A SSR marker fingerprint identification method for the strain of Hylocereus edulis Rongbai 002 (H) and its construction method and application

Abstract

The present invention discloses an SSR marker fingerprint identification method for the genus Agaricus eryngii Rongbai 002 (H) strain, a construction method and an application thereof, including that the fingerprint is composed of 6 pairs of SSR markers. The construction method includes: (1) mycelium culture; (2) genomic DNA extraction; (3) SSR molecular marker detection; (4) capillary electrophoresis detection. The application includes: SSR marker amplification of the genus Agaricus eryngii strain, and the obtained band type is compared with the fingerprint spectrum. The one that is consistent with the group of fingerprint spectrum is the genus Agaricus eryngii Rongbai 002 (H) strain. Compared with conventional morphological detection, antagonistic test and mushroom fruiting test, the present invention has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the genus Agaricus eryngii Rongbai 002 (H) strain among 59 main cultivated strains of genus Agaricus cultivated at home and abroad.

Description

Technical Field

[0001] The invention belongs to the technical field of detection of pleurotus eryngii strains, and specifically relates to an SSR marker fingerprint spectrum identification method of pleurotus eryngii Rongbai 002 (H) strain and a construction method and application thereof. Background Art

[0002] Hypsizygus marmoreus (Peck) HE Bigelow in Latin) belongs to the phylum Basidiomycetes, class Agaricaceae, order Agaricales, family Pleurotus, and is named for the marble pattern on the surface of its cap. It is popular among consumers for its beautiful appearance, tender texture, unique seafood flavor and economical price. Hypsizygus marmoreus not only contains rich vitamins and 18 kinds of amino acids, but also has been found in recent years that the small molecule compounds, polysaccharides and polypeptides contained in Hypsizygus marmoreus have the functions of hemolysis, anti-oxidation, inhibition of leukemia and lymphoma cells, lowering blood lipids, anti-inflammatory and anti-oxidation, and is a kind of food and medicine with high economic value. Since the establishment of the first Hypsizygus factory cultivation enterprise in my country in 2001, Hypsizygus marmoreus has become one of the new edible fungi with rapid development in the Chinese market. In 2019, China's total factory-based production of shiitake mushrooms was 328,000 tons, a year-on-year increase of 58.63% over 2018, accounting for 9.6% of the total factory-based production of edible fungi, ranking third in the total production of factory-cultivated edible fungi in my country.

[0003] High-quality strains play a pivotal role in the factory cultivation of leucopus. At present, the leucopus strains used by my country's factory production enterprises are mainly introduced from Japan or further hybridized and bred on the basis of Japan. The brown fruiting bodies after cultivation are called shimeji mushrooms, and the white fruiting bodies are called white jade mushrooms or jade dragon mushrooms. Although the output of factory production has increased year by year, some strains still have problems such as long cultivation cycle, low yield, poor appearance uniformity of single root fruiting bodies, and easy appearance of tumor caps. These defects may lead to increased production costs and reduce the market competitiveness of products. On the other hand, due to the low diversity of leucopus factory production strains, the product appearance is similar and cannot meet the diverse needs of market consumers. my country has abundant wild and natural cultivation resources of leucopus. Efficient use of these high-quality resources and expansion of the genetic basis of strains are conducive to the selection and breeding of high-yield, high-quality and characteristic leucopus strains in China.

[0004] With the promulgation and implementation of the International Plant Variety Protection Act, establishing a mature, rapid and accurate molecular biological identification technology system has become a powerful means to protect the intellectual property rights of edible fungi varieties. Summary of the invention

[0005] Hypsizygus marmoreus Rongbai 002 (H) was deposited in the China Center for Type Culture Collection on October 26, 2020, address: Wuhan University, Wuhan, China; the deposit number is CCTCC NO: M 2020641.

[0006] The technical problem to be solved by the present invention is to provide an SSR marker fingerprint of the mushroom strain "Rongbai 002 (H)" and a construction method and application thereof. Compared with conventional morphological detection, antagonism test and mushroom fruiting test, the fingerprint has the advantages of short detection time, high accuracy and good repeatability.

[0007] The SSR marker fingerprint of the mushroom strain "Rongbai 002 (H)" of the present invention is composed of 6 pairs of SSR markers. SSR primers are developed based on simple repeat sequence fragments of the mushroom genome, and the amplified SSR primers have good banding and high repeatability. The detailed information of the markers is shown in Table 1:

[0008] Table 1 SSR marker detailed information list

[0009]

[0010] The method for constructing an SSR marker fingerprint of a Pleurotus eryngii "Rongbai 002 (H)" strain of the present invention comprises:

[0011] (1) Mycelium culture: The spawn of Pleurotus eryngii was transferred to potato dextrose agar solid medium and cultured at 22°C for 8 days before collecting the mycelium;

[0012] (2) Extraction of genomic DNA: Use the Meijimei Fungal DNA Extraction Kit to extract genomic DNA according to the kit's experimental steps, and take 2 μl of DNA for 1.2% agarose gel electrophoresis. UV spectrophotometry is used to detect the total genomic DNA concentration and purity, and the concentration of the sample DNA is adjusted to be consistent;

[0013] (3) Development of SSR molecular marker primers: Based on the genome resequencing results of the Pleurotus eryngii strain, 20 pairs of SSR primers were designed and synthesized by selecting polymorphic sequences;

[0014] (4) Detection of SSR molecular markers: PCR amplification of gene SSR markers was performed on the DNA extracted above;

[0015] (5) Electrophoresis detection: The product obtained by the PCR amplification is mixed with formamide loading buffer, denatured, and tested on an electrophoresis machine;

[0016] (6) GeneMapper data analysis.

[0017] The method for constructing the SSR marker fingerprint of the Echinops eryngii Rongbai 002 (H) strain is characterized in that: the extraction of genomic DNA in step (2) comprises:

[0018] (1) Add liquid nitrogen to the fungal sample and grind it thoroughly;

[0019] (2) Quickly add 360 μl of Buffer STE and 40 μl of Buffer SDS to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65°C water bath for 15 min. Invert the centrifuge tube several times during the water bath to mix the sample.

[0020] (3) Add 5 μl RNase Solution to the lysate, vortex to mix, and let stand at room temperature for 15-30 min;

[0021] (4) Add 140 μl Buffer PS, vortex for 30 seconds, and place on ice for 10 minutes;

[0022] (5) Centrifuge at 13,000 g for 5 min at room temperature and carefully transfer 400 μl of the supernatant to a new centrifuge tube;

[0023] (6) Add 600 μl Buffer PBD to the sample and vortex mix for 30 seconds;

[0024] (7) Place the DNA binding column in a collection tube, transfer half of the mixture to the column, and centrifuge at 8000 g for 1 min.

[0025] (8) Discard the filtrate and put the column back into the collection tube, transfer the remaining mixed solution to the column, and centrifuge at 8000g for 1 min;

[0026] (9) Discard the filtrate and return the column to the collection tube. Add 600 μl of Buffer GW2 to the column and centrifuge at 8000 g for 1 min.

[0027] (10) Repeat step 9;

[0028] (11) Discard the filtrate and return the column to the collection tube. Centrifuge at 10,000 g for 2 min to remove the residual ethanol in the column.

[0029] (12) Transfer the column to a new 1.5 ml centrifuge tube, add 30 μl of Buffer AE preheated to 65°C to the center of the column membrane, let stand at room temperature for 2 min, and centrifuge at 10,000 g for 1 min;

[0030] (13) Take 2 μl of DNA for 1.2% agarose gel electrophoresis detection, take 2 μl of DNA for NanoDrop spectrophotometer to measure the concentration, and store the remaining DNA at -20°C.

[0031] The PCR amplification system in step (3) is as follows: a total volume of 10 μl, including: 10×PCR buffer 1 μl, 2.5 mmol / l dNTP 0.8 μl, 5 U / μl TAKARA HSTaq enzyme 0.1 μl, 5 μmol / l TP-M13 0.5 μl, 5 μmol / l SSR marker specific primers with a total volume of 0.6 μl each, 20 ng to 30 ng / μl extracted template DNA 1.2 μl, and 5.2 μl ddH2O;

[0032] PCR reaction conditions: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 95°C for 5 min; 95°C for 30 s, 53°C for 30 s, 72°C for 30 s, 10 cycles; 60°C for 30 min.

[0033] The loading buffer in step (5) is 9 μl of a mixture of molecular weight internal standard and formamide (0.5:8.5); the loading amount of PCR amplification product is 1 μl.

[0034] The specific process of denaturation in step (5) is to denature at 95° C. for 3 minutes, and then cool in an ice-water mixture for 3 minutes.

[0035] The process parameters of electrophoresis in step (5) are as follows: the denatured polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer is 3730buffer EDTA, the injection voltage is 2000V, the operating voltage is 15000V, the injection time is 10s, the temperature is 60°C, the capillary length is 50cm, the power is 200W, the electrophoresis is 20min, and the current and power are both dynamic.

[0036] The data analysis in step (6) is specifically as follows: the raw data file obtained by the detection is imported into the analysis software GeneMapper ID3.2, and the population structure analysis, clustering and heterozygosity analysis, and core germplasm resource calculation and analysis are performed using software such as POPGENE and NTSYS. The number of alleles (Na, Nei), Nei's genetic diversity index (He), Shannon's diversity information index (I) and gene observed heterozygosity (Ho) are analyzed.

[0037] Table 2 Summary of allelic fragment information amplified by SSR primers

[0038]

[0039]

[0040]

[0041] The invention discloses an application of an SSR marker fingerprint map of a "Rongbai 002 (H)" strain of the leucopus mushroom, which is 6 pairs of SSR primers developed by using simple repeat sequence fragments of the leucopus mushroom genome. The invention screens a large number of SSR primers, and amplifies the SSR primer banding patterns of 59 collected main cultivars of the leucopus mushroom, determines the number of allele fragments amplified by the 6 pairs of SSR primers in each cultivar of the leucopus mushroom and numbers them (Table 2). The number combination of different SSR allele sites can effectively identify the "Rongbai 002 (H)" strain in the 59 collected main cultivars. The relative molecular weight of the alleles amplified by each SSR primer can be determined by capillary electrophoresis combined with software analysis. The strain with the "Rongbai 002 (H)" strain-specific SSR allele fragment combination is the "Rongbai 002 (H)" strain of Pleurotus eryngii, and the numbering combination of this strain is: (8+16) / 1 / 2 / (13+1414+13) / 4 / 1.

[0042] Beneficial effects of the present invention: Compared with conventional morphological detection, antagonistic test and fruiting test, the present invention has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24 hours (including extraction of genomic DNA, PCR amplification, electrophoresis analysis and data analysis), while the conventional antagonistic test requires at least two weeks and the fruiting test requires at least three months; the method of the present invention has the specificity of the "Rongbai 002 (H)" strain among the 59 main cultivated strains of commercially available enoki mushrooms collected, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0044] Figure 1 The relative molecular weight peaks of allele sites detected by primer HMSSR5 in the selected cultivation material of Pleurotus eryngii "Rongbai 002 (H)" and several major commercial varieties are shown in the figure;

[0045] Figure 2 The relative molecular weight peaks of allele sites detected by primer HMSSR11 in the selected cultivation material of Pleurotus eryngii "Rongbai 002 (H)" and several major commercial varieties are shown in the figure;

[0046] Figure 3 The relative molecular weight peaks of allele sites detected by primer HMSSR36 in the selected cultivation material of Pleurotus eryngii "Rongbai 002 (H)" and several major commercial varieties are shown in the figure;

[0047] Figure 4 The relative molecular weight peaks of allele sites detected by primer HMSSR47 in the selected cultivation material of Pleurotus eryngii "Rongbai 002 (H)" and several major commercial varieties are shown in the figure;

[0048] Figure 5 The relative molecular weight peaks of allele sites detected by primer HMSSR48 in the selected cultivation material of Pleurotus eryngii "Rongbai 002 (H)" and several major commercial varieties are shown in the figure;

[0049] Figure 6 The relative molecular weight peak diagram of the allele sites obtained by detecting the primer HMSSR61 in the selected Pleurotus eryngii cultivation material "Rongbai 002 (H)" and several major commercial varieties. DETAILED DESCRIPTION

[0050] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0051] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0052] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0053] Embodiment 1:

[0054] (1) Mycelium culture: The spawn of Pleurotus eryngii was transferred to potato dextrose agar solid medium and cultured at 22°C for 8 days before collecting the mycelium;

[0055] (2) Extraction of genomic DNA: Use the Meijimei Fungal DNA Extraction Kit to extract genomic DNA according to the kit's experimental steps, and take 2 μl of DNA for 1.2% agarose gel electrophoresis. UV spectrophotometry is used to detect the total genomic DNA concentration and purity, and the concentration of the sample DNA is adjusted to be consistent;

[0056] The CTAB method for extracting genomic DNA from mycelium includes:

[0057] ① Add liquid nitrogen to the fungal sample and grind it thoroughly;

[0058] ① Quickly add 360μl Buffer STE and 40μl Buffer SDS to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65℃ water bath for 15min. Invert the centrifuge tube several times during the water bath to mix the sample;

[0059] ③ Add 5 μl RNase Solution to the lysate, vortex to mix, and let stand at room temperature for 15-30 minutes;

[0060] ④ Add 140 μl Buffer PS, vortex for 30 seconds, and place on ice for 10 minutes;

[0061] ⑤ Centrifuge at 13000g for 5 min at room temperature and carefully transfer 400 μl of supernatant to a new centrifuge tube;

[0062] ⑥ Add 600 μl Buffer PBD (diluted with anhydrous ethanol) to the sample and vortex mix for 30 seconds;

[0063] ⑦ Place the DNA binding column in a collection tube, transfer half of the mixture to the column, and centrifuge at 8000g for 1 min;

[0064] ⑧Discard the filtrate and put the column back into the collection tube, transfer the remaining mixed solution to the column, and centrifuge at 8000g for 1 min;

[0065] ⑨Discard the filtrate and put the column back into the collection tube, add 600 μl Buffer GW2 (diluted with anhydrous ethanol) to the column, and centrifuge at 8000 g for 1 min;

[0066] ⑩Repeat step 9;

[0067] Discard the filtrate and put the column back into the collection tube, and centrifuge at 10000g for 2 minutes to remove the residual ethanol in the column;

[0068] Transfer the column to a new 1.5 ml centrifuge tube, add 30 μl of Buffer AE preheated to 65°C to the center of the column membrane, let stand at room temperature for 2 min, and centrifuge at 10,000 g for 1 min;

[0069] 2 μl of DNA was used for 1.2% agarose gel electrophoresis, 2 μl of DNA was used for concentration measurement using a NanoDrop spectrophotometer, and the remaining DNA was stored at -20°C.

[0070] (3) Detection of SSR molecular markers: PCR amplification of gene SSR markers was performed on the DNA extracted above;

[0071] The PCR amplification system was as follows: total volume 10 μl, including: 10×PCR buffer 1 μl, 2.5 mmol / l dNTP 0.8 μl, 5 U / μl TAKARAHS Taq enzyme 0.1 μl, 5 μmol / l TP-M13 0.5 μl, 5 μmol / l SSR marker specific primers total volume 0.6 μl each, 20 ng to 30 ng / μl extracted template DNA 1.2 μl, ddH2O 5.2 μl;

[0072] PCR reaction conditions: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 95°C for 5 min; 95°C for 30 s, 53°C for 30 s, 72°C for 30 s, 10 cycles; 60°C for 30 min.

[0073] (4) Electrophoresis detection: 1 μl of the product obtained by the above PCR amplification was mixed with 9 μl of loading buffer, denatured at 95°C for 3 min, and then cooled in an ice-water mixture for 3 min; 3 μl of the sample was spotted on a denaturing polyacrylamide gel for electrophoresis. The denatured polyacrylamide gel was commercial POP7 gel, the electrophoresis buffer was 3730 buffer EDTA, the injection voltage was 2000 V, the operating voltage was 15000 V, the injection time was 10 s, the temperature was 60°C, the capillary length was 50 cm, the power was 200 W, and the electrophoresis was performed for 20 min. Both the current and power were dynamic.

[0074] (5) Results analysis

[0075] Six pairs of SSR primers were used to perform PCR amplification and capillary electrophoresis on the Pleurotus eryngii strains. By analyzing the number of alleles (Na, Ne), Nei's genetic diversity index (He), Shannon's diversity information index (I) and gene observed heterozygosity (Ho), combined with the relative molecular weight peak graph of the allele sites, the strains with the number combination of HMSSR5, HMSSR11, HMSSR36, HMSSR47, HMSSR48, and HMSSR61 and the corresponding band type of (8+16) / 1 / 2 / (13+1414+13) / 4 / 1 were found, and the strain was identified as the Pleurotus eryngii "Rongbai 002 (H)" strain. To ensure the accuracy of identification, it is recommended to repeat the experiment three times.

[0076] Taking several major commercial varieties as examples, the relative molecular weight peaks of allele sites detected by 6 pairs of primers are given, as shown in Figures 1 to 6 As shown (in order: ① Rongbai 002 (H) ② K ③ B2 ④ 15-X2 ⑤ 14-X1 ⑥ 13-X6 ⑦ H2 ⑧ B3027 ⑨ X5 ⑩ DTG B4).

[0077] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention. Sequence Listing <110> Shanghai Rongmei Agricultural Technology Co., Ltd. Jiangsu Runzheng Biotechnology Co., Ltd. <120> A SSR marker fingerprint identification method for the strain of Hylocereus edulis Rongbai 002 (H) and its construction method and application <130> 2021040709-zf-wjn <141> 2021-04-07 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 cacaccttac gaggtgagca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tgtttgatgt tagccgaacg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ggagtttgag ttgaggcagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 atgaaccaga ccaaagaccg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 tcttcttgta gagcgcctcg 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 ctctcgacgc gtgttcct 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 tctcatggaa cgacctggag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 tccaaatcca gactcttcgc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 gccgtgtgac accaaataca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 acatctaacc gacccacgac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 cttccttgtc ccgacatgat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ggctcggcct tagtgtgtaa 20

Claims

1. A type of shimeji mushroom ( Hypsizygus marmoreus ) The SSR marker fingerprint identification method of Rongbai 002(H) strain is characterized by: The fingerprint map consists of 6 pairs of SSR markers, and the specific sequences of the corresponding 6 pairs of primers are as follows: HMSSR5 forward primer: CACACCTTACGAGGTGAGCA; Reverse primer: TGTTTGATGTTAGCCGAACG; HMSSR11 forward primer: GGAGTTTGAGTTGAGGCAGC; Reverse primer: ATGAACCAGACCAAAGACCG; HMSSR36 forward primer: TCTTCTTGTAGAGCGCCTCG; Reverse primer: CTCTCGACGCGTGTTCCT; HMSSR47 forward primer: TCTCATGGAACGACCTGGAG; Reverse primer: TCCAAATCCAGACTCTTCGC; HMSSR48 forward primer: GCCGTGTGACACCAAATACA; Reverse primer: ACATCTAACCGACCCACGAC; HMSSR61 forward primer: CTTCCTTGTCCCGACATGAT; Reverse primer: GGCTCGGCCTTAGTGTGTAA; The corresponding belt type number combination is: (8+16) / 1 / 2 / (14+13) / 4 / 1; The band number corresponding to primer HMSSR5 is 8+16; the band size of the allele fragment corresponding to band number 8 is 206~206.99bp, and the band size of the allele fragment corresponding to band number 16 is 236~236.99bp; The band number corresponding to primer HMSSR11 is 1, and the band size of the corresponding allele fragment is 263~263.99bp; The band number corresponding to primer HMSSR36 is 2, and the band size of the corresponding allele fragment is 153~153.99bp; The band number corresponding to primer HMSSR47 is 14+13, of which the band size of the allele fragment corresponding to band number 14 is 114~114.99 bp, and the band size of the allele fragment corresponding to band number 13 is 143~143.99 bp; The band number corresponding to primer HMSSR48 is 4, and the band size of the corresponding allele fragment is 118~118.99bp; The band number corresponding to primer HMSSR61 is 1, and the band size of the corresponding allele fragment is 142~142.99bp; The Echinoderma eryngii Rongbai 002 (H) strain was deposited in the China Center for Type Culture Collection on October 26, 2020, with the collection number CCTCC NO: M 2020641.

2. The enoki mushroom according to claim 1 ( Hypsizygus marmoreus )Application of SSR marker fingerprint of Rongbai 002(H) strain, characterized by: The SSR marker fingerprint of the Pleurotus eryngii Rongbai 002 (H) strain is used to identify the specific allelic variation of the Pleurotus eryngii Rongbai 002 (H) strain and / or to identify the specificity of the Pleurotus eryngii Rongbai 002 (H) strain.

Images