A rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab

Abstract

The present invention provides a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab, including: (1) an anti-pollution cotton swab preparation system, and (2) an anti-pollution colorimetric swab detection and analysis system. The present invention verifies the anti-pollution performance of zwitterions, grafts zwitterions on the surface of cotton swabs by using photoinitiated polymerization, characterizes and verifies the cotton swabs before and after modification and measures the anti-pollution performance, and verifies the feasibility of the zwitterion-modified cotton swabs and the anti-pollution characteristics of the modified cotton swabs in actual food matrix samples. The present invention uses an anti-pollution colorimetric swab as the terminal detection platform, blue latex microspheres / aptamers as colorimetric signal probes, and cooperates with a portable colorimeter and a smart phone to obtain quantitative detection results, realizing the quantitative detection of Salmonella in milk without sample pretreatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab. Background Art

[0002] Salmonella is one of the main causes of foodborne infectious diseases and is extremely likely to contaminate foods such as meat, eggs, and milk. Usually, when there is only one colony unit of Salmonella formed, it can cause human infection. Its pathogenic limit is extremely low, its transmission power is strong, and the prevention and control is difficult, posing a serious threat to public health. Since traditional methods such as plate counting method and real-time polymerase chain reaction are both time-consuming and laborious, there is an urgent need for new rapid detection methods for on-site and online applications. As a simple, sensitive, and low-cost analysis means, biosensors provide effective guarantees for the rapid detection of food safety, especially for pathogens, proteins, heavy metals, and antibiotics.

[0003] As a rapid detection element that is easy to obtain, easy to modify, and low-cost, cotton swabs have been widely used in sample collection, target enrichment, and quantitative detection. However, during the detection of complex samples, there are often interferences from the matrix, which affects the detection sensitivity and result scientificity of the biosensor. In recent years, the research on modifying biosensors with zwitterionic anti-pollution materials has received increasing attention. In order to resist the matrix interference in complex samples, improve the detection sensitivity and specificity of the sensor, and ensure the scientificity and reliability of the final detection results, the development and application of anti-pollution biosensors in the field of rapid detection are particularly important. So far, zwitterionic-modified biosensors have been used in the field of rapid detection, but there is no report on the detection of Salmonella with zwitterionic-modified cotton swabs. Summary of the Invention

[0004] The purpose of the present invention is to develop a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab.

[0005] In order to achieve the purpose of the present invention, an anti-pollution cotton swab was designed, an anti-pollution colorimetric swab detection platform was constructed, and a "blue latex microsphere / aptamer" was used as a colorimetric signal probe, in combination with a portable colorimeter and a signal reading device of a smart phone, to realize the qualitative and quantitative rapid detection of Salmonella in milk.

[0006] On the one hand, the present invention provides a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab, including: (1) an anti-pollution cotton swab preparation system, (2) an anti-pollution colorimetric swab detection and analysis system:

[0007] The anti-pollution cotton swab preparation system refers to the surface modification of commercial cotton swabs by zwitterionic materials and Salmonella-specific aptamer sequences through photoinitiated polymerization and immersion method;

[0008] Preferably, the anti-pollution material is sulfobetaine methacrylate (SBMA)

[0009] The SBMA is a zwitterionic anti-pollution chemical material with strong hydrophilicity and strong anti-pollution property;

[0010] The Salmonella-specific aptamer sequence is used to specifically capture Salmonella for detection;

[0011] The photoinitiated polymerization uses ultraviolet irradiation and photoinitiator to achieve the polymerization reaction;

[0012] The immersion method uses the way of immersion incubation to achieve physical adsorption between polymers;

[0013] The anti-pollution colorimetric swab detection and analysis system includes anti-pollution cotton swabs, blue latex microspheres / aptamers, a color difference meter, and a smartphone;

[0014] The blue latex microspheres / aptamers are signal probes in the detection system;

[0015] The signal probe is a polymer formed by covalent coupling of blue latex microspheres and aptamers.

[0016] On the other hand, the present invention provides materials for preparing anti-pollution cotton swabs used in the rapid detection method of Salmonella, including SBMA, aptamers, and commercial cotton swabs;

[0017] The SBMA and the cotton swab are subjected to photoinitiated polymerization by ultraviolet irradiation and photoinitiator;

[0018] Preferably, the wavelength of ultraviolet irradiation is 365 nm and the time of ultraviolet irradiation is 20 min;

[0019] Preferably, the photoinitiator is Irgacure2595;

[0020] The aptamer and the cotton swab achieve physical adsorption by the immersion method;

[0021] Preferably, the immersion incubation time is 4 h;

[0022] Preferably, the concentration of the aptamer is 10 nM.

[0023] On the other hand, the present invention provides a colorimetric signal probe used in the rapid detection method of Salmonella, including blue latex microspheres and Salmonella-specific aptamers;

[0024] The average particle size of the blue latex microspheres is about 250 nm, which is used for covalent connection of Salmonella-specific aptamers;

[0025] Preferably, the Salmonella - specific aptamer sequence is SAT;

[0026] Preferably, the aptamer concentration is 10 nM;

[0027] Preferably, the covalent - linking initiator is EDC / NHS.

[0028] On the other hand, the present invention provides the detection conditions for the above - mentioned rapid Salmonella detection method:

[0029] The incubation time of the anti - contamination swab in milk is 10 min, and it is washed twice with distilled water;

[0030] The anti - contamination swab is incubated in the blue latex microsphere / aptamer solution for 10 min, and it is washed twice with distilled water;

[0031] The color - difference meter detection and analysis process includes: aligning the color - difference meter with the swab to read color data, randomly taking five points on the surface of each swab to read values, and taking the average of the color - data results.

[0032] On the other hand, the present invention provides a method for quantitatively detecting Salmonella using the aforementioned detection method, including the following steps:

[0033] SI: Making a standard curve:

[0034] The Salmonella stock solution is diluted by a factor of 10 in a gradient manner to construct a Salmonella - signal probe binding system with different Salmonella concentrations. The detection and analysis system combined with the anti - contamination colorimetric swab is the same as the aforementioned detection steps;

[0035] Taking the logarithm of the Salmonella concentration as the abscissa and the gray - scale value of the positive sample minus the gray - scale value of the blank control sample as the ordinate, a standard curve is plotted;

[0036] SII: Detecting the sample to be tested according to the aforementioned detection method, substituting the gray - scale value of the sample to be tested obtained minus the gray - scale value of the blank control sample into the standard curve, and calculating the content of Salmonella in the sample to be tested to achieve the quantitative detection of Salmonella.

[0037] SIII: The nucleic acid sequences used in the experiment are:

[0038] TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG(SAT)

[0039] SIIII: Determining the linear range to be 10 3 ~10 7 CFU / mL, y = 6.6803x + 3.0119, R 2= 0.9936, and the detection limit is 117.80 CFU / mL, thus enabling the quantitative detection of Salmonella.

[0040] On the other hand, the present invention also provides a detection swab for use with the above method.

[0041] It includes: (1) an anti-pollution cotton swab preparation system, and (2) an anti-pollution colorimetric swab detection and analysis system

[0042] The anti-pollution cotton swab preparation system refers to the surface modification of commercial cotton swabs by a zwitterionic material and a Salmonella-specific aptamer sequence through photoinitiated polymerization and immersion methods;

[0043] Preferably, the anti-pollution material is sulfobetaine methacrylate (SBMA);

[0044] More preferably, the anti-pollution material can resist macromolecular protein contaminants in milk;

[0045] More preferably, the photoinitiated polymerization method can simply and quickly modify the cotton swab;

[0046] More preferably, the anti-pollution detection cotton swab can enhance the colorimetric signal during the detection process;

[0047] Preferably, the anti-pollution colorimetric swab detection and analysis system includes an anti-pollution cotton swab, blue latex microspheres / aptamer, a color difference meter, and a smartphone;

[0048] More preferably, chemical covalent bonding can effectively connect blue latex microspheres and aptamers;

[0049] More preferably, the Salmonella-specific aptamer sequence is as shown by SAT;

[0050] More preferably, for the color difference meter detection and analysis system, the color difference meter is aligned with the cotton swab to read color data. Five points are randomly selected on the surface of each cotton swab to read the values, and the average value of the color data results is taken.

[0051] Detection and analysis principle of the swab of the present invention: First, immerse the anti-pollution cotton swab in the milk sample and incubate for 10 min. At this time, the aptamer on the cotton swab can specifically capture Salmonella in the sample, while SBMA can effectively prevent the approach of non-specific proteins in milk, thus achieving the effect of anti-pollution. Then, wash twice with distilled water to remove the unbound bacteria. Then, immerse the cotton swab in the blue nanospheres / aptamer solution and incubate for 10 min. At this time, the aptamer on the blue nanospheres can specifically recognize the Salmonella carried on the cotton swab, making the cotton swab visibly turn blue to the naked eye. Wash twice with distilled water to remove the unbound blue latex microspheres. Finally, put the cotton swab into a light-tight box, use a portable colorimeter to read the color of the colorimetric cotton swab, and the colorimeter transmits the real-time detection data to the smartphone via Bluetooth to obtain the color data of the anti-pollution colorimetric cotton swab. Finally, obtain the quantitative detection result of Salmonella by calculating the gray value.

[0052] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0053] The present invention establishes a rapid detection method based on an anti-pollution colorimetric swab for the detection of Salmonella in complex milk matrices. First, prepare an amphoteric ion anti-pollution cotton swab, with the recognition element being a Salmonella-specific aptamer, the colorimetric signal being a "blue latex microsphere / aptamer" signal probe, and the anti-pollution material being amphoteric ion SBMA. The sandwich method is used in the detection process, and Salmonella in the milk sample can be qualitatively determined by the naked eye. With the help of a colorimeter and a smartphone as the terminal quantitative device, rapid reading of the colorimetric signal and rapid quantitative detection of Salmonella are achieved. Secondly, in the present invention, by optimizing the experimental conditions, the entire detection process can be completed within 20 min. Compared with the traditional detection method that takes up to 3 - 5 days, this method greatly shortens the detection time. The present invention uses an anti-pollution modified cotton swab to enhance the anti-pollution characteristics of the sensor, avoid interference of non-specific macromolecular substances in milk with the detection signal, and achieve rapid detection without sample pretreatment. The present invention provides the possibility for on-site instant rapid detection.

[0054] (1) This method uses EDC / NHS to activate the aptamer to react with blue latex microspheres to form a blue latex microsphere / aptamer conjugate polymer, forming a sensing detection colorimetric signal probe. And the enzyme-linked immunosorbent assay is used to verify that the aptamer synthesized and designed in this study has good affinity and specificity with Salmonella, meeting the detection requirements.

[0055] (2) Through the optimization of experimental conditions, the optimal aptamer concentrations of the anti-pollution cotton swab and blue latex microspheres were obtained, and the entire detection result could be completed within 20 minutes. Compared with the traditional detection method, the detection time was faster, meeting the requirements of rapid detection. The qualitative result was determined by the naked eye, and the detection result was quantitatively read out by using the detection assembly that combined a portable color difference meter and a smart phone. The operation was simple, providing the possibility for on-site rapid detection law enforcement operations.

[0056] (3) The anti-pollution colorimetric swab sensing platform established by this method achieved high-specific recognition and high-sensitive detection of Salmonella. The linear detection range for Salmonella was 10 3 ~10 7 CFU / mL, and the detection limit was 117.80 CFU / mL. The biosensor in this study was highly specific only for viable Salmonella and could provide reference information on the viable count of pathogenic bacteria in food during the detection.

[0057] (4) By comparing the colorimetric swab method with the national standard method and the traditional plate technology method, it was possible to accurately and efficiently detect milk samples without pretreatment within the detection range. The detection results of the colorimetric swab method were consistent with those of the national standard method and the plate counting method, and the recovery rates were between 94.15% and 108.26%. Description of the Drawings

[0058] Figure 1 It is the schematic diagram of detecting Salmonella by the colorimetric swab based on the quantitative detection of the color difference meter.

[0059] Figure 2 It is the verification result of the anti-pollution ability of the colorimetric swab; Figure a is the comparison result of protein adhesion of cotton swabs in different modification states in milk samples; Figure b is the influence of different cotton swabs on the colorimetric signal.

[0060] Figure 3 It is the optimization result of the aptamer concentration of the cotton swab.

[0061] Figure 4 It is the optimization result of the blue latex microsphere / aptamer concentration.

[0062] Figure 5 It is the optimization result of the detection time.

[0063] Figure 6 It is the sensitivity of the colorimetric swab sensor for detecting different concentrations of Salmonella.

[0064] Figure 7 It is the specificity of the colorimetric swab sensor for detecting Salmonella. Detailed Implementation Modes

[0065] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0066] The blue latex microspheres involved in this article are hydroxyl blue microspheres, purchased from Huataixin Biology CPB-03-10 product, with an average particle size of 0.3-0.39 μm.

[0067] Example 1 Establishment of a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab

[0068] 1. Experimental materials

[0069] 2-(Methacryloyloxy)ethyl dimethyl-(3-sulfopropyl) ammonium hydroxide (SBMA), 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure2595), 10×PBS buffer, Tris-HCl buffer, sodium periodate, hydrochloric acid, sodium chloride, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), bovine serum albumin (BSA), N-hydroxysuccinimide (NHS), etc. are all purchased from commercially available products.

[0070] The nucleic acid sequences used in the experiment are as follows (from 5' to 3'):

[0071] STA-NH 2 :TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG- / NH 2 /

[0072] 2. Design principle of a rapid detection method for Salmonella in complex food matrices based on an anti-pollution colorimetric swab

[0073] A simple, rapid, anti-pollution and sensitive detection method for Salmonella in milk was constructed by sandwich method using an anti-pollution colorimetric swab, blue latex microspheres / aptamers, a color difference meter and a smartphone. First, the anti-pollution cotton swab was immersed in the milk sample and incubated for 10 min. At this time, the aptamer on the cotton swab could specifically capture Salmonella in the sample, while the zwitterionic SBMA hydrogel could effectively prevent the approach of non-specific proteins in milk, thus achieving the anti-pollution effect. Then, it was washed twice with distilled water to remove unbound bacteria. Then, the cotton swab was immersed in the aptamer / blue nanomicrosphere solution and incubated for 10 min. At this time, the aptamer on the blue nanomicrospheres could specifically recognize Salmonella carried on the cotton swab, making the cotton swab visibly turn blue. It was washed twice with distilled water to remove unbound blue latex microspheres. The cotton swab was placed in a dark box, and the color of the colorimetric cotton swab was read using a portable color difference meter. The color difference meter transmitted the real-time detection data to the smartphone via Bluetooth to obtain the RGB value of the anti-pollution colorimetric cotton swab. Finally, the quantitative detection result of Salmonella was obtained by calculating the gray value.( Figure 1 )

[0074] 3. Preparation of anti-pollution cotton swab

[0075] 240 mg of sodium periodate (NaIO 4 ) and 100 μL of concentrated sulfuric acid (H 2 SO 4 ) were added to 10 mL of water and mixed for 10 min. Then the cotton swab was immersed in the solution and incubated at 37 °C in the dark for 4 h to activate the hydroxyl groups to generate aldehyde groups. Then the activated cotton swab was washed twice with distilled water to remove the excess activator. Then it was placed in an oven to dry and stored at 4 °C to obtain the activated cotton swab. The activated cotton swab was immersed in a PBS buffer solution containing 558 mg / mL of SBMA and 1% of Irgacure 2595. After the cotton swab was completely wet, it was irradiated with UV at 365 nm for 20 min, dried, and stored at 4 °C to obtain the SBMA cotton swab. 100 μL of 10 nM aptamer SAT-NH 2 was added to 1 mL of Tris-HCl buffer solution (pH 8.5). The SBMA cotton swab was immersed in the solution and incubated at 37 °C for 4 h, washed twice with Tris-HCl buffer solution (pH 8.5) to remove unbound aptamer, dried, and stored at 4 °C to obtain the anti-pollution cotton swab.

[0076] 4. Verification of the anti-pollution ability of the anti-pollution cotton swab

[0077] The unmodified cotton swab, activated cotton swab, SBMA cotton swab and anti-pollution cotton swab were respectively immersed in the milk sample (protein content about 30 mg / mL) for 10 min. After washing three times with distilled water, the protein remaining on the cotton swab was determined using a BCA protein content assay kit.

[0078] The activated cotton swabs were incubated at 37 °C for 4 h under the optimal aptamer concentration condition, and then dried to obtain unmodified cotton swab swabs. The unmodified cotton swab swabs and the anti-pollution cotton swabs were immersed in the buffer solution and the standard bacterial solution (10 2 CFU / mL) and incubated for 10 min. After washing twice with Tris-HCl buffer solution (pH 8.5), they were incubated in the blue latex microsphere / aptamer suspension for 10 min. The RGB values of the cotton swabs were measured with a color difference meter, and the gray values of the cotton swabs were calculated to obtain the influence on the colorimetric signal of the cotton swabs before and after modification.( Figure 2 )

[0079] 5. Synthesis of blue latex microsphere / aptamer

[0080] Transfer 200 μL of blue latex microsphere solution into a 1 mL centrifuge tube and wash it 3 times with distilled water. Then add freshly prepared EDC (0.57 mg / mL) and NHS (12 mg / mL) for coupling activation. Subsequently, wash the microspheres with distilled water to remove the excess coupling agent. After centrifuging the activated microspheres in distilled water at a speed of 10000 rpm for 10 min, completely aspirate the supernatant. After mixing 20 μL of 10 nM aptamer SAT-NH2 solution with 280 μL of Tris-HCl buffer solution (pH 8.5) evenly, add it to the washed activated microspheres and incubate overnight at 4 °C to help the aptamer fix on the activated nanobeads. Incubate with 1% bovine serum albumin (BSA) at 4 °C for 30 minutes to block the unbound sites of the nanoparticles. Subsequently, wash the nanobeads with Tris-HCl buffer solution (pH 8.5) to remove the unconnected BSA. The prepared blue latex microsphere / aptamer was stored at 4 °C for later use.

[0081] Results of the detection condition optimization in Example 2

[0082] 1. Optimization of the aptamer concentration of the cotton swab

[0083] The prepared dry SBMA cotton swabs were respectively placed into 5 tubes of 1 mL Tris-HCl buffer solution (pH 8.5), and 100 μL of 1 nM, 10 nM, 100 nM, 1000 nM, and 10000 nM aptamer SAT-NH 2 were added to each tube respectively. Incubate at 37 °C for 4 h, wash three times with the buffer solution and then dry. In the standard bacterial solution with the same concentration (10 3Incubate for 10 min in (CFU / mL), wash twice with Tris-HCl buffer (pH 8.5), incubate for 10 min in the blue latex microsphere / aptamer suspension at the same concentration, wash twice with Tris-HCl buffer (pH 8.5), then measure the RGB value of the cotton swab with a color difference meter, calculate the change in the gray value of the cotton swab at different aptamer concentrations, and determine the aptamer concentration required for preparing the aptamer cotton swab.( Figure 3 )

[0084] 2. Optimization of the aptamer concentration of blue latex microspheres

[0085] Incubate the cotton swab with the determined aptamer concentration in the standard bacterial solution at the same concentration (10 5 CFU / mL) for 10 min, wash twice with Tris-HCl buffer (pH 8.5), then incubate separately in the blue latex microsphere suspension bound with 1 nM, 10 nM, 100 nM, 1000 nM, 10000 nM aptamers for 10 min, wash twice with Tris-HCl buffer (pH 8.5), then measure the RGB value of the cotton swab with a color difference meter, calculate the change in the gray value of the cotton swab incubated in the blue latex microspheres at different aptamer concentrations, and determine the aptamer concentration required for preparing the blue latex microsphere / aptamer suspension.( Figure 4 )

[0086] 3. Optimization of the detection time

[0087] Under the condition of the optimal aptamer concentration, immerse the cotton swab in the standard bacterial solution (10 6 CFU / mL) and incubate for 5 min, 10 min, 15 min, 20 min, wash twice with Tris-HCl buffer (pH 8.5), then incubate in the blue latex microsphere / aptamer suspension for 5 min, 10 min, 15 min, 20 min, respectively, to obtain 16 groups of detection cotton swabs with different incubation times, measure the RGB value of the cotton swab with a color difference meter, calculate the change in the gray value of the cotton swab at the incubation time, and determine the optimal detection time.( Figure 5 )

[0088] Determination of the sensitivity of the detection method in Example 3

[0089] According to the above optimization system, dilute the original Salmonella solution with a 10-fold concentration gradient, incubate the anti-pollution cotton swab swab at room temperature for 10 min, and then test the lowest detection limit of the prepared cotton swab. From( Figure 6 ) it can be seen that the colorimetric signal increases with the increase of the Salmonella concentration. Taking the logarithm of the Salmonella concentration as the abscissa and the gray value of the positive sample minus the gray value of the blank control sample as the ordinate, plot the standard curve: y = 6.6803x + 3.0119, R 2= 0.9936, the linear range for Salmonella detection is 10 3 ~10 7 CFU / mL, the detection limit is 117.80 CFU / mL, thus enabling the quantitative detection of Salmonella.

[0090] Selectivity verification of the detection method in Example 4

[0091] According to the above-optimized system, prepare bacterial solutions with a concentration of 10 5 CFU / mL of Salmonella, Escherichia coli, Shigella, Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Salmonella solution after autoclaving, and test the specificity of the prepared cotton swabs. The response signal of the sensor to Salmonella is much greater than that of other pathogenic bacteria, showing good specificity, and this experiment only has a specific detection effect on live Salmonella.( Figure 7 )

[0092] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. A rapid detection method based on an anti-pollution colorimetric swab for complex food matrices, characterized in that, it includes: (1) An anti-pollution cotton swab preparation system, (2) An anti-pollution colorimetric swab detection and analysis system: The anti-pollution cotton swab preparation system refers to modifying and modifying the cotton swab with zwitterionic materials and target aptamer sequences; The anti-pollution colorimetric swab detection and analysis system includes the above-mentioned modified cotton swab, blue latex microspheres / aptamer; The blue latex microspheres / aptamer is a signal probe in the detection system, and the aptamer is the above-mentioned target aptamer sequence; The signal probe is a polymer formed by covalently coupling blue latex microspheres and aptamers; The target aptamer sequence is SAT: 5’-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-3’ wherein the concentration of the target aptamer sequence on the cotton swab is 10 nM, and the concentration of the aptamer of the blue latex microspheres is 10 nM; the cotton swab is incubated for 10 min and incubated in the blue latex microspheres / aptamer suspension for 10 min.

2. The rapid detection method according to claim 1, characterized in that, the zwitterionic material is poly(sulfobetaine methacrylate).

3. The rapid detection method according to claim 1 or 2, characterized in that, the zwitterionic material and the target aptamer sequence are used to modify the surface of the cotton swab by photoinitiated polymerization and immersion method.

4. The rapid detection method according to claim 3, characterized in that, the photoinitiated polymerization method uses ultraviolet irradiation and photoinitiator to achieve the polymerization reaction; the immersion method uses the method of immersion incubation to achieve physical adsorption between polymers.

5. The application of the rapid detection method according to any one of claims 1-4 in the detection of milk products.

6. The application of the rapid detection method according to any one of claims 1-4 in the detection of Salmonella for non-diagnostic purposes.

7. A detection kit, which includes the anti-pollution cotton swab in any one of the detection methods of claims 1-4, and blue latex microspheres / aptamer; it also includes a color difference meter and a smart phone.

Images