Rna interference inducing nucleic acids comprising 8-oxoguanine, modified nucleic acids binding to micro rnas comprising 8-oxoguanine and uses thereof

Abstract

In this invention, it has been demonstrated that when RNA interference-induced nucleic acids are generated and applied to cells or mice, various pathophysiological phenomena are induced, wherein the RNA interference-induced nucleic acids contain at least one 8-oxoguanine (O2) from the first to ninth nucleotides of the 5' end of at least one single strand of the nucleic acid double strand. 8 G) and specifically binds to microRNA, wherein at least one of the nucleotides from the 1st to the 9th nucleotide from the 5' end is a guanine (G) via 8-oxoguanine (o) 8 G>T modified nucleic acids. Furthermore, the location of G>T modification has been identified in cDNA generated by reverse transcription of microRNA to confirm the site of oxidative modification to 8-oxoguanine, where guanine (G) in the microRNA is converted to 8-oxoguanine (O) through oxidative stress in the seed region of the microRNA. 8 G) Oxidation modification.

Description

Technical Field

[0001] This invention relates to RNA interference-induced nucleic acids containing 8-oxoguanine, modified nucleic acids that specifically bind to microRNAs containing 8-oxoguanine, pharmaceutical compositions using these nucleic acids, recombinant animal models, drug screening methods, disease diagnostic methods, and methods for controlling pathophysiological phenomena. Background Technology

[0002] When cells undergo pathophysiological changes, oxidative stress typically occurs, leading to the generation of reactive oxygen species (ROS). Due to their high reactivity, these ROS modify various biological structures, with RNA being the most susceptible. In particular, among the RNA bases most prone to oxidative modification, the guanine (G) base is oxidized and converted to 8-oxoguanine (o8G).

[0003] On the other hand, heart disease is one of the top three causes of death among adults in South Korea, including cancer. It begins with various pathological stresses during an attack, leading to changes in the size of heart tissue and resulting in cardiac hypertrophy. Cardiac hypertrophy is characterized by an increase in the size of cardiomyocytes and an increased rate of protein synthesis. Cardiac hypertrophy gradually induces myocardial fibrosis and heart failure, ultimately leading to cardiac dysfunction. In particular, given the extremely high mortality rate of approximately 50% in cases of heart failure, research is underway to ultimately prevent cardiac hypertrophy or develop treatments for it; therefore, establishing disease models is necessary.

[0004] Korean Patent Publication No. 1481007

[0005] Public content

[0006] Technical issues

[0007] The inventors have confirmed that when guanine (G) bases are oxidized to 8-oxoguanine (O) in the seed region of microRNA due to oxidative stress, 8 When G), it passes through o 8 The G:A sequence binds to the target sequence, and the location of the oxidative modification to 8-oxoguanine in the generated cDNA was confirmed by identifying the site of G>T modification in the cDNA produced by reverse transcription of microRNA. Therefore, it was confirmed that when guanine (G) in the generated microRNA is replaced by 8-oxoguanine (o... 8 When RNA interference (G) induces nucleic acids and is applied to cells or mice, it induces various pathophysiological phenomena. Based on this, the present invention was completed.

[0008] Therefore, in this invention, the 5' end of at least one single strand of the RNA interference-inducing double-stranded nucleic acid contains at least one nucleotide from the 1st to the 9th nucleotide, which comprises at least one 8-oxoguanine (o 8 RNA interference from G induces nucleic acid.

[0009] Furthermore, the present invention provides a method for identifying 8-oxoguanine (o 8 The method of positioning G).

[0010] Furthermore, the present invention provides a modified nucleic acid and a recombinant vector comprising a gene encoding the modified nucleic acid, wherein at least one guanine (G) in the 5' end, from the first to the ninth nucleotide, is modified to 8-oxoguanine (o). 8 G) binds specifically to microRNA.

[0011] In addition, the present invention provides a pharmaceutical composition for treating cardiac hypertrophy comprising modified nucleic acids or recombinant vectors, and a pharmaceutical composition for treating liver cancer or glioblastoma comprising RNA interference-induced nucleic acids.

[0012] Another embodiment provides a pharmaceutical composition for the prevention or treatment of cardiac hypertrophy, comprising an antioxidant as an active ingredient, and a method for providing information for the diagnosis of cardiac hypertrophy.

[0013] Another implementation provides a method for generating an animal model of anticardiomegaly and an animal model of anticardiomegaly.

[0014] Another implementation provides a method for screening candidate substances for treating cardiac hypertrophy.

[0015] The technical objectives to be achieved by this invention are not limited to those described above. Other unmentioned objectives will be clearly understood by those skilled in the art through the following description.

[0016] Technical solution

[0017] This invention provides an RNA interference-induced nucleic acid, which contains at least one 8-oxoguanine (O2) in the first to ninth nucleotides at the 5' end of at least one single strand of the nucleic acid double strand. 8 G).

[0018] One embodiment of the present invention provides an RNA interference-induced nucleic acid, wherein the 5' end, from the 1st to the 9th nucleotide, contains a microRNA sequence.

[0019] In another embodiment of the present invention, the microRNA may be at least one of the following group 1 microRNAs:

[0020] [Group 1]

[0021] miR-1, miR-184, let-7f-5p, miR-1-3p, miR-122, let-7 and miR-124.

[0022] In another embodiment of the invention, RNA interference-induced nucleic acid can recognize a target site, wherein o 8 G:A arrangement appears in 8-oxoguanine (o 8 At position G).

[0023] In another embodiment of the invention, at least one single strand of the nucleic acid double helix may comprise at least one of the following Group 2 polynucleotides:

[0024] [Group 2]

[0025] By SEQ ID NO: 1(5'p-Uo 8 A polynucleotide composed of the base sequence of GGAAUGUAAAGAAGUAUGUAU-3');

[0026] By SEQ ID NO: 2(5'p-UGo 8 A polynucleotide composed of the base sequence of GAAUGUAAAGAAGUAUGUAU-3');

[0027] By SEQ ID NO: 3(5'p-UGGAAUo 8 A polynucleotide composed of the base sequence of GUAAAGAAGUAUGUAU-3');

[0028] By SEQ ID NO: 65(5'p-Uo 8 Go 8 A polynucleotide composed of the base sequence of GAGUGUGACAAUGGUGUUUG-3');

[0029] By SEQ ID NO: 66(5'p-UGAo 8 A polynucleotide composed of the base sequence of GUAGUAGGUUGUAUAGdTdT-3'); and

[0030] By SEQ ID NO: 67(5'p-UAAo 8 A polynucleotide composed of the base sequence GGCACGCGGUGAAUGCdTdT-3').

[0031] When the RNA interference-induced nucleic acid according to the present invention is injected into cells or animals, it can induce cardiac hypertrophy, inhibit liver cancer cell migration, or induce apoptosis.

[0032] The present invention provides a composition comprising the above-mentioned RNA interference-induced nucleic acid and an antioxidant.

[0033] Furthermore, the present invention provides a method for identifying 8-oxoguanine (o 8 Methods for determining the location of G include:

[0034] (a) Extracting RNA from cells;

[0035] (b) Use of anti-o 8 G antibodies were isolated from extracted RNA via immunoprecipitation (IP) to remove 8-oxoguanine (O2) 8 G) RNA;

[0036] (c) via reverse transcription containing 8-oxoguanine (o 8 G) isolates RNA to produce cDNA, and generates and sequences sequencing libraries to determine the location of 8-oxoguanine; and

[0037] (d) By confirming the position of guanine (G) modified by thymine (T) as a sequencing result, the modification of guanine (G) by 8-oxoguanine (O) was identified. 8 G) The position modified.

[0038] Furthermore, the present invention provides a modified nucleic acid that specifically binds to microRNA, wherein at least one guanine (G) in the first to ninth nucleotides from the 5′ end is substituted with 8-oxoguanine (o) 8 G) Modification,

[0039] The modified nucleic acid contains a polynucleotide complementary to six or more consecutive polynucleotides starting from either the second or third nucleotide at the 5' end of the modified microRNA, and

[0040] The modified nucleic acid contains adenine (A) as a nucleotide, located at least one 8-oxoguanine (O) in the first to ninth nucleotides from the 5′ end of the modified microRNA. 8 G) The position where they combine.

[0041] In one embodiment of the invention, in a microRNA that specifically binds to a modified nucleic acid, at least one guanine (G) in the 2nd, 3rd, or 7th nucleotide at the 5' end can be modified to 8-oxoguanine (O). 8G), and the modified nucleic acid may contain a polynucleotide complementary to six or more consecutive polynucleotides starting from the second or third nucleotide from the 5' end of the microRNA, and adenine (A) is included as a nucleotide, located at a position that binds to at least one 8-oxoguanine (o8G) in the second, third or seventh nucleotide from the 5' end of the modified microRNA.

[0042] In one embodiment of the present invention, the modified nucleic acid may contain 5'-ACAUUC. A -3'(SEQ ID NO: 4), 5'-ACAUU A C-3' (SEQ ID NO: 5) or 5'-A A The base sequence of AUUCC-3' (SEQ ID NO: 6).

[0043] Furthermore, the present invention provides a recombinant vector comprising a gene encoding the nucleic acid described above.

[0044] Furthermore, the present invention provides a pharmaceutical composition for treating cardiac hypertrophy. This pharmaceutical composition for treating cardiac hypertrophy comprises a modified nucleic acid that specifically binds to microRNA, and wherein at least one guanine (G) from the 1st to 9th nucleotides from the 5′ end is converted to 8-oxoguanine (o) 8 G) Modification, or a recombinant vector containing a gene encoding the modified nucleic acid, wherein the modified nucleic acid comprises a polynucleotide complementary to six or more consecutive polynucleotides starting from either the second or third nucleotide from the 5' end of the microRNA, and includes adenine (A) as a nucleotide located at at least one 8-oxoguanine (o) from the first to the ninth nucleotide from the 5' end of the microRNA. 8 G) The position where they combine.

[0045] In one embodiment of the present invention, the microRNA may be miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0046] As one embodiment of the present invention, the pharmaceutical composition for treating cardiac hypertrophy may also contain an antioxidant.

[0047] Furthermore, the present invention provides a pharmaceutical composition for treating liver cancer or glioblastoma comprising RNA interference-induced nucleic acid, wherein the RNA interference-induced nucleic acid comprises at least one 8-oxoguanine (O2) from the 1st to the 9th nucleotides from the 5' end of at least one single strand of the nucleic acid double strand. 8 G).

[0048] In one embodiment of the present invention, in a pharmaceutical composition for treating liver cancer, the microRNA may be miR-122.

[0049] In another embodiment of the invention, in a pharmaceutical composition for treating glioblastoma, the microRNA may be let-7 or miR-124.

[0050] In another embodiment of the invention, the pharmaceutical composition for treating liver cancer or glioblastoma may further contain an antioxidant.

[0051] Furthermore, the present invention provides a pharmaceutical composition comprising an antioxidant as an active ingredient for the prevention or treatment of cardiac hypertrophy.

[0052] This antioxidant inhibits the oxidative modification of one or more guanine (G) nucleotides at the 5' end of RNA (from nucleotide 1 to nucleotide 9) to 8-oxoguanine (O). 8 G).

[0053] In one embodiment of the present invention, the antioxidant may be N-acetylcysteine ​​(NAC) or butylated hydroxyanisole (BHA).

[0054] In another embodiment of the present invention, the RNA may be miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0055] Furthermore, the present invention provides an information provision method for diagnosing cardiac hypertrophy, comprising:

[0056] Determine whether at least one guanine (G) nucleotide in the microRNA expressed in animal cardiomyocytes is modified to 8-oxoguanine (o). 8 G); and

[0057] When at least one guanine (G) in the nucleotides of microRNA is modified to 8-oxoguanine (O) 8 When G), it is classified as cardiac hypertrophy.

[0058] In one embodiment of the present invention, the nucleotide may be the first to ninth nucleotides at the 5' end of the microRNA.

[0059] In another embodiment of the invention, the nucleotide may be the 2nd, 3rd, or 7th nucleotide at the 5' end of the microRNA.

[0060] In another embodiment of the present invention, the microRNA may be miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0061] Furthermore, the present invention provides a method for generating a non-human animal model of anti-cardiac hypertrophy, and a non-human animal model of anti-cardiac hypertrophy generated by the method, comprising:

[0062] (a) The gene encoding the modified nucleic acid is operatively linked to the promoter to construct a recombinant vector;

[0063] (b) Introducing the recombinant vector into the fertilized eggs of an animal; and

[0064] (c) Fertilized eggs are transferred into a surrogate mother to produce fertilized eggs to obtain a transgenic animal model.

[0065] Furthermore, the present invention provides a method for screening candidate substances for treating cardiac hypertrophy, comprising:

[0066] (a) Processing candidate substances in cardiomyocytes of a hypertrophic heart animal model;

[0067] (b) Analysis of the nucleotides in microRNAs expressed in cardiomyocytes of a hypertrophic cardiac model showed that guanine (G) was modified to 8-oxoguanine (O). 8 The frequency of G); and

[0068] (c) When compared with the case of untreated candidate material, 8-oxoguanine (o 8 When G) decreases, the candidate substance is selected as a treatment for cardiac hypertrophy.

[0069] In one embodiment of the present invention, the candidate substance may be an antioxidant.

[0070] In another embodiment of the invention, the microRNA may be miR-1.

[0071] In addition, the present invention provides a method for inhibiting cardiac hypertrophy, comprising applying modified nucleic acids to a subject.

[0072] In addition, the present invention provides a method for inhibiting liver cancer metastasis or for treating glioblastoma, comprising administering RNA interference-induced nucleic acid to a subject.

[0073] Furthermore, the present invention provides a method for preventing or treating cardiac hypertrophy, comprising administering a composition containing an antioxidant as an active ingredient to a subject.

[0074] Furthermore, this invention provides the use of modified nucleic acids for inhibiting cardiac hypertrophy.

[0075] Furthermore, this invention provides the use of RNA interference-induced nucleic acids for inhibiting liver cancer metastasis and treating liver cancer or glioblastoma.

[0076] Furthermore, the present invention provides the use of compositions containing antioxidants as active ingredients for the prevention or treatment of cardiac hypertrophy.

[0077] The present invention also provides the use of antioxidants in the preparation of medicaments for the treatment of cardiac hypertrophy.

[0078] Beneficial effects

[0079] According to the present invention, RNA interference-induced nucleic acid and at least one guanine (G) of the 5' end 1 to 9 nucleotides thereof are modified to 8-oxoguanine (o). 8 Modified nucleic acids that specifically bind to G's microRNA can be used to control pathophysiological phenomena in cells or animals.

[0080] Specifically, it can be used for the diagnosis and development of therapeutic agents for cardiomegaly, liver cancer, or glioblastoma. Attached Figure Description

[0081] Figure 1A is a schematic diagram of intraperitoneal (IP) injection of 75 mg / kg isoproterenol (ISO) into mice (n=7) every 2 days for 29 days.

[0082] Figure 1B shows the changes in mouse heart size caused by ISO and NAC treatments.

[0083] Figure 1C is a diagram confirming the RNA oxidation effect of ROS generated by ISO treatment.

[0084] Figure 1D shows the results in Ago2 and o 8 Immunofluorescence staining with G confirmed the simultaneous presence of microRNAs treated with PE or ISO in rCMC cells. 8 The graph showing the result of G modification.

[0085] Figure 1E shows the processing of H9c2 according to PE or ISO. 8 Figure showing the results of immunofluorescence staining for G and Ago2.

[0086] Figure 1F shows the use of o in H9c2 and rCMC cells. 8 A figure showing the results of dot blot analysis of G-specific antibodies.

[0087] Figure 1G shows the results of northwestern analysis of PE-treated H9c2 cells (top of Figure 1G) and ISO-treated mouse hearts (bottom of Figure 1G).

[0088] Figure 1H shows the results of dot blot analysis of approximately 20 nt miRNA extracted from the hearts of ISO-treated mice.

[0089] Figure 2A shows o 8 G sequencing method (o 8 A schematic diagram of G-miSeq.

[0090] Figure 2B shows o 8 A figure showing the optimized method for immunoprecipitation (IP) of G.

[0091] Figure 2C shows the result obtained through the optimized IP method. 8 A graph of the amount of G.

[0092] Figure 2D illustrates how G>T mutations in the cDNA of oxidized miRNAs were indirectly confirmed by sequence-specific cleavage of restriction enzyme sites (top of Figure 2D) and directly by sequencing (middle and bottom of Figure 2D).

[0093] Figure 2E shows the oxidized miRNAs in H9c2 cells. 8 A graph of the G-miSeq results.

[0094] Figure 2F shows the results of volcano plot analysis in H9c2 cells.

[0095] Figure 2G shows the oxidized miRNAs in rCMC cells. 8 A graph of the G-miSeq results.

[0096] Figures 2H and 2I show the effects of exposing rCMC and H9c2 cells to serum deficiency. 8 A graph showing the results of G-miSeq analysis.

[0097] Figure 2J shows the oxidation of miRNAs in H9c2 cells treated with H2O2. 8 Comparison of G-miSeq results with Wang JX, 2015 (Wang, JX et al., Oxidative Modification of miR-184 Enables It to TargetBcl-xL and Bcl-w, Mol Cell 59, 50-61).

[0098] Figure 3A shows the oxidation-induced miRNA in rCMC cells via PE treatment. 8 A graph of the relative amount of G.

[0099] Figure 3B shows the relative amounts of miR-1 induced by ISO treatment and o in the mouse heart. 8 A graph of the amount of miR-1 in GIP.

[0100] Figures 3C and 3D show the oxidation of miR-1.8 A diagram confirming the target silencing effect based on the G:A base arrangement.

[0101] Figure 3E shows the analysis results of luciferase reporter genes with miR-1 oxidase sites in AC16 treated with PE or H2O2.

[0102] Figure 3F shows the results of flow cytometry analysis of the dual fluorescent protein (dFP) reporter gene with the miR-1 7oxo site in GFP in H9c2 cells.

[0103] Figure 3G shows the results of flow cytometry analysis of dual fluorescent protein (dFP) reporter genes with miR-1 seed sites in GFP in H9c2 cells.

[0104] Figure 3H shows the expression of miR-1 in AC16, H9c2, rCMC, and mouse heart.

[0105] Figure 3I shows the results of flow cytometry analysis of dual fluorescent protein (dFP) reporter genes with miR-1 7oxo, 3oxo, and 2oxo sites in H9c2 cells.

[0106] Figure 3J shows the size (log) of GFP containing the miR-1 7oxo site in H9c2 cells. 10 (FSC)) and GFP value (log 10 A diagram showing the distribution of (GFP)).

[0107] Figure 3K shows the results of dFP reporter gene quantification in H9c2 cells using flow cytometry.

[0108] Figure 3L shows the confirmation of miR-1:7o in H92c cells using the dFP reporter gene assay. 8 A graph showing the activity of G(RFP:GFP-7oxo and RFP:GFP,NT).

[0109] Figure 3M shows the results of dFP reporter gene analysis in H9c2 cells based on NAC treatment.

[0110] Figure 3N shows the results of dFP reporter gene analysis with miR-1 7oxo site in RFP in H9c2 cells using flow cytometry.

[0111] Figure 3O is a graph showing the results of dFP reporter analysis when only a limited cell population with 25% minimum reporter value (RFP) in H9c2 cells is considered.

[0112] Figure 3P shows the presence of 2o in H9c2 cells.8 G, 3o 8 G, 7o 8 Figure showing the results of luciferase reporter gene analysis with miR-1 seed sites at G and miR-1.

[0113] Figure 4A confirms the role of miR-1 expression in PE-treated or NAC-treated rCMC cells.

[0114] Figure 4B confirms the use of miR-1:o8G (miR-1:2o) according to an embodiment of the present invention. 8 G, miR-1: 3o 8 G, miR-1: 7o 8 A diagram showing the cell size in rCMC cells transfected with G) or miR-1:2U, miR-1:3U, or miR-1:7U.

[0115] Figure 4C shows the effect of oxidized miR-1 (miR-1: 2o). 8 G, miR-1: 3o 8 G, miR-1: 7o 8 Microscopic observation of H9c2 transfected with G) or miR-1:U (miR-1:2U, miR-1:3U, miR-1:7U) (scale bar, 50 μm).

[0116] Figure 4D is a graph confirming that treatment with PE and NAC according to an embodiment of the present invention leads to an increase in the expression of the cardiac hypertrophy marker ANP.

[0117] Figure 4E shows the size distribution of H9c2 cells transfected with miR-1:7U.

[0118] Figure 4F shows the use of miR-1:7o according to an embodiment of the present invention. 8 A time-lapse image of rCMC cells (top of Fig. 4F) and H9c2 cells (bottom of Fig. 4F) transfected with G or miR-1:7U.

[0119] Figure 4G shows the application of miR-1:7o according to an embodiment of the present invention. 8 The effect of G on cardiac hypertrophy in mice when injected via tail vein (Figure 4H upper part) and the results of quantitative examination of delivery to cardiac tissue by qPCR (Figure 4H lower part).

[0120] Figure 4H illustrates the in vivo delivery of miR-1:7o according to an embodiment of the present invention. 8 A diagram of the heart of a G mouse.

[0121] Figure 4I confirms that miR-1:7o is used according to an embodiment of the present invention. 8Figure showing the results of immunostaining of the ventricular septum (IS) and expression of cardiomyocytes and ANPs when G was injected into mice.

[0122] Figure 5A is a graph showing the results of executing the luciferase reporter gene at the target site compared with cells in which miR-122 was removed from Huh7 (Huh7: miR-122 KO), where the target site resulted in miR-122 activation at bases 2 and 3 of the Huh7 liver cancer cells. 8 It can be recognized when modified with G.

[0123] Figure 5B shows the results of confirming the presence of modified let-7 in HS683 glioma cells using a luciferase reporter gene targeting the 4-oxygen site, where the site is modified to o at the 4th base of let-7. 8 G can be recognized.

[0124] Figure 5C shows the results of confirming the presence of modified miR-124 using a luciferase reporter gene targeting the 4-oxygen site when oxidative stress was applied by removing fetal bovine serum from glioma cells HS683, where this site is modified to o at the 4th base of miR-124. 8 G can be recognized.

[0125] Figure 5D shows the effect of introducing miR-122 into Huh7 liver cancer cells. 8 G oxidation modification altered cell migration and the effect of antioxidant treatment on miE-122:2,3o 8 G shows a graph of observations that demonstrate more effective action.

[0126] Figure 5E shows the effect of introducing let-7a:4o into glioma cells HS683. 8 G (where the fourth base of let-7 is modified to o) 8 The figure shows the results of confirming apoptosis function at time G).

[0127] Figure 5F shows the effect of introducing mir-124:4o into glioma cells HS683. 8 G (where the fourth base of miR-124 is modified to o) 8 The figure shows the results of confirming apoptosis function at time G).

[0128] Figure 6A is a graph showing the results of Ago HITS-CLIP from the left ventricle of a human cardiomyopathy patient.

[0129] Figure 6B shows the confirmation of o in the Ago-mRNA cluster. 8 G: A graph of the binding frequencies.

[0130] Figure 6C is a diagram showing the base sequences of seed resistance and 7oxo resistance according to an embodiment of the present invention (top of Figure 6C) and the results of luciferase reporter gene analysis (bottom of Figure 6C).

[0131] Figure 6D is a graph showing the miR-1 7oxo target inhibitory activity against 7oxo(9x) according to one embodiment.

[0132] Figure 6E is a graph confirming the inhibitory effect of anti-7oxo(4x) on cardiac hypertrophy when introduced into rCMC according to one embodiment.

[0133] Figure 6F is a diagram confirming the inhibitory effect of cardiac hypertrophy when anti-7oxo(4x) RNA or α-MHC 13x is injected into ISO-treated mice according to one embodiment.

[0134] Figure 6G confirms cardiomyocyte size (top of Figure 6G) and miR-1: 7o 8 A diagram of the G-target inhibition effect (lower part of Figure 6G), which depends on the application of anti-7oxo (α-MHC 13x) according to one embodiment.

[0135] Figure 6H is a graph confirming that the administration of anti-7oxo (4x or 13x) according to one embodiment has an effect on the increase of ROS in the heart of ISO-treated mice.

[0136] Figure 6I is a diagram showing a recombinant vector designed according to one embodiment for generating transformed mice expressing anti-7oxo (α-MHC 13x).

[0137] Figure 6J is a diagram confirming the expression of anti-7oxo(13x) in mice transformed with the recombinant vector of Figure 5I.

[0138] Figure 6K is a diagram confirming the heart size of mice transformed with anti-7oxo(13x) according to one embodiment.

[0139] Figure 6L shows the miR-1:7o in mice transformed with anti-7oxo(13x) according to one embodiment. 8 A graph of the total suppression of target G.

[0140] Figure 6M is a diagram confirming the reduction in cardiomyocyte size in the interventricular septum (IS) of mice transformed with anti-7oxo(13x) according to one embodiment.

[0141] Figure 6N shows ROS-induced miR-1:7o 8 A schematic diagram of site-specific oxidation of G and its induction of cardiac hypertrophy.

[0142] Figure 7A is a diagram confirming the successful induction of cardiac hypertrophy in an animal model of cardiac hypertrophy used to obtain plasma samples according to one embodiment.

[0143] Figure 7B illustrates the experimental procedure following fixation of the plasma sample in Figure 6A.

[0144] Figure 7C shows the measurement results of miRNA-1 in plasma samples from the cardiac hypertrophy group and its control group.

[0145] Figure 7D confirms the oxidative modification of microRNA-1 (miR-1:o 8 G) The graph showing an increase in o in cardiac hypertrophy, as measured by plasma samples from the cardiac hypertrophy group and its control group. 8 G immunoprecipitation was used for measurement.

[0146] Figure 8A is a diagram showing that immunostaining confirmed that treatment with an antioxidant (N-acetylcysteine, hereinafter referred to as NAC) reduced PE-induced cardiac hypertrophy in H9c2 cells.

[0147] Figure 8B is a graph showing the results of echocardiograms of mice treated with ISO and NAC.

[0148] Figure 8C shows the o in rCMC and H9c2 cells treated with PE and NAC. 8 A figure showing the results of G immunofluorescence staining.

[0149] Figure 8D shows the results of inhibiting cardiomyocyte hypertrophy by treating H9c2 cells induced by PE or ISO with BHA and Sigma-Aldrich cell culture antioxidants.

[0150] Figure 8E confirms that, according to one implementation method, the method used to suppress miR-1:7o 8 When G's anti-miR-1-7oxo was introduced into H9c2 cells treated with PE to induce cardiomyocyte hypertrophy, cardiomyocyte hypertrophy was completely inhibited in the presence of the antioxidant NAC.

[0151] The best way to implement an invention

[0152] As used herein, the term "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. These are the monomeric units of a nucleic acid sequence.

[0153] In RNA, the sugar is ribose, while in DNA, it is deoxyribose (a sugar lacking the hydroxyl group present on the ribose). The nitrogenous heterocyclic base can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as their modified derivatives or analogs. In this invention, the sugar in the nucleotide is ribose, and the base includes adenine (A), guanine (G), cytosine (C), or uracil (U).

[0154] As used in this article, the term "target site" refers to the target base sequence that binds to the second through eighth bases of the 5' end of the microRNA.

[0155] As used in this article, the term "seed region" refers to the base sequence located between positions 1 and 9 at the 5' end of the microRNA.

[0156] As used in this article, the type of "cell" can be vertebrates, such as mammals including humans (humans, monkeys, mice, rats, hamsters, cattle, etc.), birds (chickens, ostriches, etc.), amphibians (frogs, etc.), and fish or invertebrates (such as insects (such as silkworms, moths, fruit flies, etc.)), plants, microorganisms (such as yeast, etc.), ideally mammals including humans, but not limited to them.

[0157] In this invention, "cardiac hypertrophy" refers to a state of enlarged myocardial fibers, increased heart weight, and thickened ventricular walls. It may be an early symptom of cardiac hypertrophy, heart failure, heart dysfunction, fibrosis, mitral atresia, aortic regurgitation, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid regurgitation, pulmonary insufficiency, pulmonary hypertension, right ventricular myocardial infarction, cardiomyopathy involving the right ventricle, atrial septal defect, atrial fibrillation, hypertrophic cardiomyopathy, or infiltrative cardiomyopathy. However, if the disease is related to myocardial hypertrophy, the type is not limited, except for the above-mentioned diseases.

[0158] As used herein, the term "recombinant" refers to a cell in which it replicates a heterologous nucleic acid, expresses a nucleic acid, or expresses a peptide, heterologous peptide, or protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not present in the natural form of the cell, either in a sense or antisense form. Furthermore, recombinant cells can express genes that are present in the cell in their natural state but have been modified and reintroduced into the cell through artificial methods.

[0159] As used herein, the term "vector" refers to a DNA construct containing a DNA sequence operatively linked to a suitable regulatory sequence capable of influencing DNA expression in a suitable host. Suitable regulatory sequences may include promoters influencing transcription, optional operon sequences controlling transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling transcription and translation termination. The vectors of this invention are not specifically limited, and any vector known in the art, such as plasmids, granules, phage particles, viral vectors, etc., can be used as long as they can replicate within cells.

[0160] In this invention, the term "recombinant vector" can be used as an expression vector for a target polypeptide that can efficiently express the target polypeptide in a suitable host cell when the coding gene of the target polypeptide to be expressed is operatively linked, and the recombinant vector can be expressed in the host cell. The host cell can ideally be a eukaryotic cell, and expression regulatory sequences, such as promoters, terminators, enhancers, sequences for membrane targeting or secretion, etc., can be appropriately selected according to the type of host cell, and can be combined in various ways according to the purpose.

[0161] In this invention, the term "promoter" refers to a nucleic acid sequence that acts as a DNA base sequence site for binding to transcriptional regulatory factors to regulate gene expression, with the aim of inducing overexpression of a target gene. For example, the recombinant vector of this invention may include a selection from αMHC (αMHC) promoters, βMHC (βMHC) promoters, Nkx 2.5 promoters, cardiac troponin T (TNNT2) promoters, muscle creatine kinase (MCK) promoters, human α-skeletal actin (HAS) promoters, and mouse stem cell virus (MSCV) promoters operably linked to regulate cardiomyocyte-specific expression. According to embodiments of the invention, αMHC (αMHC) promoters may be operably linked, but the type of promoter is not limited.

[0162] In this invention, the term "cardiomyocyte specificity" refers to a feature that is not expressed or is expressed at a low level in cells other than cardiomyocytes but is expressed at a very high level in cardiomyocytes.

[0163] As used herein, the term “expression” refers to the process of producing a polypeptide from a structural gene, and this process includes transcribing the gene into mRNA and translating the mRNA into a polypeptide.

[0164] In this invention, the term "transformation" refers to a change in the genetic properties of an organism caused by: directly introducing DNA in the form of a vector into a cell through physicochemical means, or by infecting a host cell with a virus to express a foreign gene, that is, transferring a gene into a host cell so that it is expressed in the host cell.

[0165] In this invention, "antioxidants" are substances that prevent the excessive production of reactive oxygen species (ROS) and are used to prevent oxidative stress in cells and tissues. Antioxidants neutralize free radicals that cause harmful reactions in cells before they attack DNA or oxidize lipids. Furthermore, antioxidants are highly reactive, reacting with harmful substances in the body to prevent chain reactions caused by ROS, thereby protecting cells.

[0166] In this invention, "prevention" refers to any action that inhibits or delays the onset of a target pathophysiological phenomenon by applying the composition according to the invention.

[0167] In this invention, "treatment" means any effect of improving or beneficially altering the symptoms of a target disease by applying the composition according to the invention.

[0168] microRNAs (miRNAs) are small RNA molecules composed of approximately 21 bases. Their function is to induce RNA interference, thereby suppressing gene expression in the post-transcriptional stage of a target gene. MicroRNAs recognize hundreds of target mRNAs through a base sequence located primarily at the 5' end (positions 1-8), then perform base alignment and suppress their expression to regulate biological functions. Therefore, when guanine (G) modification to 8-oxoguanine (O) occurs in the seed region of a microRNA... 8 When G), through the o enabled as a result. 8 The G:A base sequence may inhibit new targets due to the base sequence of other mRNAs, thereby regulating other pathophysiological functions.

[0169] In other words, oxidative modifications occurring in the seed region may be a mechanism by which target recognition is regulated through naturally occurring or pathologically occurring microRNAs. Based on this, it is possible to develop a technology capable of artificially inducing or inhibiting pathophysiological functions. It is previously known that 8-oxoguanine modifications in RNA primarily occur in a group of diseases associated with the human aging process (degenerative diseases), with heart disease also being closely related. Therefore, nucleosomal modifications based on 8-oxoguanine have the potential to regulate a variety of diseases.

[0170] This invention provides an RNA interference-induced nucleic acid, which contains at least one 8-oxoguanine (O2) in the first to ninth nucleotides at the 5' end of at least one single strand of the nucleic acid double strand. 8 G).

[0171] In one single strand of a double-stranded nucleic acid, the 1st to 9th nucleotides at the 5' end can contain at least one 8-oxoguanine, and both strands of the double-stranded nucleic acid, i.e., both single strands, can contain at least one 8-oxoguanine in the 1st to 9th nucleotides at the 5' end.

[0172] RNA interference-inducible nucleic acids can be selected from microRNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), DsiRNA, lsiRNA, ss-siRNA, piRNA, endo-siRNA, and asiRNA, but are not limited to the above types, as long as they are nucleic acids that induce RNA interference.

[0173] For example, the first to ninth nucleotides at the 5' end can contain a microRNA sequence.

[0174] For example, microRNA can be one or more microRNAs from group 1:

[0175] [Group 1]

[0176] miR-1, miR-184, let-7f-5p, miR-1-3p, miR-122, let-7 and miR-124.

[0177] For example, microRNAs can be miR-1, miR-122, let-7, or miR-124.

[0178] For example, 8-oxoguanine (o 8 G) can be located at positions corresponding to the 2nd, 3rd, 4th, 7th, or a combination thereof at the 5' end of the microRNA.

[0179] For example, at least one single strand of the double-stranded nucleic acid induced by RNA interference may contain the 1st to 9th nucleotides at the 5' end of miR-1, wherein at least one guanine (G) can be converted to 8-oxoguanine (o 8 G) substitution, for example, 8-oxoguanine (o 8 G) can be present at the 2nd, 3rd and 7th bits or a combination thereof at the 5' end of miR-1.

[0180] For example, at least one single strand of the double-stranded nucleic acid induced by RNA interference may contain the 1st to 9th nucleotides at the 5' end of miR-122, wherein at least one guanine (G) can be converted to 8-oxoguanine (o 8 G) substitution, for example, 8-oxoguanine (o 8 G) can be located at the 2nd and 3rd bits or a combination thereof at the 5' end of miR-122.

[0181] For example, at least one single strand of the double-stranded nucleic acid induced by RNA interference may contain the first to ninth nucleotides at the 5' end of let-7 or miR-124, wherein at least one guanine (G) can be replaced by 8-oxoguanine (o 8 G) substitution, for example, 8-oxoguanine (o8 G) can be located at bit 4 of the 5' end corresponding to let-7 or miR-124.

[0182] In RNA interference-induced nucleic acids, 8-oxoguanine (o 8 The position of G) occurs o 8 G:A arrangement to identify target sites.

[0183] For example, RNA interference-induced nucleic acids may include one or more polynucleotides from group 2 below:

[0184] [Group 2]

[0185] By SEQ ID NO: 1(5'p-Uo 8 A polynucleotide composed of the base sequence of GGAAUGUAAAGAAGUAUGUAU-3');

[0186] By SEQ ID NO: 2(5'p-UGo 8 A polynucleotide composed of the base sequence of GAAUGUAAAGAAGUAUGUAU-3');

[0187] By SEQ ID NO: 3(5'p-UGGAAUo 8 A polynucleotide composed of the base sequence of GUAAAGAAGUAUGUAU-3');

[0188] By SEQ ID NO: 65(5'pU o 8 Go 8 A polynucleotide composed of the base sequence of GAGUGUGACAAUGGUGUUUG-3');

[0189] By SEQ ID NO: 66(5'p-UGA) o 8 G A polynucleotide composed of the base sequence UAGUAGGUUGUAUAGdTdT-3'); and

[0190] By SEQ ID NO: 67(5'p-UAA) o 8 G A polynucleotide composed of the base sequence GCACGCGGUGAAUGCdTdT-3').

[0191] When the aforementioned RNA interference-induced nucleic acids are injected into cells or animals, various pathophysiological phenomena can be controlled. For example, they can induce cardiac hypertrophy, inhibit liver cancer cell migration, or induce apoptosis.

[0192] For example, it contains the 1st to 9th nucleotides at the 5' end of miR-1, wherein at least one guanine (G) is replaced by 8-oxoguanine (o). 8G) RNA interference induced by substitution can induce cardiac hypertrophy when injected into cells or animals.

[0193] For example, when it contains the 1st to 9th nucleotides at the 5' end of miR-1225 and at least one of them is guanine (G) coated with 8-oxoguanine (o) 8 When G) RNA interference-induced nucleic acid is injected into liver cancer cells, it can induce inhibition of liver cancer cell migration.

[0194] For example, when it contains the 1st to 9th nucleotides at the 5' end of let-7 or miR-1245 and at least one of them is guanine (G) coated with 8-oxoguanine (o) 8 G) When the RNA interference-induced nucleic acid is injected into glioma cells, it may induce apoptosis.

[0195] The present invention provides a composition comprising the above-mentioned RNA interference-induced nucleic acid and an antioxidant.

[0196] Antioxidants can prevent RNA interference-induced further oxidation of nucleic acids, specifically preventing the oxidation of additional guanine (G) to 8-oxoguanine (O). 8 G), thereby enabling RNA interference-induced nucleic acids to more effectively control pathophysiological phenomena. As an antioxidant, all commonly used antioxidants in this field can be used.

[0197] Furthermore, this invention provides a method for identifying 8-oxoguanine (o 8 Methods for determining the location of G include:

[0198] (a) Extracting RNA from cells;

[0199] (b) Use of anti-o 8 G antibodies were isolated from extracted RNA via immunoprecipitation (IP) to remove 8-oxoguanine (O2) 8 G) RNA;

[0200] (c) By separating the 8-oxoguanine (o 8 The RNA of G is reverse transcribed to produce cDNA, which is used to determine 8-oxoguanine (o) 8 Sequencing library at position G) and sequencing of the library; and

[0201] (d) The modification of guanine (G) to 8-oxoguanine (O) was identified by determining the location of the modification from guanine (G) to thymine (T) based on sequencing results. 8 The position of G).

[0202] Compared to existing methods that identify locations by reverse transcription of RNA to prepare cDNA and then sequencing it, this method for identifying 8-oxoguanine (o8 The method of determining the position of G) can more accurately identify guanine (G) modified to 8-oxoguanine (o) 8 The position of G).

[0203] Furthermore, the present invention provides a modified nucleic acid wherein at least one guanine (G) from the 1st to 9th nucleotides at the 5' end is modified to 8-oxoguanine (o). 8 G) binds specifically to microRNA.

[0204] The modified nucleic acid may include a polynucleotide complementary to six or more (e.g., six, seven, or eight) consecutive polynucleotides starting from either the second or third nucleotide from the 5' end of the modified microRNA, and

[0205] It may contain adenine (A) as at least one 8-oxoguanine (O) in the first to ninth nucleotides at the 5' end of the modified microRNA. 8 The nucleotide at the G) binding site.

[0206] For example, the modified nucleic acid can be modified with at least one guanine (G) from the 2nd, 3rd, or 7th nucleotide at its 5' end to 8-oxoguanine (o). 8 G) binds specifically to microRNA.

[0207] The modified nucleic acid may include a polynucleotide complementary to six or more consecutive polynucleotides starting from the second or third nucleotide at the 5' end of the modified microRNA, and

[0208] It may contain adenine (A) as at least one 8-oxoguanine (O) in the 2nd, 3rd, or 7th nucleotide at the 5' end of the modified microRNA. 8 The nucleotide at the G) binding site.

[0209] For example, modified nucleic acids may include 5'-ACAUUC A -3'、5'-ACAUU A C-3' and 5'-A A At least one base sequence in AAUUCC-3', but not limited thereto.

[0210] Furthermore, the present invention provides a recombinant vector comprising a gene encoding the nucleic acid described above.

[0211] The recombinant vector may include DNA, which may contain a polynucleotide complementary to the polynucleotide of the modified nucleic acid for inhibiting cardiac hypertrophy of the present invention. For example, when the base of the modified nucleic acid for inhibiting cardiac hypertrophy is adenine (A), it may contain a thymine (T) base; when the base of the modified nucleic acid for inhibiting cardiac hypertrophy is guanine (G), it may contain a cytosine (C) base; when the base of the modified nucleic acid for inhibiting cardiac hypertrophy is cytosine (C), it may contain a guanine (G) base; and when the base of the modified nucleic acid for inhibiting cardiac hypertrophy is uracil (U), it may contain an adenine (A) base.

[0212] Furthermore, the present invention provides a pharmaceutical composition for treating cardiac hypertrophy comprising the above-described modified nucleic acid or recombinant vector.

[0213] For example, a pharmaceutical composition for treating cardiac hypertrophy may contain at least one guanine (G) among the 1st to 9th nucleotides at its 5' end, which may be modified to 8-oxoguanine (o). 8 G) microRNA specifically binds to modified nucleic acids.

[0214] The modified microRNA that specifically binds to the modified nucleic acid can be a microRNA that modifies any one of miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0215] The modified microRNA can be a modified miR-1 in which, for example, guanine (G) is modified at positions corresponding to the 2nd, 3rd, and 7th positions or combinations thereof at the 5' end of miR-1.

[0216] For example, a pharmaceutical composition for treating cardiac hypertrophy may further comprise an antioxidant. All antioxidants commonly used in the art, such as NAC, BAH, or antioxidants for cell culture (A1345; Sigma-Aldrich) may be used, but are not limited thereto.

[0217] Furthermore, the present invention can provide a pharmaceutical composition comprising the above-mentioned RNA interference-induced nucleic acid for the treatment of liver cancer or glioblastoma.

[0218] For example, a pharmaceutical composition for treating liver cancer may comprise an RNA interference-induced nucleic acid in which at least one single strand of the nucleic acid double strand may contain the 1st to 9th nucleotides at the 5' end of miR-1225 and wherein at least one guanine (G) is substituted with 8-oxoguanine (o 8 G) Replace.

[0219] For example, RNA interference-induced nucleic acids can contain a single strand with the following base sequence: guanine (G) at the 5' end of the 1st to 9th nucleotides of miR-1222 at positions 2 and 3 of the 5' end is replaced by 8-oxoguanine (o 8 G) replaces.

[0220] For example, a pharmaceutical composition for treating glioblastoma may comprise an RNA interference-induced nucleic acid in which at least one single strand of the nucleic acid double strand may contain the first to ninth nucleotides at the 5' end of let-7 or miR-124, and wherein at least one guanine (G) is substituted with 8-oxoguanine (o 8 G) Replace.

[0221] For example, RNA interference-induced nucleic acids may include single-stranded nucleic acids containing the following base sequence: guanine (G) at position 4 of the 5' end of nucleotides 1 to 9 at the 5' end of let-7 or miR-124 is replaced by 8-oxoguanine (o 8 G) Replace.

[0222] For example, pharmaceutical compositions for treating liver cancer may contain antioxidants in addition to RNA interference-induced nucleic acids, and pharmaceutical compositions for treating glioblastoma may contain antioxidants in addition to RNA interference-induced nucleic acids. Antioxidants refer to commonly used antioxidants such as NAC and BAH, or antioxidants used in cell culture (A1345; Sigma-Aldrich), but are not limited to these.

[0223] Pharmaceutical compositions for treating liver cancer or glioblastoma also contain antioxidants to prevent RNA interference-induced further oxidation of other guanine (G) in nucleic acids by reactive oxygen species in cells, thereby maximizing their function.

[0224] The pharmaceutical compositions of the present invention can be formulated into various forms according to conventional methods. For example, they can be formulated into oral dosage forms, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, creams, gels, patches, sprays, ointments, wamings, lotions, liniments, and pastas, or they can be formulated and applied as topical preparations (such as pastes), suppositories, and sterile injections.

[0225] The pharmaceutical compositions according to the invention may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions. In this case, the carriers, excipients, and diluents included in the composition may include lactose, dextran, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylparaben, propylparaben, talc, magnesium stearate, and mineral oil. In the case of formulations, they are prepared using commonly used diluents or excipients (e.g., fillers, extenders, binders, wetting agents, disintegrants, and surfactants). Solid formulations for oral administration may include tablets, pills, powders, granules, capsules, etc., which may contain at least one excipient in the extract, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Besides commonly used simple diluents such as water and liquid paraffin, and various excipients (e.g., humectants, sweeteners, flavorings, preservatives, etc.), liquid formulations for oral use can also include suspensions, oral solutions, emulsions, syrups, etc. Formulations for parenteral administration can include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, Wipedesol, polyethylene glycol, Tween 61, cocoa butter, lauryl acetate, glycerin gelatin, etc., can be used.

[0226] The pharmaceutical compositions of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dosage may vary depending on the patient's condition and weight and the severity of the disease, as well as the form of the drug and the route and time of administration, but may be appropriately selected by those skilled in the art.

[0227] The pharmaceutical compositions of the present invention are administered in pharmaceutically effective amounts. In this invention, a "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment. The effective dose level is determined based on a variety of factors, including type, severity, drug activity and patient disease type, drug sensitivity, timing of administration, route of administration and excretion rate, treatment duration, concurrent administration, and other factors well known in the medical field. The pharmaceutical compositions according to the invention can be administered as a single therapeutic agent or in combination with other therapeutic agents, can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered alone or multiple times. Considering all the foregoing factors, it is important to administer an amount that achieves maximum effect with minimal dosage and without side effects, which can be readily determined by those skilled in the art. Administration can be once daily or in several separate doses.

[0228] Furthermore, the present invention provides a pharmaceutical composition for the prevention or treatment of cardiac hypertrophy comprising an antioxidant as an active ingredient, wherein the antioxidant inhibits the oxidative modification of at least one guanine (G) in the first to ninth nucleotides at the 5' end of microRNA to 8-oxoguanine (O). 8 G).

[0229] In this invention, antioxidants are used to inhibit the oxidative modification of guanine (G) bases to 8-oxoguanine (O). 8 G), the antioxidant may be, for example, selected from N-acetylcysteine ​​(NAC), butylated hydroxyanisole (BHA), ascorbic acid (vitamin C), glutathione, urate, bilirubin, vitamin E, carotenoids, ubiquinone (Co-Q10), flavonoids, antioxidant enzymes, SOD (superoxide dismutase), catalase, glutathione peroxidase (GSH-PX), glutathione reductase, glutathione transferase, SOD mimic (CuDIOS), ibuselenline, lazaroids (21-aminosteroids), captodative alkenes, α-lipoic acid and dihydrolipoic acid (DHLA), 5-HTP (hydroxytryptophan), DHEA (dehydroepiandrosterone), amino acids, herbal antioxidants and minerals. According to embodiments of the present invention, the antioxidant may be N-acetylcysteine ​​(NAC) or butylated hydroxyanisole (BHA), but the present invention is not limited to the type of antioxidant.

[0230] For example, microRNAs can be miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0231] Furthermore, the present invention provides an information provision method for diagnosing cardiac hypertrophy, comprising:

[0232] Determine whether one or more guanine (G) nucleotides in microRNA isolated from animal cardiomyocytes are modified to 8-oxoguanine (o). 8 G); and

[0233] When one or more guanine (G) nucleotides in microRNA are modified to 8-oxoguanine (o) 8 When G) is present, it is classified as cardiomegaly.

[0234] In this invention, "diagnosis" refers to confirming the presence or characteristics of a pathological state. For the purposes of this invention, diagnosis is used to determine whether cardiac hypertrophy has occurred.

[0235] For example, the nucleotide can be the first to ninth nucleotides at the 5' end of the microRNA.

[0236] For example, the nucleotide can be the 2nd, 3rd, or 7th nucleotide at the 5' end of the microRNA.

[0237] For example, microRNAs can be miR-1, miR-184, let-7f-5p, or miR-1-3p.

[0238] Furthermore, the present invention provides a method for generating a non-human animal model of anti-cardiac hypertrophy and a non-human animal model of anti-cardiac hypertrophy generated by the method, wherein the method includes:

[0239] (a) Operable linking a gene encoding a modified nucleic acid for inhibiting cardiac hypertrophy to a promoter to construct a recombinant vector;

[0240] (b) Introducing the recombinant vector into the fertilized eggs of an animal; and

[0241] (c) Fertilized eggs are transferred into a surrogate mother to produce fertilized eggs to obtain a transgenic animal model.

[0242] For example, microRNAs can be miR-1, miR-184, let-7f-5p, or miR-1-3p, such as miR-1.

[0243] For example, the animal can be a non-human primate, mouse, dog, cat, rabbit, horse, or cow.

[0244] According to embodiments of the present invention, the animal may be a mouse, but if it is a mammal other than a human, the species is not particularly limited.

[0245] In this invention, there are no particular limitations on the method of introducing DNA in vector form into cells, and it can be performed, for example, by nuclear transfection, transient transfection, cell fusion, liposome-mediated transfection, polybrene-mediated transfection, calcium phosphate transfection (Graham, FL et al., Virology, 52:456 (1973)), DEAE dextran transfection, microinjection transfection (Capecchi, MR, Cell, 22:479 (1980)), cationic lipid transfection (Wong, TK et al., Gene, 10:87 (1980)), electroporation (Neumann E et al., EMBO) J, 1:841 (1982)), transduction or transfection, or methods well known to those skilled in the art as described in Basic Methods in Molecular Biology, Davis et al., 1986 and Molecular Cloning: A Laboratory Manual, Davis et al., (1986).

[0246] Furthermore, the present invention provides a method for screening candidate substances for treating cardiac hypertrophy, comprising:

[0247] (a) Processing candidate substances in cardiomyocytes of a hypertrophic heart animal model;

[0248] (b) Analysis of the nucleotides in microRNAs expressed in cardiomyocytes of a hypertrophic cardiac model showed that guanine (G) was modified to 8-oxoguanine (O). 8 The frequency of G); and

[0249] (c) When compared with the case of untreated candidate material, 8-oxoguanine (o 8 When G) decreases, the candidate substance is selected as a treatment for cardiac hypertrophy.

[0250] In this invention, candidate substances refer to substances used for screening to test whether they affect polynucleotides and o in cardiomyocytes of a cardiac hypertrophy animal model. 8 G: An unknown substance with an unknown binding frequency to a target site, and may include, but is not limited to, chemicals, proteins, (poly)nucleotides, antisense RNA, siRNA (small interfering RNA), or natural product extracts.

[0251] In this invention, the candidate substance can be an antioxidant, but is not limited thereto.

[0252] Furthermore, the present invention provides a method for inhibiting cardiac hypertrophy, the method comprising applying modified nucleic acids to an individual.

[0253] Furthermore, the present invention provides a method for inhibiting liver cancer metastasis or treating glioblastoma, the method comprising applying RNA interference-induced nucleic acid to an individual.

[0254] Furthermore, the present invention provides a method for preventing or treating cardiac hypertrophy, the method comprising applying a composition containing an antioxidant as an active ingredient to an individual.

[0255] In this invention, "individual" refers to a subject who needs to be administered a composition comprising a modified nucleic acid or RNA interference-induced nucleic acid for inhibiting cardiac hypertrophy or an antioxidant for treating liver cancer or glioblastoma, and more specifically, to mammals such as humans or non-human primates, mice, dogs, cats, horses and cattle.

[0256] In this invention, "application" means giving an individual, in any suitable manner, a composition of the present invention comprising a modified nucleic acid for inhibiting cardiac hypertrophy or an RNA interference-induced nucleic acid or an antioxidant for treating liver cancer or glioblastoma.

[0257] Furthermore, this invention provides the use of modified nucleic acids for inhibiting cardiac hypertrophy.

[0258] Furthermore, this invention provides the use of RNA interference-induced nucleic acids for inhibiting liver cancer metastasis and treating liver cancer or glioblastoma.

[0259] Furthermore, the present invention provides the use of compositions containing antioxidants as active ingredients for the prevention or treatment of cardiac hypertrophy. Detailed Implementation

[0260] Preferred embodiments are presented below to aid in understanding the invention. However, the following embodiments are provided merely for ease of understanding, and the scope of the invention is not limited to these embodiments.

[0261] Example 1. Cell culture, drug treatment and transfection

[0262] 1. Cell Culture

[0263] Rat cardiomyocyte line H9c2 (H9c2(2-1), ATCC CRL-1446; H9c2, Korean Cell Bank), human ventricular cardiomyocyte line AC16 (provided by J. Han, HWLee and WJPark), and human cervical adenocarcinoma cell line HeLa (ATCC CCL-2) were grown in Dulbecco modified Eagle medium (DMEM; Hyclone) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Welgene) at 37°C and 5% CO2.

[0264] For consistency of results, several different batches of H9c2 maintained at two different facilities (ATCC and Korean cell line bank) were used, and AC16 was obtained from each of the different batches derived from Dr. MM Davidson (scc109, Millipore).

[0265] Primary cultures of rat neonatal cardiomyocytes (rCMCs) were prepared using the Neomyt kit (nc-6031; Cellutron) according to the manufacturer’s protocol, as described in Seok, HY et al. Circ Res 114, 1585-1595 and Huang, ZPetal. Circ Res 112, 1234-1243.

[0266] On day 1 postnatal (P1), ventricular tissue derived from the hearts of Sprague Dawley rats was collected, washed, and cut into 3-4 mm pieces. The pieces were then agitated in a 50 ml flask at 37°C, and cells derived from the ventricular sections were completely separated by repeated enzymatic reactions (solutions provided by the Neomyt kit). Undigested tissue was removed from the resulting supernatant using a sieve, and the tissue was then plated for 2 hours to remove easily adhering non-cardiac cells. Finally, non-adherent rCMCs were harvested and cultured in SureCoat (sc-9035; Cellutron) plates with 10% FBS (Gibco), 5% horse serum (HS; Welgene), 2% L-glutamine (Welgene), 0.1 mM 5-bromo-2'-deoxyuridine (Sigma-Aldrich), and 100 U / ml. -1 Penicillin and supplements of 100 μg / ml -1 Treatment with a 4:1 mixture of DMEM and M199 (Welgene) for streptomycin (Welgene).

[0267] 2. Drug treatment

[0268] To induce adrenergic hypertrophy, unless otherwise specified, rCMC, H9c2, or AC16 are typically treated with 200 μM phenylephrine (PE) or 10 mM isoproterenol (ISO) and tested 48 hours post-treatment. Since serum deficiency is also used as a pretreatment condition for myocardial hypertrophy, the same medium without FBS and HS is replaced 24 hours prior to treatment. For antioxidant treatment, 2 mM N-acetylcysteine ​​(NAC) is applied during PE or ISO treatment.

[0269] 3. Transfection

[0270] Typically, following the manufacturer's general protocol, Lipofectamine 2000 or 3000 (Invitrogen) is used to transfect or co-transfect vectors containing dual miRNAs into H9c2, AC16, rCMC, or HeLa cells, while RNAiMAX (Invitrogen) or Lipofectamine 3000 (Invitrogen) is used for transfection of miRNAs or miRNA inhibitors (50 nM). For maximum efficiency, the correct number of cells is counted using the Countess II automated cell counter (Invitrogen), and the cells are aliquoted into plates before transfection.

[0271] Example 2. ROS and cell size measurement

[0272] For quantitative measurement of cellular ROS levels, flow cytometry was performed based on ROS fluorescent dyes, and dihydroethidium (DHE) was applied using the Muse CellAnalyzer (Milipore) and Muse Oxidative Stress Kit (Milipore). Specifically, one day prior to drug treatment, at a concentration of 10... 6 H9c2 or AC16 cells were ablated at a density of 1 cell / well in a 6-well plate. Cells were harvested, fixed, stained, and measured after repeated treatments (n=3) from 10 minutes to 48 hours post-treatment, according to the manufacturer's protocol. For analysis, ROS levels and cell size were quantified in ablated numbers (n=10,000). Forward scattered light (FSC) was measured as cell size (log) according to the manufacturer's protocol. 10 (FSC), y-axis; hypertrophy, cell size >3).

[0273] To determine the amount of ROS in cardiac tissue lysates, CM-H2DCFDA (Invitrogen) was used. Protein quantification was performed on homogenized lysates prepared in 1x RIPA lysis buffer supplemented with protease inhibitors (COPLETE, Mini, EDTA-free; Roche) and 2.5 mM deferoxamine mesylate (DFOM; Sigma-Aldrich) using the Qubit Protein Assay Kit (Invitrogen). 100 μg of lysate was incubated with 2 μM CM-H2DCFDA in the dark at 37°C for 30 min. Fluorescence signals were detected using a Qubit 2.0 fluorometer (Invitrogen).

[0274] To visualize cellular ROS levels, DHE (Invitrogen) was used. Initially, H9c2 cells were serum-starved for 24 hours and treated with 100 μM PE until the specified time point. Then, the harvested cells were washed with serum-free DMEM and incubated with 10 μM DHE at 37°C for 10 minutes in the dark. After incubation, the cells were washed again with serum-free DMEM. ROS images were obtained using an inverted fluorescence microscope (Leica DM18).

[0275] Example 3. Immunofluorescence staining

[0276] H9c2 or rCMC was fixed with 4% paraformaldehyde (PFA; Bioseseang) for 15 minutes at room temperature. After washing twice with PBS (Bioseseseang) containing 0.1% NP-40 (Sigma-Aldrich), the samples were incubated at room temperature for 1 hour with the addition of 5% bovine serum albumin (BSA; Bovogen). Then, the samples were washed twice and incubated with the primary antibody under the following conditions: overnight at 4°C in PBS containing 0.1% NP-40 and 3% BSA; MF20 (1:1000, Developmental Hybridoma), o 8 G (15A3, 1:1000, QED Bioscience) and Ago2 (ab5072, 1:200, Abcam) were used. DAPI (1.5 μg / ml, Vectorlab) was used for nuclear staining. Due to the varying degrees of fate heterogeneity among H9c2 cardiomyocytes (although all H9c2 cells belong to the same lineage as cardiomyocytes), MF20 was used for staining. For RNase treatment, 10 μg / ml RNase A (Invitrogen) was administered at room temperature for 15 min prior to primary antibody incubation. Alexa Fluor 488 donkey anti-mouse IgG (1:1000, Abcam) and Alexa Fluor 594 donkey anti-rabbit IgG (1:1000, Abcam) were used as secondary antibodies in PBS containing 0.1% NP-40 for 1 h at room temperature. The stained cells were examined using an inverted fluorescence microscope (Leica DMi8), analyzed using Leica Application Suite (LAS), and quantified using ImageJ (≥100 cells, https: / / imagej.nih.gov / ).

[0277] Example 4. Cell size measurement

[0278] Cell size was quantified from cultures or tissue sections using the "Measure" function in ImageJ 1.51s software (https: / / imagej.nih.gov / ). All images were converted to 2560x1962 pixels, equivalent to 35.56x26.67 inches. 2 This is to ensure consistent comparison across multiple images. Then, in inches... 2 The cell area in the converted image is measured in units of 71.9 pixels per inch and used for the next analysis.

[0279] Example 5. RNA Synthesis and Modification

[0280] Custom synthesis and modification services from TriLink Biotechnologies (USA), Integrated DNA Technologies (USA), ST Pharm (Korea), and Bioneer (Korea) were used to produce RNA with various modifications and to monitor and validate its quality.

[0281] 8-oxoguanine (o) in ribonucleotides 8 G) Introducing miR-1 (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 7) at the specified location; miR-1: 7o 8 G, 5'p-UGGAAU o 8 G UAAAGAAGUAUGUAU-3'(SEQ IDNO:3);miR-1:2o 8 G, 5'pU o 8 G GAAUGUAAAGAAGUAUGUAU-3'(SEQ ID NO: 1); and miR-1: 3o 8 G, 5'p-UG o 8 G AAUGUAAAGAAGUAUGUAU-3' (SEQ ID NO: 2).

[0282] By annealing with the synthesized miR-1 passenger strand (5'p-ACAUACUUCUUUAUAUGCCCAUA-3' (SEQ ID NO: 8), with fluorescein isothiocyanate (FITC) attached to the 5'-terminus upon confirmation of transfer), miR-1 duplexes containing oxidized derivatives were generated in vitro under the following conditions: 90°C for 2 minutes, 30°C for 1 hour, and 4°C for 5 minutes.

[0283] In addition, 8-oxoguanine (o) in ribonucleotides 8 G) Introducing miR-122 (5'pU)G GAGUGUGACAAUGGUGUUUG-3'; SEQ ID NO: 68), let-7(5'-pUGA G UAGUAGGUUGUAUAGdTdT-3';SEQ ID NO:69) and miR-124(5'-p UAA G The specified position of GCACGCGGUGAAUGCdTdT-3';SEQ ID NO:70) is as follows: miR-122:2,3o 8 G, 5'pU o 8 Go 8 G AGUGUGACAAUGGUGUUUG-3' (SEQ ID NO: 65); let-74o 8 G: 5'p-UGA o 8 G UAGUAGGUUGUAUAGdTdT-3' (SEQ ID NO: 66);miR-124: 4o 8 G, and 5'-pUAA o 8 G GCACGCGGUGAAUGCdTdT-3' (SEQ ID NO: 67).

[0284] The double strands of miR-122, let-7 and miR-124 containing oxidized derivatives were prepared using the same method as that for miR-1 double strands.

[0285] miR-1 containing G>U substitution at a specified position (miR-1: 2GU, 5'pU) was also synthesized. U GAAUGUAAAGAAGUAUGUAU-3'(SEQ ID NO:9);miR-1:3GU,5'p-UG U AAUGUAAAGAAGUAUGUAU-3' (SEQ ID NO: 10); miR-1: 7GU, and 5'p-UGGAAU UUAAAGAAGUAUGUAU-3' (SEQ ID NO: 11)) and formed a doublet with the guest strand of miR-1. As a control miRNA, a non-target miRNA (NT) derived from cel-miR-67 (a Caenorhabditis elegans-specific miRNA provided by D. Dharmacon as a negative control) (5'-UCACAACCUCCUAGAAAGAGUA-3'; SEQ ID NO: 12) was synthesized as siRNA and used as a doublet (guide strand: 5'p-UCACAACCUCCUAGAAAGAGUAdTdT-3' (SEQ ID NO: 13), guest strand: 5'p-UACUCUUUCUAGGAGGUUGUGAdTdT-3' (SEQ ID NO: 14), 'dT' represents thymidine deoxynucleotide). When seed-mediated off-target effects were excluded, the NT was further modified to include a dSpacer (a base-free deoxynucleotide) at position 6 in both the guide strand and the guest strand. ), or as previously reported, 2'-O-methyl at positions 1 and 2.

[0286] To confirm o 8 G-induced G>T mutation, 39-oxo-R(o 8 G;5'-CCUGGUCCCAGACUAAA GAAUo 8 GC UUGACAGUUAUCUCGUAUGCCGUCUUCUCGAGGUAGCGGAACCGUGAGCUUUGAAGU-3';SEQ ID NO: 15), which may be transmitted via o during RT-PCR. 8 G:A base binding generates the EcoR1 site; and 39R (G; 5'-CCUGGUCCCAGACUAAAGAAUGCUUGACAGUUAUCUCGUAUGCCGUCUUCUCGAGGUAGCGGAACCGUGAGCUUUGAAGU-3'; SEQ ID NO: 16) was synthesized as its control. As a spike-in control, o was synthesized. 8 G spiked (5'pU) o 8 Go 8 G AAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 17), G-labeled (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 18), and miRNA: o 8 G-Dive (5'p-UAAG) o 8 G CACGCGGUGAAUGCCAA-3'; SEQ ID NO: 19).

[0287] For competitive miR-1 and miR-1:7o 8 G inhibitor, synthesized anti-seed (2x: (5'-ACAUUCC-3' is the miR-1 seed site; SEQ ID NO: 20)), anti-7oxo (2x: 4x: 5'- dTAAAUUCCAAAUUCC AG AAAUUCC AC AAAUUCC AdT-3', 9x: 'dN' represents deoxynucleotides A, T, C, or G (5'-AAAUUCC-3' is the miR-1 7oxo site; SEQ ID NO: 6)), cont (anti-NT; 2x: 4x: 5'-dT GGUUGUGGGUUGUG AG GGUUGUG AC GGUUGUG AdT-3', 9x: (5'-GGUUGUG-3' is the cont NT site; SEQ ID NO: 21). The intentional attachment of "dT" or "dN" to the 5'- and 3'-termini of the inhibitor contributes to RNA stability. This is achieved by using debased deoxynucleotides... Introducing target site binding sites in anti-seed (2x) or anti-7oxo (2x) to prevent off-target effects via the putative sequence of the binding site confirmed no phenotypic difference compared to inhibitors without debased deoxynucleotides. Underlined sequences indicate the corresponding target repressive sites.

[0288] Example 6. RNA Extraction

[0289] Small (<-200 nt) and large (>-200 nt) RNA fractions were separated using the miRNeasy Mini Kit (Qiagen) to purify RNA by size according to the manufacturer's protocol. For cardiac tissue samples, as previously reported, a Minillys Personal Homogenizer (Bertin) or a glass homogenizer was used in the presence of 700 μl Qiazol Lysis Reagent (Qiagen) supplemented with 2.5 mM DFOM (Sigma-Aldrich) to prevent in vitro oxidation. For total RNA purification, after adding 20% ​​chloroform (Merck), RNA was precipitated with isopropanol and treated with RQ1 RNase-free DNase (37°C for 30 min; heat inactivation stop solution, 65°C for 10 min; Promega). For accurate RNA quantification, a spectrophotometer (Denovix) and Qubit PCR (Invitrogen) were used.

[0290] To purify miRNA, approximately 20 nt of gel extraction was performed from total RNA. Total RNA, denatured in gel loading buffer II (90°C for 2 min; Ambion), was separated by a 15% Urea-PAGE gel labeled with approximately 20 nt of miRNA markers (synthetic miR-1), and its size was cross-validated using 14 to 30 ssRNA ladder markers (Takara). Then, after staining with SYBR Gold, approximately 20 nt samples were excised from the gel, incubated overnight at 65°C in a temperature-controlled mixer (Thriller, Peqlab) with gel extraction buffer (0.5 M ammonium acetate, 10 mM magnesium acetate, 0.1% SDS, 1 mM EDTA, pH 8.0), and further purified using the Oligo Clean & Concentrator kit (Zymo).

[0291] Example 7. O via ELISA 8 Quantitative analysis of G

[0292] According to the manufacturer's instructions, the OxiSelect Oxidative RNA Damage ELISA kit (CellBiolabs) was used for o 8 Colorimetric detection and quantification of G. For sample preparation, purified small or large RNA (0.4-5 μg) was treated with nuclease P1 (Wako) at 37°C for 1 hour, extracted by ethanol precipitation, and then supplemented with a competitive O2-O2 solution. 8 G / BSA conjugates are used to bind anti-o 8G antibody, pre-coated on a plate, was then reacted with the HRP-conjugated secondary antibody provided in the kit for detection. The absorbance of the sample was measured using a spectrophotometer (450 nm, GloMax-Multi Detection System; Promega) and compared with a predetermined o 8 G standard curve comparison estimation o 8 The concentration of G is expressed as a relative amount.

[0293] Example 8. Drug treatment

[0294] All experimental procedures were approved by the Laboratory Animal Steering Committee of Korea University and conducted in accordance with animal protection and laboratory animal use guidelines. To induce adrenergic cardiac hypertrophy, 8- to 12-week-old male C57BL / 6J mice (Koatech) were administered ISO (75 mg / kg) via intraperitoneal injection (IP) every 2 days for a total of 29 days.

[0295] As a mock injection control, an equal volume of PBS was used, and 100 mg / kg NAC was administered to investigate antioxidant effects. Mice were grouped according to the injected drug (n=4 per group, and sample size was selected based on the minimum number used in previous studies (Lee, H. Set et al. Nature Communications 6, 10154)): Mock, ISO, ISO+NAC, and NAC. Heart tissue was collected 29 days after the first injection by measuring heart weight (HW), body weight (BW), and tibia length (TL), and HW / BW or HW / TL was used as the normalized heart size. All samples were stored at -80°C until analysis of ROS measurements, CLEAR-CLIP, and RNA extraction, followed by... 8 G ELISA, dot blot, Northwestern, IP, and qPCR were used. For paraquat (Sigma-Aldrich) treatment, mice were administered 10 mg / kg paraquat weekly via IP for 4 weeks. RNA was then extracted and used for ELISA. In the RNA-Seq case, ISO was injected three times via IP on days 1, 3, and 5, and mice (n=3) were sacrificed one week later and injected with the same volume of PBS as a control. All samples were stored at -80°C until used for constructing RNA-Seq libraries and qPCR analysis.

[0296] Example 9. Echocardiography

[0297] Echocardiography was monitored and recorded under the control of the Samsung Medical Center Animal Imaging Core Facility. Specifically, mice were initially exposed to 2% to 5% isoflurane to induce anesthesia, and maintained with 1% isoflurane while echocardiography (Visual Sonics Vevo 2100 Imaging System) was performed for approximately 5 minutes. Under M-mode tracking, a single recording location, namely the mouse's nipple region, was fixed using 2D short axes. Heart rate, diastolic and systolic wall thickness, left ventricular (LV) size, and LV end-diastolic and end-systolic chamber sizes were measured.

[0298] Example 10. Analysis of dotted and northwestern blots

[0299] For dot blots, size-specific RNA (80-300 ng) or gel-purified miRNA (50 ng) is plotted on a Zeta-Probe membrane (Bio-Rad) and then cross-linked with UV light onto a Spectrolinker XL-1000 (Spectroline) membrane using optimal cross-linking (120 mJ / cm²). 2 Crosslinking was performed using the option. For Northwestern blotting, total RNA was denatured in gel loading buffer II (90°C for 2 min; Ambion), separated using a 22nt miRNA-size marker (synthetic miR-1) on a 15% Novex TBE-Urea gel (Invitrogen), transferred to a Zeta-Probe blotting membrane, and protected with UV (120 mJ / cm²). 2 Crosslinked with Spectrolinker XL-1000. The membrane was blocked at room temperature with 1x TBST (Biosesang) and 5% BSA for 1 hour, and then in 1x TBST with anti-oxidant. 8 G antibody (15A3, 1:2000; QED Bioscience) was incubated at room temperature for 1 hour. Then, HRP-conjugated goat anti-mouse IgG (1:5000, Pierce) was incubated in TBST at room temperature for 1 hour, followed by reaction with ECL (SuperSignal West Pico PLUS, Pierce) for detection. When using a fluorophore-conjugated secondary antibody (Alexa Fluor 680 goat anti-mouse IgG, 1:15000 in 1xTBST, Invitrogen), the blocking agent FL Fluorescence Blocking Buffer was used for blocking and reacting with anti-o antibody. 8G antibody incubation. Fluorescence signal was directly quantified using an iBright FL100 imaging system (Invitrogen) and calculated as the intensity relative to the total amount of RNA stained as spots by SYBR Gold (1:10000, Invitrogen).

[0300] Example 11.o 8 Optimization of G Immunoprecipitation (IP)

[0301] In order to optimize o 8 G targets anti-o 8 Immunoprecipitation (IP) conditions for G antibody (15A3, QED Bioscience), o 8 G plus (5'p-Uo) 8 Go 8 GAAUGUAAAGAAGUAUGUAU-3'), synthesized 20nt length containing two o 8 RNA with G bases and no o 8 G was compared with G-spiked (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'). This was to prepare a product with anti-o... 8 G antibody beads, containing 2.5 μg of anti-o 8 G antibody (15A3, QED Bioscience) was incubated in 25 μl Dynabeads Protein G (Invitrogen) and 200 μl PBS at room temperature for 1 hour. To prevent the formation of anti-o antibodies... 8 The nonspecific interaction of G antibodies was also tested during bead preparation with the addition of 250 μg deoxyguanosine (dG, Sigma-Aldrich). For washing and purification, Dynabeads Protein G was separated using a DynaMag-2 magnet (Invitrogen). After washing the beads three times with PBS, the results were examined for o 8 IP buffers with different conditions: G and G spiked (10 pg or 100 pg in the presence of 300 ng small RNA); PBS containing 0.04% NP-40; low detergent, PBS containing 0.004% NP-40; high detergent, PXL (PBS, 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40). For reference, all IP procedures were performed at 4°C for 2 hours in the presence of 2.5 mM DFOM and 40 U recombinant RNase inhibitor (Takara).

[0302] Other conditions for the washing buffer were also tested: high detergent, IP buffer (2 times) > PXL (4 times) > PBS (2 times); salt addition, PBS supplemented with 100mM NaCl (3 times) > PBS (5 times); continuous washing with high salt, TE (15mM Tris-HCl pH7.5, 5mM EDTA) > TE containing high detergent (1% Triton X-100, 1% deoxycholate, 0.1% SDS and 2.5mM EGTA) and high salt (1M NaCl) > TE containing high detergent and salt (120mM NaCl) > washing buffer (50mM Tris-HCl pH7.5, 1mM MgCl, 150mM NaCl, 0.05% NP-40); continuous washing with extreme salt, TE > TE containing high detergent and high salt > TE containing high detergent and extreme salt (2M NaCl) > TE containing high detergent and salt > washing buffer. RNA was purified from Qiazol Lysis Reagent beads using 700 μl of Qiazol Lysis Reagent supplemented with 2.5 mM DFOM and 20% chloroform, and the RNA Clean & Concentrator-5 kit (Zymo) was used. Since the spiked control was 22 nt in size, the RNA was measured by quantitative RT-PCR (qPCR). 8 The G-scaling and G-scaling quantities are used, and their relative ratios are used to estimate the signal: noise in the IP process.

[0303] Example 12. Quantitative RT-PCR (qRT-PCR) of miRNA

[0304] To quantify miRNAs, miRNA qPCR or TaqMan MicroRNA assay (Applied Biosystems) was used. Specifically, 1 μg of small RNA or IP-purified RNA purified using the miRNeasyMini Kit (Qiagen) was polyadenylated using Poly(A) Polymerase (Ambion), with a total volume of 10 μl. Subsequently, the polyadenylated RNA was reverse transcribed using SuperScript III reverse transcriptase (Invitrogen) along with a 2 μM oligonucleotide (dT) adapter primer (5'-GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTTTVN-3'; SEQ ID NO: 22). qPCR reactions were performed in SYBR Green PCR Master Mix (Applied Biosystems) using forward (same sequence as the target miRNA) and reverse primers (5'-GCGAGCACAGAATTAATACGACTCAC-3'; SEQ ID NO: 23); cycling conditions (95°C for 5 min; 95°C for 15 s, 55°C for 15 s, and 72°C for 20 s, 45 cycles; and 72°C for 5 min). U6 snRNA measurements were typically used as a reference control (forward: 5'-CGCTTCGGCAGCACATATAC-3' (SEQ ID NO: 28), reverse: 5'-TTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 29)), except when using o 8 G or G-spiked (positive: 5'-TGGAATGTAAAGAAGTATGTAT-3' (SEQ ID NO: 24), negative: 5'-GCGAGCACAGAATTAATACGACTCAC-3' (SEQ ID NO: 25)) or miRNA: o 8 G is spiked (positive: 5'-TAAGGCACGCGGTGAATGCCAA-3'(SEQ ID NO: 26), negative: 5'-GCGAGCACAGAATTAATACGACTCAC-3'(SEQ ID NO: 27)).

[0305] When using the TaqMan MicroRNA Assay, follow the manufacturer's instructions. Specifically, use the MicroRNA Reverse Transcription Kit (Applied Biosystems) along with specific RT probes that recognize each miRNA sequence to reverse transcribe 100 ng of small RNA. Use the RT product to perform a qPCR reaction using specific qPCR primers and TaqMan Universal PCR Master Mix (No AmpErase UNG; Invitrogen). RT probes and qPCR primers for detecting specific miRNAs are provided in the following kits: miR-1b and hsa-miR-1 in rCMC (ID: 002222); miR-1-3p and rno-miR-1 in rCMC (ID: 002064); miR-184 and -miR-184 in rCMC (ID: 000485); let-7f and hsa-let-7f in rCMC (ID: 000382); miR-1 and hsa-miR-1 in H9c2, AC16, rCMC, and mouse heart (ID: 00222); U6 and U6 snRNA (ID: 001973); o 8 G or G-labeled, hsa-miR-1 (ID: 002222); miRNA: o 8 G spiked, mmu-miR-124a (ID: 001182); and NT spiked, cel-miR-67-3p (ID: 000224). All qPCR analyses were performed by Rotor-GeneQ (Qiagen) with technical replicates (n=3) and parallel reactions without reverse transcriptase (negative control).

[0306] Example 13. RT-PCR in o 8 Analysis of G>T transformation

[0307] Due to o 8 G can pair with A, based on the synthetic 39-oxo-R from GAAUo 8 The effect of GC-to-GAATTC (EcoRI site) changes on inducing G>T conversion was investigated. 8Reverse transcription of G control (39-oxo-R) and G control (39R) was performed using SuperScript III reverse transcriptase (Invitrogen) and RT primers (5'-ACTTCAAAGCTCACGGTTCCGCTACCTCGAGAAGACGGCATACGA-3' (SEQ ID NO: 30), Bioneer). cDNA was amplified by PCR reactions (30 cycles of 98°C for 10 seconds; 98°C for 10 seconds, 40°C for 30 seconds, 72°C for 20 seconds; and 72°C for 10 minutes) using Ex Taq (Takara) with primers (forward: 5'-CCTGGTCCCAGACTAAAGAAT-3' (SEQ ID NO: 31), reverse: 5'-ACTTCAAAGCTCACGGTTCCG-3' (SEQ ID NO: 32); Bioneer).

[0308] After purification using the Oligo Clean & Concentrator kit (Zymo), the RT-PCR products were digested with EcoRI (NEB) and separated on a 12% PAGE gel in TBE.

[0309] RT-PCR in o 8 G-induced G>T conversion was also directly confirmed by sequencing. Following each ligation step, according to the protocol used to construct a modified small RNA-Seq library (see Example 14), 400 ng of [a specific RNA] including [a specific RNA] was constructed, except using the RNA Clean & Concentrator-5 kit (Zymo). 8 G's 22nt synthesized RNA (5'p-UGGAAUo) 8 The sequencing library of GUAAAGAAGUAUGUAU-3' (SEQ ID NO: 33). Specifically, the unique read values ​​resulting from the degenerate barcode (4 random nucleotides) in the 5' adaptor can be analyzed. 8 The frequency of nucleotides at the G position is used to eliminate confounding biases in PCR amplification.

[0310] Example 14.o 8 G-miSeq

[0311] Based on RT-PCR, o 8 Optimization of GIP conditions and o 8 G-induced G>T conversion led to the development of sequencing methods (o 8 G-miSeq was used to identify oxidized miRNAs and their o 8 G position. 12.5 μg of anti-o... 8Antibody G (15A3, QED) was used to prepare antibody-coated magnetic beads by alternating incubation for 1 hour at room temperature with 125 μl of Dynabeads Protein G (Invitrogen) in PBS (total volume 500 μl) supplemented with 1.2 mg deoxyguanosine (Sigma). Dynabeads Protein G was isolated using a DynaMag-2 magnet (Invitrogen) for washing and purification. After washing twice with PBS, 7–10 μg of small RNA sample purified from the miRNeasy Mini Kit (Qiagen) was mixed with beads prepared in 200 μl of PXL containing 2.5 mM DFOM (Sigma) and 40 U of recombinant RNase inhibitor (Takara). After alternating incubation at 4°C for 2 hours, a series of washes were performed using extreme salts: TE (15 mM Tris-HCl pH 7.5, 5 mM EDTA); TE containing high detergent (1% Triton X-100, 1% deoxycholate, 0.1% SDS and 2.5 mM MEGTA) and high salt (1 M NaCl); TE containing high detergent and extreme salt (2 M NaCl); TE containing high detergent and salt (120 mM NaCl); and washing buffer (50 mM Tris-HCl pH 7.5, 1 mM MgCl, 150 mM NaCl, 0.05% NP-40). The purified oxidized small RNA on the beads was processed either as is or after extraction.

[0312] For the treatment of intact beads, the RNA of the beads was washed twice with PNK buffer (50 mM Tris-Cl pH 7.4, 10 mM MgCl2, 0.5% NP-40). The beads were incubated at 70 °C for 2 min with 8 μl of T4 RNA ligase 2 lysing KQ (NEB) in 80 μl of T4 RNA ligase buffer (NEB) supplemented with 1 mg / ml BSA and 40 U recombinant RNase inhibitor (Takara). Then, the beads were prepared on ice with 0.25 μM of 3' adapter (5'-(rApp)T(PMe)GGAATTCTCGGGTGCCAAGG(ddC)-3' (SEQ ID NO: 34); rApp: adenosine monophosphate, PMe: methylphosphonate, ddC: dideoxycytosine; Trilink).

[0313] After incubating at 28°C for 1 hour in a Thriller (Peqlab), the beads were washed once with PXL (2.5 mM MDFOM) and twice with PNK buffer. For 5' adapter ligation, the 0.25 μM 5' adapter (5'-GUUCAGAGUUCUACAGUCCGACGAUCNNNN(2'-methoxy-C)-3' (SEQ ID NO: 35); Trilink) prepared on ice was incubated at 28°C for 1 hour on beads containing a total of 80 μl of T4 RNA ligase buffer consisting of 8 μl T4 RNA ligase (Thermo), 1 mg / ml BSA, and 40 U recombinant RNase inhibitor in a Thriller (Peqlab). After sequential washing with PXL (2.5 mM DFOM) and 1x first-strand buffer (Invitrogen), the RNA on the beads was reverse transcribed as follows: 1 μl SuperScript III reverse transcriptase (Invitrogen), 0.72 μM RT primer (5'-GCCTTGGCACCCGAGAATTCCA-3'; SEQ ID NO: 36), 375 μM dNTP, 7.25 mM DTT, and 4 U recombinant RNase inhibitor, totaling 40 μl 1x first-strand buffer; and incubated at 55 °C in a Thriller (Peqlab) for 1 hour. The obtained cDNA was further amplified by PCR to construct a sequencing library.

[0314] Additionally, supplemental small RNA (0.4-1 μg; small RNA-Seq) or o 8 The cDNA sequencing library was purified from beads using 700 μl of Qiazol Lysis Reagent with G IP (2.5 mM DFOM and 20% chloroform) and then extracted from the RNA-extracted product (concentrated using the Clean & Concentrator-5 kit).

[0315] First, 0.25 μM of the 3' adaptor was ligated in 13 μL of total T4 RNA ligase buffer (replenished with 20% PEG 8000 and 20 U of recombinant RNase inhibitor prepared on ice) using 1 μL of T4 RNA ligase 2 lysed KQ (NEB) in 13 μL of total T4 RNA ligase buffer (replenished with 20% PEG 8000 and 20 U of recombinant RNase inhibitor prepared on ice). After incubation at 28 °C for 60 min, the ligation was inactivated at 65 °C for 20 min. Then, 13 μL of T4 RNA ligase buffer containing 0.25 μM of 5' adaptor, 2 μL of T4 RNA ligase (ThermoFisher), 40 U of recombinant RNase inhibitor, and 1 mg / ml BSA was added to ligate the 5' adaptor, and the buffer was incubated at 28 °C for 60 min and inactivated at 65 °C for 20 min. The ligated total RNA sample was denatured at 70°C for 2 minutes with 1 μl of 10 μM RT primers, placed on ice for 1 minute, and then reverse transcribed as follows: 1 μl SuperScript III reverse transcriptase (Invitrogen), 375 μM dNTPs, 7.25 mM DTT, and 4 U recombinant RNase inhibitor, in a total of 40 μl 1x first-strand buffer; and incubated at 55°C for 1 hour and 70°C for 15 minutes. The resulting cDNA was further amplified by PCR to prepare sequencing libraries.

[0316] The prepared cDNA was further processed to include the Trussq indexed adapter sequence (Illumina). First, cDNA was amplified by PCR using Q5 high-precision 2x premix (NEB) with 100 nM universal forward primers (5'-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3'; SEQ ID NO: 37) and 100 nM RT primers; 5 cycles were performed at 98°C for 30 seconds; 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 15 seconds; followed by a final incubation at 72°C for 10 minutes. After purifying the primary PCR product using the QIAquick PCR Purification Kit (Qiagen), a portion of the elution was used for qPCR (Rotor-GeneQ; Qiagen) by adding SYBR Geen I (1:10000, Invitrogen) to Q5 high-precision 2x premix, and the number of cycles required to reach linear amplification was determined. The remaining purified primary PCR product was subjected to a second PCR using a set of optimal cycles with Q5 high-precision 2x premix to generate multiplex barcodes (250 nM universal forward primers, 250 nM barcode primers: 5'-CAAGCAGAAGACGGCATACGAGAT-6mer barcode-GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3'; SEQ ID NO: 38). The PCR product, containing the expected size of approximately 20 nt insert, was further purified using Pippin Prep (Sage Science) with 15% Urea-PAGE gel extraction (see Example 6) or a 3% agarose gel cartridge. Quantification was performed using the Qubit RNA HS assay kit (Invitrogen) and Fragment Analyzer (Advanced analytical) with cross-checking. Finally, the prepared library was sequenced to 50 single-end reads using a HiSeq 2500 system (Illumina) and demultiplexed using CASAVA (Illumina).

[0317] Example 15. Bioinformatics and Statistical Data Analysis

[0318] For bioinformatics analysis, Python scripts (http: / / clip.korea.ac.kr / oxog / ) and the UCSC Genome Explorer (http: / / genome.ucsc.edu / ) were primarily used. Tuxedo Suite; TopHat2 (http: / / ccb.jhu.edu / software / tophat), Cufflinks, and Cuffdiff (http: / / cole-trapnell-lab.github.io / cuffiinks / ) were used for RNA-Seq analysis. Bowtie (http: / / bowtie-bio.sourceforge.net) was used to localize sequencing reads to miRNAs. Peak analysis of CLIP data was performed using CLIPick (http: / / clip.korea.ac.kr / clipick / ). Unless otherwise specified, GO analysis was performed using DAVID (http: / / david.abcc.ncifcrf.gov / ) with default parameters, and visualization was performed using REVIGO (http: / / revigo.irb.hr / ). The enhancement of functional annotations was analyzed using GSEA (http: / / sofiware.broadinstitute.org / gsea / ).

[0319] Standard laboratory practice randomization procedures were used for cell lines and mice of the same age and sex. Experimenters received no information about their location during the experiment and outcome assessment. All statistical tests, including the Kolmogorov-Smirnov test (KS test), t-tests (unpaired two-tailed), and Fisher's exact test (total miR-1 reads relative to location), were obtained from Scipy (http: / / www.scipy.org / ) or Excel (two-sided test). Unless otherwise specified, values ​​represent mean ± sd. Statistical significance was assumed by default as P = 0.05, and between-group variances were considered similar.

[0320] Example 16.o 8 G-miSeq data analysis

[0321] The demultiplexed sequencing reads (FASTQ files) were aligned using Bowtie (Bowtie-norc-1 7-n 2-af), which tolerates two mismatches, and the reduced sequencing reads were indexed (using the bowtie-build indexer with default parameters) and located by mature miRNA sequences of the same species in miRBase (http: / / www.mirbase.org / ). Further analysis of the results by filtering out reads with mismatch errors resulted in quality scores below 20. The number of reads per miRNA was normalized to the total reads (reads per million total reads; RPM) and used as the log2 value (e.g., log2(input) and log2(o)). 8 G IP). In particular, o 8 The enrichment of G is achieved by measuring o 8 GIP sequencing (o 8 The RPM of GIP and the RPM of input small RNA-Seq (input; miRNA frequency) were estimated, calculated as log2 ratios, and expressed as significance (-log) in the volcano plot analysis. 10 (P-value), t-test). To investigate the influence of G frequency in miRNA sequences on o 8 GIP bias, visualized by G content (G number) and o in the sequence through heatmap analysis. 8 The number of miRNAs classified by G enrichment value (bin size = 1) (Treeview, http: / / rana.lbl.gov / EisenSoftware.htm). To analyze the differences based on PE treatment... 8 G enrichment, relative to o 8 The G enrichment value is based on the difference between PE-treated and simulants (untreated). 8 G enrichment rate calculation

[0322] Considering only the mismatch with the highest quality score in base calls, the percentage of mismatches occurring at each position in the miRNA sequence relative to the total matching frequency was calculated: Inconsistency (%). Specifically, seed sequences from mir-1:2U and miiR-1:3U do not overlap with other mammalian miRNAs (n = 17,948; miRBase, http: / / www.mirbase.org / ), and except for miR-1:7U and species-specific miRNAs, mdo-miR-12320-3p and mmu-miR-7216-3p (<80 sequencing reads) showed very low expression and were negligible.

[0323] Example 17. By o 8 Quantification of oxidized miRNAs using GIP and qPCR

[0324] rCMC (n=3) was treated with 100 μM PE for 48 hours or by long-term injection of ISO (75 mg / kg) -1 (n=3) After inducing cardiac hypertrophy in mice, the miRNeasy Mini Kit (Qiagen) was used. Then, as cross-confirmation, the same amount of small RNA (2 μg, PE-treated vs. untreated) was accurately measured using a spectrophotometer (Denovix) and Qubit quantitative PCR (Invitrogen) at 10 pg miRNA:o 5 G-spiked control is used for o 8 G immunoprecipitation. RNA was extracted from beads using Qiazol Lysis Reagent and the RNA Clean & Concentrator-5 kit (Zymo), and its efficacy was evaluated using the TaqMan MicroRNA Assay kit (Applied Biosystems). 8 The amount of specific miRNAs in GIP was measured. For reference, all procedures prior to reverse transcription were performed in the presence of 2.5 mM DFOM to prevent RNA oxidation in vitro. To normalize mutations during the IP process, o was measured by qPCR. 8 miRNA in GIP: o 8 The amount of G spiked is used as the denominator to quantify the relative o of a specific miRNA. 8 G value. Furthermore, by measuring o 8 U6snRNA in GIP was estimated at relative levels and used for normalization to confirm the enrichment of oxidation in specific miRNAs.

[0325] Example 18. Construction of luciferase reporter gene

[0326] To measure miRNA-mediated gene repression activity, either psiCheck-2 (Promega) or the pmirGLO vector (Promega) was used. In particular, in the case of the miR-1 oxo site, detection sensitivity was improved by repeating the target site side-by-side (n=5) and inserting it into the 3'UTR of the psiCheck-2 renin luciferase (hRLuc).

[0327] To construct this vector, as indicated, synthetic duplex oligonucleotides (Macrogen) containing various miR-1 oxo sites were cloned into the psiCheck-2 plasmid via XhoI and NotI sites; miR-1 seed site, forward: 5'-TCGAGA CATTCC A CATTCC A CATTCC A CATTCC A CATTCCGC-3' (SEQ ID NO: 39), reverse: 5'-GGCCGC GGAATG T G GAATG T GGAATG T GGAATG T GGAATG TC-3' (SEQ ID NO: 40); miR-1-2oxo site, positive: 5'-TCGAGA C ATTCA A CATTCA A CATTCA A CATTCA A CATTCA GC-3' (SEQ ID NO: 41), reverse: 5'-GGCCGC TGAATG T TG AATG T TGAATG T TGAATG T TGAATG TC-3' (SEQ ID NO: 42); miR-1-3oxo site, positive: 5'-TCGAGA CA TTAC A CATTAC A CATTAC A CATTAC A CATTAC GC-3' (SEQ ID NO: 43), reverse: 5'-GGCCGC GTAATG T GTA ATC T GTAATG T GTAATC T GTAATG TC-3' (SEQ ID NO: 44); miR-1-7oxo site, positive: 5'-TCGAGA AAT TCC A AATTCC A AATTCC A AATTCC A AATTCC GC-3' (SEQ ID NO: 45), reverse: 5'-GGCCGC GGAATT T GGAA TT T GGAATT T GGAATT T GGAATT TC-3' (SEQ ID NO: 46); miR-1 control site, positive: 5'TCGAGA CTTTCC A CTTTCC A CTTTCC A CTTTCC A CTTTCC GC-3' (SEQ ID NO: 47), reverse: 5'GGCCGC GGAAAG T GGAAAG T G GAAAG T GGAAAG T GGAAAG TC-3' (SEQ ID NO: 48)). Importantly, due to having the same bases, the miR-1 control site has a mismatch at position 6 (pivot) of the miR-1 seed site. It has been reported that the damaged pivot loses seed-mediated target inhibition, and therefore it was constructed as a negative control.

[0328] In the same manner as described above, o is generated at the seed sites of miR-122, let-7, and miR-124. 8 The identifiable sequence for G modification is prepared by replacing the o8G modification with A at the site of the 8th complementary sequence at the 5' end.

[0329] In order to sensitively identify identified miR-1: 7o 8 The 7oxo site in the G target mRNA was modified and subcloned in the psiCheck-2 vector to include repeats of 2 or 3 target sites. First, via ApaI and XbaI, the firefly gene (hluc+) containing the predicted offset 7oxo site (3:8) was replaced by a different firefly gene (Luc2) lacking the 7oxo site and located in the pmirGLO vector (Promega).

[0330] Example 19. Luciferase reporter gene analysis

[0331] Various luciferase reporter vectors (pmirGLO, psiCheck-2, or modified plasmids containing the desired site) and / or synthetic double-stranded miRNAs (50-75 nM, unless otherwise specified) were transfected into H9c2, rCMC, and AC16. The activity of the expressed luciferase was typically measured 24 hours post-transfection. In the case of drug treatment, specified concentrations of PE, H2O2, and / or NAC were applied at specified time points, starting 24 hours post-transfection and obtained after treatment. Relative activities (normalized to firefly luciferase versus Renilla luciferase activity) were measured in replicates (n=6) using a dual luciferase reporter assay system (Promega) with the GloMax-Multi assay system (Promega), according to the manufacturer's protocol. To assess miRNA-mediated inhibition efficiency, different concentrations of miRNA (0 to 100 nM) were transfected into HeLa. Then, using Scipy(scipy.optimize.curve_fit), a nonlinear least-squares fit is performed on the sigmoid function to calculate IC. 50 If the least squares method is not suitable for the function, then an approximate IC is calculated based on the regression line. 50 .

[0332] Example 20. Preparation of dual-fluorescent reporter gene

[0333] A dual fluorescent protein (dFP) reporter gene vector was constructed based on psiCheck-2 (Promega), replacing the luciferase gene with the fluorescent protein gene. The eGFP gene was amplified in pUlta (Addgene; provided by Malcolm Moore), and hRLuc was replaced by NheI and XhoI sites; forward primer: 5'-TAGGCTAGC CACCATGGTGAGCAAGGGCGA -3' (SEQ ID NO: 49), reverse primer: 5'-GGGCTCGAG CGATCGCCTAGAATTACTTGTACAGCTCGTCCATGC -3' (SEQ ID NO: 50). The TurboRFP gene is amplified in pTRIPZ (ThermoScientific), with hluc+ replaced by ApaI and XbaI sites (forward primer: 5'-GAAGGGCCC). TATGAGCGAGCTGATCAAGGAGA -3' (SEQ ID NO: 51), reverse primer: 5'-GACTCTAGA ATTATTATCTGTGCCCCAGTTTGCTAG -3' (SEQ ID NO: 52)) and further processed to remove the residual 33bp of the hluc+ sequence via PCR-mediated deletion (forward primer: 5'-GTACTGTTGGTAAAGCCACCATGAGCGAGCTGATCA-3' (SEQ ID NO: 53), reverse primer: 5'-TCCTTGATCAGCTCGCTCATGGTGGCTTTACCAACA-3' (SEQ ID NO: 54)), then the non-deleted main strand plasmid was removed (DpnI treatment). All PCR reactions were performed using PfuUltra high-fidelity DNA polymerase (Agilent Technologies) according to the manufacturer's protocol. In addition, the transformed dFP vector (p.UTA.3.0 Empty; Addgene plasmid #82447 provided by Jens Gruber) was used, which is derived from the psiCheck-2 vector but with acGFP replacing hluc+ and RFP replacing hRLuc, as if the reporter gene and control fluorescent gene were interchanged in dFP. Finally, following the same subcloning method used for psiCheck-2, the miR-1 seed site, 7oxo site, 2oxo site, and 3oxo site were inserted into dFP or the transformed dFP vector (p.UTA.3.0).

[0334] Example 21. Single-cell reporter gene detection using flow cytometry

[0335] Fluorescent protein reporter vectors were used to measure miRNA-mediated gene repression at the single-cell level using flow cytometry. First, dFP (RFP:GFP site) containing miR-1 seed, 7oxo, 3oxo, or 2oxo sites, or transformed dFP (GFP:RFP site), was transfected into H9c2 cells, and cells were collected 24 hours post-transfection. As a positive control, homologous miRNAs (50 nM) for each target site were co-transfected. To confirm that miR-1 oxo site repression is mediated by endogenous miR-1, a 50 nM miR-1-specific inhibitor obtained from the miRIDIAN microRNA hairpin inhibitor (Dharmacon) was also co-transfected.

[0336] For co-transfection, the same amount of NT was used as a control. For drug treatment, cells were treated with 200 μMPE (serum-depleted H9c2) or 2 mM NAC for 24 hours starting at transfection. Cells were harvested in PBS (Biosesang) containing 4% BSA (Bovogen) and 5 mM EDTA (Sigma) and analyzed by flow cytometry.

[0337] For H9c2 cells transfected with dFP (RFP: GFP site), the initial procedure was performed using a BD Accuri C6 Plus (BD Biosciences) in a 4-blue configuration (blue laser only, excitation wavelength: 488 nm; standard filters, GFP: 533 / 30, RFP: 670 LP). After live single-cell gating (based on FSC and SSC), cells without reporter gene expression were further filtered out according to the baseline level of autofluorescence estimated by psi-Check2 transfected cells. Scatter plots of GFP versus RFP signals were then analyzed (n = 10,000 cells). H9c2 cell size was estimated by FSC values. To test the effect of PE treatment on oxidative miR-1-mediated inhibition, cell distributions were shown based on GFP intensity (log2(GFP)) or relative GFP ratio (log2(GFP / RFP)) by comparing PE-treated and untreated cells, and further statistical analysis was performed using cumulative fractional analysis (Scipy, scypy.stats.ks_2samp) (KS test).

[0338] To improve the detection sensitivity of dFP (RFP: GFP site) and transformed dFP (GFP: RFP site), complete excitation of GFP and RFP was achieved using an Attune NxT flow cytometer equipped with blue (488 nm) and yellow (561 nm) lasers. For this analysis, the ranges of GFP and RFP signals were initially selected in a scatter plot analysis, and the reporter gene value (log of dFP) was also considered. 10log of (GFP) and dFP 10 (GFP) is derived from similar vectors and its expression range is (by log) 10 RFP estimation is used for dFP and log 10 (GFP) is used for the transformation of dFP; input is the same) log 10 (RFP) was averaged and quantified as a relative ratio. Ultimately, relative fold changes were calculated by normalizing the relative ratios to values ​​from the same reporter gene at no locus (e.g., the average GFP value in each bin for each dFP and RFP value was expressed as a value from a control at no locus). To narrow the analysis to the lowest 25% of reporter gene expression, relative fold changes were recalculated using only the cells with the lowest 25% of reporter gene values ​​in each bin for each vector expression value.

[0339] Example 22. Using miR-1: o 8 G induces cardiac cell hypertrophy

[0340] According to the manufacturer's instructions, use RNAiMax or Lipofectamine 3000 (Invitrogen) to deliver NT- miR-1, miR-1:7o 8 G, miR-1: 2o 8 G, miR-1: 3o 8 G, miR-1:7U, miR-1:2U, and miR-1:3U were transfected into H9c2 or rCMC cells, and to obtain static images, an inverted microscope (Leica DM18) was used and analyzed using ImageJ (≥100 cells, https: / / imagej.nih.gov / ). To generate time-lapse images, miR-1:7U was used... 8 After transfection with G or miR-1:7U, use Lumascope 400 (Etaluma) at 20-minute intervals between 0 and 50 hours.

[0341] Example 23. Administration of miRNA to mice

[0342] The miRNA was delivered into mice. Specifically, according to the manufacturer's protocol, the double-stranded miRNA (5 mg / kg) was delivered intravenously (IV) using in vivo jetPEI (N / P ratio = 5; Polyplus). -1 ) was administered to 12-week-old male C57BL / 6 mice (Koatech). The results were determined based on the injected miRNA (NT vs. miR-1: 7o) 8 Mice were divided into two groups (G, NT vs. miR-1: 7U; n=4) and two experiments were designed. When injected with miR-1: 7U... 8G(4mg kg -1 ) or miR-1: 7U (4mg kg) -1 When, and also injected NT (1mg kg) -1 This was to confirm delivery to the mouse heart. Specifically, the miR-1 used for injection was 7o... 8 The G or miR-1:7U doublet was generated by confirming delivery to heart tissue using a miR-1 guest strand containing FITC at the 5' end. Two injections were administered on days 1 and 2, and mice were sacrificed on day 7. Heart tissue was collected for each cardiac measurement: HW, BW, and TL. The excised heart tissue was immediately used for RNA extraction (small and large RNA; miRNeasy Mini Kit, Qiagen), and the amount of delivered NT was investigated by qPCR analysis (see detailed method for qPCR of miRNA slices), followed by RNA sequencing and qPCR.

[0343] The removed portions of the heart were also prepared as tissue sections on glass slides for immunohistochemical analysis.

[0344] Example 24. Quantitative RT-PCR of mRNA

[0345] Total RNA was isolated using the RNeasy Mini Kit (Qiagen) after DNA digestion with an RNase-free DNase Set (Qiagen). Reverse transcription was performed using SuperScript III reverse transcriptase (Invitrogen) and oligonucleotide (dT) primers. qPCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems). All reactions were performed in triplicate using a standard two-step cycling protocol, and relative quantification was calculated using the ΔCT method with ACTB and GAPDH as controls.

[0346] Example 25. Immunohistochemistry of cardiac tissue

[0347] Dissected mouse heart tissue was fixed (4% paraformaldehyde, 4°C overnight), stored (70% ethanol), paraffin-embedded, sectioned (cross-section, serial sections; 5 μm wide), and stained with hematoxylin and eosin (H&E). Paraffin-embedded section preparation, H&E staining, and Masson's trichrome staining were performed by the Cardiovascular Product Evaluation Center (Yonsei University College of Medicine, Korea) or the Pathology Core Facility (Seoul National University College of Medicine, Korea) via service order. The prepared slides were then subjected to immunofluorescence staining. After dewaxing with Histo-Clear (National Diagnostics), the sections were hydrolyzed with serially diluted ethanol and stored in PBS. Antigens were recovered using BD Retrievagen Antigen Retrieval Systems (BD Biosciences) according to the manufacturer's protocol. Then, the target staining areas defined by the PAP pen (Sigma) were immunostained according to the prescribed procedure; blocking solution (PBS with 10% normal goat serum and 1% BSA) was used for 1 hour at RT; MF20 antibody (1:200, developmental hybridoma) was used in blocking solution and incubated overnight at 4°C; Alexa Fluor 488 donkey anti-mouse IgG (1:1000, Abcam) was used in blocking solution and incubated for 1 hour at room temperature. In addition, Alex Fluor 594 conjugated WGA (50 μg / ml; Invitrogen) and DAPI (1.5 μg / ml; Vectorlab) were used to visualize the cell membrane and nucleus, respectively. The stained tissues were observed using an inverted fluorescence microscope (Leica DM18; 20x or 40x magnification), analyzed using the Leica Application Suite (LAS), and quantified using ImageJ (≥100 cells, https: / / imagej.nih.gov / ).

[0348] Example 26. Transformation of mice to generate

[0349] To generate cardiomyocyte-specific transformed (TG) mice, the transformation cassette was isolated by digesting the anti-7oxo (α-MHC13x) plasmid with BamHI. Following mating, the gel-purified transformation cassette was injected into the nuclei of mouse zygotes prepared from superovulated C57BL / 6 female mice (induced by PMSG and HCG). Subsequently, mouse embryos (fertilized single-cell zygotes) were transferred into pseudopregnant female mice (Korea Bio Co. Ltd, Seoul, Korea). After parturition, two anti-7oxo TG(+) mice were identified by PCR analysis of genomic DNA (purified from the ends) using primer sets corresponding to hGHpoly(A) (forward: 5'-CCACCAGCCTTGTCCTAATAAA-3' (SEQ ID NO: 55), reverse: 5'-CAGCTTGGTTCCCAATAGA-3' (SEQ ID NO: 56)). For anti-7oxo TG, four independent originators (F0; #44, #65, #68, and #69) were established and studied. All mice were given food and water randomly and maintained in a 12:12 hour light:dark cycle.

[0350] Example 27. RNA-Seq Library Construction and Analysis

[0351] RNA-Seq libraries are generated from whole or large RNAs using adaptor-based ligation methods or strand displacement termination / ligation methods. For adaptor-based ligation methods, according to the manufacturer's protocol, 100 ng of total RNA (miRNeasy Mini Kit; purified from Qiagen) was applied to the TruSeq Stranded mRNA LibraryPrep Kit (Illumina) using NeoPrep (Illumina); sample names: H9C2-NT-N1, H9C2-miR-1-2o 8 G-N1 and H9C2-miR-1-3o 8 G-N1. Furthermore, the TruSeq Stranded mRNA library was constructed, sequenced, and demultiplexed by Omega Bioservices (Norcross, GA, USA); sample names: H9C2-NT-O1, H9C2-NT-O2, H9C2-miR-1-7o 8 G-O1 and H9C2-miR-1-7o 8 G-O2.

[0352] The remaining samples were processed using a strand substitution termination / ligation method as follows: Specifically, from 1.5 μg of large RNA (>200 nt, RNeasy or miRNeasy Mini Kit; extracted by Qiagen), 10 μl of Dynabead Oligo(dT) was added according to the manufacturer's instructions. 25 (Invitrogen) purified polyadenylated mRNA. Then, according to the manufacturer's instructions, an RNA-Seq library was prepared using 10 ng of purified mRNA with the SENSE Total RNA-Seq Library Kit (Lexogen). After library generation, amplification was performed by PCR with the lowest optimal cycle, which was determined by comparing the results of different cycles or according to Example 14. 8 The G-miSeq method was used for qPCR to determine the quality of the amplified library. The size distribution and quantity were confirmed using Fragment Analyzer (Advanced Analytical).

[0353] If necessary, further size selection was performed using urea-PAGE gel extraction or Pippin Prep (Sage Science). Finally, the prepared multiplexed libraries were precisely quantified using the Qubit RNA HS Analysis Kit (ThermoFisher) and Fragment Analyzer, and sequenced into 50 single-end reads using the HiSeq 2500 system (Illumina). For sequencing, samples named H9C2-cont, H9C2-anti-7oxo, mHT-ISO-cont, mHT-ISO-anti-7oxo, mHT-ISO-anti-7oxo-TG(-), and mHT-ISO-anti-7oxo-TG(+) and the MiniSeq system (Illumina) were used. To ensure consistency with the HiSeq 2500 system results, only SE50 information was used with the MiniSeq system.

[0354] Demultiplexed sequencing reads (CASAVA; obtained using Illumina) with RefSeq gene annotation feeds were aligned to the mouse genome (mm9) or rat genome (rn5). When preparing sequencing libraries using strand substitution termination / ligation methods, the first 9 nucleotides from the read start side were pruned to TopHat2 according to the manufacturer's instructions. Transcriptional levels were quantified using Cufflinks (cufflinks-Nb), and differential transcriptomic profiles were analyzed in groups with identical experimental conditions using Cuffdiff (Cuffdiff-FDR=0.1-bN-min-alignment-count=10-library-norm-method=geometric) and the localization feed. Only valid state values ​​were selected and used, except for fold change and statistical significance (p-value). If the replicates are derived from two different library construction methods (the linker-based method and the chain permutation termination / linking method), cufflinks are only used for the same type of library, and then the mean RPKM and p-value are calculated from all replicates (t-test, two-tailed method).

[0355] Example 28. Cumulative Score Analysis

[0356] To test the tendency of a putative target transcript to inhibit or derepress based on a given miRNA or miRNA inhibitor, cumulative fractions (log2 ratios) with fold changes were analyzed. Putative miR-1: o 8 The G target was selected as transcripts containing the miR-1 pxo site at the 3'UTR (defined by RefSeq downloaded from the UCSC Genome Explorer), where miR-1 is typically investigated. 8 All 6mer matches of G are positions 2-8 (matching o) 8 G: A instead of o 8 G:C), unless otherwise stated. "No site" refers to a transcript that does not contain the miR-1 seed site and oxo site in its mRNA sequence. "Cont site" refers to a transcript that contains the miR-1 control site in its 3' UTR and that has the oxo site corresponding to the o... 8 The G-binding nucleotide substitution was replaced with G, which served as a negative control in previous studies. KS tests were performed on total mRNA or cont sites using Scipy (scypy.stats.ks_2samp). The fold change and significance (-log) were calculated. 10The volcano plot was analyzed using p-values, and cutoff values ​​were used to select differentially expressed genes (DEGs).

[0357] Example 29. Ago HITS-CLIP Data Analysis

[0358] Ago HITS-CLIP results from left ventricular tissues of cardiomyopathy patients were retrieved from the GEO database (GSE83410). Reads containing miRNA sequences were identified as having two mismatch tolerances by “reverse” localization (alignment of mature miRNA sequences with sample reads) from Bowtie, and positional mismatches of miRNA reads were analyzed for miR-1. For enrichment analysis of miR-1 oxo sites, Ago2 binding clustering was analyzed compared to G:U binding-mediated miR-1 seed sites, as provided in previous studies (Spengler, R.M.T., Nucleic Acids Res 44, 7120-7131). The seed site for miR-124, a brain-specific miRNA, was used as a negative control because it is not present in cardiac tissue. The nucleus-free protrusion of miR-1 was also used as a negative control.

[0359] To identify the miR-1 7oxo site in patients with cardiomyopathy, raw sequencing data from Ago HITS-CLIP were processed by CLIPIck. Specifically, FASTQ files were initially filtered and reduced (fastq2collapse.pl) based on a quality score (fastq_filter.pl - fmean: 0-24:20). Preprocessed reads were then aligned to the human genome (hg19) using the NovoAlign program (http: / / www.novocraft.com) with the same parameters. After selecting reads from annotated transcripts (RefSeq), peak analysis of expression profiles was performed using BedTools and SAMtools (http: / / samtools.sourceforge.net / ) and human heart data (derived from RNA-Seq Atlas, http: / / medicalgenomics.org / rna_seq_atlas). To visualize the peaks, all edited reads, and the putative miR-1 7oxo sites (6mer at positions 2 to 8), the UCSC Genome Browser (http: / / genome.ucsc.edu / ) was used.

[0360] Example 30. CLEAR-CLIP

[0361] Mouse heart tissue (approximately 150 mg) dissected from ISO-treated or PBS-treated mice was crushed and subjected to UV irradiation (400 mJ / cm²).2 Three times; Spectrolinker XL-1000 induced covalent cross-linking in RNA-protein complexes in vivo. Ago-related fragment mRNA, processed by treatment with 50 μU / μl RNase A (Affymetrix) at 37 °C for 5 min, was immunoprecipitated with two different anti-Ago antibodies attached to 60 mg Dynabeads Protein A (Invitrogen) at 10 μg. Ligation was performed with 0.625 U / μl T4 RNA ligase 1 (NEB) overnight at 16 °C to generate miRNA-targeting mRNA chimeras, further enhanced by treatment with 1 U / μl T4 RNA ligase 1 (NEB) at 25 °C for 75 min in the presence of 3% DMSO (Sigma) and 18% PEG8000 (Sigma). Isotopically labeled RNA-protein complexes were separated by size using NuPAGE 10% Bis-Tris Gel (Invitrogen), transferred to nitrocellulose membranes (BA85; Whatman), cut, treated with 4 mg / ml proteinase K (Roche) and 7M urea (Sigma), and extracted using acidic phenol:chloroform:IAA (125:24:1; Invitrogen) and the RNA Clean & Concentrator-5 kit (Zymo). The purified RNA underwent adapter ligation and RT-PCR using the Small RNA-Seq Library Prep kit (Lexogen) to generate libraries for high-throughput sequencing, which were finally sequenced using a HiSeq 2500 system (Illumina).

[0362] Sequencing reads were preprocessed and localized, and potential chimeric reads containing miRNA sequences were identified by "reverse" localization after remover sequences, where mature miRNA sequences were reverse-aligned against the sample library using Bowtie. The remaining sequences were then localized to the mouse genome (mm9), with further selection only for sequences overlapping with combined exons from the 2A8 and 2E12 antibodies, and ultimately focusing only on miR-1 containing chimeric reads. For miR-1 seed and oxo site investigations, enrichment results were compared between the hearts of ISO-injected and uninjected mice, with upstream (5', -) and downstream (3', +) extensions from the localized chimeric reads (- / +0, - / +25, - / +50, - / +100).

[0363] Example 31. Cardiac cell-specific miR-1: 7o 8 Construction of G inhibitors

[0364] To specifically inhibit miR-1 in cardiomyocytes: 7o 8G, a competitive inhibitor containing multiple miR-1 7oxo target sites was constructed based on the pJG / ALPHA MHC plasmid carrying a cardiomyocyte-specific α-MHC promoter. A synthetic di-oligonucleotide (Macrogen) containing 13 miR-1 7oxo sites (5'-AAAUUCC-3'; SEQ ID NO: 6) or the control NT target site (5'-GGUUGUG-3'; SEQ ID NO: 21) was cloned into the indicated pJG / ALPHAMHC vector via SalI and HindIII sites; anti-7oxo, α-MHC 13x, forward: 5'-TCGAC AAATTCC AA AAATTCC AT AAATTCC AG AAATTCC AC AAATTCC AA AAATTCC AC AAATTCC AT AAATTCC AG AAATTCC AA AAATTCC AT AAATTCC AG AAATTCC AC AAAT TCC AA-3' (SEQ ID NO: 57), reverse: 5'-AGCTTT GGAATTT GT GGAATTT CT GGAATTT AT GGAATTT TTG GA ATTT CT GGAATTT AT GGAATTT GT GGAATTT TT GGAATTT GT GGAATTT CT GGAATTT AT GGAATTT TT GGAATT T G-3' (SEQ ID NO: 58); cont, anti-NT, positive: 5'-TCGAC GGTTGTG AA GGTTGTG AT GGTTGTG AG GGTTGT G AC GGTTGTG AA GGTTGTG AC GGTTGTG AT GGTTGTG AG GGTTGTG AA GGTTGTG AT GGTTGTG AG GGTTGTG AC G GTTGTG AA-3' (SEQ ID NO: 59), reverse: 5'-AGCTTT CACAACC GT CACAACC CT CACAACC AT CACAACC TT CACAACC CT CACAACC AT CACAACC GT CACAACC TT CACAACC GT CACAACC CT CACAACC AT CACAACC TT CACA ACC G-3' (SEQ ID NO: 60). Notably, the control vector (anti-NT) uses the same plasmid as the anti-7oxo (α-MHC 13x) vector, except that it contains a binding site for a non-targeting siRNA (NT) derived from cel-miR-67 (Caenorhabditis elegans). The pJG / ALPHA MHC vector was provided to Dr. Da-Zhi Wang by Jeffrey Robbins (Addgene plasmid #55594). Other competitive miRNA inhibitors were synthesized from RNA (see RNA synthesis methods).

[0365] Example 32. Administration of miRNA inhibitors to ISO-treated mice

[0366] In order to study the competitive miR-1: 7o 8 Whether G inhibitors (anti-7oxo) can attenuate ISO-induced cardiac hypertrophy in vivo was initially investigated by intraperitoneal injection (IP) of ISO (75 mg / kg) into 8- to 12-week-old male C57BL / 6J mice (Korea Bio Co., LTD). -1 ), and at this time, an equal volume of PBS was used as a control (n=5 per group). Eight hours later, mice were intravenously injected with jetPEI (Polyplus) at the amounts and ratios specified by the manufacturer's protocol, 1.9 mg / kg, for anti-7oxo or control (anti-NT); anti-7oxo (α-MHC13x) or cont (anti-NT 13x). -1 N / P ratio = 8; Anti-7oxo (4x) or cont (anti-NT 4x), 5mg / kg -1The N / P ratio was 5. Three consecutive injections were administered on days 1, 2, and 5, and all mice were sacrificed on day 7 for cardiac examination. RT-qPCR of the anti-7oxo transcript, including hGH poly(A) (forward: 5'-TAAATTCCAAATTCCAGAAATTCCACAAATTCCAT-3' (SEQ ID NO: 61), reverse: 5'-CCAGCTTGGTTCCCAATAGA-3' (SEQ ID NO: 62)), was performed to measure the delivery rate of anti-7oxo (a-MHC 13x) to cardiac tissue. To confirm the delivery of anti-7oxo (4x) to the mouse heart, a poly(A)-tailed miRNA qPCR method was performed using anti-7oxo (4x) (forward, 5'-TAAATTCCAAATTCCAGAAATTCCACAAATTCCAT-3'; SEQ ID NO: 63) specific primers (see miRNA quantitative PCR methods).

[0367] Example 33. miR-1 during ISO time process: o 8 Quantitative analysis of G

[0368] To investigate the changes in oxidized miR-1 levels during ISO time-course experiments, mice were administered 75 mg / kg via intraperitoneal injection (IP). -1 ISO was administered, and injected mice were sacrificed on days 1, 5, and 7 from the treatment time point (n=4 at each time point). An equal volume of PBS was also injected, and the mice were immediately sacrificed and used as samples on day 0 (n=4). After dissection of the heart, small RNA was extracted using the miRNeasy MiniKit (Qiagen). For quantification of miR-1: o 8 G, such as "through o" 8 The method described in "Quantification of Oxidized miRNAs by GIP and qPCR" involves... 8 GIP and miR-1 qPCR were performed, but with the following modifications. In bead preparation, 3 μg of anti-o antibody was used in 150 μL of PXL. 8 G antibody (15A3, QED Bioscience), 30 μl Dynabeads Protein G (Invitrogen), and 300 μg deoxyguanosine (dG, Sigma-Aldrich); and in IP culture, 2 μg of small RNA sample and 1 pg o in 150 μl PXL containing 2.5 mM DFOM and 40 U recombinant RNase inhibitor (Takara) were used. 8 dGRNA spiking (miR-124-3p: 4o) 8 dG: 5'p-UAAG o 8 dG CACGCGGUGAAUGCC-3'; SEQ ID NO: 64).

[0369] Example 34.3 Sequence conservation analysis of miR-1 target sites in the UTR

[0370] When counting motifs of conserved sequences in the 3'UTR, mammalian PhaseCons results were obtained from the UCSC Genome Explorer (http: / / genome.ucsc.edu) and used only when the score was greater than or equal to 0.9, and calculated as a conservation rate (number of conserved motifs / total number of motifs; %). Conservation rates for all 3'UTRs (defined by RefSeq) were calculated using seed sites (n = 103, 6mers at positions 2 to 8) of miRNA families conserved at four distinct sites (seed, 2oxo, 3oxo, and 7oxo sites) of miR-1. Sequences are conserved in most of these mammals (but generally not beyond placental mammals; http: / / www.targetscan.org). As a background control, conservation for all 6mers (n = 4098) was also calculated. The resulting distributions are expressed as cumulative scores and proportions for the overall population.

[0371] Example 35. Data Availability

[0372] From o 8 All raw sequencing data from G-miSeq (SRP189806, SRP189807, SRP189808, SRP226125), RNA-Seq (SRP189813, SRP189117, SRP189812, SRP189811, SRP189809, SRP213998, SRP214400, SRP228274), and CLEAR-CLIP (SRP189810) are stored in Sequence ReadArchives. All FASTQ files, including those with 0 spikes, are also available on the project website (http: / / clip.korea.ac.kr / oxog / ). 8 Sequencing data from GIP.

[0373] Example 36. miR-1 in plasma of an animal model of hypertrophic myocardium: o 8 Measurement of G

[0374] With reference to Example 8 ( Figure 6aCardiac hypertrophy in mice was induced by ISO injection in the same manner as described in Example 12. Subsequently, 700 μl of blood was collected from each of three control animals treated with PBS and three animals treated with ISO, and plasma was separated by sedimentation at 4°C, 1000 x g, and centrifugation for 5 minutes. Small RNA was extracted from the same 350 μl plasma volume from each group using a Qiagen miRNeasy Serum / Plasma Kit, and the miR-1 content in the extracted small RNA was quantified by qPCR with a certain amount of U6 correction as described in Example 12. Furthermore, o3 was specifically isolated from 100 ng of small RNA separated from plasma by antibody precipitation (IP) as described in Example 11. 8 G-modified RNA was used, and miR-1 was quantified by qPCR. Furthermore, for the use of o 8 Quantitative analysis of G-modified miR-1 was performed using... 8 Adding 1 pg of miR-124-3p to the immunoprecipitation assay with G antibody: 4o 8 dG(UAAG o 8 dG CACGCGGUGAAUGCC-3-3'; SEQ ID NO: 64), where o 8 G was synthesized in DNA form in the 5th iteration, and measured and corrected by qPCR.

[0375] Experimental Example 1. miRNA oxidation in ROS-dependent cardiac hypertrophy

[0376] H9c2 rat cardiomyocytes were treated with an α-adrenergic receptor (AR) agonist (phenylephrine; PE), and pathophysiological hypertrophic stimulation by PE treatment, ROS production, and miRNA oxidation was confirmed. Flow cytometry analysis using the ROS fluorescent dye (DHE) (10,000 cells, n=3) confirmed increased ROS in cells after PE treatment. Specifically, 93% of mast cells generated after PE treatment showed a 1.8-fold increase in ROS production. Serum deficiency is a pre-existing prerequisite for stimulating adrenergic hypertrophy and also enhances the extended phenotype with high basal ROS levels.

[0377] Further extended to an in vivo mouse model, long-term administration of the β-AR agonist isoproterenol (ISO), as shown in Figure 1A, induced cardiac hypertrophy (an increase of approximately 13%), as shown in Figure 1B. Pathological confirmation was obtained by echocardiography, which also confirmed the generation of reactive oxygen species (ROS) upon ISO treatment.

[0378] Next, we investigated whether RNA was oxidized by ROS in a mouse model of cardiac hypertrophy, with ROS administered together with ISO.

[0379] RNA was isolated based on size (based on 200 nucleotides) and analyzed using ELISA. 8 G-specific antibody measurement of 8-oxoguanine (o) induced by ISO treatment 8 G). The measurement results confirmed the presence of o produced from small RNAs. 8 G was produced approximately 3.1 times more than that from large RNA, as shown in Figure 1C. This shows that it was produced faster (1.8 times) than from large RNA, even when large RNA was subjected to paraquat (PQ) treatment-induced oxidative stress.

[0380] Based on Argonaute2 (Ago2) and o, which are key proteins in the RNA-induced silencing complex. 8 Colocalization of G, and further oxidation of small RNA into miRNA, are shown in Figure 1D. Quantification and amplification of this miRNA reveal that it is quantified and amplified (approximately 8-fold) in PE-treated rCMCs, as shown in Figure 1E. It is also amplified in PE- or ISO-treated H9c2 (per plane). 8 G+, Ago2; 100 cells, n=4; P=0.05).

[0381] Independently, using o 8 Dot blot analysis with G-specific antibodies showed that oxidation of small RNAs (<200 nt) from PE-treated H9c2 and rCMC increased in a redox-dependent manner, as shown in Figure 1F.

[0382] When the oxidation of miRNA was confirmed in PE-treated H9c2 and ISO-injected mouse hearts, as shown in Figure 1G, the results of northwestern analysis of PE-treated H9c2 (top of Figure 1G) and ISO-injected mouse hearts (bottom of Figure 1G), and the dot blot analysis of approximately 20 nt miRNA extracted by gel extraction shown in Figure 1H, confirmed that oxidation was generated from approximately 20 nt miRNA by PE and ISO treatment, respectively. 8 G.

[0383] In summary, the experimental results indicate that cardiac hypertrophy is redox-dependent and can generate ROS, thereby inducing miRNA activation. 8 G modifies.

[0384] Experimental Example 2: Site-specific o in cardiac miRNAs 8 sequencing of G

[0385] To identify oxidized miRNAs and their corresponding o 8 Position G, through optimization o 8 Immunoprecipitation (IP) and detection of G 8 G-induced G>T base transitions led to the development of novel miRNAs containing o. 8 G sequencing method (o8 The schematic diagram of G-miSeq is shown in Figure 2A.

[0386] First, by adopting the conditions for CLIP, o 8 The IP process for G was extensively improved, as shown in Figure 2B, and the optimized IP, as shown in Figure 2C, exhibited approximately 3000-fold improvement in synthesis compared to non-specific background (non-oxidized G). 8 The amount of G. Because o 8 G can pair with A, so the efficacy of inducing G>T mutations in cDNA is enhanced to about 50 to 60%, which is indirectly demonstrated by sequence-specific cleavage of the restriction enzyme sites obtained (top of Figure 2D) and directly demonstrated by sequencing (middle and bottom of Figure 2D).

[0387] Then, as shown in Table 1, o 8 G-miSeq was initially applied to H9c2, and based on its basal expression, it identified miR-1b as the most oxidized miRNA (o). 8 G enrichment, log2(IP / input) = 7; normalized by miRNA-Seq), o 8 G enrichment, i.e., o 8 The log ratio of G IP is normalized relative to the input read count of miRNA and represented by dots according to miRNA frequency, as shown in the left panel of Figure 2E. The number of Gs in the sequence is shown as heatmap density in the right panel of Figure 2E.

[0388] (Table 1)

[0389]

[0390] The specificity of IP was demonstrated by the absence of any observed bias in the amount of miRNA and G content, as shown in Figure 2F, which exhibits significance (-log). 10 (P-value) is used as a volcano map, and the o in miR-1b 8 G was significantly higher (P < 0.01), and the seed regions (positions 2, 3, and 7) based on the mutation rate of G > T were found to be significant. Furthermore, through additional application of rCMC, as shown in Table 2 and Figure 2G, o 8 G-miSeq further showed that miR-1b was preferentially oxidized after PE treatment, with o at the recognition locations (positions 2, 3, and 7) in the seed region. 8 G increases (Figure 2 G top) (relative to o) 8 G enrichment, log2(PE / simulation) = 1.66; Figure 2 (bottom of G).

[0391] (Table 2)

[0392]

[0393] Then, to exacerbate the hypertrophic phenotype of rCMCs, o was performed after exposing rCMCs to serum deficiency. 8 The PE processing of G-miSeq analysis is shown in Table 3. The results show that at position 7... 8 G significantly increased (miR-1: 7o) 8 G (approximately 2-fold increase), as estimated by the G>T conversion rate in the miR-1 sequence, as shown in Figure 2H. In addition to the observed enhanced miR-1b oxidation, as shown in Figure 2I and Table 4, significant oxidation (P < 0.01) was also observed for other miRNAs, such as miR-184, let-7f-5p, and miR-1-3p, with significant amounts of o 8 G(log2(o 8 G-IP > 10). In particular, it was confirmed that miR-184 was consistent with the previous H2O2 treatment results, as shown in Figure 2J, while there were some inconsistencies with other miRNAs.

[0394] Overall, by using o 8 G-miSeq can accurately detect oxidized miR-1 and its specificity during cardiac hypertrophy. 8 G positioning.

[0395] (Table 3)

[0396]

[0397] (Table 4)

[0398]

[0399] Experimental Example 3: Oxidation of miR-1 8 G:Target silencing effect of A base pairing

[0400] As demonstrated in Experimental Example 2, oxidized miRNAs (miR-1b, miR-1-3p, miR-184, and let-7f), as shown in Figure 3A, were treated according to PE... 8 GIP(miRNA:o) 8 G), their levels were significantly increased in rCMC (P < 0.05, t test). Among them, miR-1 showed the most significant improvement (approximately 2.5–5-fold) and was also confirmed in the hearts of ISO-treated hypertrophic mice, although it was downregulated after ISO treatment, as shown in Figure 3B.

[0401] The study investigated o-type ions identified in the seed region centered on miR-1. 8 G position (positions 2, 3, and 7), miR-1 (miR-1: 2o) 8G, miR-1: 3o 8 G and miR-1: 7o 8 G) Is it possible to pass through o? 8 G:A base binding recognizes the corresponding new target sites (2oxo, 3oxo and 7oxo sites), and the results are shown in Figure 3C.

[0402] Luciferase reporter gene analysis confirmed the synthesis of miR-1:2o 8 G, miR-1: 3o 8 G and miR-1: 7o 8 G can silence targets with oxo sites (2oxo, 3oxo, and 7oxo sites), which are recognized as G:A arrangements during the corresponding oxidation modification process and are not inhibited by miR-1.

[0403] Indeed, as shown in Figure 3D, these luciferase reporter genes with miR-1 oxo sites were all inhibited in PE-treated rCMCs, but were activated in the presence of the antioxidant NAC. This indicates that endogenous miR-1 oxo sites are produced by adrenergic stimulation of rCMCs. 8 The G level is sufficient to alter target recognition and silence the target.

[0404] Moreover, consistent results were observed in AC16 immediately after treatment with PE or H2O2, as shown in Figure 3E.

[0405] Next, to exclude synthetic effects from cell population heterogeneity, flow cytometry was performed using dual fluorescent protein (dFP) reporter genes, as shown in Figure 3F: green fluorescent protein (GFP) with miRNA target sites and red fluorescent protein (RFP) without these sites. Analysis of the cumulative fraction of relative activity in hypertrophic H9c2 cells (P = 1.56 x 10⁻⁶) was used to determine the optimal levels. -5 The Kolmogorov-Smimov test (KS test) was used to observe the dFP reporter gene (GFP / RFP).

[0406] Although the expression level of endogenous miR-1 is low (possibly due to fate heterogeneity of cardiomyocyte cell lines, as shown in Figure 3H), miR-1 was detected at the level of a single H9c2 cell: 8 G-dependent suppression, as shown in Figure 3G. Figure 3I confirms that all miR-1 oxo sites (7oxo, 3oxo, and 2oxo sites) of the dFP reporter gene are associated with o. 8 miR-1 observed by G-miSeq: o 8 G positions (2, 3, and 7) are consistent (Fig. 2F) and are endogenously suppressed, with the ability to detect miR-1 at baseline levels: o 8Sensitivity to G-mediated inhibition, and can be identified by transfection with miR-1 inhibitors or homologous miR-1 variants.

[0407] Furthermore, the dFP reporter gene detected significant PE-dependent repression at the miR-17oxo site in hypertrophic H9c2, as shown in Figure 3J.

[0408] Furthermore, as the sensitivity to complete excitation of both fluorescent proteins increased, the values ​​compared to the dFP reporter gene without a site (RFP:GFP,NT) were shown in Figure 3K, thus through miR-1:7o 8 The endogenous level of G was verified by the inhibition of miR-1 (RFP: GFP-7oxo vs RFP: GFP, NT) to carefully examine the assay, as shown in Figure 3L, and its activation by NAC treatment (RFP: GFP-7oxo, mimic vs. NAC), as shown in Figure 3M.

[0409] Importantly, this relative inhibition (calculated by averaging the reporter fluorescence value (GFP-7oxo) at a similar range of control fluorescence values ​​(RFP) in cells) was considered to be significant at the lowest 25% of the reporter fluorescence value (GFP-7oxo), indicating the presence of high levels of miR-1:7oxo. 8 The cell population of G. Furthermore, as shown in Figure 3N, the dFP reporter gene (with the exchanged reporter gene and control fluorescent protein) sensitively detected miR-1: 7o 8 The endogenous level of G increases the inhibitory effect on miR-1 7oxo site and the PE-dependent aspect of inhibition.

[0410] Furthermore, using the exchanged dFP reporter gene as shown in Figure 3O, it was observed that when only a limited cell population with a minimum reporter value (RFP) of 25% was considered, PE-induced inhibition of the miR-1 7oxo site was more significant, and the recovery of reporter gene activity (RFP) by introducing a miR-1 inhibitor further confirmed that the PE-dependent inhibition of the miR-1 7oxo site is mediated by miR-1. Specifically, as shown in Figure 3P, the introduction of oxidized miR-1 (2o... 8 G, 3o 8 G and 7o 8 G) is less effective than unoxidized miR-1, but it may inhibit the seed site in the luciferase reporter gene because o 8 Retention of G:C base binding activity was observed. miR-1:7 o 8 G via o 8 G:A base binding silences target mRNAs acquired in adrenergic cardiac hypertrophy.

[0411] Experimental Example 4. miR-1: o 8 Confirmation of G-induced cardiac hypertrophy

[0412] Although miR-1 has been reported to have a negative effect on hypertrophy, PE treatment reduced miR-1-induced atrophy of rCMCs, as shown in Figure 4A, which illustrates the microscopic observation and cell size quantification results of rCMC cells. Cell size (inches) was quantified using ImageJ. 2 (n = 100).

[0413] In Experimental Example 2, the synthetic miR-1:2o was introduced. 8 G, miR-1: 3o 8 G or miR-1: 7o 8 G, which discovered miR-1:o 8 The redox dependence of G and PE-induced hypertrophy is maintained, as shown in Figure 4B. It was observed that hypertrophy of rCMC was significantly more induced compared to PE treatment.

[0414] When U replaces o 8 When G is synthesized into miR-1 (miR-1:2U, miR-1:3U, and miR-1:7U), these effects are similarly manifested, in which hypertrophy depends on o 8 G: A base binding.

[0415] As shown in Figure 4C, this effect was also observed in H9c2.

[0416] Specifically, miR-1: 7o 8 G or miR-1:7U-induced hypertrophy is shown in Figure 4D as a result of qPCR measurements, which, as observed in PE treatment, significantly increased the expression of atrial natriuretic peptide (ANP), a marker of cardiac hypertrophy. These results were further confirmed by flow cytometry analysis and time-lapse images of rCMC (top of Figure 4F) and H9c2 (bottom of Figure 4F), as shown in Figure 4E.

[0417] In addition, miR-1:7o was also tested. 8 The effect of G on cardiac hypertrophy in vivo. As shown in Figure 4G, miR-1: 7o 8G, as a polyethyleneimine (PEI) complex, was administered via tail vein injection with a non-targeted control (NT) (Figure 4G top) and delivered to cardiac tissue, which was validated by quantitative PCR (qPCR) (Figure 4G bottom). The results showed a significant increase in heart size of at least approximately 10% or more (P = 0.001, n = 3), as shown in Figure 4H. Immunostaining of the interventricular septum (IS) in H&E-stained cardiac tissue and quantification of cardiomyocyte size revealed an increase of approximately 19% in cardiomyocyte size and a significant upregulation of ANP expression, as shown in Figure 4I.

[0418] At this point, in Figure 4J, WGA (wheat germ lectin) was used for cell boundary staining, MF20 was used for cardiomyocytes, and DAPI was used for nuclear staining.

[0419] In summary, the experimental results above indicate that miR-1, especially miR-1:7o 8 Site-specific oxidation of G can be achieved through o 8 G:A base binding fully induces cardiac hypertrophy in vivo.

[0420] Experimental Example 5. Discovery of oxidized miR-122, let-7 and miR-124 and acquisition of their resulting functions

[0421] Besides cardiomegaly, several microRNAs with ozone (oxidative stress) were identified in the seed region from the 5′ end to the 8th end for other known diseases that cause oxidative stress. 8 Is G modified?

[0422] First, in the Huh7 hepatocellular carcinoma line, which specifically expresses high levels of miR-122, a luciferase reporter gene was constructed in tumors known to have increased free radicals. The second (2oxo), third (3oxo), or second and third miR-122 guanine derivatives were then identified as being associated with the O2 gene. 8 G-modified (2oxo and 3oxo). At this time, luciferase reporter gene experiments were performed using the psi-check2 (Promega) vector, which includes 5 target sites and can interact with the miR-122 seed region. 8 G:A binding was used for identification and measured after transfection into Huh7. Furthermore, to reveal that the repression at the corresponding site was directly caused by miR-122, a cell line in which the miR-122 gene was removed by CRISPR / Cas9 gene editing in Huh7 (Huh7:miR-122 KO) was used together with a miRNA CRISPR knockout kit (Canopy, Bioscience Inc.) and tested under the same conditions.

[0423] The results of the above experiment are shown in Figure 5A.

[0424] As a result of the experiment, the existing seed site recognized by mir-122 (seed: 5′-ACACUCCA-3′) was not only suppressed, but also the 2 o 8 G-modified site (2oxo:5′-ACACUC) A A-3′), 3rd o 8 G-modified site (3oxo: 5′-ACACU) A CA-3′) and the 2nd and 3rd o 8 G simultaneously modifies the site (2oxo, 3oxo: 5′-ACACU) AAA-3′) It is suppressed.

[0425] Furthermore, in Huh7: miR-122KO, the 3rd phase of miR-122 was observed. 8 G-modified sites (3oxo) and the 2nd and 3rd sites 8 The inhibition at the G-modified sites (2oxo, 3oxo) disappeared, and it was demonstrated that the corresponding inhibition was caused by the conversion of miR-122.

[0426] For let-7, the 4th o was prepared in the same manner as before. 8 G site (4oxo: 5'-CUAC) A The luciferase reporter gene (UCA-3') was used, and as a result of its measurement in glioblastoma tumor HS683, the inhibition was less than that of the seed site of let-7 (seed: 5′-CUACCUCA-3′), but showed a significant inhibitory effect compared with the control (P<0.01), as shown in Figure 5B.

[0427] Furthermore, in order to understand whether seed regions, where miR-124 is known to be highly expressed in neurons and glioblastoma cells, also produce o 8 G modification, for miR-124's 4th o 8 G-modified target site (4oxo:5'-GUGC) A UUA-3') was used in glioblastoma HS683 cells for luciferase reporter gene assays, and the results are shown in Figure 5C.

[0428] As a result of the experiment, the seed site of miR-124 (seed: 5′-GUGCCUUA-3′) was inhibited, but no inhibition of the 4oxo site was observed. In the case of tumor cells, it is known that oxidative stress and intracellular oxidation increase when nutrition or blood supply is insufficient. Therefore, in order to understand the oxidative stress of miR-124 expressed in HS683 under such conditions... 8Whether G modification increased was determined by removing serum from the cell culture medium. Under these conditions, the 4oxo site of miR-124 was significantly inhibited (P < 0.01).

[0429] The above experimental results confirm that in miR-122 of liver cancer cells, positions 2 and 3, or positions 2 and 3 together, are oxidized. 8 G modification, in glioblastoma, involves the fourth base of let-7 being replaced by o. 8 G-modification, and when miR-124 is subjected to oxidative stress that may occur in tumor cells, such as removal of serum from the culture, the o at the 4th base... 8 G modification occurs to suppress the expression of newly recognized target genes.

[0430] For liver cancer cells to metastasize, the migratory ability of these cells is preferentially required, and miR-122 expression is known to inhibit liver cancer cell migration. Since miR-122 expression has been observed to inhibit the migration of cells at their second and third phasors in the Huh7 liver cancer cell line... 8 G-modification (miR-122:2,3) 8 G) To examine whether the corresponding oxidized miR-122 affects the migration ability of liver cancer cells, miR-122:2,3-O was synthesized using Trilink's RNA synthesis service. 8 G(5'pU o 8 Go 8 GAGUGUGACAAUGGUGUUUG-3' (SEQ ID NO: 65), synthesized cis-streptone (has-miR-122-5p) and bilayer, generated bilayer with cis-streptone (has-miR-122-5p) and transfected it into Huh7 for wound healing assay.

[0431] As shown in Figure 5D, the experimental results indicate that when miR-122:2,3o 8 When G was introduced into cells, it was confirmed that the migration rate of Huh7 was significantly inhibited compared with the control NT-6pi (all the 6th bases of cel-miR-67 were replaced by dSpacer).

[0432] miR-122 introduced into cells: 2,3o 8 G also has the possibility that other guanines may be additionally oxidized by free radicals in the cell, thus reducing their function (see Figure 8E). Therefore, it was confirmed that when the same wound healing assay was performed after treatment with an antioxidant for cell culture (an antioxidant supplement from Sigma-Aldrich), miR-122:2,3o 8 G exhibited a greater inhibitory effect on the migration of liver cancer cells. In other words, the effect of antioxidant treatment on o can be maximized. 8Biological effects of G-modified microRNAs.

[0433] In addition, in order to study let-7:4o 8 The function of G, and its recognition in glioblastoma. 8 G modifies microRNA, which is synthesized as siRNA (let-7:4o). 8 G: 5'-pUGA o 8 G UAGUAGGUUGUAUAGdTdT-3' (SEQ ID NO: 66) was introduced into HS683 cells in double-stranded form. After introduction into HS683 cells, apoptosis was measured using an Attune NxT flow cytometer with the eBioscience Annexin V-FITC apoptosis detection kit (Invitrogen).

[0434] The experimental results confirmed a significant increase in apoptosis in HS683, as shown in Figure 5E.

[0435] Regarding miR-124: 4o 8 G(5'p-UAA o 8 G The same experiment was performed on the siRNA synthesized form of GCACGCGGUGAAUGCdTdT-3' (SEQ ID NO: 67), as shown in Figure 5F, and induced apoptosis was observed.

[0436] Referring to the experimental results of Examples 1 to 5, o occurred in the seed region (bases up to the 8th base from the 5′ end) of several microRNAs. 8 G modification can exhibit a variety of pathophysiological functions during synthesis and introduction into cells.

[0437] Experimental Example 6. miR-1: 7o 8 G and loss of function in cardiomyopathy

[0438] The oxidation of miR-1 was investigated by analyzing Ago HITS-CLIP results obtained from the left ventricle of human cardiomyopathy patients (n=6, see Tables 5 to 7).

[0439] (Table 5)

[0440]

[0441] (Table 6)

[0442]

[0443] (Table 7)

[0444]

[0445] As a result, as shown in Figure 6A, although the rate was low, the same pattern of G>T mutations (positions 2, 3, and 7) was detected in Ago-related miR-1 (Figure 6A, left panel), and clustered to include patient groups with the highest frequency at position 7 (positions 1, 2, 4, and 5) as well as other smaller positions (positions 2, 3, and 12; n=4). The others (3 and 6) had the highest frequency only at position 2 (n=2) (Figure 6A, right panel). Within the normalized Ago-mRNA clusters, mutations caused by o were observed. 8 The number of oxidized miR-1 target sites represented by G binding at positions 2, 3, or 7 was significantly higher than expected, as shown in Figure 6B (P < 0.01, chi-square test), corresponding to an average of approximately 18% more than G:U binding (approximately 10%) and control sites (approximately 7%).

[0446] To further address miR-1:7o 8 The physiological relevance of G was assessed, and the loss of function was evaluated. Employing the concept of miRNA sponges (synthesized as competitive inhibitors of RNA) to preserve seed-mediated target site tandem repeat sequences, as shown in Figure 6C, miR-1 (anti-seed) and miR-1:7o were prepared. 8 G (anti-7oxo) (top of Figure 6C) and their specific inhibitory effects were verified (bottom of Figure 6C).

[0447] As shown in Figure 6D, RNA-Seq (see Table 8) confirmed that the inhibitory activity of anti-7oxo(9x) completely inhibited the miR-1 7oxo target in serum-deficient H9c2.

[0448] (Table 8)

[0449]

[0450] Then, as shown in Figure 6E, anti-7oxo(4x) was introduced into rCMCs and showed attenuation of PE-induced hypertrophy. Two anti-7oxo (4x and α-MHC 13x) were also injected into ISO-treated mice as synthetic anti-7oxo(4x) RNA or as a cardiomyocyte-specific expression vector (α-MHC 13x) containing 13 target sites that effectively antagonize adrenergic cardiac hypertrophy, as shown in Figure 6F. The extent of anti-7oxo (α-MHC 13x) delivery was confirmed and observed to be correlated with their inhibitory activity.

[0451] Administration of anti-7oxo (α-MHC 13x) maintained cardiomyocyte size, as shown in Figure 6G (top of Figure 6G) and completely inhibited miR-1: 70. 8 G target (see bottom of Figure 6G and Table 9). However, as shown in Figure 6H, there was no effect on the increase in ROS in the hearts of ISO-treated mice.

[0452] (Table 9)

[0453]

[0454] In addition, as shown in Figure 6I, transformed mice (TG) expressing anti-7oxo (α-MHC 13x) were generated, and their expression was confirmed as shown in Table 10 and Figure 6J (RNA-Seq).

[0455] (Table 10)

[0456]

[0457] As a result, there was no fundamental difference in heart size among them, as shown in Figure 6K (top of Figure 6K), but ISO-induced cardiac hypertrophy was significantly prevented in all three different TG models (bottom of Figure 6K), miR-1: 7o 8 The overall inhibition of the G target is shown in Figure 6L, and even with ISO treatment (TG(+)) ISO vs.TG(-) ISO In IS, the size of cardiomyocytes also decreases, as shown in 6M.

[0458] In summary, miR-1, especially miR-1:7o 8 Site-specific oxidation of G is an endogenous driver of cardiac hypertrophy and disease, indicating that it generates and alters target interactions in patients with cardiomyopathy. In this regard, ROS-induced miR-1 of the present invention: 7 o 8 A schematic diagram of site-specific oxidation of G and its induction of cardiac hypertrophy is shown in Figure 6N.

[0459] Experimental Example 7. miR-1 in plasma of an animal model of cardiac hypertrophy: o 8 G added confirmation

[0460] Observations were made on miR-1 levels in myocardial tissue of cardiac hypertrophy models and patients with myocardial hypertrophy. 8 After G modification was increased, to confirm that myocardial hypertrophy could be diagnosed through non-invasive detection, the o of miR-1 was increased. 8 G modification was intended to be detected in the blood of mice with induced cardiac hypertrophy. First, it was confirmed whether ISO treatment induced cardiac hypertrophy in mice. Figure 7A shows representative heart photographs of ISO-induced myocardial hypertrophy, with 3 mice in each group. Compared to the control group, the experimental groups treated with ISO showed an average increase in heart size of approximately 30% (36% H / B vs 32% H / T). Details are recorded in Table 11. Furthermore, to determine whether miR-1:o was measured in the blood of the animal model... 8 G and whether it is enriched in myocardial hypertrophy, isolated plasma and its effect on miR-1:o 8 G is quantized (n=3).

[0461] (Table 11)

[0462]

[0463] Then, plasma was separated from the blood of each animal model, and small RNA was extracted. The amount of miR-1 in the isolated small RNA was measured, and simultaneously, it was analyzed by o 8 G Immunoprecipitation Measurement 8 The amount of G-modified miR-1 (Figure 7B). The amount of miR-1 was measured using an equal amount of RNA extracted from plasma, confirming that there was no statistically significant difference between the experimental and control groups, indicating that miR-1 is present in plasma and exists in corresponding amounts regardless of whether cardiac hypertrophy is induced (Figure 7C).

[0464] Subsequently, small RNAs isolated from plasma were subjected to o 8 G-IP to confirm miR-1:o 8 G is present in plasma (Figure 7B). At this point, in order to correct and quantify o... 8 Differences in the G-IP process, prior to immunoprecipitation, will be present in o 8 Human miR-124-3p synthesized at position 5 of G was added to the small RNA sample in the same amount and used. The result was an oxidized miR-1:o 8 In each of the three animals, G showed an average increase of approximately 379% in plasma in patients with cardiac hypertrophy, and this change was confirmed to be statistically significant by Student's t-test (p = 0.031) (Figure 7D). In summary, microRNA-1 measured in plasma by qPCR showed no difference between cardiac hypertrophy and controls, but... 8 G-IP-qPCR measurement of oxidized modified microRNA-1 (miR-1:o 8 G) showed a significant increase in cardiac hypertrophy, and it was observed that this could be achieved through blood-based miR-1:o 8 G measurement provides a non-invasive way to diagnose cardiac hypertrophy.

[0465] Experimental Example 8. Effects of Antioxidants on Myocardial Hypertrophy and their Ability to Improve the Inhibition of Cardiomyocyte Hypertrophy miR-1-7oxo, which inhibits miR-1:7oxo during antioxidant treatment. 8 G

[0466] When PE-induced mast cells were treated with the antioxidant NAC, as shown in Figure 8A, a reduction in mast size was confirmed (n = 4 inches). 2 As shown in Figure 8B (ImageJ), simultaneous treatment with ISO and NAC attenuates ISO-induced myocardial hypertrophy.

[0467] Additionally, as shown in Figure 8C, it is confirmed that o processed by ISO or PE... 8The increase in G decreased with NAC treatment (scale bar, 100 μm). That is, treatment with the antioxidant NAC reduced the oxidation of miRNA.

[0468] After observing the inhibitory effect of ISO treatment with NAC on cardiomyocyte hypertrophy (Fig. 1B), to examine whether cardiomyocyte hypertrophy could be inhibited in the same manner by other antioxidant treatments, H9c2 cells were treated with PE and ISO to induce cardiomyocyte hypertrophy, along with other antioxidants such as butylated hydroxyanisole (BHA) and Sigma-Aldrich's antioxidant supplement (A1345), which are marketed as antioxidants for cell culture (Fig. 8D). The results confirmed a reduction in cardiomyocyte size regardless of the type of antioxidant, particularly in the H9c2 cardiomyocyte line, where the size did not increase at all even with PE or ISO treatment; the results were statistically significant in all three replicates (*, P < 0.01).

[0469] Furthermore, it was confirmed that primary cardiomyocytes (rCMCs) cultured in rat embryos underwent PE treatment, resulting in cell hypertrophy (Fig. 8E, top). Here, the introduction of an inhibitory anti-7oxo(4x) containing multiple 7oxo sites to recognize miR-1 and inhibit o 8 G-modified form (miR-1:7o) 8 At G), it was further confirmed that cardiomyocyte hypertrophy was inhibited after progression, and the maximum effect of no cardiomyocyte hypertrophy was observed when additional treatment with the antioxidant NAC was applied (Fig. 8E, middle panel). These results may be due to the prevention of ozone formation caused by increased free radicals after the introduction of anti-7oxo(4x) into cells due to PE treatment. 8 The effect shown by G oxidation. In fact, to determine whether additional ozone (O2) occurs in artificially introduced RNA into cells. 8 G produces and inhibits, therefore, in order to introduce miR-1: 7o 8 Treatment with G instead of PE was used to induce cardiomyocyte hypertrophy, thereby generating reactive oxygen species, while simultaneously applying oxidative stress by treatment with 100 μM hydrogen peroxide (H2O2) (Figure 8E, bottom panel). As a result, it was observed that the existing miR-1:7o 8 G-induced cardiomyocyte hypertrophy was inhibited by hydrogen peroxide treatment. Conversely, treatment with the antioxidant NAC confirmed that miR-1:7o 8 G-induced cardiomyocyte hypertrophy is more effective.

[0470] Therefore, based on these results, it is confirmed that not only NAC, but also BHA and other general antioxidants used in cell culture, if antioxidant treatment can exhibit antioxidant effects, may inhibit cardiomyocyte hypertrophy, and it was found that antioxidant treatment can effectively prevent o8 G-modified microRNAs or RNAs that may undergo additional oxidative modifications can inhibit their ability to induce regulation of cardiomyocyte size through artificial RNA expression. Specifically, myocardial hypertrophy is characterized by both physiological and pathological hypertrophy. When athletes or pregnant women require sufficient blood supply, depending on the situation, temporary induction of physiological hypertrophy may be necessary to enhance cardiac function as the heart enlarges to provide a smoother supply. Therefore, miR-1:7o 8 The cardiac hypertrophy induced by the introduction of G into cardiomyocytes may play a role in physiological hypertrophy. In this case, antioxidant treatment can effectively induce myocardial hypertrophy and inhibit pathological myocardial hypertrophy. Pathological cardiac hypertrophy can usually be inhibited by preventing additional oxidative stress that causes pathological phenomena.

[0471] The foregoing description of the present invention is for illustrative purposes. Those skilled in the art will understand that modifications to other specific forms can be readily made without altering the technical spirit or essential characteristics of the invention. Therefore, it should be understood that the above embodiments are illustrative in all respects and not restrictive. <110> Korea University Industry-Academia Collaboration Group <120> RNA interference-induced nucleic acids containing 8-oxoguanine, modified nucleic acids that bind to microRNAs containing 8-oxoguanine, and their applications. <130> OPP20205123KR <150> 10-2019-0156147 <151> 2019-11-28 <160> 70 <170> koPatentIn 3.0 <210> 1 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:2(8-oxoguanine) <220> <221> misc_difference <222> (2) <223> 8-oxoguanine <400> 1 uggaauguaa agaaguaugu au 22 <210> 2 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:3(8-oxoguanine) <220> <221> misc_difference <222> (3) <223> 8-oxoguanine <400> 2 uggaauguaa agaaguaugu au 22 <210> 3 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:7(8-oxoguanine) <220> <221> misc_difference <222> (7) <223> 8-oxoguanine <400> 3 uggaauguaa agaaguaugu au 22 <210> 4 <211> 7 <212> RNA <213> Artificial sequence <220> <223> miR-1 2oxo site <400> 4 acauuca 7 <210> 5 <211> 7 <212> RNA <213> Artificial sequence <220> <223> miR-1 3oxo site <400> 5 acauuac 7 <210> 6 <211> 7 <212> RNA <213> Artificial sequence <220> <223> miR-1 7oxo site <400> 6 aaauucc 7 <210> 7 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1 <220> <221> gene <222> (1)..(22) <223> miR-1 <400> 7 uggaauguaa agaaguaugu au 22 <210> 8 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> miR-1 passenger <400> 8 acauacuucu uuauaugccc aua 23 <210> 9 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:2GU <400> 9 uugaauguaa agaaguaugu au 22 <210> 10 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:3GU <400> 10 uguaauguaa agaaguaugu au 22 <210> 11 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR-1:7GU <400> 11 uggaauuuaa agaaguaugu au 22 <210> 12 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> cel-miR-67 <220> <221> gene <222> (1)..(22) <223> cel-miR-67 <400> 12 ucacaaccuc cuagaaagag ua 22 <210> 13 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> thymidine deoxynucleotide (dT) <220> <221> misc_difference <222> (23)..(24) <223> thymidine deoxynucleotide (dT) <400> 13 ucacaaccuc cuagaaagag uatt 24 <210> 14 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> passenger strand <220> <221> misc_difference <222> (23)..(24) <223> thymidine deoxynucleotide (dT) <400> 14 uacucuuucu aggagguugu gatt 24 <210> 15 <211> 80 <212> RNA <213> Artificial sequence <220> <223> 39‑oxo‑R <220> <221> misc_difference <222> (22)<l <223> 8‑oxoguanine <400> 15 ccugguccca gacuaaagaa ugcuugacag uuaucucgua ugccgucuuc ucgagguagc 60 ggaaccguga gcuuugaagu 80 <210> 16 <211> 80 <212> RNA <213> Artificial sequence <220> <223> 39R <400> 16 ccugguccca gacuaaagaa ugcuugacag uuaucucgua ugccgucuuc ucgagguagc 60 ggaaccguga gcuuugaagu 80 <210> 17 <211> 22 <212> RNA <213> Artificial sequence <220> <223> 8‑oxoguanine spike‑in <220> <221> misc_difference <222> (2)..(3) <223> 8-oxoguanine <400> 17 uggaauguaa agaaguaugu au 22 <210> 18 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> G spike-in <400> 18 uggaauguaa agaaguaugu au 22 <210> 19 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miRNA:8‑oxoguanine spike‑in <220> <221> misc_difference <222> (5) <223> 8-oxoguanine <400> 19 uaaggcacgc ggugaaugcc aa 22 <210> 20 <211> 7 <212> RNA <213> Artificial sequence <220> <223> miR-1 seed site <400> 20 acauucc 7 <210> twenty one <211> 7 <212> RNA <213> Artificial sequence <220> <223> cont NT site <400> twenty one gguugug 7 <210> twenty two <211> 46 <212> DNA <213> Artificial sequence <220> <223> oligo dT adaptor primer <400> twenty two gcgagcacag aattaatacg actcactata ggttttttttttttvn 46 <210> twenty three <211> 26 <212> DNA <213> Artificial sequence <220> <223> miRNA reverse primer <400> twenty three gcgagcacag aattaatacg actcac 26 <210> twenty four <211> twenty two <212> DNA <213> Artificial sequence <220> <223> 8‑oxoguanine or G spike‑in forward primer <400> twenty four tggaatgtaa agaagtatgt at 22 <210> 25 <211> 26 <212> DNA <213> Artificial sequence <220> <223> 8‑oxoguanine or G spike‑in reverse primer <400> 25 gcgagcacag aattaatacg actcac 26 <210> 26 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> miRNA:8‑oxoguanine spike‑in forward primer <400> 26 taaggcacgc ggtgaatgcc aa 22 <210> 27 <211> 26 <212> DNA <213> Artificial sequence <220> <223> miRNA:8‑oxoguanine spike‑in reverse primer <400> 27 gcgagcacag aattaatacg actcac 26 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> control forward primer <400> 28 cgcttcggca gcacatatac 20 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <220> <223> control reverse primer <400> 29 ttcacgaatt tgcgtgtcat 20 <210> 30 <211> 45 <212> DNA <213> Artificial sequence <220> <223> RT primer <400> 30 acttcaaagc tcacggttcc gctacctcga gaagacggca tacga 45 <210> 31 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 39‑oxo‑R or 39R forward primer <400> 31 cctggtccca gactaaagaa t 21 <210> 32 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 39‑oxo‑R or 39R reverse primer <400> 32 acttcaaagc tcacggttcc g 21 <210> 33 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> 22nt synthetic RNA <220> <221> misc_difference <222> (7) <223> 8-oxoguanine <400> 33 uggaauguaa agaaguaugu au 22 <210> 34 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> 3' adapter: 5'-adenylation <220> <221> misc_difference <222> (2) <223> methyl-phosphonate guanine <220> <221> misc_difference <222> (2) <223> dideoxy-cytosine <400> 34 tggaattctc gggtgccaag gc 22 <210> 35 <211> 31 <212> RNA <213> Artificial sequence <220> <223> 5' adapter <220> <221> misc_difference <222> (31) <223> 2'-methoxy-C <400> 35 guucagaguu cuacaguccg acgaucnnnn c 31 <210> 36 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> RT primer <400> 36 gccttggcac ccgagaattc ca 22 <210> 37 <211> 50 <212> DNA <213> Artificial sequence <220> <223> universal forward primer <400> 37 aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga 50 <210> 38 <211> 57 <212> DNA <213> Artificial sequence <220> <223> barcode primer <400> 38 caagcagaag acggcatacg agatgtgact ggagttcctt ggcacccgag aattcca 57 <210> 39 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑seed site forward primer <400> 39 tcgagacatt ccacattcca cattccacat tccacattcc gc 42 <210> 40 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑seed site reverse primer <400> 40 ggccgcggaa tgtggaatgt ggaatgtgga atgtggaatg tc 42 <210> 41 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑2oxo site forward primer <400> 41 tcgagacatt caacattcaa cattcaacat tcaacattca gc 42 <210> 42 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑2oxo site reverse primer <400> 42 ggccgctgaa tgttgaatgt tgaatgttga atgttgaatg tc 42 <210> 43 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑3oxo site forward primer <400> 43 tcgagacatt acacattaca cattacacat tacacattac gc 42 <210> 44 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑3oxo site reverse primer <400> 44 ggccgcgtaa tgtgtaatgt gtaatgtgta atgtgtaatg tc 42 <210> 45 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑7oxo site forward primer <400> 45 tcgagaaatt ccaaattcca aattccaaat tccaaattcc gc 42 <210> 46 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1‑7oxo site reverse primer <400> 46 ggccgcggaa tttggaattt ggaatttgga atttggaatt tc 42 <210> 47 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1 control site forward primer <400> 47 tcgagacttt ccactttcca ctttccactt tccactttcc gc 42 <210> 48 <211> 42 <212> DNA <213> Artificial sequence <220> <223> miR‑1 control site reverse primer <400> 48 ggccgcggaa agtggaaagt ggaaagtgga aagtggaaag tc 42 <210> 49 <211> 30 <212> DNA <213> Artificial sequence <220> <223> NheI and XhoI site forward primer <400> 49 taggctagcc accatggtga gcaagggcga 30 <210> 50 <211> 45 <212> DNA <213> Artificial sequence <220> <223> NheI and XhoI site reverse primer <400> 50 gggctcgagc gatcgcctag aattacttgt acagctcgtc catgc <210> 51 <211> 32 <212> DNA <213> The snowstorm <220> <223> ApaI and XbaI site forward primer <400> 51 gaagggccct atgagcgagc tgatcaagga of <210> 52 <211> 36 <212> DNA <213> The snowstorm <220> <223> ApaI and XbaI site reverse primer <400> 52 gactctagaa ttattatctg tgccccagtt tgctag <210> 53 <211> 36 <212> DNA <213> The snowstorm <220> <223> residual 33bp of hluc+ forward primer sequences <400> 53 gtactgttgg taaagccacc atgagcgagc tgatca <210> 54 <211> 36 <212> DNA <213> The snowstorm <220> <223> residual 33bp of hluc+ sequences reverse primer <400> 54 tccttgatca gctcgctcat ggtggcttta ccaaca 36 <210> 55 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> hGH poly (A) forward primer <400> 55 ccaccagcct tgtcctaata aa 22 <210> 56 <211> 19 <212> DNA <213> Artificial sequence <220> <223> hGH poly (A) reverse primer <400> 56 cagcttggtt cccaataga 19 <210> 57 <211> 122 <212> DNA <213> Artificial sequence <220> <223> anti‑7oxo (alpha‑MHC 13x) forward primer <400> 57 tcgacaaatt ccaaaaattc cataaattcc agaaattcca caaattccaa aaattccaca 60 aattccataa attccagaaa ttccaaaaat tccataaatt ccagaaattc cacaaattcc 120 aa 122 <210> 58 <211> 122 <212> DNA <213> Artificial sequence <220> <223> anti‑7oxo (alpha‑MHC 13x) reverse primer <400> 58 agctttggaa tttgtggaat ttctggaatt tatggaattt ttggaatttc tggaatttat 60 ggaatttgtg gaatttttgg aatttgtgga atttctggaa tttatggaat ttttggaatt 120 tg 122 <210> 59 <211> 122 <212> DNA <213> Artificial sequence <220> <223> cont (anti‑NT 13x) forward primer <400> 59 tcgacggttg tgaaggttgt gatggttgtg agggttgtga cggttgtgaa ggttgtgacg 60 gttgtgatgg ttgtgagggt tgtgaaggtt gtgatggttg tgagggttgt gacggttgtg 120 aa 122 <210> 60 <211> 122 <212> DNA <213> Artificial sequence <220> <223> cont (anti‑NT 13x) reverse primer <400> 60 agctttcaca accgtcacaa ccctcacaac catcacaacc ttcacaaccc tcacaaccat 60 cacaaccgtc acaaccttca caaccgtcac aaccctcaca accatcacaa ccttcacaac 120 cg 122 <210> 61 <211> 35 <212> DNA <213> Artificial sequence <220> <223> hGH poly (A) forward primer <400> 61 taaattccaa attccagaaa ttccacaaat tccat 35 <210> 62 <211> 20 <212> DNA <213> Artificial sequence <220> <223> hGH poly (A) reverse primer <400> 62 ccagcttggt tcccaataga 20 <210> 63 <211> 35 <212> DNA <213> Artificial sequence <220> <223> anti-7oxo (4x) primer <400> 63 taaattccaa attccagaaa ttccacaaat tccat 35 <210> 64 <211> 20 <212> RNA <213> Artificial sequence <220> <223> 8‑oxo deoxyguanosine RNA spike‑in <220> <221> misc_difference <222> (5) <223> 8-oxo deoxyguanosine <400> 64 uaaggcacgc ggugaaugcc 20 <210> 65 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> miR‑122:2,3(8‑oxoguanine) <220> <221> misc_difference <222> (2) <223> 8‑oxoguanine <220> <221> misc_difference <222> (3) <223> 8‑oxoguanine <400> 65 ugggagugug acaauggugu uug 23 <210> 66 <211> 19 <212> RNA <213> Artificial sequence <220> <223> let‑7:4(8‑oxoguanine) <220> <221> misc_difference <222> (4) <223> 8‑oxoguanine <400> 66<00022�9>ugaguaguag guuguauag 19 <210> 67 <211> 19 <212> RNA <213> Artificial sequence <220> <223> miR‑124:4(8‑oxoguanine) <220> <221> misc_difference <222> (4) <223> 8‑oxoguanine <400> 67 uaaggcacgc ggugaaugc 19 <210> 68 <211> 22 <212> RNA <213> Artificial sequence <220> <223> miR-122 <400> 68 uggaguguga caaugguguu ug 22 <210> 69 <211> 19 <212> RNA <213> Artificial sequence <220> <223> let-7 <400> 69 ugaguaguag guuguauag 19 <210> 70 <211> 19 <212> RNA <213> Artificial sequence <220> <223> miR-124 <400> 70 uaaggcacgc ggugaaugc 19

Claims

1. RNA interference induces nucleic acids containing a 5' terminal sequence of a polynucleotide selected from the following group: 5'p-Uo 8 GGAAUG-3',5'p-UGo 8 GAAUG-3' and 5'p-UGGAAUo 8 G-3' The RNA interference-induced nucleic acid induces myocardial hypertrophy when injected into cells or animals.

2. The RNA interference-induced nucleic acid of claim 1, comprising polynucleotides selected from group 2: [Group 2] SEQ ID NO: 1 polynucleotide (5'p-Uo) 8 GGAAUGUAAAGAAGUAUGUAU-3'); SEQ ID NO: 2 polynucleotide (5'p-UGo) 8 GAAUGUAAAGAAGUAUGUAU-3'); and SEQ ID NO: 3 polynucleotide (5'p-UGGAAUo) 8 GUAAAGAAGUAUGUAU-3').

3. A composition comprising the RNA interference-induced nucleic acid of claim 1 or claim 2 and an antioxidant.

4. Modified nucleic acids that specifically bind to modified microRNAs. The modified microRNA contained polynucleotides selected from group 2: [Group 2] SEQ ID NO: 1 polynucleotide (5'p-Uo) 8 GGAAUGUAAAGAAGUAUGUAU-3'); SEQ ID NO: 2 polynucleotide (5'p-UGo) 8 GAAUGUAAAGAAGUAUGUAU-3'); and SEQ ID NO: 3 polynucleotide (5'p-UGGAAUo) 8 GUAAAGAAGUAUGUAU-3'), and The modified nucleic acid contains adenine (A), which binds to at least one 8-oxoguanine (O) from the 2nd, 3rd, or 7th nucleotide starting from the 5' end of the modified microRNA. 8 G).

5. The modified nucleic acid of claim 4, wherein... The modified nucleic acid contains 5'-ACAUUC A -3', 5'-ACAUU A C-3', or 5'-A A Any base sequence of AUUCC-3'.

6. A recombinant vector comprising a gene encoding the modified nucleic acid of claim 4 or claim 5.

7. A pharmaceutical composition for treating cardiac hypertrophy, comprising: The modified nucleic acid of claim 4 or 5, or a recombinant vector containing a gene encoding the modified nucleic acid.

8. The pharmaceutical composition for treating cardiac hypertrophy as claimed in claim 7, further comprising an antioxidant.

9. The pharmaceutical composition of claim 7, wherein the antioxidant is N-acetylcysteine ​​or butylated hydroxyanisole.

10. Anti-8-oxoguanine (o 8 G) Use of antibodies in the preparation of a kit for diagnosing cardiac hypertrophy, wherein the kit is used in a method comprising: To determine whether one or more guanine (G) nucleotides in microRNA isolated from animal cardiomyocytes are modified to 8-oxoguanine (o) 8 G); and When one or more guanine (G) nucleotides in the 2nd, 3rd, or 7th nucleotide from the 5' end of the microRNA are modified to 8-oxoguanine (O) 8 When G) is present, it is classified as cardiomegaly. The microRNA mentioned therein is miR-1, as indicated by Seq ID No. 7.

Images