Application of SNP molecular marker related to rice bacterial blight resistance and primer composition thereof

By using KASP marker technology and specific primer combinations to detect SNP polymorphisms in the rice genome, the problems of cumbersome and costly traditional detection methods have been solved, enabling rapid and accurate identification of rice bacterial blight resistance and improving breeding efficiency.

CN115029466BActive Publication Date: 2026-05-08INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2022-04-14
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies are insufficient for quickly and accurately identifying resistance to bacterial blight in rice, and traditional detection methods are cumbersome and costly, making them unsuitable for high-throughput molecular detection platforms.

Method used

Using KASP marker technology, specific primer combinations were designed to detect SNP polymorphisms in the rice genome, especially the A/G polymorphism at 15471465bp on rice chromosome 5. Combined with fluorescent probes, genotyping was performed to achieve rapid identification of rice bacterial blight resistance.

Benefits of technology

It enables rapid and accurate identification of rice bacterial blight resistance, reduces detection costs, is suitable for high-throughput molecular detection platforms, and improves rice breeding efficiency and breeding level.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003595828960000101
    Figure BDA0003595828960000101
  • Figure BDA0003595828960000111
    Figure BDA0003595828960000111
  • Figure BDA0003595828960000121
    Figure BDA0003595828960000121
Patent Text Reader

Abstract

The application discloses a SNP molecular marker for identifying or assisting in identifying rice bacterial leaf blight resistance and a primer composition thereof. The method comprises detecting polymorphism or genotype (allele) of an SNP site in a genome of a rice to be detected, and identifying or assisting in identifying rice bacterial leaf blight resistance according to the genotype, wherein the SNP site is a site on a chromosome 5 of the rice, and the nucleotide type is A or G, which is the 30th nucleotide in sequence 4 in a sequence table. The method can be used for predicting rice bacterial leaf blight resistance and rice breeding. The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as a substance for detecting single nucleotide polymorphism or genotype of other molecular markers related to rice bacterial leaf blight resistance) to prepare a product for identifying rice bacterial leaf blight resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene biotechnology, specifically relating to the application of an SNP molecular marker related to resistance to bacterial blight in rice and its primer composition. Background Technology

[0002] Rice bacterial blight, caused by *Xanthomonas oryzae* pv. oryzae (Xoo), is an important bacterial disease in rice cultivation worldwide. For a long time, breeding and planting resistant varieties have played a crucial role in controlling bacterial blight. Developing molecular markers for detecting rice bacterial blight resistance is of significant application value in screening resistant rice germplasm resources and in rapidly identifying resistant plants during the breeding process.

[0003] KASP (Kompetitive Allele-Specific PCR) achieves genotyping by specifically recognizing gene loci using fluorescent probes, and can be used to detect SNP and InDel loci. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers offer advantages such as rapid detection, low cost, and ease of large-scale application. KASP markers do not require genotyping based on DNA fragment size, overcoming the relatively cumbersome and low-throughput drawbacks of traditional gel electrophoresis methods, making them suitable for high-throughput molecular detection platforms. Therefore, identifying functional SNP loci associated with rice bacterial blight resistance and developing KASP molecular markers suitable for high-throughput molecular detection platforms is of significant application value for improving rice breeding efficiency and breeding level in my country. Summary of the Invention

[0004] The problem to be solved by this invention is how to identify or assist in the identification of rice bacterial blight resistance.

[0005] To address the above technical problems, this invention first provides the application of a substance for detecting SNP polymorphisms or genotypes in the rice genome in any of the following situations:

[0006] (1) To identify or assist in the identification of rice bacterial blight resistance;

[0007] (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight;

[0008] (3) Screening or breeding rice plants, lines, strains or varieties susceptible to bacterial blight;

[0009] (4) Rice breeding;

[0010] (5) Prepare products for identifying or assisting in the identification of rice bacterial blight resistance;

[0011] (6) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight;

[0012] (7) Prepare products for screening or breeding rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0013] (8) Preparation of rice breeding products;

[0014] The SNP site is a site on rice chromosome 5, and its nucleotide type is A or G, which is the 30th nucleotide of sequence 4 in the sequence listing.

[0015] Using the Nipponbare genome sequence as a reference genome, the SNP site is located at 15471465 bp on rice chromosome 5 (specifically, position 30 of sequence 4 in the sequence listing).

[0016] This invention also provides a method for identifying or assisting in the identification of rice bacterial blight resistance, comprising detecting the genotype of the SNP locus in the genome of the rice to be tested, and identifying or assisting in the identification of rice bacterial blight resistance based on the genotype, wherein the genotype is AA, AG, or GG, wherein GG is a homozygous type of the SNP locus being G, AA is a homozygous type of the SNP locus being A, and AG is a heterozygous type of the SNP locus being both A and G.

[0017] Optionally, according to the above method, the identification or auxiliary identification of rice bacterial blight resistance can be carried out in any of the following ways:

[0018] (1) Rice varieties with genotypes of AA or AG at the SNP loci are or candidate rice varieties resistant to bacterial blight.

[0019] (2) The rice species tested with the genotype GG at the SNP locus is or is a candidate for rice species susceptible to bacterial blight.

[0020] (3) The bacterial blight resistance of the tested rice with the genotype AA or AG at the SNP site is higher than that of the tested rice with the genotype GG at the SNP site.

[0021] As one implementation method, the method for identifying or assisting in the identification of rice bacterial blight resistance may include the following steps:

[0022] (1) Using the genomic DNA of the rice to be tested as a template, KASP was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C;

[0023] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-40 of sequence 1 in the sequence listing;

[0024] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-40 of sequence 2 in the sequence listing;

[0025] Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing.

[0026] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the rice to be tested;

[0027] (3) Identify the bacterial blight resistance of the rice to be tested based on the genotype results: The bacterial blight resistance of the rice to be tested with the genotype AA or AG at the SNP locus is higher than that of the rice to be tested with the genotype GG at the SNP locus.

[0028] In the above method, the primer dissolution and preparation method can be as follows: first, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution as follows: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL.

[0029] In the above method, the KASP reaction system can be: 1 μL template solution, 0.14 μL primer working solution, 5 μL KASPHiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0030] In the above method, KASP can be performed on a BIO-RAD T100 Thermal Cycler PCR amplification instrument.

[0031] In the above method, the reaction procedure of KASP can be:

[0032] Step 1: Pre-denaturation at 94℃ for 10 min;

[0033] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0034] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 44 cycles.

[0035] The above method can be used to determine the genotype of the SNP in the rice to be tested as follows: perform fluorescence reading on an ABI 7500 real-time PCR instrument at a temperature of 35℃ for 30 seconds, and use the terminal fluorescence value to perform genotyping.

[0036] The application of the above-described methods in rice breeding also falls within the scope of protection of this invention.

[0037] This invention also provides a method for rice breeding.

[0038] The rice breeding method provided by this invention is M1 or M2:

[0039] M1. The method includes detecting the genotype of the SNP locus in the rice genome, selecting rice with the genotype AA or AG at the SNP locus as parents for breeding, wherein AA is a homozygous type with the SNP locus A, and AG is a heterozygous type with the SNP locus A and G. The breeding objective of the method includes selecting rice with resistance to bacterial blight.

[0040] M2. The method includes detecting the genotype of the SNP locus in the rice genome, selecting rice with the genotype GG at the SNP locus as a parent for breeding, wherein GG is a homozygous type of the SNP locus G, and the breeding objective of the method includes selecting rice susceptible to bacterial blight.

[0041] As an implementation method, rice breeding methods may include the following steps:

[0042] (1) Using the genomic DNA of the rice to be tested as a template, KASP was performed using the above primer set;

[0043] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the rice to be tested;

[0044] (3) Select AA genotype rice for bacterial blight resistance breeding.

[0045] In the method described, the primer dissolution and preparation method can be as follows: first, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution as follows: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL.

[0046] In the method described, the KASP reaction system may consist of: 1 μL template solution, 0.14 μL primer working solution, 5 μL KASPHiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0047] In this method, KASP can be performed on a Bio-Rad T100 Thermal Cycler PCR amplification instrument.

[0048] In the aforementioned method, the KASP reaction procedure can be as follows:

[0049] Step 1: Pre-denaturation at 94℃ for 10 min;

[0050] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0051] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 44 cycles.

[0052] The method for determining the genotype of the SNP site in the rice to be tested is as follows: A fluorescence plate is read using an ABI 7500 real-time PCR instrument at a temperature of 35°C for 30 seconds, and the fluorescence value is read from the terminal ends for genotyping.

[0053] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the rice genome.

[0054] The product provided by this invention for detecting polymorphisms or genotypes of SNP sites in the rice genome is any one of the aforementioned substances for detecting SNP site polymorphisms or genotypes in the rice genome.

[0055] C1) Products that detect single nucleotide polymorphisms or genotypes related to resistance to rice bacterial blight;

[0056] C2) Products used to identify or assist in identifying resistance to rice bacterial blight;

[0057] C3) Products used in rice breeding;

[0058] C4) Screening or breeding of rice single plants, lines, strains or varieties resistant to bacterial blight;

[0059] C5) Screening or breeding of rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0060] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0061] Optionally, the substance is D1), D2), or D3):

[0062] D1) The substance described is a primer composition for amplifying rice genomic DNA fragments including the SNP sites;

[0063] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0064] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0065] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0066] D3) The kit may further include a specific probe set. The specific probe set includes fluorescent probe A, quencher probe A, fluorescent probe B, and quencher probe B; fluorescent probe A, as shown in sequence 5 of the sequence listing, has a fluorescent group attached to its 5' end; fluorescent probe B, as shown in sequence 6 of the sequence listing, has a fluorescent group attached to its 5' end; the fluorescent groups in fluorescent probe A and fluorescent probe B are different; quencher probe A, as shown in sequence 7 of the sequence listing, has a quencher group attached to its 3' end; quencher probe B, as shown in sequence 8 of the sequence listing, has a quencher group attached to its 3' end. Fluorescent probe A may specifically be attached to the FAM fluorescent group. Fluorescent probe B may specifically be attached to the HEX fluorescent group. Quencher probe A may specifically be attached to the quencher group BHQ. Quencher probe B may specifically be attached to the quencher group BHQ.

[0067] The kit described in D3 may also include KASP HiGeno 2x Probe Mix.

[0068] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-40 of Sequence 1 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-40 of Sequence 2 in the sequence listing, and single-stranded DNA with nucleotide sequences of Sequence 3 in the sequence listing. The primer composition may also be a primer set consisting of single-stranded DNA shown in Sequence 1, Sequence 2, and Sequence 3 in the sequence listing. Sequence 1 in the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-40 being the specific sequence; Sequence 2 in the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-40 being the specific sequence.

[0069] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 4 of the sequence listing.

[0070] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following:

[0071] (1) To identify or assist in the identification of rice bacterial blight resistance;

[0072] (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight;

[0073] (3) Screening or breeding rice plants, lines, strains or varieties susceptible to bacterial blight;

[0074] (4) Rice breeding;

[0075] (5) Prepare products for identifying or assisting in the identification of rice bacterial blight resistance;

[0076] (6) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight;

[0077] (7) Prepare products for screening or breeding rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0078] (8) Prepare rice breeding products.

[0079] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0080] In this study, it was found that rice resistant to bacterial blight exhibited higher resistance to bacterial blight than rice susceptible to bacterial blight.

[0081] In this article, rice resistant to bacterial blight can specifically refer to rice with leaf lesion length less than or equal to 5 cm in the disease resistance test.

[0082] In this article, rice susceptible to bacterial blight can specifically refer to rice with leaf lesions longer than or equal to 10 cm in the disease resistance test.

[0083] The disease resistance test was conducted as follows: during the peak tillering stage of rice plants, the leaves of the rice variety to be tested were inoculated with a bacterial suspension of bacterial blight pathogen using the leaf-cutting method, and the length of the lesions on the leaves was measured 3 weeks after inoculation.

[0084] The specific bacterial blight strain mentioned can be strain GD1358.

[0085] The concentration of the bacterial suspension can specifically be 10. 8 cfu / mL.

[0086] The specific method for preparing the bacterial suspension is as follows: inoculate strain GD1358 onto PSA solid medium, incubate at 28°C for 48 hours, and wash off the colonies with sterile water to obtain the bacterial suspension.

[0087] For details on the manual leaf-pruning method, please refer to the reference "Kauffman HE, Reddy AP K, Hsieh SP, et al. A improved technique for evaluation of resistance of rice varieties to Xanthomonasoryzea[J]. Plant Dis Rep, 1973, 57: 537-541".

[0088] The bacterial blight mentioned above can specifically be caused by GD1358 or other bacterial blight strains.

[0089] One of the most common types of snowflakes is DV 86::IRGC8840-1, AUS 295::IRGC 29083-1、AUS 308::IRGC 29096-1、DJ 47::IRGC 8497-1、AUS344::IRGC29131-1、DL 5::IRGC 8593-1、HANPA::IRGC 27547-2、UCP 41::IRGC8742-1、M 142::IRGC35054-1、AUS 219::IRGC 29031-1、KALIA::IRGC 34699-1、ARC7001::IRGC 20436-1、CHANDARHAT::IRGC 25845-1、PANKHIRAJ::IRGC 24139-1、KACHILON::IRGC 27555-1、AUS299::IRGC 29087-1、AUS 329::IRGC 29116-1, Hongkezhenuo, Mowangguneiza, Jinzhinuo4, Fanhaopi, E ZI 110::IRGC 70201-1, Qitoubaigu3, Haohuangla, Zhongyouzao81, Youngian, Menjiading 2, QUN XUAN ZAO::IRGC 70371-1、TN1、Heimangdao、Zaoxian 14、Vietnam Zaodao、2037(Rajahamsal)、Zaoxian 240 Haoxiang, Xianluosichi, Nanxiongzaoyouzhan, Sanbaili, Zacaodao 13, Laozaogu, BETSILAIZINA::GERVEX 8405-C1, Tianhandao, MARHARORA::IRGC 63511-1, IFUGAO RICE::IRGC 8052-1、SHANGYIPA::IRGC64928-1、ARC 11777::IRGC 21639-1、Yu Qiu Gu、AMBOHIMANDAY::IRGC 68330-1、Xiangdao、Jiefangxian、AUS 171::IRGC 29004-1, BURI BURING::IRGC 64174-1, DM49::IRGC 8775-1, IR 63380-16::C1, KALIBAJARI::IRGC 67718-1.

[0090] The rice varieties tested above are offspring obtained from any one or two of the following rice materials as parents: DV86::IRGC 8840-1, AUS 295::IRGC 29083-1, AUS 308::IRGC 29096-1, DJ 47::IRGC8497-1, AUS 344::IRGC 29131-1, DL 5::IRGC 8593-1, HANPA::IRGC 27547-2, UCP41::IRGC 8742-1, M 142::IRGC 35054-1, AUS 219::IRGC 29031-1, KALIA::IRGC34699-1, ARC 7001::IRGC 20436-1, CHANDARHAT::IRGC 25845-1, PNKHIRAJ::IRGC24139-1, KACHILON::IRGC 27555-1, AUS 299::IRGC 29087-1, AUS 329::IRGC 29116-1, Hongkezhenuo, Mowangguneiza, Jinzhinuo4, Fanhaopi, E ZI110::IRGC 70201-1, Qitoubaigu3, Haohuangla, Zhongyouzao 81, Younian, Menjiading2, QUN XUAN ZAO::IRGC70371-1, TN1, Heimangdao, Zaoxian 14, Vietnam Zaodao, 2037(Rajahamsal), Zaoxian240, Haoxiang, Xianluosichi, Nanxiongzaoyouzhan, Sanbaili, Zacaodao 13. Laozaogu, BETSILAIZINA::GERVEX 8405-C1, Tianhandao, MARHARORA::IRGC 63511-1, IFUGAO RICE::IRGC 8052-1, SHANGYIPA::IRGC64928-1, ARC 11777::IRGC 21639-1, Yu Qiu Gu, AMBOHIMANDAY::IRGC 68330-1, Xiangdao, Jiefangxian, AUS 171::IRGC 29004-1, BURIBURING::IRGC 64174-1, DM49::IRGC 8775-1, IR 63380-16::C1, KALIBAJARI::IRGC67718-1.

[0091] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with rice resistance to bacterial blight) to prepare products for identifying rice varieties resistant to bacterial blight.

[0092] This invention provides a primer composition and a method for identifying or assisting in the identification of rice bacterial blight resistance using the primer composition. The method established by this invention can be used to predict rice resistance to bacterial blight, for early screening of rice varieties, and for marker-assisted breeding of rice. It has significant application value in the research of discovering bacterial blight-resistant rice germplasm resources and breeding bacterial blight-resistant rice varieties. Attached Figure Description

[0093] Figure 1 This is a graph showing the genotype test results. Detailed Implementation

[0094] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0095] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0096] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0097] The rice materials used in the following examples are all publicly described in the reference: Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703):43-49. The public can obtain the biological materials from the applicant. The biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0098] The bacterial blight pathogen GD1358 in the following examples is strain GD1358 from the following literature: "Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight pathogen in rice in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88". It can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0099] HiGeno 2x Probe Mix: Beijing Jiacheng Biotechnology Co., Ltd., Product No.: AQP-001S.

[0100] Example 1: Detection of rice resistance to bacterial blight using SNPs

[0101] 1. Discovery of SNP markers associated with resistance to bacterial blight in rice

[0102] Thirty-fourty rice varieties were selected from the globally sequenced (average depth 14×) core rice germplasm resources (Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703):43-49.) as experimental materials and inoculated with rice strain Xoo GD1358. Based on the high-density SNP genotypes, genome-wide association analysis was performed on the resistance and susceptibility phenotypes of the 340 rice varieties to bacterial blight. Combined with linkage disequilibrium (LD) analysis, a region associated with bacterial blight resistance was found on chromosome 5. The SNP locus within this region that was most significantly associated with bacterial blight resistance was selected for further analysis. Using the Nipponbare genome sequence as a reference genome, the SNP locus was located at 15471465 bp on chromosome 5. The SNP locus (SNP-15471465) and its surrounding nucleotides are shown in Sequence 4 of the sequence listing, where the 30th nucleotide is the SNP locus, exhibiting an A / G polymorphism. In Sequence 4, r represents either a or g. The genotypes of this SNP locus are AA, AG, or GG. GG is the homozygous type for the G genotype at the SNP locus, AA is the homozygous type for the A genotype at the SNP locus, and AG is the heterozygous type for both A and G genotypes at the SNP locus. Rice varieties with the genotype AA or AG at this SNP locus show significantly higher resistance to bacterial blight than rice varieties with the genotype GG at this SNP locus.

[0103] 2. Convert SNP markers to KASP markers and design a primer set for detecting these markers.

[0104] SNP markers were converted to KASP markers for use in marker-assisted selection breeding.

[0105] A primer set for detecting KASP markers based on KASP technology was designed, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C).

[0106] The nucleotide sequence of primer A is shown in Sequence 1 of the sequence listing.

[0107] Sequence 1: 5'- GAAGGTGACCAAGTTCATGCT GTGCGGGAGAGGGTGCGGC-3'.

[0108] The nucleotide sequence of primer B is shown in Sequence 2 of the sequence listing.

[0109] Sequence 2: 5'- GAAGGTCGGAGTCAACGGATT GTGCGGGAGAGGGTGCGGT-3'.

[0110] The nucleotide sequence of primer C is shown in Sequence 3 of the sequence listing.

[0111] Sequence 3: 5'-GAGGCCCGGCATCAGTGGAT-3'.

[0112] SNP-15471465 is the 30th nucleotide of the DNA molecule shown in sequence 4 of the sequence listing in the rice genome.

[0113] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the G fragment of SNP-15471465. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument.

[0114] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment A of SNP-15471465. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0115] 3. Establishment of a method for detecting resistance to bacterial leaf blight in rice

[0116] 3.1. Genomic DNA was extracted from the leaves of the rice plants to be tested and diluted to obtain a template solution. The DNA concentration in the template solution was 30-40 ng / μL.

[0117] 3.2 Perform KASP.

[0118] Primer working solution: First, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution according to the following formula: Primer A 12μL, Primer B 12μL, Primer C 30μL, ddH2O 46μL.

[0119] KASP HiGeno 2x Probe Mix is ​​a product of Beijing Jiacheng Biotechnology Co., Ltd. (Catalog No. AQP-001S). KASP HiGeno 2x Probe Mix contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, high-fidelity Taq enzyme, dNTPs, and Mg. 2+ The sequence of fluorescent probe A is 5'-GAAGGTGACCAAGTTCATGCT-3', with a FAM fluorescent group attached to the 5' end. The sequence of fluorescent probe B is 5'-GAAGGTCGGAGTCAACGGATT-3', with a HEX fluorescent group attached to the 5' end. The sequence of quenching probe A is 5'-AGCATGAACTTGGTC. ACCTTC -3', the 3' end is connected to the quencher group BHQ. The sequence of the quencher probe B is 5'-AATCCGTTGACTCCG ACCTTC -3', the 3' end is connected to the quenching group BHQ.

[0120] The KASP reaction system consisted of 1 μL template solution, 0.14 μL primer working solution, 5 μL KASP HiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0121] KASP was performed on a Bio-Rad T100 Thermal Cycler PCR amplification instrument using the Touch-down PCR amplification program.

[0122] KASP's response procedure:

[0123] Step 1: Pre-denaturation at 94℃ for 10 min;

[0124] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0125] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 44 cycles.

[0126] The experiment also included a blank control (NTC) in the reaction system without template DNA, with one or more blank controls in each plate.

[0127] 3.3 Perform fluorescence scanning.

[0128] After completing step 2, perform fluorescence reading on an ABI 7500 real-time PCR instrument at 35°C for 30 seconds, and use the terminal ends to read the fluorescence values ​​for genotyping.

[0129] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.

[0130] If only the HEX group shows a fluorescent signal, the genotype of the rice SNP-15471465 to be tested is AA (i.e., SNP-15471465 in the rice genome is homozygous for A); if only the FAM group shows a fluorescent signal, the genotype of the rice SNP-15471465 to be tested is GG (i.e., SNP-15471465 in the rice genome is homozygous for G); if both the FAM and HEX groups show fluorescent signals, the genotype of the rice SNP-15471465 to be tested is AG (i.e., SNP-15471465 in the rice genome is heterozygous for both A and G).

[0131] 4. Actual testing of rice bacterial leaf blight resistance

[0132] 4.1. Inoculate bacterial blight pathogen GD1358 onto PSA solid medium, incubate at 28℃ for 48 h, and wash off the colonies with sterile water to prepare a 10% concentration. 8 A bacterial suspension of cfu / mL.

[0133] 4.2 Select 55 rice materials from Table 1 as experimental materials. Sow the rice seeds to be tested in seedling trays containing nutrient soil that has been sprayed with soil fungicide. After being cultivated in a greenhouse for about 25 days, transplant them to a net house for planting. Each variety was set up with 3 replicates, with 2 rows planted in each replicate and 6 seedlings transplanted in each row.

[0134] 4.3. During the peak tillering stage of rice plants in step 4.2, take the bacterial suspension obtained in step 1 and artificially inoculate the rice plants using the manual leaf cutting method (refer to the literature: Kauffman HE, Reddy AP K, Hsieh SPY, et al. A improved technique for evaluation of resistance of rice varieties to Xanthomonasoryzea[J]. Plant Dis Rep, 1973, 57: 537-541). Inoculate 5-6 leaves per plant.

[0135] 4.4 After completing step 4.3, continue cultivation for 21 days. After 21 days, measure the length of lesions on the leaves of each plant. There is one lesion along the vein of each leaf. Measure the length of lesions on 3 inoculated leaves of each plant. Repeat the survey for 6 plants and take the average length of the lesions. According to the grading standard of Fang Zhongda et al. (1990), rice varieties are classified into resistance and susceptibility types: lesion length <3cm, 3cm≤lesion length<5cm, 5cm≤lesion length<10cm, 10cm≤lesion length<15cm and lesion length≥15cm are respectively classified as resistant, moderately resistant, moderately susceptible, susceptible and highly susceptible (Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight of rice in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88).

[0136] The results are shown in Table 1. Of the 55 rice materials, 17 were resistant to bacterial blight and 38 were susceptible to bacterial blight.

[0137] 5. Identification of rice bacterial blight resistance using SNP-15471465

[0138] The genotype of SNP-15471465 in the rice sample was detected according to the method in step 3. The bacterial blight resistance of the rice sample was then determined based on the genotype results: if the genotype of SNP-15471465 was AA or AG, the rice sample was resistant to bacterial blight. If the genotype was GG, the rice sample was susceptible to bacterial blight. The bacterial blight resistance of the resistant rice was higher than that of the susceptible rice.

[0139] The results are shown in Tables 1 and 2. Figure 1 . Figure 1 In the above, AA represents the rice material with the genotype AA for SNP-15471465, AG represents the rice material with the genotype AG for SNP-15471465, GG represents the rice material with the genotype GG for SNP-15471465, and NTC represents the blank control in the reaction system without the addition of template DNA.

[0140] Table 1. Leaf lesion length and SNP genotypes after rice germplasm resources were inoculated with bacterial blight pathogen GD1358.

[0141]

[0142]

[0143]

[0144] The results showed that the genotypes of 17 bacterial blight-resistant rice accessions (SNP-15471465) were all AA / AG; while the genotype of 38 bacterial blight-susceptible rice accessions (SNP-15471465) was GG. Rice accessions with genotypes AA and AG showed significantly higher resistance to bacterial blight than those with genotype GG. According to the grading criteria for resistance levels of rice bacterial blight by Fang Zhongda et al. (Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of rice bacterial blight pathogen in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88), rice varieties with genotype AA of SNP-15471465 showed resistance to bacterial blight at the resistant or moderately resistant level, while rice varieties with genotype AG showed moderately resistant resistance to bacterial blight.

[0145] The results of this invention in identifying rice bacterial blight resistance using SNP-15471465 are consistent with the actual results of rice bacterial blight resistance testing. Therefore, by detecting polymorphisms or genotypes of SNP-15471465 in the rice genome, rice bacterial blight resistance can be identified rapidly and accurately.

[0146] In breeding rice resistant to bacterial blight, it is best to select rice with the genotype AA or AG at the SNP locus as the parent for breeding; in breeding rice susceptible to bacterial blight, it is best to select rice with the genotype GG at the SNP locus as the parent for breeding.

[0147] Table 2. Analysis of the relationship between SNP-15471465 genotype and resistance to rice bacterial blight.

[0148] genotype Lesion length (cm) Resistance to bacterial blight AA <![CDATA[2.8±1.2 a ]]> Disease resistance AG <![CDATA[4.0±0.3 b ]]> Moderate disease resistance GG <![CDATA[26.8±6.1 c ]]> Highly susceptible to disease

[0149] Note: Different superscript letters in the same column indicate significant differences (P<0.05).

[0150] Table 2 shows that the average lesion length of homozygous AA and heterozygous AG rice varieties was 2.8 cm and 4.0 cm, respectively, indicating that both AA and AG genotypes showed resistance or moderate resistance to bacterial blight. The average lesion length of homozygous GG rice varieties was 26.8 cm, and all of them were susceptible to the disease. There were significant differences in lesion length among the three genotypes.

[0151] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Institute of Crop Science, Chinese Academy of Agricultural Sciences <120> Application of SNP molecular markers related to resistance to rice bacterial blight and their primer compositions <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <400> 1 gaaggtgacc aagttcatgc tgtgcgggag agggtgcggc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <400> 2 gaaggtcgga gtcaacggat tgtgcgggag agggtgcggt 40 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gaggcccggc atcagtggat 20 <210> 4 <211> 48 <212> DNA <213> Artificial Sequence <400> 4 gaggcccggc atcagtggat cccctcctcr ccgcaccctc tcccgcac 48 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 gaaggtgacc aagttcatgc t 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 gaaggtcgga gtcaacggat t 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 agcatgaact tggtcacctt c 21 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence <400> 8 aatccgttga ctccgacctt c 21

Claims

1. The application of substances for detecting SNP polymorphisms or genotypes in the rice genome in any of the following: (1) To identify or assist in the identification of rice bacterial blight resistance; (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight; (3) Screening or breeding of rice individual plants, lines, strains or varieties susceptible to bacterial blight; (4) Prepare products for identification or auxiliary identification of rice bacterial blight resistance; (5) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight; (6) Prepare or select rice single plants, lines, strains or varieties susceptible to bacterial blight; The SNP site is a site on rice chromosome 5, and its nucleotide type is A or G, which is the 30th nucleotide of sequence 4 in the sequence listing.

2. The application according to claim 1, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying rice genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

3. The application according to claim 2, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-40 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-40 of sequence 2 in the sequence listing; The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

4. A method for identifying or assisting in the identification of rice bacterial blight resistance, characterized in that: This includes detecting the genotype of SNP sites in the genome of rice to be tested, and identifying or assisting in the identification of rice bacterial blight resistance based on the genotype. The SNP site is a site on chromosome 5 of rice, and its nucleotide type is A or G, which is the 30th nucleotide of sequence 4 in the sequence listing. The genotype of the SNP site is AA, AG, or GG, where GG is the homozygous type of the SNP site with G, AA is the homozygous type of the SNP site with A, and AG is the heterozygous type of the SNP site with both A and G. The identification or auxiliary identification of rice bacterial blight resistance is carried out in any of the following ways: 1) Rice varieties with genotypes of AA or AG at the SNP loci are, or candidate, rice varieties resistant to bacterial blight. 2) The rice species tested with the genotype GG at the SNP locus is or is a candidate for rice species susceptible to bacterial blight; 3) The bacterial blight resistance of the tested rice with the genotype AA or AG at the SNP locus is higher than that of the tested rice with the genotype GG at the SNP locus, and the bacterial blight resistance of the tested rice with the genotype AA at the SNP locus is higher than that of the tested rice with the genotype AG at the SNP locus.

5. The application of the method described in claim 4 in rice breeding.

6. A method for rice breeding, characterized by: The method is M1 or M2: M1. The method includes detecting the genotype of the SNP locus in claim 1 in the rice genome, selecting rice with the genotype AA or AG at the SNP locus as parents for breeding, wherein AA is a homozygous type with the SNP locus A, and AG is a heterozygous type with the SNP locus A and G, and the purpose of the breeding method is to select rice with resistance to bacterial blight. M2. The method includes detecting the genotype of the SNP locus in claim 1 in the rice genome, selecting rice with the genotype GG at the SNP locus as a parent for breeding, wherein GG is a homozygous type of the SNP locus G, and the purpose of the breeding method is to select rice susceptible to bacterial blight.

7. The nucleotide sequence is the application of sequence 4 of the sequence listing in any of the following DNA molecules: (1) To identify or assist in the identification of rice bacterial blight resistance; (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight; (3) Screening or breeding of rice individual plants, lines, strains or varieties susceptible to bacterial blight; (4) Prepare products for identification or auxiliary identification of rice bacterial blight resistance; (5) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight; (6) Prepare or select rice single plants, lines, strains or varieties susceptible to bacterial blight.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker for detecting bacterial blight resistant gene Xa1 of rice and detection method

    CN117363776A