Biomarkers, kits and drugs for anxiety and depression-related diseases

Abstract

The present invention relates to biomarkers, kits and drugs for anxiety and depression-related diseases. The present invention provides a biomarker for anxiety and depression-related diseases, wherein the marker is miRNA-344-5p or circRNA_3476, and provides a kit capable of measuring the expression level of the above marker, as well as the use of the above marker and screening drugs for treating stress-related diseases. The present invention provides a new pathological mechanism for anxiety and depression-related diseases, provides a new target for preventing or treating stress-related diseases, and provides a new detection method for diagnosing anxiety and depression-related diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to drugs, biomarkers and kits for anxiety and depression-related diseases. Background Art

[0002] With the rapid development of social economy and the accelerated pace of people's lives and work, the living and working environment faced by human beings has become increasingly complex. Negative stress life events (experiences) including unemployment, heartbreak, work pressure, and low economic income have become important environmental factors affecting the physical and mental health of individuals. Although a large number of studies have confirmed that stress, especially chronic stress, is an important cause of stress-related diseases including depression and anxiety, the pathogenesis of stress-related diseases has not yet been fully elucidated, which has become a key bottleneck restricting the effective prevention and treatment of the above diseases.

[0003] Stress stimulation can cause the body's stress response, which can change the expression of specific functional genes, trigger the body's neural-endocrine-immune system's homeostasis imbalance, and lead to changes in the body's behavioral phenotype. A large number of studies have shown that changes in gene epigenetic modifications (DNA methylation, histone modification, non-coding RNA, chromatin remodeling, etc.) are closely related to the occurrence and development of stress response and depression, as well as the efficacy of antidepressant drugs. Non-coding RNA (ncRNA), an important class of epigenetic regulatory molecules highly expressed in the central nervous system, includes microRNA (miRNA), long non-coding RNA (lncRNA) and circular RNA (circRNA), which can regulate gene expression by affecting the function of mRNA, DNA methylation or histone modification, and play an important regulatory role in maintaining individual brain development and brain function. It is also closely related to the generation of stress effects and the onset of many neuropsychiatric diseases. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art, provide biomarkers and diagnostic kits for anxiety and depression-related diseases, provide assistance for early clinical discovery of anxiety and depression-related diseases, and provide a drug for treating anxiety and depression-related diseases.

[0005] The specific technical solutions of the present invention are as follows:

[0006] One aspect of the present invention provides a biomarker for anxiety and depression-related diseases, wherein the marker is miRNA-344-5p or circRNA_34764.

[0007] Specifically, the nucleotide sequence of circRNA_34764 is shown in SEQ ID No.1.

[0008] Specifically, the nucleotide sequence of the miRNA-344-5p is shown in SEQ ID No.2.

[0009] Another aspect of the present invention provides a diagnostic kit for anxiety and depression-related diseases, which can measure the expression level of miRNA-344-5p or circRNA_34764 in a sample.

[0010] As some preferred embodiments of the present invention, they contain primer probes of miRNA-344-5p or circRNA_34764, the primer probe sequence of miRNA-344-5p is shown as SEQ ID No.3, and the primer probe sequence of circRNA_34764 is shown as SEQ ID No.4.

[0011] In another aspect, the present invention provides the use of miRNA-344-5p or circRNA_3476 in screening therapeutic drugs for anxiety and depression related diseases.

[0012] As some preferred embodiments of the present invention, the application is to use miRNA-344-5p or circRNA_34764 as a marker to screen therapeutic drugs for anxiety and depression related diseases.

[0013] As some preferred embodiments of the present invention, the application is to screen therapeutic drugs for anxiety and depression-related diseases using a kit capable of determining the expression level of miRNA-344-5p or circRNA_34764 in a sample.

[0014] In another aspect, the present invention provides the use of a miRNA-344-5p inhibitor or a circRNA_34764 agonist in the preparation of a therapeutic drug for anxiety and depression-related diseases.

[0015] The above-mentioned anxiety and depression-related diseases include depression, anxiety disorders and memory impairment.

[0016] The beneficial effects of adopting the above technical solution are:

[0017] The present invention verifies through experiments that circRNA_34764 (also called circSYNDIG1) can improve stress-induced abnormal behavior of mice by enhancing cell activity and increasing the density of neuronal dendritic spines. CircSYNDIG1 absorbs miR-344-5p, inhibiting the harmful effects of miR-344-5p in downregulating cell activity and dendritic spine density, thereby improving depression-like and anxiety-like behaviors and memory impairment in mice.

[0018] The research results of the present invention provide a new pathological mechanism for the occurrence of anxiety and depression related diseases, provide a new target for the prevention or treatment of anxiety and depression related diseases, and provide a new detection method for the diagnosis of anxiety and depression related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for use in the specific implementation or the description of the prior art are briefly introduced below.

[0020] Figure 1 This is a graph showing down-regulation of circSYNDIG1 expression in the hippocampus of mice in the chronic mild stress model (CMS) and its correlation with abnormal behaviors;

[0021] In the figure: A is a timetable for CMS treatment and behavioral test procedures; B is a bar graph of the central residence time in the open field test of the stress-susceptible group mice and the normal control group mice; C is a bar graph of the feeding latency in the novel environment inhibition feeding test of the stress-susceptible group mice and the normal control group mice; D is a bar graph of the sucrose water preference in the sucrose preference test of the stress-susceptible group mice and the normal control group mice; E is a bar graph of the floating immobility time in the forced swimming test of the stress-susceptible group mice and the normal control group mice; F is a bar graph of the expression of circSYNDIG1 in the hippocampus of the stress-susceptible group and the normal group determined by qRT-PCR method; G is a correlation diagram of the relative expression of circSYNDIG1 and the floating immobility time in the FST test of the model mice; H is a correlation diagram of the relative expression of circSYNDIG1 and the feeding latency of the NSF model mice;

[0022] Figure 2 The abnormal behavior of mice with corticosterone (CORT) depression model and the down-regulation of circSYNDIG1 expression in the hippocampus;

[0023] In the figure: A is the timetable of HT-22 cells receiving CORT treatment program; B is the timetable of mice receiving CORT treatment program; C is a bar graph of cell activity of HT-22 cells treated with different doses of CORT for 24 hours; D is a bar graph of circSYNDIG1 expression levels in HT-22 cells treated with 300 μM CORT for 24 hours and the normal control group; E is a bar graph of circSYNDIG1 expression in the hippocampus of the corticosterone group and the vehicle group determined by qRT-PCR method; F is a bar graph of floating immobility time in the FST test of the CORT-treated group and the normal group; G is a bar graph of NSF feeding latency in the corticosterone group and the vehicle group; H is a correlation diagram of the relative expression level of circSYNDIG1 and the immobility time of the FST test of the model mice; I is a correlation diagram of the relative expression level of circSYNDIG1 and the feeding latency of the NSF of the model mice.

[0024] Figure 3 Abnormal behavior of mice treated with LPS and down-regulation of circSYNDIG1 expression in the hippocampus

[0025] In the figure: A is the timetable of LPS treatment procedure; B is the bar graph of open field test of mice in endotoxin group and vehicle group; C is the bar graph of floating immobility time in FST test of mice in endotoxin group and vehicle group; D is the bar graph of circSYNDIG1 expression in hippocampus of endotoxin group and vehicle group determined by qRT-PCR method; E is the correlation diagram of relative expression of circSYNDIG1 and floating immobility time of FST test of model mice; F is the correlation diagram of relative expression of circSYNDIG1 and central residence time of OTF of model mice;

[0026] Figure 4 Overexpression of circSYNDIG1 in the hippocampus can improve abnormal behaviors of mice induced by chronic mild stress (CMS);

[0027] In the figure: A is the experimental procedure timetable, adeno-associated virus packaged with circSYNDIG1 overexpression plasmid or control plasmid was microinjected into the mouse hippocampus, CMS modeling was performed, and the weight changes of mice were monitored and the behavior of mice was observed; B is a fluorescence image of circSYNDIG1 overexpressed in the mouse hippocampus; C is a comparative bar graph of circSYNDIG1 expression levels in the negative control group and the injection group determined by the qRT-PCR method; D is a comparative bar graph of mouse weight changes; E is a comparative bar graph of the central residence time of mice in the open field test; F is a comparative bar graph of the distance of mice in the open field test; G is a comparative bar graph of the feeding latency of mice in the novel environment suppression feeding test, and H is a comparative bar graph of the return to cage food intake of mice in the novel environment suppression feeding test; I is a comparative bar graph of the sugar water preference rate of mice in the sugar water preference test; J is a comparative bar graph of the total drinking amount of mice in the sugar water preference test; K is a comparative bar graph of the immobility time of mice in the tail suspension test; L is a comparative bar graph of the latency of mice in the tail suspension test; M is a comparative bar graph of the new object recognition rate of mice in the new object recognition test.

[0028] Figure 5 Overexpression of circRNA in the hippocampus can reverse the abnormal behavioral phenotype of mice induced by miR-344-5p;

[0029] In the figure: A is a timetable for the cell experiment procedure; B is a sequence comparison of miR-344-5p and circSYNDIG1; C is a bar graph of cell activity overexpressing miR-344-5p detected by CCK-8; D is a timetable for the experiment procedure; E is a bar graph comparing the central residence time of mice in the open field test; F is a bar graph comparing the moving distance of mice in the open field test; G is a bar graph comparing the feeding latency of mice in the novel environment suppression feeding experiment, and H is a bar graph comparing the feeding amount of mice in the novel environment suppression feeding experiment; I is a bar graph comparing the immobility time of mice in the forced swimming test; J is a bar graph comparing the immobility latency of mice in the forced swimming test; K is a bar graph comparing the recognition rate of mice in the novel object recognition experiment. DETAILED DESCRIPTION

[0030] In order to make the objectives, technical solutions and advantages of the present invention more clear, the present invention is clearly and completely described below in conjunction with specific embodiments.

[0031] In this example, the mice used were 7-week-old male ICR mice purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The evaluation and detection methods used were as follows:

[0032] 1. The depressive-like behavior of mice was evaluated by sucrose preference test (SPT), tail suspension test (TST) and forced swimming test (FST).

[0033] 2. The anxiety-like behavior of mice was evaluated by open field test (OFT) and novelty suppressed feeding test (NSF).

[0034] 3. Evaluate the memory ability of mice through the novel object recognition test (NOR).

[0035] 4. The expression changes of circSYNDIG1 were determined by qRT-PCR.

[0036] 5. The CCK-8 method was used to detect the effects of corticosterone treatment / overexpression of circSYNDIG1 and / or / miR-344-5p on HT-22 cell proliferation and cell activity.

[0037] 6. Adeno-associated virus was microinjected into the brain stereotaxically to specifically overexpress circSYNDIG1 and / or miR-344-5p in the mouse hippocampus.

[0038] 7. Use the neuronal Golgi staining method to detect the density of neuronal dendritic spines.

[0039] The steps and operations of the above method are as follows:

[0040] 1. Open field test (OFT)

[0041] The test was conducted in a black opaque open box (40cm×40cm x 35cm) with a light intensity of 20lx. During the test, the mice were placed in the central area of ​​the open field (15cm x 15cm) and allowed to move freely for 5 minutes. During this period, the central residence time (second) and total activity distance (cm) of the mice were recorded using the animal behavior tracking and analysis system (Smart 3.0). After each mouse test, the bottom and inner wall of the box were wiped with 75% alcohol before the next mouse test.

[0042] 2. Novelty suppressed feeding test (NSF)

[0043] The test equipment is a black opaque open box (40cm×40cm x 35cm) with a pellet of mouse food placed in the center. After the mice have fasted for 24 hours, the test begins. The mice are placed in the box from one side, and the time from the mice entering the venue to the time they start to eat the pellets (feeding latency) is recorded. Then, the mice are placed in cages individually, and the weight of pellets consumed within 10 minutes in the cage is recorded to exclude the interference of different hunger levels of the mice on the feeding latency. After each mouse test, wipe the bottom and inner wall of the box with 75% alcohol before testing the next mouse.

[0044] 3. Sucrose preference test (SPT)

[0045] Two days before the experiment, two bottles of 1% sucrose water were given to each cage to adapt them to two bottles of drinking water and the perception of sweetness. The mice were fasted from water for 24 hours before the test. After the test began, the mice were housed in individual cages, and each cage was given one bottle of 1% sucrose water and one bottle of plain water. The positions of the water bottles were exchanged 12 hours after the start of the test. The consumption of the two bottles of water (g) was calculated by weighing 24 hours after the test. Sugar water preference rate = sugar water consumption / (sugar water consumption + plain water consumption) x 100%, total water intake = sugar water consumption + plain water consumption.

[0046] 4. Forced swimming test (FST)

[0047] The experiment was conducted in a transparent water tank 40 cm high and 20 cm in diameter, with a water depth of 25 cm and a water temperature of 23-25°C. The mice were placed in the water at the beginning of the experiment for a total of 6 minutes. The time from entering the water to floating immobile (immobility latency) and the time the mice floated immobile (immobility time) were recorded. The standard for floating immobility was set as the mouse floating on the water surface and only performing necessary activities to maintain the body floating state.

[0048] 5. Tail suspension test (TST)

[0049] Fix the mouse with white tape 1 cm from the tail tip and hang it on a hook. Time for 6 minutes and record the time from the beginning of hanging to the end of struggling (immobility latency) and the total time the mouse hangs immobile (immobility time).

[0050] 6. Novel Object Recognition Test (NOR) The NOR equipment is a black opaque open box (40cm×40cm x 35cm), involving 3 steps: ① Adaptation: Let the mice explore freely in the venue for 5 minutes every day for 2 days. ② Training: 24 hours after adaptation, each mouse is placed in the same position in the venue, facing two identical objects, and the time is counted for 5 minutes. ③ Testing: 24 hours after training, each mouse is placed in the same position and faces the test area in the same direction. The objects in the test area are changed to a familiar object and a new object. The behavior of the animals is recorded by a camera, and an experienced observer records the exploration time of the mice on the two objects. Exploration is defined as sniffing or touching an object with the nose and / or forehead. Sitting or crossing an object is not considered exploratory behavior. Novel object recognition rate (%) = (time spent exploring new objects / total exploration time) x 100%.

[0051] 7. Detection of RNA expression level by quantitative real-time PCR (qRT-PCR)

[0052] 7.1 Extraction of total RNA:

[0053] (1) Cells: Add 1000 μL RNA trizol lysis buffer to the cell culture flask, shake slowly on a shaker for 5 to 10 minutes, then place on ice for 5 minutes, and collect the lysate into a 1.5 mL nuclease-free centrifuge tube.

[0054] Hippocampal tissue: Place the hippocampal tissue in a 2 ml nuclease-free centrifuge tube, add 1000 μL RNA trizol lysis buffer, then add 2 beads (2 mm in diameter), and use a tissue homogenizer at 70 Hz for 60 s to homogenize.

[0055] (2) Add 200 μL of chloroform to the cell / tissue lysate, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes.

[0056] (3) Centrifuge at 4°C, 12,000 g for 15 min and the solution will separate into three layers.

[0057] (4) Use a pipette to transfer the upper aqueous phase (about 500 μL) into a new centrifuge tube without nuclease, add 1.5 times the volume of anhydrous ethanol, and vortex to mix.

[0058] (5) Place the RNeasy spin column on a 2 mL collection tube, transfer the mixed solution (<700 μL / time) into it, centrifuge at 8000 g for 15 s at room temperature, and discard the filtrate.

[0059] (6) Add 800 μL of Buffer RWT and centrifuge at room temperature, 8000 x g, 15 s, and discard the filtrate.

[0060] (7) Add 500 μL of Buffer RPE and centrifuge at room temperature, 8000 x g, 15 s, and discard the filtrate.

[0061] (8) Add 500 μL of Buffer RPE and centrifuge at room temperature, 8000 x g, 15 s, and discard the filtrate.

[0062] (9) Place the spin column in a new 2 mL collection tube and centrifuge at 13,000 g for 1 min at room temperature. Discard the filtrate.

[0063] (10) Place the centrifuge column in a new 1.5 mL nuclease-free centrifuge tube and add 20 μL of RNase-free water to the center of the centrifuge column. After standing at room temperature for 1 min, centrifuge at 10,000 g for 1 min. The filtrate is the extracted RNA and is stored at -80°C.

[0064] 7.2 RNA Identification and Quantification

[0065] Take 2 μg of RNA extracted in the previous step and identify the integrity of RNA by agarose gel electrophoresis. The intact total RNA will produce clear 28S and 18S rRNA bands when subjected to denaturing gel electrophoresis. The intensity of the 28S rRNA band should be roughly twice that of the 18SrRNA band. The extracted RNA is quantified using a nucleic acid quantifier to obtain the RNA concentration, and the OD260 / 280 ratio is in the range of 1.8 to 2.0, indicating that the obtained RNA is of high purity and can be used for subsequent experiments.

[0066] 7.3 RNA Reverse Transcription

[0067] The reaction system was mixed according to the instructions of the Thermo Fisher reverse transcription kit. The components were formulated as follows:

[0068] RNA 5 μg

[0069] Random Primer 1μl

[0070] Make up to 12 μl with water

[0071] Place the above system in a PCR instrument at 65°C for 5 minutes and immediately take it out and place it on ice, then continue to add the following reagents:

[0072]

[0073] The above reaction system was placed in a PCR instrument for reverse transcription reaction under the following conditions:

[0074] 25℃,5min

[0075] 42℃,60min

[0076] 70℃,5min

[0077] After the procedure, place on ice immediately and store at -20℃

[0078] 7.4 Real-time quantitative PCR

[0079] Dilute the reverse transcription product 5 times and prepare the reaction system:

[0080]

[0081] After centrifugation and mixing, real-time quantitative PCR reaction was performed. The reaction conditions were as follows:

[0082]

[0083]

[0084] β-actin was used as the internal reference, and the relative quantitative analysis was performed using the ΔCt=Ct target-Ct internal reference method. The relative expression of genes was expressed as 2 -ΔCt express.

[0085] 8. Nucleus localization surgery and adeno-associated virus nucleus microinjection

[0086] After isoflurane anesthesia, the mice were placed on a brain stereotaxic instrument (prone position), fixed in the horizontal direction with ear bars, the skull was exposed, and the target brain area was located using computer software. A capillary glass needle sucked AAV virus / miRNA and connected to the injection pump, and injected at a rate of 0.1μl / min for 8min and stayed for 8min. After the operation, the mice were kept in a single cage and given penicillin to prevent infection.

[0087] 9. Cell Culture

[0088] Cell culture uses DMEM high-glucose medium containing double antibodies (penicillin and streptomycin) and 10% fetal bovine serum. Cells are cultured in a cell culture incubator at 37°C and 5% CO2. The cell culture medium is replaced every 2-3 days. After the cells grow to 70-80%, they are digested and passaged with 0.25% trypsin (keep at room temperature before use). When passaged, first rinse the adherent cells twice with PBS, then add 0.25% trypsin, place the cell culture flask under an inverted microscope for observation, and after most of the cells shrink and shorten under the microscope, remove the trypsin. Then add DMEM high-glucose cell culture medium containing 10% FBS and double antibodies to terminate the action of trypsin, use a pipette to gently blow the adherent cells, blow off the cells, and passage the cells to a new culture flask in proportion.

[0089] 10. Cell Transfection

[0090] (1) The cells were seeded at an appropriate density in a cell culture dish and cultured in an incubator for 24 h. When the cells adhered to the wall and grew to a density of 60% to 80%, transfection was performed.

[0091] (2) The plasmid was diluted to a certain concentration with Opti-MEM culture medium without antibiotics, and Lipofectamine 2000 was diluted to a certain concentration with Opti-MEM culture medium without antibiotics. After standing for 5 minutes, the two were mixed and allowed to stand at room temperature for 10 minutes.

[0092] (3) Wash the cells once with autoclaved PBS, add Opti-MEM culture medium and plasmid liposome complex in sequence, mix well, and continue to culture in the incubator.

[0093] (4) 6 hours after transfection, the culture medium was replaced with 3% FBS DMEM high-glucose culture medium. The cells were collected after culturing for another 24 hours; or the cells were collected after drug stimulation for another 24 hours.

[0094] 11. CCK-8 detection of cell proliferation

[0095] (1) The cells were seeded in a 96-well plate at a density of 1x105 / ml, with 100 μL per well.

[0096] (2) After 24 hours, the cells grew to about 70% and were transfected with circSYNDIG1

[0097] (3) Add Veh / CORT (300 μM) 24 h after transfection

[0098] (4) After 24 hours of Veh / CORT treatment, add 10 μL of CCK-8 solution to each well.

[0099] (5) Incubate the culture plate in an incubator for 2 hours.

[0100] (6) Measure the absorbance at 450 nm using an enzyme-labeled instrument.

[0101] 12. Golgi staining of neurons

[0102] (1) Routinely anesthetize the animal by perfusion with 4% paraformaldehyde

[0103] (2) Immediately and carefully remove the brain tissue and soak it in paraformaldehyde at 4°C for 24 h.

[0104] (3) Carefully transfer to a mixture containing 10 ml of GENMED Fixative Solution (Reagent A) and 10 ml of GENMED Fixative Solution B (Reagent B) (20 ml / 2 tissue blocks)

[0105] (4) Incubate at room temperature for 2 weeks, away from light

[0106] (5) Wash with PBS and carefully transfer to a 30% sucrose solution prepared by the user

[0107] (6) Incubate at 4°C for 48 hours, or until the tissue sinks to the bottom, away from light (note: not more than one week).

[0108] (7) Remove the tissue block and slice it with an oscillating method (environment: 6% sucrose solution) to a thickness of 80-100 μm. Spread the slices on gelatinized slides. After the slides are basically dry, soak them in 6% sucrose solution.

[0109] (8) Clean with Reagent G for 3 minutes

[0110] (9) Carefully add 500 μl of GENMED staining solution (Reagent H) and cover the entire surface of the slice sample.

[0111] (10) Incubate at room temperature for 30 minutes

[0112] (11) Carefully remove the GENMED staining solution (Reagent H) from the slices.

[0113] (12) Carefully place the slices in 50 ml of GENMED cleaning solution (Reagent G) and incubate for 3 min at room temperature (Note: Gently stir repeatedly to ensure thorough cleaning).

[0114] (13) Carefully remove the GENMED cleaning solution (Reagent G) from the slices.

[0115] (14) Carefully add 500 μL of GENMED colorimetric working solution to cover the entire surface of the slice sample (prepare a 20-mL plastic bottle, add 10 mL of user-prepared deionized water, then add 5 mL of GENMED colorimetric solution A (Reagent I) and GENMED colorimetric solution B (Reagent J) respectively, mix well, mark as GENMED colorimetric working solution (effective for 10 days), and avoid light)

[0116] (15) Incubate at room temperature for 10-30 minutes until the tube turns black, then stop immediately and avoid exposure to light (Note: You can observe under a microscope during this period)

[0117] (16) Carefully remove the GENMED color development solution from the slice

[0118] (17) Carefully place the slices in 50 ml of GENMED clearing solution (Reagent G) and incubate for 3 min at room temperature.

[0119] (18) Carefully remove the GENMED cleaning solution (Reagent G) from the slices.

[0120] (19) Transparent treatment (50%, 70%, 80%, 90%, 95%, 100% ethanol for 1 min each, xylene for 2 h)

[0121] (20) Place a cover glass or sealant (neutral resin)

[0122] (21) The density of dendritic spines was analyzed using Fiji software and the observations were taken under an oil microscope.

[0123] 2.7 Fluorescence in situ hybridization (FISH)

[0124] (1) Tissue fixation: The mouse brain tissue after perfusion was removed and placed in in situ hybridization fixative for >12 h.

[0125] (2) Dehydration: After fixation of the brain tissue, the following steps are performed: gradient alcohol dehydration, wax immersion, and embedding.

[0126] (3) Slicing: Slice with a slicer, scoop out slices with a slicer, and bake at 62°C for 2 hours.

[0127] (4) Dewaxing: Place the sections in xylene (#1) for 15 minutes, xylene (#2) for 15 minutes, anhydrous ethanol (#1) for 5 minutes, and anhydrous ethanol (#2) for 5 minutes, dry them, and place them in DEPC water for later use.

[0128] (5) Digestion: Depending on the length of fixation time, the slices were boiled in the repair solution for 10-15 minutes and cooled naturally. Circles were drawn with a gene pen. According to the different characteristics of different tissues and indicators, proteinase K (20ug / ml) was added and digested at 37°C for 15 minutes. Washed once with pure water and 5 minutes × 3 times with PBS.

[0129] (6) Prehybridization: Add prehybridization solution and incubate at 37°C for 1 h.

[0130] (7) Hybridization: Remove the pre-hybridization solution, add hybridization solution containing the probe, and hybridize overnight at a constant temperature of 42°C.

[0131] (8) Post-hybridization washing: wash in 2×SSC at 37°C for 10 min, wash in 1×SSC at 37°C for 5 min×2, and wash in 0.5×SSC for 10 min.

[0132] (9) DAPI counterstaining of nuclei: add DAPI staining solution, incubate in the dark for 8 min, rinse, add anti-fluorescence quenching sealing agent, and seal the slide.

[0133] (10) Microscopic examination: The sections were observed and images were collected under an upright fluorescence microscope.

[0134] Example 1 Behavioral differences between chronic stress model mice and normal control mice and the accompanying expression of circRNA in the hippocampus

[0135] 1. Establishment of the mouse chronic mild stress model (CMS) and experimental methods

[0136] After purchase, 7-week-old male mice were first acclimated for 5 days, and the breeding environment was controlled at: temperature (23±2)℃, humidity 40-60%, light-dark cycle (bright 20:00-8:00 / dark 8:00-20:00). They then received 28 days of mild stress treatment: mice were randomly given 2 types of stress every day: 24 hours of tilted empty cages; 24 hours of fasting; 24 hours of water deprivation; 5 minutes of ice water swimming; 24 hours of wet bedding environment; 24 hours of crowded environment; 2 hours of restraint; 2 minutes of tail clamping; 24 hours of day and night reversal; 10 minutes of cold stimulation. Continue for 4 weeks. The mice in the normal control group were placed in another room and raised normally for 4 weeks. After 4 weeks, behavioral tests such as OFT, NSF, SPT, and FST were performed, and finally the mouse hippocampus was taken for subsequent experiments. The experimental procedure schedule is as follows Figure 1 shown.

[0137] 2. Experimental results

[0138] (1) By Figure 1 As shown in B-1E, behavioral tests proved that the chronic mild stress (CMS) model had been established.

[0139] (2) Figure 1 As shown in F, the expression of circSYNDIG1 in the hippocampus of CMS model mice determined by qRT-PCR was significantly decreased in the stress-susceptible group compared with the normal control group (P = 0.016). (3) The relative expression of circSYNDIG1 was correlated with the immobility time of the FST test of model mice ( Figure 1 G) and NSF feeding latency ( Figure 1 H) negatively correlated (r = -0.665, P = 0.018 and r = -0.701, P = 0.011), suggesting that the decrease of circSYNDIG1 in the hippocampus is related to the depression-like behavior and anxiety-like behavior of chronic mildly stressed mice.

[0140] Example 2 Behavioral differences between CORT depression model mice and normal control mice and the accompanying expression of circRNA in the hippocampus

[0141] 1.1 Expression of circSYNDIG1 in CORT-damaged cells

[0142] according to Figure 2 The cells were treated according to the process shown in A, and the cell activity and circSYNDIG1 expression were observed.

[0143] 1.2 Mouse CORT depression model

[0144] The experimental process is as follows Figure 2 As shown in B, 20 7-week-old male ICR mice were randomly divided into 2 groups. CORT (corticosterone) group: CORT 20mg / kg / day subcutaneous injection, continued for 21 days. Vehicle group, that is, the solvent liquid equal to CORT was subcutaneously injected according to body weight, continued for 21 days. After the injection, FST and NSF tests were performed, and finally the mouse hippocampus was taken for molecular biology experiments.

[0145] 1.3 Experimental Results

[0146] Figure 2 The results of C showed that CORT treatment of HT-22 cells for 24 h could dose-dependently downregulate cell survival rate; the expression of circSYNDIG1 in HT-22 cells treated with 300 μM CORT for 24 h was significantly lower than that in the vehicle group ( Figure 2 D).

[0147] Figure 2E (qRT-PCR results) showed that the expression of circSYNDIG1 in the hippocampus of corticosterone model mice was significantly decreased compared with the vehicle group (P=0.0046).

[0148] Figure 2 F shows that the floating time of the corticosterone group was significantly longer than that of the vehicle group. Figure 2 G shows that the latency of feeding in the corticosterone group was significantly greater than that in the vehicle group, and the relative expression level of circSYNDIG1 was significantly correlated with the immobility time in FST of mice ( Figure 2 H) and NSF feeding latency ( Figure 2 I) was negatively correlated (r=-0.5841, P=0.0461and r=-0.6447, P=0.0322), suggesting that the reduction of circSYNDIG1 was associated with depression-like behavior and anxiety-like behavior in mice.

[0149] Example 3 Behavioral differences between lipopolysaccharide (LPS) depression model mice and normal control mice and the accompanying expression of circRNA in the hippocampus

[0150] 1. LPS depression model in mice

[0151] Thirty 7-week-old male ICR mice were randomly divided into three groups. LPS12h group: a single intraperitoneal injection of LPS 0.85 mg / kg 12 hours before the test; endotoxin group: a single intraperitoneal injection of LPS 0.85 mg / kg 24 hours before the test; the normal control group was the solvent group, that is, a single intraperitoneal injection of solvent liquid equal to LPS was given according to body weight. Finally, OFT and FST tests were performed, and the mouse hippocampus was taken for molecular biology experiments. The experimental procedure schedule is as follows Figure 3 As shown in A.

[0152] 2. Experimental results

[0153] Figure 3 B shows that the central residence time in the endotoxin group (24.96±3.20s) was significantly shorter than that in the vehicle group (41.19±4.37s) (P=0.0179).

[0154] Figure 3 C shows that the floating immobility time of mice in the endotoxin group (111.00±7.78s) was significantly longer than that in the vehicle group (51.57±11.69s) (P=0.0232).

[0155] Figure 3D (qRT-PCR results) showed that the expression of circSYNDIG1 in the hippocampus of endotoxin model mice was significantly decreased compared with the vehicle group (P = 0.0012). Moreover, the expression level of circSYNDIG1 was significantly correlated with the FST immobility time ( Figure 3 E) was negatively correlated (r = -0.650, P = 0.022), and was significantly correlated with the central residence time of OFT ( Figure 3 F) was positively correlated (r=0.595, P=0.041), suggesting that circSYNDIG1 was associated with reduced anxiety and depression-like behaviors in LPS model mice.

[0156] Example 4 Overexpression of circSYNDIG1 in the hippocampus can improve stress-induced abnormal behavior in mice

[0157] according to Figure 4 The experimental process shown in A was to overexpress circSYNDIG1 in the mouse hippocampus ( Figure 4 B), divided into two groups, one group as control group, the other group made into CMS model as stress group, monitored the weight changes of mice and observed the behavior of mice. The results are as follows:

[0158] (1) Figure 4 C (qRT-PCR) showed that CMS significantly reduced the expression of circSYNDIG1 in the hippocampus, and the expression of circSYNDIG1 in the hippocampus of mice injected with AAV-circSYNDIG1 was significantly increased.

[0159] (2) Figure 4 D shows that CMS significantly inhibited the weight gain of mice (in the negative control virus group, stress group: 4.3±0.2g Vs control group: 8.1±0.7g, P=0.0002); overexpression of circSYNDIG1 had no effect on the weight gain of non-model mice (in the control group, overexpression virus group: 7.9±0.5g Vs negative control virus group: 8.1±0.7g, P=0.9928); overexpression of circSYNDIG1 could significantly increase the weight of CMS model mice (in the stress group, overexpression virus group: 6.5±0.6g Vs negative control virus group: 4.3±0.2g, P=0.0307). This suggests that circSYNDIG1 can improve CMS-induced weight loss.

[0160] (3) Figure 4EF (OFT) showed that CMS significantly reduced the central residence time of mice (in the negative control virus group, the stress group: 29.74±5.19s Vs control group: 50.83±4.04s, P=0.00757); overexpression of circSYNDIG1 had no effect on the central residence time of non-model mice (in the control group, the overexpression virus group: 47.21±5.15s Vs negative control virus group: 50.83±4.04s, P=0.605); while overexpression of circSYNDIG1 significantly increased the central residence time of model mice (in the stress group, the overexpression virus group: 55.13±5.10s Vs negative control virus group: 29.74±5.19s, P=0.004). There was no significant difference in the total activity distance of the four groups. This suggests that circSYNDIG1 can improve the anxiety-like behavior of mice induced by CMS.

[0161] (4) Figure 4 GH (NSF) showed that CMS significantly prolonged the feeding latency of mice (in the negative control virus group, the stress group 154.14 ± 17.15s Vs control group 63.2 ± 6.29s, P = 4.5x10 -5 ); Overexpression of circSYNDIG1 had no effect on the feeding latency of non-model mice (in the control group, overexpression disease group: 58±7.45s Vs negative control virus group: 63.2±6.29s, P=0.600); while overexpression of circSYNDIG1 in the hippocampus significantly shortened the feeding latency of model mice (in the stress group, overexpression virus group: 74.56±8.52s Vs negative control virus group: 154.14±17.15s, P=0.0005). There was no significant difference in the amount of food intake in the four groups. This suggests that circSYNDIG1 improves the anxiety-like behavior induced by CMS in mice.

[0162] (5) Figure 4 IJ (SPT) showed that CMS significantly reduced the sugar water preference rate of mice (in the negative control virus group, the stress group 53.77% ± 8.85% Vs control group 76.90% ± 2.91%, P = 0.019); overexpression of circSYNDIG1 did not change the sugar water preference rate of non-model mice (P = 0.591), but significantly increased the sugar water preference rate of CMS model mice (in the stress group, the negative control virus group 53.77% ± 8.85% Vs overexpression virus group 77.72% ± 3.22%, P = 0.022). This suggests that circSYNDIG1 improves CMS-induced anhedonia in mice.

[0163] (6) Figure 4KL (TST) showed that CMS significantly prolonged the immobility time of mice (in the negative control virus group, stress group: 50.67±5.28s Vs control group: 9.00±0.06s, P=3.3x10-5); overexpression of circSYNDIG1 did not change the immobility time of non-model mice; but overexpression of circSYNDIG1 could significantly reduce the immobility time of model mice (in the stress group, negative control virus group: 50.67±5.28s Vs overexpression virus group: 18.43±10.71s, P=0.0267). This suggests that overexpression of circSYNDIG1 improves the depressive-like behavior of mice induced by CMS.

[0164] (7) Figure 4 M(NOR) showed that CMS significantly reduced the sniffing ratio of mice to new objects (in the negative control virus group, stress group: 49.98%±6.25% Vs control group: 71.49%±4.09%, P=0.0009); overexpression of circSYNDIG1 did not change the sniffing ratio of non-model mice to new objects; but overexpression of circSYNDIG1 significantly increased the sniffing ratio of model mice to new objects (in the stress group, overexpression virus group: 69.55%±4.37% Vs negative control virus group: 49.98%±6.25%, P=0.003). This suggests that circSYNDIG1 can improve CMS-induced memory impairment in mice.

[0165] Example 5 Overexpression of circRNA in the hippocampus can reverse abnormal behavior induced by miR-344-5p in mice

[0166] miR-344-5p interacts with circSYNDIG1

[0167] 1.1 Agomir synthesis

[0168] Agomir is a double-stranded small RNA molecule designed based on the mature sequence of microRNA, specially labeled and chemically modified, and is used to simulate the endogenous mature miRNA sequence. Agomir includes a sequence that is consistent with the mature sequence of the target miRNA and a sequence that is complementary to the mature sequence of the miRNA.

[0169] 1.2 circSYNDIG1 and miR344-5p probe sequences

[0170] circSYNDIG:

[0171] AGGACCCATTTCCCTCATGGGACAAGTAGATTTCATCATCAT

[0172] miR344-5p:

[0173] CCTGGAATCTAGCCAGGAGCCTGACTTTT CATCATCAT

[0174] like Figure 5 B shows that through bioinformatics prediction (http: / / circatlas.biols.ac.cn / ), we found that miR-344-5p and circSYNDIG1 have complementary sequences, so we speculate that circSYNDIG1 may function by adsorbing miR-344-5p.

[0175] Cell processing procedures are shown in Figure 5 A, CCK-8 test results show ( Figure 5 C): In the control group, overexpression of miR-344-5p significantly reduced the activity of HT-22 cells (miR random sequence group: 100% ± 1.6%, miR-344-5 analog group p: 89.9% ± 4.1%, P = 0.025); while in the circRNA overexpression group, overexpressed circSYNDIG1 inhibited the effect of miR-344-5p in reducing cell activity (miR-344-5 analog group: 112.2% ± 3.58%, miR random sequence group: 111.8% ± 1.9%, P = 0.940). This suggests that circSYNDIG1 can bind to miR-344-5p and block its damaging effect on cells.

[0176] This proves that circSYNDIG1 can bind to miR-344-5p and block the effect of miR-344-5p.

[0177] 2. circSYNDIG1 improves abnormal behavior of mice induced by miR-344-5p

[0178] According to the experimental process of 5D, two groups were set up, a normal control group and a CircRNA group (overexpressing AAV-circSYNDIG1 in the mouse hippocampus), and then transfected with miR-344-5p / miR randomly, and the mice were tested for behavior. The results are as follows:

[0179] (1) Figure 5EF (OFT) showed that in the control group, miR-344-5p significantly shortened the central residence time of mice (miR random sequence group: 38.32±1.30s compared with miR-344-5p group: 26.81±2.72s, P=0.005); while in the CircRNA group, overexpression of circSYNDIG1 prevented the effect of miR-344-5p in shortening the central residence time (MiR random sequence group: 34.69±3.95s compared with miR-344-5p group: 37.72±3.66s, P=0.633). This suggests that overexpression of circSYNDIG1 can block the anxiogenic effect of miR-344-5p.

[0180] (2) Figure 5 GH (NSF) showed that in the control group, miR-344-5p significantly prolonged the latency of mice to eat (MiR random sequence group: 83.67±9.11s Vs miR-344-5p group: 172.80±33.15s, P=0.0128), while in the CircRNA group, overexpression of circSYNDIG1 blocked the effect of miR-344-5p in prolonging the latency of mice to eat (miR random sequence group: 67.43±11.84s Vs AmiR-344-5p group: 90.80±14.96s, P=0.243), suggesting that overexpression of circSYNDIG1 blocked the anxiogenic effect of miR-344-5p.

[0181] (3) Figure 5IJ (FST) showed that in the control group, miR-344-5p significantly prolonged the immobility time of mice (miR random sequence group: 89.17±15.30s Vs miR-344-5p group: 148.60±19.30s, P=0.030), while in the CircRNA group, overexpression of circSYNDIG1 could prevent the effect of miR-344-5p in prolonging the immobility time (miR random sequence group: 65.67±7.71s Vs miR-344-5p group: 96.33±10.72s, P=0.643). miR-344-5p shortened the immobility latency of mice (miR random sequence group: 102.83±6.32s Vs miR-344-5p group: 69.5±5.02s, P=0.0021), while in the CircRNA group, overexpression of circSYNDIG1 could prevent the effect of miR-344-5p in shortening the immobility latency (miR random sequence group: 105.17±10.05s miR-344-5p group: 135.17±15.31s, P=0.0022), suggesting that circSYNDIG1 can block the depressive-like behavior induced by miR-344-5p.

[0182] (4) Figure 5 K(NOR) showed that in the control group, miR-344-5p significantly reduced the recognition rate of mice to new objects (miR random sequence group: 74.06% ± 5.66% Vs miR-344-5p group: 55.54% ± 1.20%, P = 0.0012), while in the CircRNA group, overexpression of circSYNDIG1 could prevent the effect of miR-344-5p in reducing the recognition rate of new objects (miR random sequence group: 75.68% ± 1.57% Vs miR-344-5p group: 73.17% ± 6.91%, P = 0.682). This suggests that circSYNDIG1 can block the damage of miR-344-5p to memory.

[0183] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention. SEQUENCE LISTING <110> Hebei Medical University <120> Biomarkers, kits and drugs for anxiety and depression-related diseases <130> April 22, 2022 <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 696 <212> RNA <213> Artificially synthesized <400> 1 cucaugggac aaguagaagg cugcaaugcc caaaggccag aagcagcaga gcauggagaa 60 gacgcugagu cccaggugau cccguggggg caucaugagg aaguuguccu cacuuucugu 120 gucgcuggag uagucacucu ccagcuccug uaacuccucu ucuuccucca cgucauagga 180 caggguaugg auuuugaugu cauccccuga gaggucgaug aauuucccau cgggguacuc 240 caggcugucu uuggugggug accgguccuc aaugaaggug gucucacagc agucaguggc 300 uacaccaucc ccccaggauc gaaguacacc aucugaguag aggaugauau ugggacgaua 360 gugggacucg acggacugcu gcagaguguu uggguccagc aacugcugca caggcucacu 420 ucugccuccu uccaggcugc cuggugccgc acuggccacu agccuguggc ucugguacug 480 aggugcuggg uaaacagaca ccagaccauc ccugcucuca gccaugaagu uucugguguu 540 aauuaagcca uuccuuuugc cagcaucacu gaucuuacug uguaccagaa cacucuucug 600 cucaaugaug ccauccaugg uagacucccu cccugcucgg agucaggcua gcaggcugua 660 uucacagguc acacaagccc cauaggaccc auuucc 696 <210> 2 <211> 26 <212> RNA <213> Synthetic <400> 2 agucaggcuc cuggcuagau uccagg 26 <210> 3 <211> 38 <212> DNA <213> Synthetic <400> 3 cctggaatct agccaggagc ctgacttttc atcatcat 38 <210> 4 <211> 42 <212> DNA <213> Synthetic <400> 4 aggacccatt tccctcatgg gacaagtaga tttcatcatc at 42

Claims

1. A biomarker for anxiety and depression-related diseases, characterized in that: The marker is circRNA_34764, the nucleotide sequence of circRNA_34764 is shown in SEQ ID No. 1, and the anxiety and depression related diseases are depression or anxiety.

2. A diagnostic kit for anxiety and depression-related diseases, characterized in that: It can measure the expression level of circRNA_34764 in a sample, the nucleotide sequence of the circRNA_34764 is shown in SEQ ID No. 1, and the anxiety and depression-related diseases are depression or anxiety.

3. The kit according to claim 2, characterized in that It contains a probe of circRNA_3476; the probe sequence of circRNA_34764 is shown in SEQ ID No.

4.

4. Use of circRNA_34764 in the preparation of therapeutic drugs for anxiety and depression-related diseases, the nucleotide sequence of circRNA_34764 is shown in SEQ ID No.1, and the anxiety and depression-related diseases are depression or anxiety disorder.

Images