Design and application of oligonucleotide probe set for identifying chromosomes of brassica rapa

Abstract

The application relates to the field of cytology and relates to an oligonucleotide probe set design for identifying Brassica rapa chromosomes and application, which comprises the following steps: S1: obtaining a NR-TR set in a Brassica rapa R-o-18 reference genome; S2: statistically clustering the NR-TR set and obtaining TR array data of Brassica rapa chromosomes; S3: obtaining a repetitive sequence cluster which is enriched in all the chromosomes of Brassica rapa; S4: segmenting a repetitive sequence representative array of the obtained repetitive sequence cluster; and S5: respectively aligning the segmented sequences to the Brassica rapa R-o-18 reference genome by using blastn. The application establishes a technology for coating Brassica rapa chromosomes, and the technology can batch coat Brassica rapa chromosome materials.

Description

Technical Field

[0001] This invention relates to the field of cell biology, and more specifically, to the design and application of an oligonucleotide probe sleeve for identifying chromosomes of the Chinese cabbage-type rapeseed. Background Technology

[0002] Brassica rapa (Chinese rapeseed) is an important economic crop, one of the three major rapeseed types, and a fundamental component of the "Yu's Triangle" (A genome). Oligonucleotide fluorescence in situ hybridization (FISH) is a novel technique using single-stranded oligonucleotides as probes. These oligonucleotide probes are novel chromosomal physical markers that can be developed from the genomes of sequenced species. Using probes designed from repetitive sequences identified in the reference genome of Brassica rapa for genomic FISH can effectively identify the Brassica A genome, enabling the identification of Brassica rapa A genome materials and variants, the determination of genomic relationships between wild species and Brassica rapa, and the identification of Brassica A subgenomes in allopolyploid materials. This is of great significance for the creation of Brassica rapa breeding materials and genetic research. Traditional Brassica rapa probe development utilizes repetitive sequences obtained from BAC sequencing, which is complex and cumbersome. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides a method and application for designing oligonucleotide probe sleeves to identify the chromosomes of *Brassica napus* type. This invention enables batch staining of *Brassica napus* type chromosome materials.

[0004] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0005] An oligonucleotide probe sleeve design for recognizing chromosomes of *Brassica napus* type rapeseed includes the following steps:

[0006] S1: Obtain tandem repeat sequences (TRs) with repeat units greater than 300 bp from the reference genome of Chinese rapeseed Ro-18, and remove redundancy from the obtained results to obtain a set of non-redundant TR arrays NR-TR;

[0007] S2: Perform statistical clustering on the NR-TR set to obtain the TR array data of the chromosomes of Chinese cabbage-type rapeseed;

[0008] S3: Detect the distribution of homologous copies of the TR array sequence obtained in step S2 in the Ro-18 reference genome of Chinese cabbage type rapeseed, and obtain the repetitive sequence clusters enriched in all chromosomes of Chinese cabbage type rapeseed;

[0009] S4: Cut the repeat sequence representative array of the repeat sequence cluster obtained in step S3 into oligonucleotide sequences with a length of 40 bp and a step size of 5 bp, starting from the beginning.

[0010] S5: The segmented sequences were aligned to the Chinese rapeseed Ro-18 reference genome using blastn with parameters pident=90 and qcovhsp=90, resulting in oligonucleotide probe kits covering 10 chromosomes of Chinese rapeseed.

[0011] Preferably, the oligonucleotide probe sleeve obtained in step S5 is a FAM fluorescently labeled oP. A4 and oP A10 The specific sequence is as follows:

[0012] oP A4 :FAM-5'-ACTTTATGTATCCAAATCAAGCTTCTCACATCGCGATTCA-3';

[0013] oP A10 :FAM-5'-TTGGAACGACGAAGAAGCTGTCCTATTCCCAAACTGGGAA-3'.

[0014] The application of an oligonucleotide probe sleeve for identifying chromosomes of the Chinese cabbage type rapeseed includes the following steps:

[0015] Preparation of S1 denaturing hybridization staining solution: Dissolve the oligonucleotide probe kit powder in ultrapure water to a concentration of 1 μg / μL; add 0.5 μL of the above-mentioned rapeseed chromosome oligonucleotide probe kit solution, 15 μL of 50% deionized formamide, 6 μL of 20% dextran sulfate, 3 μL of 10% 2×SSC solution, and 5 μL of ddH2O to each slide, for a total of 30 μL. Denature at 99℃ for 10 min, then quickly transfer to an ice-water mixture and place in a -20℃ refrigerator for 10 min.

[0016] S2 hybridization: The prepared staining solution in S1 was dropped onto the metaphase I chromosome preparation of the anthers of Chinese cabbage-type rapeseed. 30 μL of denaturing hybridization solution was added to each preparation, covered with a coverslip, and placed in an 80℃ drying oven for 3 min for denaturation, followed by hybridization at 37℃ for 6 h.

[0017] S3 staining: Gently tap off the coverslip, wash three times in 2×SSC for 5 minutes each time, and finally rinse once with ddH2O running water. Dry in the dark. Add 20 μL of 5% DAPI staining solution prepared with anti-fluorescence quenching mounting medium to each slide, cover with a coverslip, stain for 10 minutes, and examine and photograph under a microscope.

[0018] Preferably, the 2×SSC buffer solution is composed of 0.3M trisodium citrate (C6H5Na3O7·2H2O) and 3M NaCl.

[0019] Application of an oligonucleotide probe sleeve design for identifying chromosomes of Chinese cabbage-type rapeseed in the identification of Chinese cabbage-type rapeseed chromosomes.

[0020] Compared with the prior art, the beneficial effects of this invention are:

[0021] 1. This invention analyzes tandem repeat sequences using bioinformatics methods and designs oligonucleotide probe sleeves for the chromosomes of Chinese cabbage-type rapeseed. These probes can effectively and rapidly identify all chromosomes of Chinese cabbage-type rapeseed (66-83, AA, 2n=20). A technique for staining Chinese cabbage-type rapeseed chromosomes has been established, which can be used to stain Chinese cabbage-type rapeseed chromosome materials in batches.

[0022] 2. This invention relates to an oligonucleotide probe kit developed based on the repetitive sequence of Chinese cabbage-type rapeseed and a simple, low-cost, and reliable fluorescence in situ hybridization method. Attached Figure Description

[0023] Figure 1 Distribution of the Chinese cabbage-type rapeseed chromosome probe attached to the Ro-18 reference genome;

[0024] Figure 2 To identify the chromosome staining results of *Brassica napus* type (66-83, AA, 2n=20) using a chromosome probe kit. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] like Figure 1-2 As shown, a method for designing an oligonucleotide probe sleeve to identify chromosomes of the Chinese cabbage type rapeseed includes the following steps:

[0027] S1. Using the Tandem Repeats Finder (TRF, v4.09) software, search for tandem repeats (TR) sequences with repeat units greater than 300 bp in the reference genome of Chinese rapeseed Ro-18 (GenBank: GCA_017639395.1). Use the TR-tookit software to remove redundancy from the TRF output results to obtain a set of non-redundant TR (NR-TR) arrays.

[0028] S2. Perform statistical clustering on the obtained NR-TR array set to obtain the TR array sequence of the Chinese cabbage-type rapeseed chromosome;

[0029] S3. Design of oligonucleotide probe kits for rapeseed chromosomes: The distribution of homologous copies of the above TR array sequences in the reference genome of rapeseed Ro-18 was detected using local blastn. The results showed that a representative array with a repeat unit length of 352 bp was found, and the homologous copies of its repeat unit sequences were specifically and uniformly enriched in the centromere region of all chromosomes of rapeseed.

[0030] S4. Cut the full-length sequence of the array represented by the obtained repeat sequence from scratch into oligonucleotide fragments of 40 bp in length and 5 bp in step size.

[0031] S5. The oligonucleotide sequences were submitted to the local BLASTN database for alignment with the *Brassica napus* Ro-18 reference genome. The enrichment of the sequences in all *Brassica napus* chromosomes was observed (parameters: pident=90, qcovhsp=90). If enriched in all chromosomes, the sequences were retained; otherwise, they were discarded. The results yielded oligonucleotide probe sleeves containing two sequences for *Brassica napus* chromosomes. These probe sleeves were distributed across all chromosomes of *Brassica napus*. Figure 1 As shown, it was further labeled with FAM fluorescence as oP A4 and oP A10 (SEQ ID NO:1-2) Oligonucleotide probe sleeves for recognizing the chromosomes of Chinese cabbage-type rapeseed were obtained (see Table 1 for details).

[0032] Table 1

[0033]

[0034]

[0035] Depend on Figure 1 It can be seen that the probe sheath covers all chromosomes of the Chinese cabbage-type rapeseed Ro-18, showing an enriched state.

[0036] A method for applying an oligonucleotide probe sleeve to identify chromosomes of the Chinese cabbage type rapeseed includes the following steps:

[0037] (1) Treatment of anthers of Chinese cabbage-type rapeseed: Fresh, unopened inflorescences were collected and fixed and decolorized in Carnoy solution (anhydrous ethanol: glacial acetic acid = 3:1) for 12 h, and then preserved in 70% ethanol. The fixed material was taken, and the anthers in the late stage of decay were peeled from the flower buds, enzymatically hydrolyzed at 37℃ for 12 h, washed with ddH2O, and then subjected to hypotonic treatment at room temperature for 4 h.

[0038] (2) Preparation of meiotic sections of Chinese cabbage-type rapeseed: Place the anthers on a clean glass slide, add 20 μL of 60% glacial acetic acid, smear on a slide dryer at 37°C, clean the slide with Carno fixative, dry, add 20 μL of 5% DAPI stain (prepared with ddH2O) and observe under a microscope. Select slides with better meiotic development, rinse off the coverslip and stain with running water, and dry in an oven at 55°C overnight.

[0039] (3) Chromosome degeneration: Add 30 μL of 70% deionized formamide to the chromosome slice, cover with a coverslip, and denature for 5 min on an 80℃ drying machine. Then immediately transfer to -20℃ for gradient ethanol dehydration (75%, 85%, 100%), 3 min per stage, and remove and dry at room temperature.

[0040] (4) Preparation of hybridization staining solution: Add 0.5 μL of the above-mentioned *Brassica napus* chromosome probe sleeve solution, 15 μL of 50% deionized formamide, 6 μL of 20% dextran sulfate, 3 μL of 10% 2×SSC solution, and 5 μL of ddH2O to each slide, for a total of 30 μL. Denature at 99℃ for 10 min, then quickly transfer to an ice-water mixture and place in a -20℃ refrigerator for 10 min. The concentration of the *Brassica napus* chromosome probe sleeve solution is 1 μg / μL.

[0041] (5) Hybridization: Add 30 μL of denaturing hybridization solution to each slide, cover with a coverslip, place on an 80℃ slide dryer for 3 min for denaturation, and hybridize at 37℃ for 6 h.

[0042] (6) Staining: Gently tap off the coverslip, wash three times in 2×SSC for 5 min each time, and finally rinse once with ddH2O running water. Dry in the dark. Add 20 μL of 5% DAPI staining solution (prepared with anti-fluorescence quenching mounting medium) to each slide, add a coverslip, stain for 10 min, examine under a microscope, and take pictures. Figure 2 ).

[0043] The staining results of chromosomes in *Brassica napus* type (66-83, AA, 2n=20) were identified using oligonucleotide probes on chromosomes of *Brassica napus* type. Figure 2As shown, (a) (blue) represents DAPI staining of chromosomes of *Brassica napus* type (66-83, AA, 2n=20) (the staining solution did not contain the oligonucleotide probe sleeve for *Brassica napus* chromosomes), showing 20 blue chromosome signals; (b) (green) represents the staining results of the oligonucleotide probe sleeve for *Brassica napus* chromosomes on all chromosomes of *Brassica napus* type (66-83, AA, 2n=20), showing 20 green (FAM fluorescent) chromosome signals; (c) is a composite staining diagram of the oligonucleotide probe sleeve for *Brassica napus* chromosomes on all chromosomes of *Brassica napus* type (66-83, AA, 2n=20), showing 20 chromosomes with mixed blue-green signals. This indicates that the oligonucleotide probe sleeve for *Brassica napus* chromosomes designed in this invention can efficiently identify all chromosomes of *Brassica napus* type (66-83, AA, 2n=20).

[0044] The above description only illustrates the preferred embodiments of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention, and all such changes should be included within the protection scope of the present invention. SEQUENCE LISTING <110> Zhengzhou University Henan Academy of Agricultural Sciences Horticulture Research Institute Henan Kaiyuan Agricultural Development Co., Ltd. <120> Design and application of an oligonucleotide probe sleeve for recognizing chromosomes of Chinese cabbage-type rapeseed. <130> 2022 <160> 2 <170> PatentIn version 3.3 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <400> 1 actttatgta tccaaatcaa gcttctcaca tcgcgattca 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <400> 2 ttggaacgac gaagaagctg tcctattccc aaactgggaa 40

Claims

1. An oligonucleotide probe sleeve for recognizing chromosomes of *Brassica napus* type rapeseed, characterized in that: Including FAM fluorescently labeled oP A4 and oP A10 Two sequences, the specific sequences are: on A4 : FAM−5'−ACTTTATGTATTCCAAATCAAGCTTCTCACATCGCGATTCA−3'; on A10 : FAM−5'−TTGGAACGACGAAGAAGCTGTCCTATTCCCAAACTGGGAA−3'。 2. A method for designing an oligonucleotide probe sleeve for recognizing the chromosome of *Brassica napus* as described in claim 1, characterized in that: Includes the following steps: S1: Obtain tandem repeat sequences (TRs) with repeat units greater than 300 bp from the reference genome of Chinese rapeseed Ro-18, and remove redundancy from the obtained results to obtain a set of non-redundant TR arrays NR-TR; S2: Perform statistical clustering on the NR-TR set to obtain the TR array data of the chromosomes of Chinese cabbage-type rapeseed; S3: Detect the distribution of homologous copies of the TR array sequence obtained in step S2 in the Ro-18 reference genome of Chinese cabbage type rapeseed, and obtain the repetitive sequence clusters enriched in all chromosomes of Chinese cabbage type rapeseed; S4: Cut the repeat sequence representative array of the repeat sequence cluster obtained in step S3 into oligonucleotide sequences of 40 bp in length and 5 bp in step size, starting from the beginning. S5: The segmented sequences were aligned to the Chinese rapeseed Ro-18 reference genome using blastn with parameters pident = 90 and qcovhsp = 90, resulting in oligonucleotide probe kits covering 10 chromosomes of Chinese rapeseed.

3. The application of the oligonucleotide probe sleeve for recognizing the chromosomes of Brassica napus as described in claim 1, characterized in that: Includes the following steps: Preparation of S1 denaturing hybridization staining solution: Dissolve the oligonucleotide probe kit dry powder in ultrapure water to a concentration of 1 μg / μL; add 0.5 μL of the above-mentioned Chinese cabbage type rapeseed chromosome oligonucleotide probe kit solution, 15 μL of 50% deionized formamide, 6 μL of 20% dextran sulfate, 3 μL of 10% 2×SSC solution, and 5 μL of ddH2O to each slide, for a total of 30 μL. Denature at 99℃ for 10 min, then quickly transfer to an ice-water mixture and place in a −20℃ refrigerator for 10 min; S2 hybridization: The dye solution prepared in S1 was dropped onto the chromosome preparation of the anther of Chinese cabbage-type rapeseed in metaphase I. 30 μL of denaturing hybridization solution was added to each preparation, covered with a coverslip, and placed in an 80℃ drying oven for denaturation for 3 min, followed by hybridization at 37℃ for 6 h. S3 staining: Gently tap off the coverslip, wash three times in 2×SSC for 5 min each time, and finally rinse once with ddH2O running water. Dry in the dark. Add 20 μL of 5% DAPI staining solution prepared with anti-fluorescence quenching mounting medium to each slide, cover with a coverslip, stain for 10 min, and examine under a microscope and take pictures.

4. The application according to claim 3, characterized in that: The 2×SSC buffer solution consists of 0.3 M trisodium citrate (C6H5Na3O7·2H2O) and 3 M NaCl.

5. The application of an oligonucleotide probe for identifying the chromosome of *Brassica napus* type as described in claim 1 in the identification of *Brassica napus* type chromosome.

Images