Preparation method, product and application of a mutant gene reference substance

Abstract

The present invention discloses a method for preparing a mutant gene reference product, its product and application. When there are n mutation sites in the gene to be detected, n mutant gene fragments of the gene sequence containing n mutation sites are used as n mutant gene sequences, and their corresponding n wild-type gene fragments are used as n wild-type gene sequences; 2) Obtaining of random sequences; 3) Selection of quantitative sequences; 4) Designing n sequence fragments by spacing n wild-type gene sequences, n mutant gene sequences and random sequences in sequence, connecting the n sequence fragments with random sequences to obtain a sequence, and connecting 1 quantitative sequence at the end of the sequence to obtain the mutant gene reference product. By designing a group or multiple groups of wild sequences and mutant sequences on the same sequence and separating them with irrelevant sequences, the present invention can make the theoretical ratio of wild / mutant sequences completely consistent with the actual ratio, and effectively avoid the errors and risks brought by nucleic acid degradation.

Description

Technical Field

[0001] The present invention belongs to the research fields of life science and molecular diagnosis, and particularly relates to a preparation method, a product and an application of a mutant gene reference product. Background Art

[0002] The detection of hereditary mutant genes is a conventional method for detecting genetic diseases. In the production and detection process of detection reagents, reference products or control products are required to control the quality of the reagent kit and the detection process. However, due to the scarcity of mutant gene samples, it is difficult to obtain mutant gene samples from the population. Moreover, from an ethical perspective, it is not suitable to use clinical samples as conventional reference products or control products for reagent kits. Therefore, the method of artificially synthesizing mutant genes has become the preferred method.

[0003] Currently, there are methods for constructing large-fragment plasmids, and reference products with specific base sequences desired by people can be designed according to requirements. The existing preparation methods of reference products with mutant genes are to mix the constructed wild-type (gene without mutation) and mutant genes in a certain proportion, and then conduct tests and verifications. Finally, mutant reference products with specific mixing ratios are obtained. For example, the methods mentioned in the patents under application (application numbers: 201910421072.6 and 201910431817.7) are the main methods currently used by existing manufacturers or scientific research institutions, but there are the following problems: 1) Synthesize the sequences of wild and mutant genes separately, or only synthesize the mutant gene sequence and then mix it with the normal gene. In this way, more than one gene fragment needs to be synthesized; 2) The mixing ratios of wild and mutant genes, or mutant and normal genes need to be continuously explored; 3) Gene fragments are relatively unstable chemical substances and will degrade with time and operations such as repeated freezing and thawing. If the wild gene and the mutant gene in the reference product are two synthetic fragments, then there will definitely be different degradation rates. Therefore, after degradation, the original effect cannot be achieved, and the mixing ratio needs to be explored again, as shown in the schematic diagram of Figure 1 As shown. From Figure 1 it can be seen that the adjusted ratio is 1:1, and after degradation, it becomes 2:3.

[0004] In fact, the degradation of reference products is inevitable, which is the biggest factor causing the instability of artificially prepared reference products. As a reference product for measuring the performance of reagent kits and controlling the experimental process, if it is itself unstable, the significance of process control will be greatly reduced.

[0005] Therefore, in the allelic gene mutation reference product, the ratio of wild type to mutant type is very important. If a reference product can be established with a very stable ratio of wild type to mutant type, which is not affected by factors such as degradation and freeze-thaw cycles, its application value can be greatly improved. SUMMARY OF THE INVENTION

[0006] OBJECT OF THE INVENTION: The technical problem to be solved by the present invention is to provide a method for preparing a mutant gene reference product, its product and application, to solve the problems in the commonly used reference product preparation methods that require repeated adjustment of the mixing ratio, and degradation will cause mismatching of the ratio. The mutant gene reference product established by this method has a very definite ratio of wild type to mutant type during design, so it is not affected by factors such as degradation and freeze-thaw cycles, and its application value is greatly improved.

[0007] TECHNICAL SOLUTION: To solve the above technical problem, the present invention provides a method for preparing a mutant gene reference product, including the following steps:

[0008] 1) When the number of mutation sites of the gene to be detected is n, n mutant gene fragments of the gene sequence containing n mutation sites are used as n mutant gene sequences, and the corresponding n wild-type gene fragments are used as n wild-type gene sequences; where n is a natural number from 1 to 100;

[0009] 2) Obtaining a random sequence: The random sequence is an irrelevant sequence, including a human genome sequence, a microbial genome sequence, or other sequences that do not interfere with wild-type and mutant genes;

[0010] 3) Selection of a quantitative sequence: The quantitative sequence is a conserved sequence without mutation sites on the genome corresponding to the gene to be detected;

[0011] 4) Design n sequence fragments by sequentially arranging n wild-type gene sequences, n mutant gene sequences, and random sequences at intervals, connect the n sequence fragments with the random sequence to obtain a sequence, and connect 1 quantitative sequence at the end of the sequence to obtain the mutant gene reference product.

[0012] Among them, the obtaining method of the random sequence in step 2) is as follows:

[0013] 21) Use Excel to randomly generate a lot of random numbers from 1 to 4, and the formula is INT(RAND()*4+1);

[0014] 22) Then replace 1, 2, 3, and 4 with A, T, C, and G respectively, and connect them to form a random base sequence;

[0015] 23) Import the obtained random base sequence into NCBI for comparison, and it is okay if there is no identical or similar sequence.

[0016] Among them, the random sequence can be one identical random sequence or multiple different random sequences.

[0017] Among them, the lengths of the wild-type gene sequence, the mutant gene sequence, the quantitative sequence, and the random sequence are all 20-500 bp, and the ratio of the wild-type gene sequence to the mutant gene sequence is 0.01:1 to 100:1.

[0018] Among them, the ratio of the wild-type gene sequence to the mutant gene sequence is 1:1, 1:2, 2:1, or 3:1.

[0019] The content of the present invention also includes the mutant gene reference product obtained by the preparation method described above.

[0020] Among them, the mutant gene reference product includes a sequence fragment synthesized artificially. The sequence fragment includes n combinations of mutant gene sequences. The n combinations of mutant gene sequences include n wild-type gene sequences, n mutant gene sequences, a random sequence, and one quantitative sequence. The wild-type gene sequence and the mutant gene sequence are connected by a random sequence.

[0021] The content of the present invention also includes the application of the mutant gene reference product described above in the preparation of a control product or a quality control product for a kit.

[0022] The content of the present invention also includes a kit including the mutant gene reference product described above.

[0023] Among them, the kit also includes a nucleic acid protector. The nucleic acid protector includes one or several of trehalose, Tris-HCl, ethylenediaminetetraacetic acid, sorbitol, glycine, glutamine, or sodium fluoride.

[0024] Among them, the kit also includes a diluent. The diluent is purified water or TE buffer.

[0025] The method for quantifying the synthesized mutant gene reference product of the present invention can be directly diluted according to the theoretical molecular weight, or can be carried out by a fluorescence quantitative PCR method. The quantification method can use different concentrations of the gene to be detected with the quantitative sequence as the amplification target, and perform quantification after making a calibration curve.

[0026] As an implementation method, when only one site of the mutant sequence is mutated and the ratio of the corresponding mutant gene sequence to the wild-type gene sequence is 2:1, only one group of the sequence fragments needs to be designed, which sequentially includes a wild-type gene sequence, a random sequence 1, a mutant gene sequence, a random sequence 2, a mutant gene sequence, and a quantitative sequence connected.

[0027] As an implementation, when two sites of the mutant sequence are mutated, two sets of the sequence fragments need to be designed. When the ratio of the corresponding mutated gene sequence to the wild-type gene sequence is 2:1, the sequence fragment includes a first set of mutation combinations and a second set of mutation combinations, and the first set of mutation combinations and the second set of mutation combinations are connected by a random sequence; the entire sequence fragment sequentially includes wild-type gene sequence 1, random sequence 1, mutant gene sequence 1, random sequence 2, mutant gene sequence 1, random sequence 3, wild-type gene sequence 2, random sequence 4, mutant gene sequence 2, random sequence 5, mutant gene sequence 2, and a quantification sequence connected.

[0028] As an implementation, when 100 sites of the mutant sequence are mutated, 100 sets of the sequence fragments need to be designed. When the ratio of the corresponding mutated gene sequence to the wild-type gene sequence is 2:1, the sequence fragment includes a first set of mutation combinations, a second set of mutation combinations, a third set of mutation combinations... up to the 100th set of mutation combinations, and the first set of mutation combinations, the second set of mutation combinations... up to the 100th set of mutation combinations are connected by a random sequence; the entire sequence fragment sequentially includes wild-type gene sequence 1, random sequence 1, mutant gene sequence 1, random sequence 2, mutant gene sequence 1, random sequence 3, wild-type gene sequence 2, random sequence 4, mutant gene sequence 2, random sequence 5, mutant gene sequence 2, random sequence 6, wild-type gene sequence 3, random sequence 7, mutant gene sequence 3, random sequence 8, mutant gene sequence 3,... mutant gene sequence 100 and a quantification sequence connected.

[0029] As an implementation, when n sites of the mutant sequence are mutated, n sets of the sequence fragments need to be designed. When the ratio of the corresponding mutated gene sequence to the wild-type gene sequence is 2:1, the sequence fragment includes a first set of mutation combinations, a second set of mutation combinations... up to the nth set of mutation combinations, and the first set of mutation combinations, the second set of mutation combinations... the nth set of mutation combinations are respectively connected by a random sequence; the entire sequence fragment sequentially includes wild-type gene sequence 1, random sequence 1, mutant gene sequence 1, random sequence 2, mutant gene sequence 1, random sequence 3, wild-type gene sequence 2, random sequence 4, mutant gene sequence 2, random sequence 5, mutant gene sequence 2,... mutant gene sequence n and a quantification sequence connected.

[0030] The key to this method lies in the design of the sequence, that is, the wild sequence and the mutant sequence are designed on the same sequence at the same time, and random sequences or sequences similar to the target reference sequence are used to fill the gaps between the sequences; by designing the number of repetitions of the wild sequence and the mutant sequence on the total sequence, the mixing ratio of the wild and mutant sequences is controlled. Make the theoretically required ratio exactly the same as the actual mixing ratio. At the same time, if the reference product degrades, it will not affect the mixing ratio. In addition, a quantitative sequence is designed on this sequence, which can be associated and compared with real samples through fluorescence quantitative PCR, so as to achieve the purpose of quantifying the entire fragment. After the sequence is designed and synthesized, it can be used directly by simply diluting according to the theoretical calculation. Of course, in order to increase the stability of the reference product, nucleic acid components such as genomic DNA can also be added, or substances such as nucleic acid protectants can be added thereto.

[0031] Advantages: Compared with the prior art, the present invention has the following remarkable advantages: by designing one or more groups of wild sequences and mutant sequences on the same sequence and separating them with irrelevant sequences in the middle, the theoretical ratio of wild / mutant sequences can be made exactly the same as the actual ratio, and the errors and risks caused by nucleic acid degradation can be effectively avoided. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The situation of degradation when the mutant gene in the prior art is synthesized into the whole genome in the form of a plasmid and mixed to prepare a reference product;

[0033] Figure 2 This sequence design is for a heterozygous genome containing one mutant gene locus, where the ratio of wild and mutant genes is 1:2, and a quantitative sequence is included to monitor or control the concentration or degradation degree of the overall reference product;

[0034] Figure 3 This sequence design is for a sequence designed for two mutant gene loci, and the ratio of wild and mutant genes at each locus is 1:2, and a quantitative sequence is included;

[0035] Figure 4 This figure is the fluorescence quantitative PCR amplification curve of the real reference product;

[0036] Figure 5 This figure is the fluorescence quantitative PCR amplification curve of the synthetic reference product;

[0037] Figure 6 This figure is the change of the CT value of the stability of the synthetic reference product;

[0038] Figure 7 This figure is the change of the CT value of the stability of the real sample. DETAILED DESCRIPTION OF THE INVENTION

[0039] The technical solution of the present invention will be described in detail below with reference to examples.

[0040] Example 1 Preparation of a reference product for the gene sequence of a single mutation site

[0041] In this example, it is intended to prepare a human genomic reference product containing a hepatitis B drug-resistant mutation gene site (GenBank ACCESSION: OK274310.1), with the wild gene ratio and the mutant gene ratio being 1:2, and simultaneously carrying a quantitative sequence, using the following Figure 2 scheme. The real sample in this example is the human genomic DNA extracted from the whole blood of a hepatitis B patient whose gene mutation has been confirmed by the company.

[0042] In Figure 2 , the wild-type gene sequence selected in this example is as follows:

[0043]

[0044] The mutant gene sequence is as follows:

[0045]

[0046] Among them, two random sequences are generated by randomly generating a lot of random numbers from 1 to 4 in Excel, and the formula is INT(RAND()*4+1); then 1, 2, 3, and 4 are respectively replaced by A, T, C, and G, and connected to form a random base sequence, and compared on NCBI. After querying in the existing database and finding no similar sequences, the following two random sequences are screened out:

[0047] Random sequence 1: GTTAGGGTCGCGCCAAACTCTCC

[0048] Random sequence 2: GTTGGCTAGGAACTGCAAGCAC

[0049] The quantitative sequence is a conserved sequence, without mutation sites on the upstream and downstream primers, used to control the concentration of the reference product, and its quantitative sequence is:

[0050]

[0051] Based on the above, the total sequence is designed as follows:

[0052] (Wild sequence) (Random sequence 1)

[0053] (Mutated sequence) (Random sequence 2)

[0054] (Mutated sequence)

[0055] (Quantitative sequence);

[0056] Shanghai GeneCreate Biological Engineering Co., Ltd. is responsible for plasmid synthesis.

[0057] After synthesis, it becomes the reference product for this mutation site. After dilution at a certain ratio (generally a dilution ratio of 100,000 times), it can be detected using a commercial kit.

[0058] In the kit, the upstream and downstream amplification primer sequences are as follows:

[0059] Upstream primer: GAGTGGGCCTCAGTCC;

[0060] Downstream primer: CCTGGTGGCTCCAGTTC;

[0061] Quantitative probe: FAM-TCAGTGGTTCG-MGB;

[0062] Mutation probe: VIC-CACATGGCTCA-MGB;

[0063] The amplification system formula is shown in Table 1:

[0064] Table 1

[0065]

[0066]

[0067] The sample loading system during detection is shown in Table 2:

[0068] Table 2

[0069]

[0070] The amplification program is shown in Table 3:

[0071] Table 3

[0072]

[0073] The amplification curve graph is as shown in Figure 4 and Figure 5As shown, the reference product designed by this method can simulate real samples.

[0074] At the same time, stability tests were carried out on this reference product. It was continuously placed at room temperature for one and a half months, measured once a week, and real clinical samples with mutation sites were brought along for comparison at the same time. Curve graphs were made respectively, as Figure 6 and 7 . It was found that when fluorescence quantitative PCR tests were carried out on this synthetic reference product and real samples, the CT values of both increased, indicating that there was a certain degree of degradation of nucleic acids. However, both showed the same degradation curve, and the overall increasing trend of the ratio of the quantitative sequence to the mutant sequence was also basically the same, indicating that the ratio of the mutant sequence in the reference product was relatively stable, consistent with the real reference product. (If the method of mixing synthetic plasmids with wild samples is used, the CT values of the quantitative sequence and the mutant sequence will deviate.)

[0075] Therefore, the reference product synthesized using this design idea can replace the real reference product, and the synthetic reference product is superior to the real reference product in terms of stability due to the addition of stabilizers, protectants, etc.

[0076] Preparation of a reference product for the gene sequences of two mutation sites in Example 2

[0077] Based on Example 1, in this example, a human genome reference product with one hepatitis B drug resistance mutation gene site increased to two mutation gene sites, and the wild gene ratio and mutant gene ratio were both 1:2, and it also carried a quantitative sequence, using the scheme as Figure 3 shown.

[0078] In Figure 3 , the two wild sequences are as follows:

[0079] Wild gene sequence 1:

[0080]

[0081] Wild gene sequence 2:

[0082]

[0083] The mutant sequences corresponding to the two wild sequences are as follows:

[0084] Mutant gene sequence 1:

[0085]

[0086] Mutant gene sequence 2:

[0087]

[0088] Among them, two random sequences were automatically generated by Excel using the method of Example 1 and compared on NCBI. No similar sequences were found in the existing database, and the following were generated:

[0089] Random sequence 1: GTTAGGGTCGCGCCAAACTCTCC

[0090] Random sequence 2: GTTGGCTAGGAACTGCAAGCAC

[0091] Random sequence 3: GCATAGACGTGGCTCAACTGTC

[0092] Random sequence 4: AGCTAGACCACTCAGCAGACTG

[0093] Random sequence 5: CCGACTCTTACGCTCCTACC

[0094] The quantitative sequence is a conserved sequence with no mutation sites on both the upstream and downstream primers, used to control the concentration of the reference product. Its quantitative sequence is:

[0095]

[0096] Based on the above, the total sequence is designed as follows:

[0097] (Wild sequence 1) (Random sequence 1) (Mutant sequence 1) (Random sequence 2) (Mutant sequence 2) (Random sequence 3)

[0098] (Wild sequence 2) (Random sequence 4)

[0099] (Mutant sequence 2) (Random sequence 5)

[0100] (Mutant sequence 2)

[0101] (Quantitative sequence)

[0102] The above is the design scheme of the sequences of multiple mutation sites. The subsequent detection process and detection results are similar to those in Example 1 and will not be elaborated here. Sequence Listing <110> Wuxi Boao Maya Medical Technology Co., Ltd. <120> Preparation Method, Product and Application of a Mutant Gene Reference <160> 21 <170> SIPOSequenceListing 1.0 <210> 1 <211> 111 <212> DNA <213> Wild-type gene sequence (Artificial Sequence) <400> 1 tatgggagtg ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg t 111 <210> 2 <211> 111 <212> DNA <213> Mutant gene sequence (Artificial Sequence) <400> 2 tatgggagtg ggcctcagtc cgtttcacat ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg t 111 <210> 3 <211> 23 <212> DNA <213> Random sequence (Artificial Sequence) <400> 3 gttagggtcg cgccaaactc tcc 23 <210> 4 <211> 22 <212> DNA <213> Random Sequence (Artificial Sequence) <400> 4 gttggctagg aactgcaagc ac 22 <210> 5 <211> 164 <212> DNA <213> Quantitative Sequence (Artificial Sequence) <400> 5 aaattgcact tgtattccca tcccatcatc ttgggctttc gcaaaattcc tatgggagtg 60 ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt ggttcgtagg 120 gctttccccc actgtttggc tttcagttat atggatgatg tggt 164 <210> 6 <211> 542 <212> DNA <213> Total Sequence (Artificial Sequence) <400> 6 tatgggagtg ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg tgttagggtc 120 gcgccaaact ctcctatggg agtgggcctc agtccgtttc acatggctca gtttactagt 180 gccatttgtt cagtggttcg tagggctttc ccccactgtt tggctttcag ttatatggat 240 gatgtgttgg ctaggaactg caagcactat gggagtgggc ctcagtccgt ttcacatggc 300 tcagtttact agtgccattt gttcagtggt tcgtagggct ttcccccact gtttggcttt 360 cagttatatg gatgatgtaa attgcacttg tattcccatc ccatcatctt gggctttcgc 420 aaaattccta tgggagtggg cctcagtccg tttctcctgg ctcagtttac tagtgccatt 480 tgttcagtgg ttcgtagggc tttcccccac tgtttggctt tcagttatat ggatgatgtg 540 gt 542 <210> 7 <211> 16 <212> DNA <213> Upstream Primer (Artificial Sequence) <400> 7 gagtgggcct cagtcc 16 <210> 8 <211> 17 <212> DNA <213> Downstream Primer (Artificial Sequence) <400> 8 cctggtggct ccagttc 17 <210> 9 <211> 11 <212> DNA <213> Quantitative Probe (Artificial Sequence) <400> 9 tcagtggttc g 11 <210> 10 <211> 11 <212> DNA <213> Variable Probe (Artificial Sequence) <400> 10 cacatggctc a 11 <210> 11 <211> 111 <212> DNA <213> Artificial Sequence of Wild Gene Sequence 1 <400> 11 tatgggagtg ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg t 111 <210> 12 <211> 237 <212> DNA <213> Artificial Sequence of Wild Gene Sequence 2 <400> 12 tctgcggcgt tttatcatct tcctccgcat cctgctgcta tgcctcatct tcttgttggt 60 tcttctggac tatcaaggta tgttgcccgt ttgtcctcta attccaggat catcaacaac 120 cagcaccgga ccatgcaaaa cctgcacaac tcctgctcaa ggaacctcta tgtttccctc 180 atgttgctgt acaaaaccta cggacggaaa ctgcacctgt attcccatcc catcatc 237 <210> 13 <211> 111 <212> DNA <213> Artificial Sequence of Mutated Gene Sequence 1 <400> 13 tatgggagtg ggcctcagtc cgtttcacat ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg t 111 <210> 14 <211> 237 <212> DNA <213> Mutant gene sequence 2 (Artificial Sequence) <400> 14 tctgcggcgt tttatcatct tcctccccat cctgctgcta tgcctcatct tcttgttggt 60 tcttctggac tatcaaggta tgttgcccgt ttgtcctcta attccaggat catcaacaac 120 cagcaccgga ccatgcaaaa cctgcacaac tcctgctcaa ggaacctcta tgtttccctc 180 atgttgctgt acaaaaccta cggacggaaa ctgcacctgt attcccatcc catcatc 237 <210> 15 <211> 23 <212> DNA <213> Random sequence 1 (Artificial Sequence) <400> 15 gttagggtcg cgccaaactc tcc 23 <210> 16 <211> 22 <212> DNA <213> Random sequence 2 (Artificial Sequence) <400> 16 gttggctagg aactgcaagc ac 22 <210> 17 <211> 22 <212> DNA <213> Random Sequence 3 (Artificial Sequence) <400> 17 gcatagacgt ggctcaactg tc 22 <210> 18 <211> 22 <212> DNA <213> Random Sequence 4 (Artificial Sequence) <400> 18 agctagacca ctcagcagac tg 22 <210> 19 <211> 20 <212> DNA <213> Random Sequence 5 (Artificial Sequence) <400> 19 ccgactctta cgctcctacc 20 <210> 20 <211> 164 <212> DNA <213> Quantitative Sequence (Artificial Sequence) <400> 20 aaattgcact tgtattccca tcccatcatc ttgggctttc gcaaaattcc tatgggagtg 60 ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt ggttcgtagg 120 gctttccccc actgtttggc tttcagttat atggatgatg tggt 164 <210> 21 <211> 1317 <212> DNA <213> Total Sequence (Artificial Sequence) <400> 21 tatgggagtg ggcctcagtc cgtttctcct ggctcagttt actagtgcca tttgttcagt 60 ggttcgtagg gctttccccc actgtttggc tttcagttat atggatgatg tgttagggtc 120 gcgccaaact ctcctatggg agtgggcctc agtccgtttc acatggctca gtttactagt 180 gccatttgtt cagtggttcg tagggctttc ccccactgtt tggctttcag ttatatggat 240 gatgtgttgg ctaggaactg caagcactat gggagtgggc ctcagtccgt ttcacatggc 300 tcagtttact agtgccattt gttcagtggt tcgtagggct ttcccccact gtttggcttt 360 cagttatatg gatgatgtgc atagacgtgg ctcaactgtc tctgcggcgt tttatcatct 420 tcctccgcat cctgctgcta tgcctcatct tcttgttggt tcttctggac tatcaaggta 480 tgttgcccgt ttgtcctcta attccaggat catcaacaac cagcaccgga ccatgcaaaa 540 cctgcacaac tcctgctcaa ggaacctcta tgtttccctc atgttgctgt acaaaaccta 600 cggacggaaa ctgcacctgt attcccatcc catcatcagc tagaccactc agcagactgt 660 ctgcggcgtt ttatcatctt cctccccatc ctgctgctat gcctcatctt cttgttggtt 720 cttctggact atcaaggtat gttgcccgtt tgtcctctaa ttccaggatc atcaacaacc 780 agcaccggac catgcaaaac ctgcacaact cctgctcaag gaacctctat gtttccctca 840 tgttgctgta caaaacctac ggacggaaac tgcacctgta ttcccatccc atcatcccga 900 ctcttacgct cctacctctg cggcgtttta tcatcttcct ccccatcctg ctgctatgcc 960 tcatcttctt gttggttctt ctggactatc aaggtatgtt gcccgtttgt cctctaattc 1020 caggatcatc aacaaccagc accggaccat gcaaaacctg cacaactcct gctcaaggaa 1080 cctctatgtt tccctcatgt tgctgtacaa aacctacgga cggaaactgc acctgtattc 1140 ccatcccatc atcaaattgc acttgtattc ccatcccatc atcttgggct ttcgcaaaat 1200 tcctatggga gtgggcctca gtccgtttct cctggctcag tttactagtg ccatttgttc 1260 agtggttcgt agggctttcc cccactgttt ggctttcagt tatatggatg atgtggt 1317

Claims

1. A method for preparing a mutant gene reference product, characterized in that, It includes the following steps: 1) When the number of mutation sites of the gene to be tested is n, n mutant gene fragments of the gene sequence containing n mutation sites are used as n mutant gene sequences, and the corresponding n wild-type gene fragments are used as n wild-type gene sequences; where n is a natural number from 1 to 100; 2) Obtaining of random sequences: The random sequences are irrelevant sequences, including human genome sequences, microbial genome sequences, or other sequences that do not interfere with wild-type and mutant genes; 3) Selection of quantitative sequences: The quantitative sequence is a conserved sequence without mutation sites on the genome corresponding to the gene to be tested; 4) n sequence fragments are designed by spacing n wild-type gene sequences, n mutant gene sequences, and random sequences in turn, and the n sequence fragments are connected by random sequences to obtain a sequence, and 1 quantitative sequence is connected at the end of the sequence to obtain a mutant gene reference product; The ratio of the wild-type gene sequence to the mutant gene sequence is 1:

2.

2. The preparation method of the mutant gene reference product according to claim 1, characterized in that, The obtaining method of the random sequence in step 2) is as follows: 21) Use excel to randomly generate multiple random numbers from 1 to 4, and the formula is INT(RAND()*4+1); 22) Then replace 1, 2, 3, and 4 with A, T, C, and G respectively, and connect them to form a random base sequence; 23) Import the obtained random base sequence into the NCBI database for comparison, and it is okay if there are no identical or similar sequences.

3. The preparation method of the mutant gene reference product according to claim 1, wherein The lengths of the wild-type gene sequence, the mutant gene sequence, the quantitative sequence, and the random sequence are all 20 - 500 bp.

4. A mutant gene reference product obtained by the preparation method according to any one of claims 1 to 3.

5. The mutant gene reference product according to claim 4, wherein The mutant gene reference product includes a synthetic sequence fragment, and the sequence fragment includes n mutant gene sequence combinations. The n mutant gene sequence combinations include n wild-type gene sequences, n mutant gene sequences, random sequences, and 1 quantitative sequence. The wild-type gene sequences and the mutant gene sequences are connected by random sequences, and the ratio of the wild-type gene sequence to the mutant gene sequence is 1:

2.

6. Use of the mutant gene reference product according to claim 4 or 5 in the preparation of a control product or a quality control product for a kit.

7. A kit, characterized in that, It includes the mutant gene reference product according to claim 4 or 5.

8. The kit according to claim 7, characterized in that The kit further includes a nucleic acid protectant, and the nucleic acid protectant includes one or more of trehalose, Tris-HCl, ethylenediaminetetraacetic acid, sorbitol, glycine, glutamine, or sodium fluoride.

9. The kit according to claim 7, characterized in that, The kit further includes a diluent, and the diluent is purified water or TE buffer.

Images