when the sample amount is small, and continuously detects the same sample. The process is as follows Figure 12 B. The specific method is:
[0171] Control group: 2U of EcoR I was used as the sample to be tested, and it was tested continuously. The HCR inhibition state was used as the starting point, and then the positive synergist probe was added twice in an amount twice, which was twice the amount of the negative synergist probe added at the starting point. The amount of the positive synergist probe added each time was 1 time, so that the HCR state of the system gradually changed to the initial state and the activated state, and its fluorescence signal was detected.
[0172] Experimental group I: The treatment method is the same as the control group, except that the test sample is replaced with 3pM target nucleic acid.
[0173] Experimental Group II: The treatment method is the same as the control group, except that the test sample is replaced with a mixed solution of 500 fM target nucleic acid and 2 U of EcoR I.
[0174] The results are shown in Figure 12 .
[0175] Figure 12 C shows the test results of the control group, in which the fluorescence values of the three tests were very different and almost unchanged, indicating that there was no target nucleic acid in the sample. Figure 12 The fluorescence intensity in A showed that the signal intensity of the control group reached the positive standard, so it was determined to be a false positive sample.
[0176] Figure 12 D shows the test results of experimental group I, in which the fluorescence values of the three tests differ significantly, indicating that the sample contains the target nucleic acid. Figure 12 The fluorescence intensity and target nucleic acid concentration in A determined that the target nucleic acid concentration in experimental group I reached the positive standard, and thus it was determined to be a positive sample.
[0177] Figure 12 E shows the test results of experimental group II, in which the fluorescence values of the three tests differ significantly, indicating that the sample contains the target nucleic acid. Figure 12 The fluorescence intensity and target nucleic acid concentration in A determined that the target nucleic acid concentration in experimental group II did not meet the positive standard and was therefore determined to be a negative sample.
[0178] 7. Biosensor sensitivity test
[0179] In the following experiments, unless otherwise specified, the sequences of target nucleic acids and biosensors used are shown in Table 1.
[0180] When the HCR inhibition state is taken as the starting point, a negative synergist probe is added to the starting system; when the HCR activation state is taken as the starting point, a positive synergist probe is added to the starting system; when the HCR initial state is taken as the starting point, no synergist probe is added to the starting system.
[0181] This experiment simulates the detection situation when the sample amount is small. The process is as follows: Figure 13 As shown in B: Prepare the sample according to Table 3, take the HCR activation state as the starting point, add the negative synergist probe twice as much as the positive synergist probe in the system at the starting point in two times, and add one time. Detect the fluorescence signal in the system and compare the changes in the fluorescence signal between each sample. Figure 13 .
[0182] It should be noted that since the starting point of this experiment is the activated state, that is, adding a negative synergist to the HCR product in the activated state cannot inhibit the hybridization reaction that has already occurred (adding a negative synergist to the activated state cannot inhibit the HCR product from becoming shorter, while adding a positive synergist to the inhibited state can allow the HCR product that has already occurred to continue the reaction and become longer), it needs to be combined with the annealing process. Figure 13 Compared with the background signal Figure 12 Significantly increased.
[0183] Table 3
[0184]
[0185] Figure 13 B shows the test results of sample 1, from which it can be seen that the difference between the fluorescence values obtained from the five tests of sample 1 is not large, indicating that sample 1 does not contain the target nucleic acid. Figure 13 As can be seen from A, the signal intensity in sample 3 reaches the positive standard, so it is determined to be a false positive sample.
[0186] Figure 13 C shows the test results of sample 2, from which it can be seen that the fluorescence values obtained from the five tests of sample 2 are significantly different, indicating that sample 2 contains the target nucleic acid. Figure 13 As can be seen from A, the target nucleic acid concentration in sample 2 reaches the positive standard, so it is judged as a positive sample.
[0187] Figure 13 D shows the test results of sample 3, from which it can be seen that the difference between the fluorescence values obtained from the five tests of sample 3 is quite obvious, indicating that the sample contains the target nucleic acid. Figure 13 As can be seen from A, the target nucleic acid concentration in sample 3 did not reach the positive standard, so it was judged as a negative sample.
[0188] Figure 13 E shows the test results of sample 4, from which it can be seen that the difference between the fluorescence values obtained from the five tests of sample 4 is quite obvious, indicating that the sample contains the target nucleic acid. Figure 13 As can be seen from A, the target nucleic acid concentration in sample 3 did not reach the positive standard, so it was judged as a negative sample.
[0189] Figure 13 F shows the test results of sample 5, from which it can be seen that the fluorescence values obtained from the five tests of sample 5 are quite different, indicating that sample 5 contains the target nucleic acid. Figure 13 As can be seen from A, the target nucleic acid concentration in sample 5 reaches the positive standard, so it is judged as a positive sample.
[0190] Example 2
[0191] The purpose of this example is to illustrate the dynamic reversible cycle regulation and detection effect of the biosensor provided by the present invention on other biological molecules bound to nucleic acid aptamers.
[0192] 1. Preparation of biosensors
[0193] according to Figure 14 The working principle shown in Figure A uses ATP and ATP aptamers as cooperative factor probes to construct a reversible dynamic control nucleic acid detection sensor. The specific sequences are detailed in Table 4.
[0194] The principle of ATP-activated HCR reaction in this nucleic acid detection sensor is as follows Figure 14 As shown in Figure 2, during the HCR reaction between H1b and H2b initiated by the target nucleic acid target b (Tb), an ATP nucleic acid aptamer sequence is inserted into the H1b loop. After Tb binds to H1b through a chain displacement reaction, the sequence released from H1b that hybridizes with H2b is not in a free state, but partially hybridizes with the ATP nucleic acid aptamer inserted into H1b, significantly reducing its reactivity with H2b. When ATP is added and binds to the ATP nucleic acid aptamer, the sequence released from H1b that hybridizes with H2b becomes free, ultimately improving the HCR reaction activity. Figure 14 C is the structural formula of Tb after hybridization with H1b in the absence of ATP simulation. It can be seen that the hybridization sequence released from H1b with H2b partially hybridizes with the ATP nucleic acid aptamer sequence inserted into H1b.
[0195] Table 4
[0196]
[0197] *In the hairpin probe H2b, the FAM group is attached to the underlined base" T ", the dabcy1 group is attached to the underlined base" T "superior.
[0198] Figure 14D shows the HCR process initiated by the target nucleic acid in the activated, initial, and inhibited states. The hybridization of the single-stranded ATP aptamer to the two ends of H1b increases H1b's stability, thereby reducing HCR reactivity. This reversible dynamic regulation principle can also be used to construct a reversible dynamic nucleic acid detection sensor, allowing repeated testing of nucleic acid samples to identify false positives.
[0199] 2. Nucleic acid sample detection and false positive identification test In the following experiment, the standard process for determining disease markers in actual medical testing is simulated, and 10pM is defined as the threshold for positive and negative signals. Only when the response signal shows that the sample concentration is ≥10pM is the detection output signal of the sample defined as a "positive signal", otherwise it is a "negative signal".
[0200] In the following experiments, the probes and target nucleic acid sequences used are shown in Table 4.
[0201] The complementary sequence C-H2b (nucleotide sequence: CCCAGAGCAGAATTCAGCCAAACCTTCCTCGGTTTGGCTGAATTCTGC, SEQ ID NO: 15) of the hairpin probe H2b was introduced. The hybridization of H2b and C-H2b would trigger an enhancement of the fluorescence signal, which was used to simulate the false positive signal generated by the nonspecific interaction of the probe molecules.
[0202] like Figure 15 The process shown in A simulates the situation of a small sample volume and performs continuous testing on the same sample. The specific method is:
[0203] In the control group, C-H2b at a concentration of 200 pM was used as the test sample. Starting from the initial HCR state, its fluorescence signal was measured. Then, 1 μM of the negative synergist probe Ib was added to inhibit the HCR state, and its fluorescence signal was measured. Next, 2 mM of the positive synergist probe Ab was added, and its fluorescence signal was measured.
[0204] Experimental group I: The treatment method is the same as the control group, except that the test sample is replaced with 25pM target nucleic acid.
[0205] Experimental group II: The treatment method is the same as the control group, except that the test sample is replaced with a mixed solution of 5 pM target nucleic acid and 200 pM C-H2 solution.
[0206] The results are shown in Figure 15 .
[0207] Figure 15B shows the test results of the control group, in which the fluorescence values of the three tests were very small and almost unchanged, indicating that the control group sample did not contain the target nucleic acid. However, the signal intensity of the control group sample reached the positive standard (specific standard is in Figure 15 Therefore, it was determined to be a false positive sample.
[0208] Figure 15 C shows the test results of experimental group 1, where the fluorescence values of the three tests differed significantly, indicating that the sample contained the target nucleic acid. Moreover, the target nucleic acid concentration in experimental group 1 reached the positive standard based on the fluorescence intensity and the concentration of the target nucleic acid, and thus the sample was determined to be positive.
[0209] Figure 15 D shows the test results for Experimental Group II. The fluorescence values for the three tests differed significantly, indicating that the sample contained the target nucleic acid. However, based on the fluorescence intensity and target nucleic acid concentration, the target nucleic acid concentration in Experimental Group II did not meet the positive criterion and was therefore classified as a negative sample.
[0210] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention. SEQUENCE LISTING <110> Jiaxing University <120> Reversible dynamic regulation biosensor and its application and method for reversible dynamic identification of nucleic acid detection results <130> I67057ZJXU <160> 13 <170> PatentIn version 3.5 <210> 1 <211> twenty four <212> DNA <213> SEQ ID NO: 1 <400> 1 gcagaattca gccaaaccga gatg 24 <210> 2 <211> 65 <212> DNA <213> SEQ ID NO:2 <400> 2 gcatctcggt ttggctgaat tctgcgctca tacgacccca gagcagaatt cagccaaacc 60 ctcta 65 <210> 3 <211> 48 <212> DNA <213> SEQ ID NO:3 <400> 3 gcagaattca gccaaaccga gatgggtttg gctgaattct gctctggg 48 <210> 4 <211> 25 <212> DNA <213> SEQ ID NO:4 <400> 4 gcatctcaac tctagtcgta tgagc 25 <210> 5 <211> 25 <212> DNA <213> SEQ ID NO:5 <400> 5 gctcatacga ctagagttga gatgc 25 <210> 6 <211> 11 <212> DNA <213> SEQ ID NO:7 <400> 6 gtcgtatgag c 11 <210> 7 <211> 14 <212> DNA <213> SEQ ID NO:8 <400> 7 atggtcgtat gagc 14 <210> 8 <211> 48 <212> DNA <213> SEQ ID NO:9 <400> 8 cccagagcag aattcagcca aacccatctc ggtttggctg aattctgc 48 <210> 9 <211> 24 <212> DNA <213> SEQ ID NO:10 <400> 9 gcagaattca gccaaaccga ggaa 24 <210> 10 <211> 81 <212> DNA <213> SEQ ID NO:11 <400> 10 cttcctcggt ttggctgaat tctgccctgg gggagtattg cggaggaagg cccagagcag 60 aattcagcca aacccaatac t 81 <210> 11 <211> 48 <212> DNA <213> SEQ ID NO:12 <400> 11 gcagaattca gccaaaccga ggaaggtttg gctgaattct gctctggg 48 <210> 12 <211> 27 <212> DNA <213> SEQ ID NO:14 <400> 12 acctggggga gtattgcgga ggaaggt 27 <210> 13 <211> 48 <212> DNA <213> SEQ ID NO:15 <400> 13 cccagagcag aattcagcca aaccttcctc ggtttggctg aattctgc 48
Claims
1. A reversible dynamic regulation biosensor, characterized in that: The biosensor includes a hairpin probe and a co-factor probe; Wherein, the hairpin probe includes a hairpin probe H1 and a hairpin probe H2 that exist independently of each other; The hairpin probe H1 includes six parts: H1a, H1b, H1c, H1d, H1e and H1f, wherein H1b and H1d are complementary to form a double strand as the stem of the H1 hairpin structure, H1c and H1e form the loop of the H1 hairpin structure, and H1a and H1b are complementary to the target nucleic acid; The hairpin probe H2 includes four parts: H2a', H2b', H2c' and H2d', wherein H2b' and H2d' complement each other to form a double strand as the stem of the H2 hairpin structure, and H2a' forms the loop of the H2 hairpin structure; H2a' and H2b' in the hairpin probe H2 are complementary to H1a and H1b in the hairpin probe H1, respectively; H2c' and H2d' in the hairpin probe H2 are complementary to H1c and H1d in the hairpin probe H1, respectively; The synergistic factor probes include a positive synergistic factor probe and a negative synergistic factor probe, and the sequences of the positive synergistic factor probe and the negative synergistic factor probe are completely complementary; The positive synergistic factor probe includes two parts, A1 and A2; A1 is complementary to H1e in sequence and activates H1 activity; The negative cooperating factor probe includes two parts, I1 and I2; I2 is complementary to the sequences of H1a and H1f, inhibiting H1 activity; The positive synergist probe and the negative synergist probe exist independently of each other.
2. The biosensor according to claim 1, wherein In the hairpin probe H1 and / or H2, the stem portion is 5-50 bp in length; And / or, in the hairpin probe H1 and / or H2, the number of bases in the loop portion is 5-50 nt.
3. The biosensor according to claim 1, wherein The sequences of A1 and I1 are complementary; And / or, A2 is complementary to I2 in sequence.
4. The biosensor according to claim 1, wherein The two ends of the hairpin probe H1 are respectively labeled with a signal generating group and a signal quenching group; And / or, both ends of the hairpin probe H2 are labeled with a signal generating group and a signal quenching group, respectively.
5. The biosensor according to claim 4, wherein The signal generating group generates at least one of a fluorescence signal, a surface plasmon resonance signal, an electrical signal, a colorimetric signal, and a Raman spectroscopy signal. The biosensor according to claim 5 , wherein: The signal generating group is a fluorescent group.
7. The biosensor according to claim 5, wherein The fluorescent group is FAM.
8. The biosensor according to claim 4, wherein The quenching group is dabcy1.
9. The biosensor according to claim 1, wherein The hairpin probe H1, hairpin probe H2, positive cooperating factor probe and negative cooperating factor probe are selected from at least one of a DNA probe, an RNA probe, a locked nucleic acid probe or a peptide nucleic acid probe.
10. The biosensor according to claim 1, wherein The nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO: 2, the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO: 3, the nucleotide sequence of the positive synergistic factor probe is shown in SEQ ID NO: 4, and the nucleotide sequence of the negative synergistic factor probe is shown in SEQ ID NO:
5.
11. Use of the biosensor according to any one of claims 1 to 10 in identifying nucleic acid detection results, wherein the application is a non-diagnostic application.
12. Use of the biosensor according to any one of claims 1 to 10 in identifying false positive results of nucleic acid detection, wherein the application is a non-diagnostic application.
13. A method for reversibly and dynamically identifying nucleic acid detection results using the biosensor according to any one of claims 1 to 10, wherein the method is a non-diagnostic method, characterized in that: The method comprises the following steps: (1) first mixing the target nucleic acid with the hairpin probes H1 and H2 to obtain a solution 1, and collecting a detection output signal 1 of the solution 1; (2) performing a second mixing of solution 1 and one of the synergistic factor probes to obtain solution 2, and collecting a detection output signal 2 of solution 2; (3) mixing solution 2 with another of the synergistic factor probes for a third time to obtain solution 3, and collecting a detection output signal 3 of solution 3; (4) Compare the detection output signal 1, the detection output signal 2, and the detection output signal 3. If the detection output signal intensities are different, the target nucleic acid detection result is positive. If the detection output signal intensities are the same, the target nucleic acid detection result is a false positive.
14. The method according to claim 13, wherein In step (1), in the solution 1, the concentration of the target nucleic acid is 1 aM-10 μM, the concentration of the hairpin probe H1 is 1 nM-20 μM, and the concentration of the hairpin probe H2 is 1 nM-20 μM; and / or, in step (2), the amount of the synergistic factor probe used is such that the concentration of the synergistic factor probe in the solution 2 is 1 nM-20 μM; and / or, in step (3), the amount of the synergistic factor probe used is such that the concentration of the synergistic factor probe in solution 3 is 1 nM-20 μM; And / or, in step (4), the false positive signal is derived from non-specific interaction of probe molecules and / or degradation of probe molecules.
15. The method according to claim 13 or 14, wherein: In step (1), the target nucleic acid is selected from at least one of DNA, RNA, and a biological molecule that binds to a nucleic acid aptamer.
16. The method according to claim 15, wherein The biomolecule is selected from at least one of proteins, exosomes and cells.
17. The method according to claim 13 or 14, wherein: The method further includes repeating steps (3) and (4) to further verify the accuracy of the results.
18. The method according to claim 13, wherein The detection output signal in steps (2)-(4) is selected from at least one of a fluorescence signal, a surface plasmon resonance signal, an electrical signal, a colorimetric signal, and a Raman spectroscopy signal.
19. A kit for identifying false positive results of nucleic acid detection, characterized in that: The kit comprises the reversible dynamic regulation biosensor according to any one of claims 1 to 10.
Citation Information
Patent Citations
Nucleic acid analyzing method based on cascade HCR (hybridization chain reaction)
CN107574227A
Method and kit for label-free fluorescence detection gene
CN109957608A