A method for breeding kelp

Abstract

The present invention provides a breeding method for kelp. Through polymorphism screening of heat-tolerant and non-heat-tolerant kelp strains, SSR markers linked to the heat tolerance of kelp are determined, and a method for detecting kelp parents with heat-tolerant traits is established, thereby providing effective molecular markers for the genetic breeding of kelp. By analyzing the amplification products of heat-tolerant kelp strains and temperature-sensitive kelp strains, the present invention obtains SSR markers linked to the heat-tolerant traits of kelp. Using these SSR markers, kelp strains related to heat tolerance can be screened and used for the screening and identification of hybrid strains.

Description

Technical Field

[0001] The present invention belongs to the technical field of seaweed genetic breeding, and particularly relates to a method for breeding Laminaria japonica. Background Art

[0002] Laminaria japonica is a perennial large edible alga. Its sporophyte is large, brown, and flat ribbon-shaped, and is structurally divided into a blade, a stipe, and a holdfast. The holdfast is rhizoid-like, and the blade is composed of epidermal, cortical, and medullary tissues. There are sporangia at the lower part of the blade, which have mucilage cavities and can secrete slippery substances. The holdfast is tree-like branched and is used to attach to the seabed rocks and grows in the sea with relatively low water temperature.

[0003] Laminaria japonica is the main object of economic seaweed aquaculture. China is also a major country in Laminaria japonica aquaculture. As of 2016, the aquaculture area was about 43,000 hm 2 , and the aquaculture output was more than 1.41 million tons. The annual output of Laminaria japonica accounted for more than 60% of the total output of Chinese algal aquaculture.

[0004] However, Laminaria japonica belongs to low-temperature aquaculture algal species. The harvesting period in northern China is concentrated from May to July every year. When the water temperature exceeds 20°C, Laminaria japonica will stop growing and gradually rot. And the high-temperature resistant Laminaria japonica strain effectively prolongs the growth cycle of the sporophyte.

[0005] At present, research on heat-resistant Laminaria japonica has been carried out in China. For example, the Ocean University of China and the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences have respectively carried out research on heat-resistant strains of Laminaria japonica. And some strains (Laminaria japonica 901) have been actually cultured.

[0006] However, traditional selective breeding is based on the numerical values of phenotypic traits for breeding, which has the defect of a long breeding cycle. With the development of modern molecular biology technology, molecular marker-assisted breeding can overcome the disadvantages that morphological markers used in conventional breeding are greatly affected by the environment and are not easy to directly select, thus accelerating the breeding process.

[0007] Simple sequence repeat (SSR), also known as microsatellite marker, has the advantages of codominance, multiple alleles, and high variability. It is widely distributed in the genome and is often used in research such as population genetic analysis, genetic linkage map construction, and QTL mapping. Related research work on SSR of Laminaria japonica has been carried out, but there is no relevant research on using SSR markers for association analysis of heat-resistant traits of Laminaria japonica yet. Summary of the Invention

[0008] The present invention provides a breeding method for heat-resistant kelp. Through polymorphism screening of heat-resistant and non-heat-resistant kelp strains, SSR markers linked to the heat resistance of kelp are determined, and a method for detecting kelp parents with heat-resistant traits is established, thereby providing effective molecular markers for the genetic breeding of kelp.

[0009] The present invention first provides an SSR marker LJ-SSRm07 linked to the heat-resistant trait of kelp, and its nucleotide sequence is as follows:

[0010] gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat; where n is a natural number not less than 6;

[0011] The present invention also provides a primer pair for detecting the above SSR marker. For one of the primer pairs, its upstream primer sequence is 5′-gtaggcaaaaccatcaacacaacg-3′ (SEQ ID NO:1),

[0012] and the downstream primer sequence is 5′-ataacacgttagagtgttagtg-3′ (SEQ ID NO:2);

[0013] wherein the upstream primer and / or the downstream primer is labeled with fluorescein at the 5′ end.

[0014] The application of the SSR marker provided by the present invention in screening heat-resistant kelp parents.

[0015] The present invention also provides a method for screening heat-resistant kelp parents, which is to screen by detecting the genotype of the LJ-SSRm07 marker in the individuals to be screened;

[0016] The method described above is to amplify the genomic DNA sample of the parent to be screened using the above primers, and then analyze the genotype of the amplification product.

[0017] For the heat-resistant kelp parent described above, the genotype of the LJ-SSRm07 marker is 165 / 177.

[0018] The analysis described above is to generate a locus map file using Genemapper4.0 software, measure the length of the PCR amplification product and the peak value of fluorescence intensity, and obtain the genotype of each locus; determine whether it is a heat-resistant kelp strain according to the genotype.

[0019] By analyzing the amplification products of heat-resistant kelp strains and temperature-sensitive kelp strains, the present invention obtained SSR markers linked to the heat-resistant traits of kelp. Using these SSR markers, kelp strains related to heat resistance can be screened, which can be used for the screening and identification of hybrid strains. Description of the Drawings

[0020] Figure 1 : PCR electrophoresis detection map of some SSR markers,

[0021] Figure 2 : Capillary electrophoresis result map of genotype 165 / 165,

[0022] Figure 3 : Capillary electrophoresis result map of genotype 165 / 169,

[0023] Figure 4 : Capillary electrophoresis result map of genotype 165 / 169,

[0024] Figure 5 : Capillary electrophoresis result map of genotype 165 / 177. Detailed Embodiment

[0025] Searching for molecular markers closely related to economic traits and performing marker-assisted selection have become research hotspots in current algal genetics and breeding. The present invention screened SSR loci from the kelp gametophyte EST library, designed primers for the screened SSR loci, and detected the screened polypeptide primers on heat-resistant kelp strains and temperature-sensitive kelp strains respectively, and obtained microsatellite markers related to heat resistance.

[0026] The present invention will be described in detail below in conjunction with the embodiments and the drawings.

[0027] Example 1: Screening of SSR Markers

[0028] Using the MISA tool to search and analyze the SSR loci in the kelp gametophyte EST library constructed by Ocean University of China, the SSR screening criteria are as follows:

[0029] For SSR loci with a dinucleotide repeat core, the number of repeats is at least 6 times; for SSR loci with a trinucleotide, tetranucleotide, pentanucleotide, or hexanucleotide repeat core, the number of repeats is at least 5 times.

[0030] A total of 4350 SSR loci were found. Among them, the proportions of dinucleotide, trinucleotide, tetranucleotide, pentanucleotide, and hexanucleotide repeat types were 74.10%, 23.70%, 1.20%, 0.06%, and 0.04% respectively. Among mono-, di-, and trinucleotide repeat types, the most abundant repeat motifs were AT, AC, and GGA / CAT / TAA respectively.

[0031] Fifty loci were selected for polymorphism screening. The Primer Premier 5.0 primer design software was used to design detection primers for EST sequences containing SSR loci. The objects for amplification and detection were the heat-tolerant Laminaria japonica strain 901 and the heat-sensitive Rongcheng No. 1 (RC) Laminaria japonica samples preserved in the Algae Species Room of the Shandong Academy of Marine Sciences.

[0032] The primer design principles are as follows: the primer sequence length is 18 - 26 bp, the expected amplified product size is 100 - 400 bp, the G + C content is 40% - 70%, the annealing temperature is 45 - 60 °C, and the difference in annealing temperature values between the upstream and downstream primers is no more than 2 °C.

[0033] The amplified products were subjected to 2.0% agarose gel electrophoresis. The results showed that 38 loci exhibited polymorphism and 12 loci did not show polymorphism ( Figure 1 ).

[0034] Among the 38 polymorphic loci, 10 loci were selected for genetic diversity analysis. The electrophoresis results showed that a total of 46 alleles were detected at 10 loci, with an average number of alleles of 4.600, an effective number of alleles ranging from 1.054 to 3.121, with an average value of 2.007, an observed heterozygosity ranging from 0.0472 to 0.5724, with an average value of 0.4103, and an expected heterozygosity ranging from 0.0521 to 0.6121, with an average value of 0.059. The PIC values of 7 loci were greater than 0.4, and the PIC values of 3 loci were less than 0.3.

[0035] The above results indicate that due to long-term artificial selection, the genetic polymorphism of these two cultured strains is relatively low.

[0036] Example 2: Analysis of the correlation between SSR marker LJ-SSRm07 and heat tolerance

[0037] The Algae Species Preservation Room of the Shandong Marine Science Research Institute preserves the heat-tolerant 901 kelp strain (901), the heat-tolerant Rongfu kelp strain (RF), the heat-sensitive Rongcheng No. 1 kelp (RC), the wild kelp collected from Rongcheng area that is not heat-tolerant (RCW), and the wild kelp collected from Changdao that is not heat-tolerant (CDW). Among them, the 901 kelp is a new variety obtained by crossing the Japanese long kelp (L. longissima) and the early thick finished strain No. 1 (Laminaria japonica) as female and male parents. This kelp strain has the characteristics of fast growth rate, heat tolerance, and resistance to decay. The Rongfu kelp strain is a heat-tolerant and high-yield kelp variety obtained by hybridizing the female gametophyte clone of Fujian kelp and the male gametophyte clone of "Yuanza No. 10" kelp, and then continuously conducting selective breeding after obtaining the hybrid F1. The Rongcheng No. 1 (RC) kelp is an unselected wild kelp strain and does not have the characteristic of heat tolerance. The heat-sensitive Rongcheng No. 1 kelp (RC), the wild kelp collected from Rongcheng area (RCW), and the wild kelp collected from Changdao that is not heat-tolerant (CDW) will stop growing and rot when the seawater temperature exceeds 20°C; while the heat-tolerant strains will still grow when the water temperature exceeds 23 - 25°C.

[0038] The amplification detection results show that for the SSR marker LJ-SSRm07, it is amplified by the upstream primer with the sequence 5′-gtaggcaaaaccatcaacacaacg-3′ and the downstream primer with the sequence 5′-ataacacgttagagtgttagtg-3′, and has a specific genotype 165 / 177 in the heat-tolerant strains.

[0039] The specific detection process is as follows.

[0040] I. Extract the genomic DNA of the sample

[0041] 1. Grinding:

[0042] In 5 groups of kelp samples, 5 sporophytes are selected from each group and ground thoroughly into powder. Keep liquid nitrogen in the mortar during grinding all the time, and transfer the powder to a 50 mL centrifuge tube. Add 12 mL of 2% CTAB extraction solution preheated at 60°C (2% CTAB, 3% PVP) and 2.5% β-mercaptoethanol, and gently and thoroughly mix the materials. Then incubate in a 60°C water bath for 60 min.

[0043] 2. Extraction:

[0044] 1) Add an equal volume of chloroform-isoamyl alcohol (24:1) to the extraction solution, gently and thoroughly invert and mix for 10 min, centrifuge at 12000 rpm for 10 min. Aspirate the supernatant, add 0.1 times the volume of 10% CTAB (fully preheated at 60°C) to the supernatant, gently mix for 1 min, and incubate in a 60°C water bath for 10 min.

[0045] 2) Add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1), mix gently and thoroughly, and then centrifuge at 12,000 rpm for 10 min.

[0046] 3) Aspirate the supernatant, add an equal volume of chloroform-isoamyl alcohol (24:1), mix gently and thoroughly for 1 min, and then centrifuge at 12,000 rpm for 10 min. Aspirate the supernatant.

[0047] 3. Precipitation:

[0048] 1) Add 2 / 3 volume of isopropanol (pre-cooled at -20 °C) to the supernatant, mix gently and thoroughly. After standing at -20 °C for 30 min, centrifuge at 12,000 rpm for 5 min to precipitate DNA.

[0049] 2) Add 1 ml of 70% ethanol, place at room temperature for 10 min, gently shake to make the floccules float. Wash 3 times, pour out the washing buffer, and then invert the centrifuge tube on the ultra-clean workbench to dry.

[0050] 4. Dissolution:

[0051] Add 200 μl of ultrapure water to the DNA precipitate to dissolve. After dissolution, add 5 - 8 μl of RNase, and incubate in a 37 °C water bath for 30 min to remove RNA.

[0052] 5. Detection:

[0053] Detect the integrity and quality of DNA by 1% agarose gel electrophoresis. Estimate the DNA concentration by ultraviolet spectrophotometer and gel quantification, and estimate the purity of DNA according to the value of OD260 / OD280; Store the DNA sample at -20 °C for later use.

[0054] II. PCR Amplification and Fluorescence Detection

[0055] Use the extracted DNA as a template, and use the upstream primer with the sequence 5′-gtaggcaaaaccatcaacacaacg-3′ and the downstream primer with the sequence 5′-ataacacgttagagtgttagtg-3′ for amplification. The total volume of the PCR reaction is 25 μL, the template is 20 ng of genomic DNA, use Taq enzyme (Takara), and label the 5′ end of the forward primer with fluorescein FAM (blue). The PCR reaction conditions are as follows: 94 °C for 5 min; 94 °C for 30 s, 58 °C for 30 s, 72 °C for 20 s, 30 cycles; 72 °C for extension for 5 min; store at 4 °C.

[0056] Automatically detect the fluorescence of the PCR product using an ABI3730XL (Applied Biosystems, USA) DNA analyzer.

[0057] III. Analysis and Detection of Data

[0058] Use Genemapper 4.0 software to generate the amplification map file of each sample, and obtain the genotype of each sample (Table 1). A total of four genotypes were amplified in the five strains, namely 165 / 165( Figure 2 ), 165 / 169( Figure 3 ), 169 / 169( Figure 4 ), and 165 / 177( Figure 5 ).

[0059] Table 1: Genotype Information Table of LJ-SSRm07 in Five Kelp Strains

[0060]

[0061]

[0062] It can be seen from the results in Table 1 that there is no 177bp amplification fragment in the non-heat-tolerant strains, that is, in the amplification product of the sequence

[0063] gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat, in the non-heat-tolerant strains, the number of n is mainly 12 and 14, and there is no case where n is 15.

[0064] In the heat-tolerant strains, there is a specific fragment with a length of 177bp, which can be used as a specific molecular marker for screening heat-tolerant kelp parents.

[0065] Based on the above findings, 30 plants each of the 901 kelp strain and the wild kelp (CDW) with low heat tolerance collected from Changdao were tested with a large sample size. The results showed that in the large sample test, there was also no 177bp fragment in CDW. In the 901 kelp strain, all individuals carried a fragment with a length of 177. Among them, the number of genotypes 165 / 177 was 22, 169 / 177 was 5, and the number of 177 / 177 was 3, indicating that in the heat-tolerant kelp strain, the LJ-SSRm07 genotype was mainly 165 / 177.

[0066] The above results indicate that the SSR markers screened in the present invention can be used to screen kelp parents with high temperature tolerance traits. Sequence Listing <110> Changdao Marine Ecological Civilization Comprehensive Experimental Zone Marine Economy Promotion Center, Shandong Academy of Marine Sciences (Qingdao National Marine Science Research Center) <120> A breeding method of kelp <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <400> 1 gtaggcaaaa ccatcaacac aacg 24 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <400> 2 ataacacgtt agagtgttag tg 22

Claims

1. A method for screening heat-resistant kelp parents, characterized in that, The method described is to screen heat-tolerant kelp parents by detecting the genotypes of SSR markers in individuals to be screened; after using primer pairs to amplify the genomic DNA of the samples to be screened, the genotypes of the amplification products are analyzed for screening; The nucleotide sequences of the SSR markers described are as follows: gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat; where n is a natural number not less than 6; For the primer pairs used, the sequence of the upstream primer is SEQ ID NO:1, and the sequence of the downstream primer is SEQ ID NO:2; Among them, the genotype of the heat-tolerant kelp parent is 165 / 177.

2. The method according to claim 1, wherein The upstream primer and / or the downstream primer of the primer pairs described are labeled with fluorescein at the 5' end.

3. The method according to claim 1, wherein For the method described, the Genemapper 4.0 software is used to generate the map file of the locus, measure the length of the PCR amplification product and the peak value of the fluorescence intensity, and obtain the genotype of each locus; whether it is a heat-tolerant kelp parent is determined according to the genotype.

Images