A set of SNP loci and corresponding KASP markers for assisting selection of leaf width traits in modified tobacco variety ‘K326’

Abstract

The application discloses a group of SNP sites for assisting in selecting improved tobacco variety 'K326' leaf width, which is characterized in that the SNP sites are three sites with probe numbers AX-117602251, AX-117602267 and AX-117598761 of a tobacco 430K SNP chip, and the single-strand DNA sequences of the three SNP sites and the upstream and downstream 50 nt are respectively shown as SEQ ID 1, SEQ ID 2 and SEQ ID 3. The SNP sites and the corresponding KASP detection primers provided by the application can improve the selection efficiency in directional improvement of the leaf width trait of K326, and accelerate the breeding process of new varieties.

Description

Technical Field

[0001] The invention belongs to the field of tobacco genetic breeding and relates to a group of KASP molecular markers of SNP site genotypes related to tobacco leaf width and applications thereof. Background Art

[0002] Tobacco is an important cash crop, primarily harvested for its leaves. Currently, approximately 15 million mu (approximately 1.5 million hectares) of tobacco is cultivated in China, with the main cultivars promoted being Yunyan 87, K326, and Honghua Dajinyuan. K326, introduced from the United States in 1985, currently holds the second-largest planting area in my country. However, in production, K326 suffers from insufficient upper leaf width, resulting in insufficient leaf opening, which directly impacts upper leaf yield and quality. This issue has garnered widespread attention from tobacco breeders, who are eager to address it. However, leaf width is a typical complex trait controlled by multiple genes and the environment. Genetic analysis suggests that it is likely controlled by two to three major genes plus multiple genes, with the heritability of major genes ranging from 60.61% to 90.17%, and that the effects between these genes are primarily additive. Using QTL mapping, Tong Zhijun et al. located 12 and 4 QTLs related to leaf width in genetic populations derived from two different flue-cured tobacco combinations (Honghua Dajinyuan / Kuye hicks and Y3 / K326), respectively. These QTLs were primarily distributed on linkage groups 4, 14, 17, and 22 (Tong Zhijun, Acta Agronomica Sinica, 2012; Tong Zhijun, Journal of Northwest Botany, 2018). Li Qian (Li Qian, Southwest University, 2015) constructed an F2 population using Honghua Dajinyuan and SWU109 and located four QTLs related to leaf width, all distributed on linkage groups 1, 17, and 23. These studies initially identified some QTLs related to leaf width, but the mapping studies primarily used SSR markers, resulting in the QTL regions being located on linkage groups and not directly anchored to the physical sequence of the tobacco genome. Furthermore, the differences in genetic background between the parents of these mapping populations limited the potential for genetic improvement of leaf width in the 'K326' cultivar.

[0003] Chromosome Segment Substitution Lines (CSSLs) are often considered ideal for linking molecular marker technology with crop breeding because they replace only a portion of the recipient parent's chromosome with a donor parent's chromosome segment. Their well-defined genetic background allows for accurate QTL mapping, genetic effect analysis, and functional gene discovery. They have been widely used to identify loci associated with important traits in crops such as rice, maize, wheat, soybean, and cotton. However, to date, there have been no reports on the use of tobacco CSSLs to identify variant loci associated with leaf width, develop molecular markers, and utilize them. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the shortcomings of existing research results on tobacco leaf width QTL mapping, use constructed tobacco chromosome segment substitution line materials, combine the drawn tobacco haplotype map and tobacco 430K SNP chip genotyping methods, screen and identify the SNP site genotype related to tobacco leaf width, and develop KASP markers that can facilitate rapid and high-throughput genotyping for the genetic improvement of tobacco leaf width traits.

[0005] The technical solution of the present invention is: a group of SNP sites for auxiliary selection to improve the leaf width of tobacco variety 'K326', wherein the SNP sites are three sites of tobacco 430K SNP chip probe numbered AX-117602251, AX-117602267 and AX-117598761.

[0006] Specifically, these three sites are all located on chromosome Chr09 of the Honghua Dajinyuan reference genome (V1.2) sequenced by the Chinese Tobacco Genome Project (Jiang Zipeng, Journal of Chinese Tobacco Society, 2022). The corresponding genotypes in the above-mentioned tobacco variety K326 and the narrow-leaf group chromosome segment substitution line materials are "CC", "AA", and "GG", respectively, while the genotypes of the wide-leaf group materials in the K326 chromosome substitution line are "AA", "GG", and "CC", respectively.

[0007] The three SNP sites and 50 nt of single-stranded DNA sequences upstream and downstream are shown in SEQ ID 1, SEQ ID 2 and SEQ ID 3, respectively.

[0008] AX-117602251:

[0009] TGGCATATAGCTCCAGATACTTCTTATGAAACTTCCGCCAATCAATCCCA[C / A]CATCAGCAATAGGCTCCCCAGATGGGACAAAGTCACGAAACCACTCGCGT

[0010] AX-117602267:

[0011] ATCAGTTGTCATCTATTAGAAGCTTGGTAACACTAGGGATTCGTGACGGC[A / G]TGCTCACTAATGCTGGGCTCATTATATTCAACCCTCCACCATCTATGACG

[0012] AX-117598761:

[0013] TGATATCAAGTCAGAGCATGCACCTAGGAGTCCTAGCTACAGCATCTCAT[G / C]CTGTTACAACCCAGACCTTGTTTGTTGTTTACTACAAGCCGAGGTTTGTC

[0014] The genotype composition of the AX-117602251, AX-117602267, and AX-117598761 variable sites is selected as "AAGGCC".

[0015] The method for selecting a group of SNP sites for improving leaf width of tobacco variety 'K326' was selected, three SNP sites were converted into KASP markers, and corresponding KASP detection primers were provided. The primers are as follows:

[0016] Primers for detecting KASP at AX-117602251 site:

[0017] Forward primer 1FAM:

[0018] GAAGGTGACCAAGTTCATGCTACTTCCGCCAATCAATCCCAC;

[0019] Forward primer 1HEX:

[0020] GAAGGTCGGAGTCAACGGATTACTTCCGCCAATCAATCCCAA;

[0021] Reverse primer 1: CGCGAGTGGTTTCGTGACTTTGTCCCATCT;

[0022] Primers for detecting KASP at AX-117602267 site:

[0023] Forward primer 2FAM:

[0024] GAAGGTGACCAAGTTCATGCTTAACACTAGGGATTCGTGACGGCA;

[0025] Forward primer 2HEX:

[0026] GAAGGTCGGAGTCAACGGATTTAACACTAGGGATTCGTGACGGCG;

[0027] Reverse primer 2: GAGGGTTGAATATAATGAGCCC;

[0028] Primers for detecting KASP at AX-117598761 site:

[0029] Forward primer 3FAM:

[0030] GAAGGTGACCAAGTTCATGCTGGAGTCCTAGCTACAGCATCTCATG; forward primer 3HEX:

[0031] GAAGGTCGGAGTCAACGGATTGGAGTCCTAGCTACAGCATCTCATC; Reverse primer 3: GTAGTAAACAACAAACAAGGTC.

[0032] The method for screening the set of SNP sites for assisted selection to improve leaf width of tobacco variety 'K326' comprises the following steps:

[0033] (1) The constructed tobacco variety K326 chromosome segment substitution line materials related to tobacco leaf width traits were conventionally planted in the field, and the tobacco leaf width phenotype was measured at maturity. 5 to 7 tobacco substitution line materials with significantly larger leaf widths than K326 were selected, and 5 to 7 tobacco substitution line materials with no change or smaller leaf widths than K326 were selected. Leaves of the selected wide-leaf group and narrow-leaf group materials were sampled, DNA was extracted, and then genotyped using a 430K SNP chip developed and customized by the Zhengzhou Tobacco Research Institute;

[0034] (2) The 430K SNP chip genotyping results of the above materials were processed. First, SNP sites without polymorphism and low-quality SNP sites were eliminated, and only homozygous and polymorphic SNP sites were retained. Then, the genotypes of each material at each SNP site were compared with the control material K326. The genotypes were converted according to the similarities and differences with the control material K326 genotype. The same as K326 were recorded as "XX", and the different from K326 were recorded as "YY";

[0035] (3) The genotype type and phenotype of each SNP site were combined. For example, if the genotype was "XX" and the phenotype was "BLG", it was recorded as "BLG-XX". There were four combination types, namely "BLG-XX", "BLG-YY", "NLG-XX" and "NLG-YY". The number of materials included in each combination type was counted, and then the correlation between genotype and phenotype was tested for significance using the Fisher exact test method.

[0036] (4) For the SNP sites that were significantly associated with tobacco leaf width, combined with the annotation information of the tobacco reference genome, we focused on the SNP sites located in the exon region of the gene, and combined with bioinformatics methods such as GO and KEGG annotations to screen out SNP sites whose genotype variation can significantly improve tobacco leaf width traits but has no effect or little effect on other traits, and clarified the SNP sites and corresponding genotypes.

[0037] Beneficial effects of the present invention:

[0038] 1. The present invention provides a set of SNPs and corresponding genotypes that effectively improve the leaf width trait of the tobacco variety K326. By screening constructed chromosome segment substitution lines, a single strain, G3, was identified. Field trials showed that this strain exhibited significantly increased leaf width at all positions compared to K326, while other traits remained unchanged or showed insignificant changes. This approach holds important implications for targeted improvement of leaf width in tobacco varieties.

[0039] 2. The SNP sites related to tobacco leaf width trait and the corresponding KASP markers and detection primers provided by the present invention can improve the selection efficiency in the directional improvement of K326 leaf width trait and accelerate the breeding process of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The leaf width phenotypes of individual plants numbered G1 to G11 (A: comparison of leaf width traits at different leaf positions of the experimental materials; B: phenotype of individual plants of the control K326; C: phenotype of individual plants of G3);

[0041] Figure 2 It is a SNP locus related to tobacco leaf width trait (■SSR molecular markers related to tobacco leaf width trait have been reported; SNP sites located in the intron region of the gene; SNP sites located in the exon region of the gene)

[0042] Figure 3 This is the whole plant phenotype of materials numbered G1 to G11 at field maturity (excluding G10).

[0043] Figure 4 The genotypes of the three SNP loci (AX-117602251, AX-117602267, and AX-117598761) and the width differences of the upper leaves of the corresponding materials (Hap-CCAAGG indicates that the genotypes of the three SNP loci are "CC," "AA," and "GG," respectively; Hap-AAGGCC indicates that the genotypes of the three SNP loci are "AA," "GG," and "CC," respectively, corresponding to narrow-leaf materials and wide-leaf materials);

[0044] Figure 5The results of the KASP primer usability test validation for SNP site AX-117598761. DETAILED DESCRIPTION

[0045] Example 1

[0046] (1) Using tobacco variety K326 as the recipient parent and variety Samsun as the donor parent, BC4F3 seeds were produced by backcrossing 4 times and selfing 3 times, and then planted at the Pingba Base of Guizhou Tobacco Science Research Institute. Five lines with significantly increased leaf width and five lines with reduced or no change in leaf width compared with K326 were screened and obtained, totaling 11 materials (numbered G1 to G11, as shown in Figure 2). Figure 1 Five plants were randomly selected from each accession for leaf width phenotype measurement. Corresponding leaves were collected and pooled for DNA extraction. Genotyping was performed by the Zhengzhou Tobacco Research Institute using a 430K SNP array.

[0047] (2) Genotyping of 11 modular materials was performed using the tobacco 430K SNP chip. A total of 203,429 valid SNP sites were obtained through preliminary data quality control. Combined with the data-imputation method, SNP sites with no genetic polymorphism and heterozygous were eliminated, leaving 3,123. These SNP sites were further analyzed, and the genotype of the control material K326 at each SNP site was recorded as "XX", where the letter X represents one of the four base types of "A (adenine)", "T (thymine)", "G (guanine)", and "C (cytosine)" on the deoxynucleotide. The genotype SNP sites of other materials that were different from K326 were recorded as "YY", where the letter Y represents a base type different from the letter X.

[0048] Based on this, the 11 modular materials were combined sequentially at 3123 SNP loci in the order of G1 to G11, resulting in a total of 23 combination types (Table 1). Combined with the leaf width trait results of the modular material field trials, the Fisher's exact test method was selected to statistically analyze the association between each SNP locus genotype combination and the leaf width trait. The results showed that the 11th, 18th, and 19th genotype combinations were significantly or extremely significantly associated with the tobacco leaf width trait (Table 1). Based on this screening, a total of 167 SNP loci associated with the tobacco leaf width trait were obtained, referred to as associated SNPs.

[0049] Table 1 Genotype combination types of polymorphic SNP sites and their association analysis with leaf width traits

[0050]

[0051]

[0052] *: Significant at the 0.05 level, **: Significant at the 0.01 level. *: P < 0.05, **: P < 0.01.

[0053] According to the physical position of the tobacco 430K SNP chip probe sequence on the Honghua Dajinyuan reference genome provided by the Zhengzhou Institute (Jiang Zipeng, Journal of Chinese Tobacco Society, 2022), 59 associated SNP sites were found to be distributed in 20 Scafflods, and the remaining 108 associated SNP sites were concentrated in 5 reference genome chromosomes, including Chr04, Chr07, Chr08, Chr09 and Chr18. The number of associated SNP sites on each chromosome was 7, 3, 1, 71 and 26. The 5 chromosomes were divided according to the length of 100Kb intervals, and the number of associated SNP sites in each interval was counted. At the same time, according to the distribution of interval genes, the associated SNP sites located in the exon or intron region of the gene were screened. The results showed that of the 108 associated SNP sites distributed on the 5 chromosomes, 19 were located in 17 genes, concentrated on three chromosomes, Chr04, Chr09 and Chr18, and 11 were located in the exon (Exon) region of the gene ( Figure 2 ). In addition, the study found that 5 of the associated SNP sites distributed in the Scaffold region were located in the exon region of the gene. Based on this, the study believes that the 16 genes containing associated SNP sites in the exon region are important candidate associated genes for tobacco leaf width traits, and are named TWL-1 to TWL-16 according to their physical locations in the Honghua Dajinyuan reference genome (Table 2). At the same time, the research results were compared with the early tobacco leaf width-related QTLs or molecular markers, and it was found that the associated SNP sites on chromosome Chr09 are mainly located between the two SSR molecular markers PT6039 and PT6047 on the published LG14 linkage group, while the associated SNP sites on chromosome Chr18 overlap with the position of the SSR molecular marker PT52809 on the published LG1 linkage group.

[0054] Table 2 Candidate genes associated with tobacco leaf width

[0055]

[0056] By comparing the field performance and quality evaluation results of materials G1 to G11, it was found that the width of tobacco leaves of materials G6, G7, G8 and G11 increased significantly compared with the control K326, but the leaf length became shorter, the leaf thickness became thinner, and the content of tobacco contents decreased ( Figure 3The analysis showed that the genotypes of candidate SNP sites on chromosomes Chr04 and Chr18 of G3 material were consistent with those of K326. On Chr09, single nucleotide mutations occurred in the exon regions of genes such as TWL-7 to TWL-9, which improved the leaf width trait of G3 material. However, the resistance and quality traits were comparable. This result was consistent with the analysis results of the functional annotation of each gene and the metabolic pathway.

[0057] The genotypes of the SNP sites (AX-117602251, AX-117602267 and AX-117598761) in the exon region of the TWL-7 to TWL-9 genes of the G1 and G11 materials were analyzed. The results showed that the genotypes of the three SNP sites in the NLG materials were "CCAAGG" in sequence, while the genotypes in the BLG materials changed to "AAGGCC" ( Figure 4 Based on this data and combined with the annotation information of the tobacco reference genome, it is believed that for the directional improvement of the leaf width trait of the flue-cured tobacco variety K326, KASP molecular markers can be developed based on the upstream and downstream sequences of three SNP sites, namely AX-117602251, AX-117602267, and AX-117598761, to assist in selective breeding and improve breeding efficiency. Specifically, K326 can be used as the female parent, and tobacco germplasm materials with the gene haplotype of "AAGGCC" at three SNP sites, such as AX-117602251, AX-117602267 and AX-117598761, can be used as the male parent. Continuous backcrossing can be performed, and genotype selection can be performed using SNP chips or developed KASP markers to restore the genotypes other than SNP sites such as AX-117602251, AX-117602267 and AX-117598761 to the same as K326, while the genotypes of the three SNP sites, such as AX-117602251, AX-117602267, and AX-117598761, are "AAGGCC".

[0058] Example 2: A method for genotyping tobacco germplasm resources (genotype selection using KASP markers), comprising the following steps:

[0059] (1) The three SNP sites, AX-117602251, AX-117602267, and AX-117598761, and the 50 nt upstream and downstream single-stranded DNA sequences were shown in SEQ ID 1, SEQ ID 2, and SEQ ID 3, respectively. KASP primers were designed based on the tobacco red flower Dajinyuan reference genome (V1.2) and commissioned to Shanghai Shenggong Bioengineering Technology Service Co., Ltd. for synthesis.

[0060] The primer sequences used for KASP detection of the three SNP sites are as follows:

[0061] Primers for detecting KASP at AX-117602251 site:

[0062] Forward primer 1FAM:

[0063] GAAGGTGACCAAGTTCATGCTACTTCCGCCAATCAATCCCAC;

[0064] Forward primer 1HEX:

[0065] GAAGGTCGGAGTCAACGGATTACTTCCGCCAATCAATCCCAA;

[0066] Reverse primer 1: CGCGAGTGGTTTCGTGACTTTGTCCCATCT;

[0067] Primers for detecting KASP at AX-117602267 site:

[0068] Forward primer 2FAM:

[0069] GAAGGTGACCAAGTTCATGCTTAACACTAGGGATTCGTGACGGCA;

[0070] Forward primer 2HEX:

[0071] GAAGGTCGGAGTCAACGGATTTAACACTAGGGATTCGTGACGGCG;

[0072] Reverse primer 2: GAGGGTTGAATATAATGAGCCC;

[0073] Primers for detecting KASP at AX-117598761 site:

[0074] Forward primer 3FAM:

[0075] GAAGGTGACCAAGTTCATGCTGGAGTCCTAGCTACAGCATCTCATG;

[0076] Forward primer 3HEX:

[0077] GAAGGTCGGAGTCAACGGATTGGAGTCCTAGCTACAGCATCTCATC;

[0078] Reverse primer 3: GTAGTAAACAACAAACAAGGTC.

[0079] (2) G1 to G11 materials were selected. At the same time, 22 materials including Longshe tobacco, Anshun Xiaodiaozhi, Huerzhuandao Xiaoliuye, Luodian Yanmao, Zhenfeng Liuye tobacco, Zhenfeng Xiaoliuye, Mulin Liuye, Waichun tobacco, Ribjiaohe, Miye No. 1, and 68-39 were selected from the germplasm resource bank of Guizhou Tobacco Science Research Institute for germination and DNA extraction.

[0080] (3) The availability of KASP primers for the three SNP sites mentioned above was verified using the KASP technology platform (LGC, UK). For specific PCR reaction systems and experimental operations, refer to the technical documentation provided by LGC. The model of the KASP fluorescence detector is FLUOstar Omega SNP. The genotyping results were analyzed using KlusterCaller software. The results showed that the KASP primers for the three designed SNP sites were all available, and the genotyping results of materials such as G1 to G11 were consistent with the results of the 430K SNP chip of the Zhengzhou Institute. The KASP experimental verification results of the SNP marker AX-117598761 are shown in Figure 5 . <110> Guizhou Tobacco Science Research Institute <120> A set of SNPs and corresponding KASP markers for leaf width improvement in tobacco variety 'K326' through assisted selection <160> 12 <210> 1 <211> 101 <212> DNA <213> AX-117602251 <400> 1 TGGCATATAG CTCCAGATAC TTCTTATGAA ACTTCCGCCA ATCAATCCCA 50 ACATCAGCA ATAGGCTCCC CAGATGGGAC AAAGTCACGA AACCACTCGC GT <210> 2 <211> 101 <212> DNA <213> AX-117602267 <400> 2 ATCAGTTGTC ATCTATTAGA AGCTTGGTAA CACTAGGGAT TCGTGACGGC 50 GTGCTCACT AATGCTGGGC TCATTATATT CAACCCTCCA CCATCTATGA CG <210> 3 <211>101 <212> DNA <213>AX-117598761 <400> 3 TGATATCAAG TCAGAGCATG CACCTAGGAG TCCTAGCTAC AGCATCTCAT 50 CCTGTTACA ACCCAGACCT TGTTTGTTGT TTACTACAAG CCGAGGTTTG TC <210> 4 <211>42 <212> DNA <213>Artificial Sequence <400> 4 GAAGGTGACCAAGTTCATGCTACTTCCGCCAATCAATCCCAC <210> 5 <211> 42 <212> DNA <213>Artificial Sequence <400> 5 GAAGGTCGGAGTCAACGGATTACTTCCGCCAATCAATCCCAA <210> 6 <211> 30 <212> DNA <213>Artificial Sequence <400> 6 CGCGAGTGGTTTCGTGACTTTGTCCCATCT <210> 7 <211> 45 <212> DNA <213>Artificial Sequence <400> 7 GAAGGTGACCAAGTTCATGCTTAACACTAGGGATTCGTGACGGCA <210> 8 <211> 45 <212> DNA <213>Artificial Sequence <400> 8 GAAGGTCGGAGTCAACGGATTTAACACTAGGGATTCGTGACGGCG <210> 9 <211> 22 <212> DNA <213>Artificial Sequence <400> 9 GAGGGTTGAATATAATGAGCCC <210> 10 <211> 46 <212> DNA <213>Artificial Sequence <400> 10 GAAGGTGACCAAGTTCATGCTGGAGTCCTAGCTACAGCATCTCATG <210> 11 <211> 46 <212> DNA <213>Artificial Sequence <400> 11 GAAGGTCGGAGTCAACGGATTGGAGTCCTAGCTACAGCATCTCATC <210> 12 <211> 22 <212> DNA <213>Artificial Sequence <400> 12 GTAGTAAACAACAAACAAGGTC

Claims

1. A set of SNP molecular genetic marker compositions for leaf width improvement of tobacco variety 'K326' for assisted selection, characterized by: The SNP molecular genetic marker composition consists of three sites: AX-117602251, AX-117602267, and AX-117598761. The DNA sequences of the three sites and 50 nt of DNA single-stranded sequences upstream and downstream are as follows: AX-117602251: TGGCATATAGCTCCAGATACTTCTTATGAAAC TTCCGCCAATCAATCCCA[C / A]CATCAGCAATAGGCTCCCCAGATGGGACAAAGTCACGAAACCACTCGCGT;AX-117602267:ATCAGTTGTCATCTATTAGAAGC TTGGTAACACTAGGGATTCGTGACGGC[A / G]TGCTCACTAATGCTGGGCTCATT ATATTCAACCCTCCACCATCTATGACG;AX-117598761:TGATATCAAGTC AGAGCATGCACCTAGGAGTCCTAGCTACAGCATCTCAT[G / C]CTGTTACAACCCAGACCTTGTTTGTTGTTTACTACAAGCCGAGGTTTGTC.

2. The leaf width SNP molecular genetic marker composition for assisted selection and improvement of tobacco variety 'K326' according to claim 1, characterized in that: The genotype of the AX-117602251, AX-117602267, and AX-117598761 loci was selected as "AAGGCC".

3. A method for detecting a combination of leaf width SNP molecular genetic markers for the tobacco variety 'K326' improved by assisted selection according to claim 1, characterized in that: The three SNP sites AX-117602251, AX-117602267 and AX-117598761 were converted into KASP markers, and corresponding KASP detection primers were provided. The primers are as follows: Primers for detecting KASP at AX-117602251 site: Forward primer 1 FAM: GAAGGTGACCAAGTTCATGCTACTTCCGCCAATCAATCCCAC; Forward primer 1 HEX: GAAGGTCGGAGTCAACGGATTACTTCCGCCAATCAATCCCAA; Reverse primer 1: CGCGAGTGGTTTCGTGACTTTGTCCCATCT; Primers for detecting KASP at AX-117602267 site: Forward primer 2 FAM: GAAGGTGACCAAGTTCATGCTTAACACTAGGGATTCGTGACGGCA; Forward primer 2 HEX: GAAGGTCGGAGTCAACGGATTTAACACTAGGGATTCGTGACGGCG; Reverse primer 2: GAGGGTTGAATATAATGAGCCC; Primers for detecting KASP at AX-117598761 site: Forward primer 3 FAM: GAAGGTGACCAAGTTCATGCTGGAGTCCTAGCTACAGCATCTCATG; Forward primer 3 HEX: GAAGGTCGGAGTCAACGGATTGGAGTCCTAGCTACAGCATCTCATC; Reverse primer 3: GTAGTAAACAACAAACAAGGTC.

4. A method for screening a set of leaf width SNP molecular genetic marker compositions for assisted selection of improved tobacco variety 'K326' according to claim 1, characterized in that: The following steps are involved: (1) The constructed tobacco variety K326 chromosome segment substitution line materials related to tobacco leaf width traits were conventionally planted in the field. The tobacco leaf width phenotype was measured at maturity. 5 to 7 tobacco substitution line materials with significantly larger leaf widths than K326 were selected. Another 5 to 7 tobacco substitution line materials with no change or smaller leaf widths than K326 were selected. Leaves of the selected wide-leaf group and narrow-leaf group materials were sampled, DNA was extracted, and genotyping was performed using a 430K SNP chip developed and customized by the Zhengzhou Tobacco Research Institute. (2) The 430K SNP chip genotyping results of the above materials were processed. First, the SNP sites without polymorphism and low-quality SNP sites were eliminated, and only the homozygous and polymorphic SNP sites were retained. Then, the genotypes of each material at each SNP site were compared with the control material K326. The genotypes were converted according to the differences and similarities with the control material K326 genotype. The same as K326 was recorded as "XX", and the different from K326 was recorded as "YY"; (3) The genotype type and phenotype of each SNP site were combined. The genotype was "XX" and the phenotype was "BLG", which was recorded as "BLG-XX". There were four combination types, namely "BLG-XX", "BLG-YY", "NLG-XX" and "NLG-YY". The number of materials included in each combination type was counted, and then the correlation between genotype and phenotype was tested for significance using the Fisher exact test method. (4) For the SNP sites that were significantly associated with tobacco leaf width, combined with the annotation information of the tobacco reference genome, we focused on the SNP sites located in the exon region of the gene, and combined with GO and KEGG annotation bioinformatics methods to screen out SNP sites that can significantly improve tobacco leaf width traits when genotype variation occurs, but have no effect or little effect on other traits, and clearly identify the SNP sites and their corresponding genotypes.

Images