Prame tcr receptors and uses thereof

Abstract

The present invention relates to T cell receptors (TCRs) capable of binding to PRAME peptides having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) or a portion thereof or its HLA-A2 binding form. The present invention also includes nucleic acids encoding the TCRs, vectors comprising the nucleic acids and host cells comprising the TCRs, the nucleic acid sequences or the vectors. Also included are methods of obtaining the TCRs described herein, pharmaceutical or diagnostic compositions and methods of detecting the presence of cancer in a subject in vitro. Furthermore, the present invention relates to the use of the TCRs, nucleic acids and / or vectors for the production of modified lymphocytes.

Description

TECHNICAL FIELD

[0001] The present invention relates to T cell receptors (TCRs) capable of binding to PRAME peptides having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) or a portion thereof or its HLA-A2 binding form. The present invention also includes nucleic acids encoding the TCRs, vectors comprising the nucleic acids and host cells comprising the TCRs, the nucleic acid sequences or the vectors. Also included are methods of obtaining the TCRs described herein; pharmaceutical or diagnostic compositions comprising the TCRs, the nucleic acids, the vectors and / or the host cells; and methods of detecting the presence of cancer in a subject in vitro comprising the TCRs, the host cells and / or the pharmaceutical compositions. Furthermore, the present invention relates to the use of the TCRs, the nucleic acids and / or the vectors for the production of modified lymphocytes. BACKGROUND

[0002] T lymphocytes (or T cells), which form part of the cell-mediated immune system, play an important role in eradicating pathogens. T cells develop in the thymus and express T cell receptor molecules on their surface, allowing the recognition of peptides (antigen presentation) presented on major histocompatibility complex (MHC) molecules expressed on nucleated cells. Antigens of pathogens, i.e. foreign antigens presented by MHC molecules, will elicit a strong T cell response, whereas self-antigens usually do not lead to a T cell response because of the negative selection of T cells specific for self-antigens in the thymus during their development. Thus, the immune system can distinguish between nucleated cells presenting foreign or self-antigens and specifically target and eradicate infected cells by potent cytokine release and cytotoxic mechanisms of T cells.

[0003] The ability of the immune system has been recognized as a promising tool for future cancer therapy. Over the past decade, research has begun to exploit the unique properties of T cells by using adoptive cell transfer (ACT), which involves the administration of ex vivo expanded donor-derived lymphocytes. ACT is an attractive concept for the treatment of cancer, as it does not require the patient's immune competence, and the specificity of the transferred lymphocytes can target non-mutated and thus poorly immunogenic tumor antigens that are usually unable to trigger an effective self-T cell response. Although ACT has shown to be a promising treatment for various types of cancer, its widespread use as a clinical treatment is hampered by the need for custom isolation and characterization of tumor-specific T cells from each patient, a process that can be difficult and time-consuming and also often fails to yield high-affinity T cells (Xue et al., Clin Exp Immunol. 2005 Feb; 139(2): 167-172; Schmitt et al., Hum Gene Ther. 2009 Nov; 20(11): 1240-1248).

[0004] Genetic transfer of tumor antigen-specific T cell receptors (TCRs) to primary T cells can overcome some of the current limitations of ACT, as it allows for the rapid generation of tumor-reactive T lymphocytes with defined antigen specificity, even in immunocompromised patients. However, the identification of suitable T cell clones carrying TCRs that specifically recognize tumor antigens and exhibit the desired anti-tumor effects in vivo remains a subject of ongoing research. Given that approximately 14.1 million new cancer cases occurred worldwide in 2012 and cancer is currently the cause of about 14.6% of all human deaths worldwide, there is an urgent need for novel and efficient treatment options. It is an object of the present invention to meet the aforementioned needs.

[0005] PRAME is a tumor-associated antigen that is expressed in numerous tumors, preferably melanoma. Furthermore, PRAME has been described as an independent biomarker for metastasis, such as uveal melanoma (Fiedl et al., Clin Cancer Res 2016 Mar; 22(5): 1234-1242) and as a prognostic marker for DLBCL (Mitsuhashi et al., Hematology 2014, 1 / 2014). It is not expressed in normal tissues except testis. This expression pattern is similar to that of other cancer testis (CT) antigens such as MAGE, BAGE, GAGE. However, unlike these other CT antigens, this gene is also expressed in acute leukemias. The encoded protein serves as a repressor for retinoic acid receptors and can confer a growth advantage to cancer cells through this function. Alternative splicing selects leads to multiple transcript variants. Overexpression of PRAME in triple-negative breast cancer has also been found to promote cancer cell motility by inducing epithelial-to-mesenchymal transition (Al-Khadairi et al., Journal of Translational Medicine 2019; 17:9). Deletion of PRAME has been reported in chronic lymphocytic leukemia, however, this is not functionally relevant as the gene is not expressed in B cells and the deletion is a result of physiological immunoglobulin light chain rearrangement. SUMMARY

[0006] The present invention relates to novel T cell receptors (TCRs) capable of specifically recognizing the tumor-associated antigen PRAME. In particular, the identified TCRs specifically recognize the PRAME amino acid sequence SLLQHLIGL, also referred to herein as PRAME SLLPeptides. The present invention is based at least in part on the surprising finding that the isolated T cell receptor binding to a specific PRAME peptide has outstanding properties when compared to PRAME TCRs known in the prior art. In particular, the T cell receptor of the present invention capable of binding to the PRAME peptide SLLQHLIGL also provides high functional avidity as well as advantageous tumor cell recognition and killing properties. In contrast, the TCR does not recognize normal cells and irrelevant peptides. Furthermore, the T cell receptor recognizes peptides presented on HLA molecules (human leukocyte antigen, HLA) and in particular on HLA molecules encoded by the HLA suballeles HLA-A*02:01, HLA-A*02:02 and HLA-A*02:04, even allowing the treatment of cancer patients expressing the less frequent PRAME SLL presenting PRAME

[0007] In a first aspect, the present invention relates to a T cell receptor (TCR) capable of binding to a PRAME peptide having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1 ) or a part thereof or its HLA-A2 binding form, wherein the TCR comprises:

[0008] In another aspect, the present invention relates to a T cell receptor (TCR) capable of binding to a PRAME peptide having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1 ) or a part thereof or its HLA-A2 binding form, wherein the TCR comprises:

[0009] a) a CDR3 of a TCR a chain variable region comprising the amino acid sequence (SEQ ID NO: 6) or an amino acid sequence being at least 80% identical, preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 6, or consisting of said amino acid sequence; a CDR1 of a TCR a chain variable region comprising the amino acid sequence SEQ ID NO: 2 or consisting of said amino acid sequence, and a CDR2 of a TCR a chain variable region comprising the amino acid sequence SEQ ID NO: 4 or consisting of said amino acid sequence; and

[0010] b) a CDR3 of a TCR beta chain variable region comprising or consisting of the amino acid sequence (SEQ ID NO: 7) or an amino acid sequence that has at least 80% identity, preferably at least 85% identity, more preferably 90% or 95% identity with SEQ ID NO: 7; a CDR1 of a TCR beta chain variable region comprising or consisting of the amino acid sequence SEQ ID NO: 3; and a CDR2 of a TCR beta chain variable region comprising or consisting of the amino acid sequence SEQ ID NO: 5.

[0011] It is envisaged that HLA-A2 is an HLA-A*02:01, HLA-A*02:02 or HLA-A*02:04 encoding molecule.

[0012] In particular, it is envisaged that binding of the TCR to the sequence SLLQHLIGL (SEQ ID NO: 1 ) or a preferred functional part thereof or its HLA-A2 bound form induces IFN-g secretion by the cell transduced or transfected with the TCR.

[0013] Preferably, the half maximal relative IFN-g secretion (EC 50 value) is less than 10 - 7 M.

[0014] It is also envisaged that the TCR of the application comprises:

[0015] a) a TCR alpha chain comprising a CDR1 having the amino acid sequence SEQ ID NO: 2, a CDR2 having the amino acid sequence SEQ ID NO: 4 and a CDR3 having the amino acid sequence SEQ ID NO: 6, and / or

[0016] b) a TCR beta chain comprising a CDR1 having the amino acid sequence SEQ ID NO: 3, a CDR2 having the amino acid sequence SEQ ID NO: 5 and a CDR3 having the amino acid sequence SEQ ID NO: 7.

[0017] In view of the present application, the TCR mentioned herein can comprise a TCR alpha chain variable region comprising or consisting of the amino acid sequence SEQ ID NO: 8 and / or a TCR beta chain variable region comprising or consisting of the amino acid sequence SEQ ID NO: 9.

[0018] It is also envisaged that the TCR of the application comprises a TCR alpha chain constant region and / or a TCR beta chain constant region.

[0019] Preferably, the TCR of the application comprises

[0020] a) a TCR a chain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10; or an amino acid sequence which is at least 80% identical, preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 10, or which consists of said amino acid sequence; and / or

[0021] b) a TCR b chain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 11; or an amino acid sequence which is at least 80% identical, preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 11, or which consists of said amino acid sequence.

[0022] It is also envisaged that the TCR of the application comprises at least one TCR a chain and at least one TCR b chain which are covalently linked to each other to form a TCR heterodimer or multimer.

[0023] In view of the present application, it is envisaged that the TCR mentioned herein can be selected from an initial TCR, a TCR variant, a TCR fragment or a TCR construct.

[0024] In some embodiments, the TCR of the application comprises one or more fusion components optionally selected from the group consisting of: an Fc receptor; an Fc domain, including IgA, IgD, IgG, IgE and IgM; a cytokine, including IL-2 or IL-15; a toxin; an antibody or antigen binding fragment thereof, including an anti-CD3, anti-CD28, anti-CDS, anti-CD16 or anti-CD56 antibody or antigen binding fragment thereof; a CD247 (CD3-zeta), CD28, CD137 or CD134 domain, or a combination thereof, optionally further comprising at least one linker.

[0025] The TCR mentioned herein preferably comprises at least one TCR a chain as defined herein; and / or at least one TCR b chain as defined herein; and / or an antibody or single chain antibody fragment (scFv) directed against an antigen or epitope on the surface of a lymphocyte, wherein the TCR a chain and the TCR b chain are linked to each other and optionally fused to said antibody or scFv via a linker. The antigen can be selected from the group consisting of CD3, CD28, CD5, CD16 or CD56.

[0026] The TCR of the application preferably comprises at least one molecular tag. Preferably, the TCR of the application is soluble.

[0027] In another aspect, the present application relates to a nucleic acid encoding the TCR mentioned herein.

[0028] The nucleic acid can comprise the nucleic acid sequence of SEQ ID NO: 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.

[0029] In another aspect, the present application relates to a vector comprising a nucleic acid as defined herein.

[0030] In another aspect, the present application relates to a host cell comprising a TCR as defined herein, a nucleic acid sequence as defined herein or a vector as defined herein. The host cell can be selected from the group consisting of a lymphocyte, including but not limited to a cytotoxic T lymphocyte (CTL), a CD8+ T cell, a CD4+ T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, a gamma / delta-T cell.

[0031] In another aspect, the present application relates to a method of obtaining a TCR as defined herein, wherein the method comprises incubating a host cell as defined herein under conditions that cause the TCR to be expressed, and purifying the TCR.

[0032] In another aspect, the present application relates to a pharmaceutical or diagnostic composition comprising one or more of: a TCR as defined herein; a nucleic acid as defined herein; a vector as defined herein; and / or a host cell as defined herein, and optionally a pharmaceutical excipient. The pharmaceutical composition can further comprise a checkpoint inhibitor. The checkpoint inhibitor can be selected from the group consisting of a CTLA-4 inhibitor, a PD-1 inhibitor and a PD-L1 inhibitor, a LAG3, ICOS, TIM3, VISTA and CEACAM1 inhibitor.

[0033] In another aspect, the present application relates to a TCR as defined herein, a nucleic acid as defined herein, a vector as defined herein and / or a host cell as defined herein for use as a medicament. Preferably, the use is in the detection, diagnosis, prognosis, prevention and / or treatment of cancer. In this respect, it is envisaged that the cancer is selected from the group consisting of melanoma, bladder cancer, colon and breast cancer, sarcoma, prostate cancer, uterine cancer, uveal cancer, uveal melanoma, squamous head and neck cancer, synovial cancer, Ewing’s sarcoma, triple negative breast cancer, thyroid cancer, testicular cancer, kidney cancer, pancreatic cancer, ovarian cancer, esophageal cancer, non-small cell lung cancer, non-Hodgkin’s lymphoma, multiple myeloma, melanoma, hepatocellular carcinoma, head and neck cancer, gastric cancer, endometrial cancer, colorectal cancer, biliary tract cancer, breast cancer, bladder cancer, myeloid leukemia and acute lymphoblastic leukemia, preferably wherein the cancer is selected from the group consisting of NSCLC, SCLC, breast cancer, ovarian cancer or colorectal cancer, sarcoma or osteosarcoma.

[0034] Furthermore, it is envisaged that the use of a TCR, nucleic acid, vector and / or host cell as defined herein in the prevention and / or treatment of cancer comprises:

[0035] (a) providing one or more of: (i) a TCR described elsewhere herein; (ii) a nucleic acid described elsewhere herein; (iii) a vector described elsewhere herein; (iv) a host cell described elsewhere herein; and (v) a pharmaceutical composition described elsewhere herein; and

[0036] (b) administering at least one of (i) to (v) to a subject in need thereof.

[0037] Preferably, the TCR, nucleic acid, vector and / or host cell for use in the prevention and / or treatment of cancer as defined herein comprises:

[0038] (a) providing a sample of a subject, the sample comprising lymphocytes;

[0039] (b) providing one or more of: (i) a TCR described elsewhere herein; (ii) a nucleic acid described elsewhere herein; (iii) a vector described elsewhere herein; (iv) a host cell described elsewhere herein; and (v) a pharmaceutical composition described elsewhere herein;

[0040] (c) introducing one or more of (i) to (v) of step (b) into the lymphocytes of step (b), thereby obtaining modified lymphocytes,

[0041] (d) administering the modified lymphocytes of step (c) to a subject or patient in need thereof.

[0042] In another aspect, the present application relates to a method of detecting the presence of a cancer in a subject in vitro, the method comprising:

[0043] (a) providing a sample of a subject, the sample comprising one or more cells;

[0044] (b) contacting the sample with: (i) a TCR described elsewhere herein; (ii) a host cell described elsewhere herein; and / or (iii) a pharmaceutical composition described elsewhere herein; thereby forming a complex, and

[0045] (c) detecting the complex, wherein detection of the complex is indicative of the presence of a cancer in the subject.

[0046] In another aspect, the present application relates to the use of a TCR as defined herein, a nucleic acid as defined herein and / or a vector as defined herein for the production of a modified lymphocyte. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1Peptide specificity. T2 cells were loaded with either a specific SLL (SLLQHLIGL) or an unrelated peptide (GLSNTHVL). These cells were then co-cultured with TCR-transduced T cells. After 20 hours, IFN-γ levels in the cell culture supernatant were measured using an IFN-γ ELISA. When loaded onto T2 cells, all TCR-transduced effector TCRs, except for the negative control TCR, showed recognition of the specific SLL peptide but not the unrelated peptide.

[0048] Figure 2 Functional affinity. The functional affinity of TCR transgenic T cell populations was measured by loading a titer of SLL peptide (10... -5 M to 10 -12 Half-maximal relative IFN-γ release (EC50) in co-cultures of T2 cells (M) 50 Cells transduced with TCR027-004 showed higher functional affinity than T cells transduced with TCR 3825.

[0049] Figure 3 A and Figure 3 B: TCR recognition motif (serine scan). Effector: TCR-transduced T cells with an E:T ratio of 1:1 (10,000 effector cells / 96 wells) loaded with 10 -5 In vitro co-culture of M peptide with T2 cells. For this purpose, T2 cells were loaded with a peptide that changed only at one amino acid position, where the amino acid was continuously substituted by serine residues. This was compared with T cells transduced from TCR clone 3825. Figure 3 Compared to B), T cells transduced with TCR 027-004TCR ( Figure 3 A) Shows different identification motifs with fewer fixed positions.

[0050] Figure 4 Tumor cell recognition. Both TCR-transduced T cell populations (transduced with TCR 027-004 or 3825) recognized PRAME. SLL Positive tumor cell line. Compared with 3825 TCR-transduced T cells, 027-004 TCR-transduced T cells showed greater activity against PRAME. SLL Positive cell lines showed higher recognition rates. None of the tested TCRs recognized PRAME. SLL Negative tumor cells.

[0051] Figure 5 Tumor cell killing. All TCR-transduced effector cells lysed PRAME. SLL Positive (PRAME-pos) tumor cells, and without affecting PRAME. SLLGrowth of negative tumor cells (PRAME-neg). Effector cells transduced with TCR 027-004 show better PRAME SLL Positive cell line killing.

[0052] Figure 6 Normal cell recognition. TCR transduced T cell populations do not recognize un-loaded normal cells, secreting high levels of IFN-g. However, if the cells are loaded with the specific PRAME SLL peptide, they are recognized by TCR 027-004. Co-culture with the un-loaded cell line RPTEC (endogenous PRAME positive cell line) only generates minimal IFN-g in both effector preparations.

[0053] Figure 7 HLA-A*02 allele frequency. Allele frequency in the US / European Caucasian population (http: / / www.allelefrequencies.net).

[0054] Figure 8 HLA-A*02 fine-typing of TCR 027-004. In vitro co-cultures of T cells transduced with TCR 027-004 with selected HLA-A2 sub-allele positive lymphoblastoid cell lines (LCLs; EBV transformed B cells) at an effector: target (E:T) ratio of 1 :2 (10.000 effector cells / 96 well). All individual LCLs were loaded with SLL peptide (10 -5 M) to determine unique TCR sub-allele recognition. Un-loaded target cells were used as negative control. After 20 hours of co-culture, IFN-g secretion was determined using standard ELISA. TCR 027-004 efficiently recognizes PRAME peptide presented by 3 out of 10 tested HLA-A2 sub-alleles (A*02: xx ) with comparable levels of HLA-A*02 sub-alleles A*02:02 and A*02:04 compared to A*02:01.

[0055] Figure 9 HLA-A*02 fine-typing of TCR 3825. In vitro co-cultures of T cells transduced with TCR 3825 with selected HLA-A*02 sub-allele positive lymphoblastoid cell lines (LCLs; EBV transformed B cells) at an E:T ratio of 1 :2 (10.000 effector cells / 96 well). All individual LCLs were loaded with SLL peptide (10 -5M) to determine the unique TCR sub-allelic recognition. Unloaded target cells were used as negative control. After 20 hours of co-culture, IFN-g secretion was determined using standard ELISA.

[0056] The control TCR 3825 efficiently recognized the PRAME peptide presented by 1 out of 10 tested HLA-A2 sub-alleles (A*02: xx ) i.e. only HLA-A2 sub-allele A*02:01.

[0057] Figure 10 Figure 8 and Figure 9 Summary of results shown in Figures 1 to 7.

[0058] Figure 11 : Effector cell expansion after TCR transduction. Cell numbers of effector cells were determined using a hemocytometer on the day of transduction and subsequently after 13 days of expansion. Each plot represents one donor. TCR ImCorePrefCombi1 did not show effector cell expansion and therefore could not be included in further experiments.

[0059] Figure 12 : TCR T23.8-2.1027-004 has a different recognition motif than prior art TCRs. TCR transduced effectors (effector cells) were co-cultured with T2 cells loaded with PRAME-SLL-peptide (far right) or SLL-peptide variants with single amino acid substitutions of threonine. As readout, supernatants were harvested after 20 hours and analyzed by IFN-g ELISA. Each plot represents one TCR. Letters on the x-axis indicate the position of the amino acid substitution. The "fixed" position of the recognition motif is highlighted by a box on the x-axis. TCR 46SLL did not show recognition of T2 cells loaded with the original PRAME-SLL peptide and TCR ImCore_Scaffold showed reduced recognition of T2 cells loaded with PRAME-SLL. For the avoidance of doubt, it is noted that in the present specification the TCR of the application is abbreviated as TCR 027-004, where the full name is TCR T23.8-2.1-027-004.

[0060] Figure 13 ​: TCR T23.8-2.1-027-004 transduced effectors have higher functional avidity than effectors transduced with prior art TCRs. TCR T23.8-2.1-027-004 transduced effectors (black) and other TCR transduced effectors (grey) were co-cultured with T2 cells loaded with titrated amounts of PRAME-SLL peptide. As readout, supernatants were harvested after 20 hours and analyzed by IFN-g ELISA. The peptide concentration required for half-maximal IFN-g secretion is indicated by the dotted line. The graph shows non-linear regression curves representing O.D. values. EC 50 values for the different TCR transduced effectors were calculated using non-linear regression analysis. Each graph represents a comparison of a prior art TCR to TCR T23.8-2.1-027-004.

[0061] Figure 14 : T23.8-2.1-027-004 transduced effectors recognize HLA-A*02:01 / PRAME double positive tumor cell lines stronger than effectors transduced with prior art TCRs. Effectors transduced with six different TCRs as well as untransduced control effectors were co-cultured with the HLA-A*02:01 / PRAME double positive tumor cell lines MeIA375, NCI-H1650 and NCI-H1703. Supernatants of the co-cultures were taken after 20 hours and analyzed by ELISA to determine IFN-g secretion.

[0062] Figure 15 : T23.8-2.1-027-004 transduced effectors mediate lysis of PRAME positive tumor cells more efficiently than effectors transduced with prior art TCRs. NuclightRed transduced tumor cell lines MeIA375 and NCI-H1650 (HLA-A*02:01 positive / PRAME positive) seeded in 96 well flat bottom plates were co-cultured with untransduced effectors (indicated in grey), T23.8-2.1-027-004 transduced effectors (black circles) or effectors transduced with other TCRs for 144 hours. Loss of red fluorescence visualizes tumor cell apoptosis. Untransduced effectors were used as negative control. Red cell counts (1 / mm 2 ) over time are shown in triplicates. DETAILED DESCRIPTION

[0063] The inventors of the present application have identified a TCR, TCR T23.8-2.1-027-004, which is capable of recognizing tumor associated antigen PRAME (full length PRAME as depicted in SEQ ID NO: 33) and in particular the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) (also referred to herein as PRAME SLL) of cells of the T cell receptor (TCR) clone. This sequence is recognized in a specific way, while unrelated peptides cannot be recognized Figure 1 ). The specificity is expressed by recognition of only PRAME positive cancer cell lines Figure 4 and Figure 5 ), while PRAME negative and uncharged normal cells are not recognized by the TCR receptor. However, when charged with PRAME SLL peptides, normal cells will be recognized Figure 6 ). This selective recognition can be obtained by the recognition motif of the T cell receptor, showing only a few fixed positions Figure 3 ). The amino acids LLQ and especially HLI of the sequence SLLQHLIGL (SEQ ID NO: 1) are part of this recognition motif. These amino acids exhibit advantageous effector functions, such as a high cumulative strength of the multiple affinities (e.g. functional affinities, Figure 2 ) to PRAME peptides.

[0064] In summary, the T cell receptor identified by the present inventors is able to specifically recognize cells expressing the tumor associated antigen (TAA) PRAME and in particular PRAME SLL . The TCR exhibits advantageous effector functions, such as cytokine production and cytolysis of target cells. Thus, the T cell receptor is a promising tool for highly specific and effective cancer treatment. Therefore, the identified PRAME specific TCR is suitable for adoptive T cell therapy of cancer. The above allows T cells to be armed ex vivo and reintroduced into the donor, where they can effectively recognize and specifically eliminate PRAME expressing cancer cells Figure 4 and Figure 5 ). In this context, recognition of different HLA suballeles can be advantageous to be able to include patients of different suballeles types into a research cohort covering different frequencies of the world population Figure 7 ). The TCR receptor described herein recognizes HLA-A*02:01, as well as HLA-A*02:02 and HLA-A*02:04 encoding molecules Figure 8 to Figure 10 . Thus, this is a potential cancer treatment for a large cancer patient population with tumors expressing PRAME. Furthermore, the antigen binding region of the novel TCR provided herein can be used to design soluble constructs comprising other functional moieties, such as drugs, labels or other binding domains that attract other immune cells, which are easy to administer directly.

[0065] To further demonstrate the role of the TCR of the present invention based on the prior art, the inventors compared the TCR's recognition motif, tumor cell recognition, functional affinity, and killing ability with those of TCRs known in the art. Two TCRs (46SLL and 54SLL) from WO2016142783, two TCRs (ImCore_Scaffold and ImCorePrefCombi1) from WO2018234319, and two other TCRs (R11P3D3 and R11P3D3_KE) described in WO2018172533 were selected. Table 2 provides a summary of these selected clones and their corresponding publications.

[0066] from Figure 11 It is evident that the TCR ImCorePrefCombi1 did not show effector cell expansion and therefore could not be included in subsequent experiments. The selected TCRs were analyzed using threonine scanning. Figure 12 This demonstrates the different amino acid compositions that form the corresponding recognition motifs. Importantly, in the same experimental setup, none of the selected TCRs achieved EC relative to IFN-γ release at peptide concentrations lower than the TCR of this invention (T23.8-2.1-027-004). 50 Value. In Figure 13 Among existing technologies, the best performing TCR EC 50 The TCR value is plotted for the present invention. The TCR T23.8-2.1-027-004 described herein is 1.16 × 10⁻⁶. -8 At the peptide concentration of M, EC was achieved. 50 The value is 3.57 × 10⁻⁶, while the TCR 54SLL value is 3.57 × 10⁻⁶. -8 M, TCR ImCore_Scaffold is 1.31×10 -7 M. Other TCRs do not perform as well as the TCR of this invention; they are at 8.27 × 10⁻⁶. -8 M(R11P3D3) and 5.73×10 -8 The peptide concentrations of M(R11P3D3_KE) achieve their EC50 values. Therefore, the TCR of the present invention induces higher functional affinity than the TCR of the prior art.

[0067] To further investigate tumor cell recognition, three tumor cell lines expressing PRAME were co-cultured with effector cells transduced with different TCRs, and the corresponding IFN-γ release was measured after 20 hours of co-culture. Figure 14 (and Table 3). Effector cells transduced with the TCR of the present invention showed the highest IFN-γ release after co-culturing with tumor cell lines MeIA375, NCI-H1650 and NCI-H1703.

[0068] Finally, the tumor cell lines MeIA375_NuclightRed and NCI-H1650_NuclightRed expressing PRAME were used to analyze tumor cell killing. As Figure 15 As shown in Table 4 and Table 5, effector cells transduced with the TCR of the application were more efficient in lysing tumor cells than effector cells transduced with other prior art TCRs.

[0069] From the data mentioned above, it can be concluded that the TCR of the application has a higher functional avidity than the TCRs disclosed in the prior art, is best able to recognize the tested tumor cell lines and is more efficient in lysing PRAME positive tumor cells.

[0070] Variable region

[0071] CDR3 domain

[0072] In a first aspect, the present application relates to a T cell receptor (TCR) capable of binding to a PRAME peptide having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) or a part thereof or its HLA-A2 binding form, wherein the TCR comprises: a CDR3 of a TCR a chain variable region comprising or consisting of the amino acid sequence (SEQ ID NO: 6); and / or a CDR3 of a TCR β chain variable region comprising or consisting of the amino acid sequence (SEQ ID NO: 7). Further envisaged are TCR sequence variants comprising a CDR3a comprising or consisting of an amino acid sequence which is at least 80% identical, preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 6; and / or a CDR3β comprising or consisting of an amino acid sequence which is at least 80% identical, preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 7, with the proviso that the TCR retains the advantageous ability of the TCRs assessed in the appended examples, i.e. the ability to bind to the antigenic target specified herein.

[0073] The term "T cell receptor" or "TCR" as used herein includes all grammatical forms of the original TCR as well as TCR variants, fragments and constructs. Thus, the term includes heterodimers comprising TCR a and β chains as well as multimers and single chain constructs; optionally comprising additional domains and / or moieties.

[0074] TCRs exist on the surface of T cells as a complex of several proteins in their native form. The T cell receptor is composed of two (separate) protein chains, produced from separate T cell receptor alpha and beta (TCRa and TCRb) genes and called the alpha (a-) and beta (b-) chains. Each chain of the TCR has an N-terminal immunoglobulin-like (Ig)-variable (V) domain / region, an Ig-constant-like (C) domain / region, a transmembrane / cell membrane spanning region that anchors the chain in the plasma membrane, and a short cytoplasmic tail at the C-terminus.

[0075] Antigen specificity is conferred by the variable regions of the alpha and beta chains. Both the variable domains of the TCRa and b chains comprise three hypervariable or complementarity determining regions (CDR1a / b, CDR2a / b, and CDR3a / b) surrounded by framework (FR) regions. CDR3 is the main determinant of antigen recognition and specificity (i.e., the ability to recognize and interact with a particular antigen), while CDR1 and CDR2 primarily interact with the MHC molecule that presents the antigenic peptide.

[0076] The TCRs provided herein are capable of recognizing and specifically recognizing PRAME, in particular PRAME in its MHC-bound form, as will be discussed in detail elsewhere herein. An antigenic peptide is said to exist in its “MHC-bound form” when it forms a complex with an MHC molecule (which can be present on the surface of an antigen-presenting cell, such as a dendritic cell or a tumor cell, or it can be immobilized, e.g., coated onto a bead or plate).

[0077] An initial TCR recognizes an antigenic peptide bound to (“presented / displayed on the surface of”) a major histocompatibility complex (MHC) molecule of an antigen-presenting cell. An antigenic peptide presented on a MHC molecule is also referred to herein as a “peptide:MHC complex.” There are two different classes of MHC molecules: MHC I and MHC II, which present peptides from different cellular compartments. MHC class I molecules are expressed on the surface of all nucleated cells in the human body and display peptide or protein fragments from the intracellular compartment to cytotoxic T cells. In humans, MHC is also known as human leukocyte antigen (HLA). There are three major types of MHC class I: HLA-A, HLA-B, and HLA-C. Once a TCR binds to its specific peptide:MHC complex, the T cell is activated and exerts a biological effector function.

[0078] The terms "bind" and "recognize" are used interchangeably in all grammatical forms herein. It is specifically envisaged that an antigenic target can be recognized by the TCR of the application when bound by an MHC class I molecule, in particular an HLA-A molecule, preferably an HLA-A*02 molecule. In particular, an antigenic target is recognized by the TCR of the application when presented by an HLA-molecule encoded by an HLA-A*02:01, HLA-A*02:02 or HLA-A*02:04 allele. Said MHC molecules, i.e. molecules encoded by HLA-A*02:01, HLA-A*02:02 and HLA-A*02:04 alleles, can be presented on the cell surface, e.g. on the surface of a tumor cell, or on a (solid) support. In the context of the present application, it is specifically envisaged that PRAME SLL The peptide can be recognized by the TCR of the application when bound by HLA-A2, which is an HLA-A*02:01, HLA-A*02:02 or HLA-A*02:04 encoded molecule. In a preferred embodiment of the application, the TCR can specifically recognize PRAME SLL The peptide, i.e. the peptide is able to bind all three HLA-A*02 allele encoded molecules. This means that the TCR of the application is able to bind each molecule encoded by the HLA alleles HLA-A*02:01, HLA-A*02:02 and HLA-A*02:04. However, it is not envisaged that all HLA-A2 molecules are recognized simultaneously in one patient, but it is to be understood as a surrogate.

[0079] CDR1 and CDR2 domains

[0080] As mentioned previously, it is believed that CDR1 and CDR2 of both TCR a and β chains are primarily involved in MHC recognition. There is a limited "pool" of CDR1 and CDR2 sequences known to be involved in HLA-A*02 restricted antigen recognition, and it is envisaged that the CDR3 domains of the present application can in principle be combined with any of the CDR1 and CDR2 domains depicted in SEQ ID NOs: 2 to 5, provided that the TCR retains its ability to recognize its antigenic target, preferably in its HLA-A*02 (HLA-A*02:01, HLA-A*02:02 and HLA-A*02:04) bound form, to a similar, identical or even higher extent than TCR 3825 assessed in the Examples. Useful examples of CDR1 and CDR2 domains include CDR1a comprising or consisting of the sequence as depicted in SEQ ID NO: 2; CDR2a comprising or consisting of the sequence as depicted in SEQ ID NO: 4; CDR1 β comprising or consisting of the sequence as depicted in SEQ ID NO: 3; and CDR2 β comprising or consisting of the sequence as depicted in SEQ ID NO: 5. The CDR sequences are also shown in Table 1.

[0081] In accordance with the above, the present application provides, inter alia, a TCR comprising two polypeptide chains, each polypeptide chain comprising a human variable region comprising at least one complementarity determining region (i.e. in particular CDR3, and preferably CDR1 and / or CDR2) of the TCR. A TCR having particularly advantageous properties (as shown in the accompanying Examples) comprises a first polypeptide chain comprising a CDR1 (CDR1a) comprising or consisting of the amino acid sequence SEQ ID NO: 2, a CDR2 (CDR2a) comprising or consisting of the amino acid sequence SEQ ID NO: 4, and a CDR3 (CDR3a) comprising or consisting of the amino acid sequence SEQ ID NO: 6; and / or a second polypeptide chain comprising a CDR1 (CDR1 β) comprising or consisting of the amino acid sequence SEQ ID NO: 3, a CDR2 (CDR2 β) comprising or consisting of the amino acid sequence SEQ ID NO: 5, and a CDR3 (CDR3 β) comprising or consisting of the amino acid sequence SEQ ID NO: 7.

[0082] It is further envisaged that TCR sequence variants of the TCR of the application comprise a CDR 1a comprising or consisting of an amino acid sequence which is at least about 60% identical to SEQ ID NO: 2, preferably at least about 80% identical to SEQ ID NO: 2; and / or a CDR 1β comprising or consisting of an amino acid sequence which is at least about 60% identical to SEQ ID NO: 3, preferably at least 80% identical to SEQ ID NO: 3, provided that the TCR retains the advantageous ability of the TCRs assessed in the appended examples, i.e. the ability to bind the antigenic target specified herein. It is further envisaged that TCR sequence variants of the TCR of the application comprise a CDR 2a comprising or consisting of an amino acid sequence which is at least about 70% identical to SEQ ID NO: 4, preferably at least about 85% identical to SEQ ID NO: 4; and / or a CDR 2β comprising or consisting of an amino acid sequence which is at least about 65% identical to SEQ ID NO: 5, preferably at least 80% identical to SEQ ID NO: 5, provided that the TCR retains the advantageous ability of the TCRs assessed in the appended examples, i.e. the ability to bind the antigenic target specified herein.

[0083] Complete variable region

[0084] The application further provides a TCR comprising a TCR a chain variable region comprising or consisting of the amino acid sequence as depicted in SEQ ID NO: 8; and / or a TCR β chain variable region comprising or consisting of the amino acid sequence as depicted in SEQ ID NO: 9. The a and β chain sequences are also shown in Table 1.

[0085] It is also envisaged herein that TCR sequence variants comprise an a chain variable region comprising an amino acid sequence which is at least 80% identical, more preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 8; and / or a TCR β chain variable region comprising or consisting of an amino acid sequence which is at least 80% identical, more preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 9, provided that the TCR retains the advantageous ability of the TCRs assessed in the appended examples, i.e. the ability to bind the antigenic target specified herein.

[0086] Constant region

[0087] The TCRs of the application comprise an alpha chain constant region and / or a TCR beta chain constant region. The constant region can be a human constant region or derived from another species, resulting in a "chimeric" TCR. For example, the human alpha chain and / or beta chain can be replaced by their murine counterparts ("murinized"), which has been found to enhance surface expression of human TCRs by supporting preferential pairing of TCR alpha and beta chains and more stable association with CD3 co-receptors. Suitable constant regions for the alpha chain can for example be selected from SEQ ID NO: 26 (human), SEQ ID NO: 29 (minimally murinized) and SEQ ID NO: 31 (murine). Suitable constant regions for the beta chain can be selected from SEQ ID NO: 27 (human), SEQ ID NO: 28 (human), SEQ ID NO: 30 (minimally murinized) and SEQ ID NO: 32 (murine). The TCR beta constant regions depicted in SEQ ID NOs: 27 and 28 are two human sequences that differ by several amino acids. They are to be understood as alternatives. Instead of replacing the entire human constant region by their murine counterparts, it is also possible to exchange only some amino acids of the human constant region for the corresponding amino acids of the murine constant region ("minimally murinized"), as further explained in the section "TCR sequence variants" herein. Furthermore, the application envisages that the constant region and the variable region can be combined in a manner suitable for the purpose. In this case, the constant region and the variable region can be derived from human, mouse, or obtained by the above-mentioned minimally murinized process.

[0088] Alpha and beta chains

[0089] Useful examples of TCRs of the application include those comprising an alpha chain comprising or consisting of the amino acid sequence as depicted in SEQ ID NO: 10 and / or a beta chain comprising or consisting of the amino acid sequence as depicted in SEQ ID NO: 11.

[0090] Also envisaged herein are TCR sequence variants comprising an alpha chain comprising an amino acid sequence that is at least 80% identical, more preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 10; and / or a TCR beta chain comprising or consisting of an amino acid sequence that is at least 80% identical, more preferably at least 85% identical, more preferably 90% or 95% identical to SEQ ID NO: 11; provided that the TCR retains the advantageous ability of the TCRs assessed in the appended examples, i.e. the ability to bind the antigenic target specified herein.

[0091] Antigenic target

[0092] The TCRs provided herein are advantageously capable of binding (human) PRAME (SEQ ID NO: 1), also known as PRAMESLL Accordingly, the TCR is specific for a PRAME peptide as depicted in SEQ ID NO: 1, also known as PRAME SLL The term "specific for" in the context of the present application means that the TCR specifically binds to the target. PRAME (preferentially expressed antigen of melanoma, Uniprot accession number P78395), also known as MAPE (melanoma antigen preferentially expressed in tumors) and OIP4 (OPA interacting protein 4), has been reported as a functional unknown testicular cancer antigen (CTA). PRAME is a protein-coding gene associated with melanoma, leukemia and chronic myelogenous leukemia. Gene ontology (GO) annotations associated with this gene include retinoic acid receptor binding. The PRAME protein functions as a transcriptional repressor, thereby inhibiting retinoic acid signaling through retinoic acid receptors RARA, RARB and RARG. It prevents retinoic acid-induced arrest of cell proliferation, differentiation and apoptosis.

[0093] Preferably, the TCR of the application specifically binds to its antigenic target. In particular, the present application provides a TCR capable of binding to a peptide comprised in the PRAME amino acid sequence as depicted in SEQ ID NO: 1 (see Table 1). The term "capable of binding" means that the peptide is specifically bound by the TCR. The term "specifically binds" generally indicates that the binding of a TCR to its intended antigenic target through its antigen binding site is more favored than the binding to random, unrelated, non-target antigens. In particular, the term "specifically binds" indicates that the binding specificity of a TCR to its antigenic target is at least about 5-fold, preferably 10-fold, more preferably 25-fold, even more preferably 50-fold and most preferably 100-fold or more than its binding specificity to non-target antigens. The PRAME peptide consisting of the amino acid sequence as depicted in SEQ ID NO: 1 is also referred to herein as "antigenic target" or "SLL peptide". Accordingly, the PRAME peptide sequence consisting of the amino acid sequence as depicted in SEQ ID NO: 1 is or comprises the targeting epitope of the TCR of the application.

[0094] The term "epitope" generally refers to the site on an antigen, typically a (poly)peptide, recognized by a binding domain. The term "binding domain" in its broadest sense refers to an "antigen binding site", i.e. the domain of a molecule that characterizes the binding / interaction with a specific epitope on an antigenic target. An antigenic target can comprise a single epitope, but typically comprises at least two epitopes, and can comprise any number of epitopes, depending on the size, conformation and type of the antigen. The term "epitope" generally includes linear epitopes and conformational epitopes. Linear epitopes are contiguous epitopes comprised in the primary sequence of amino acids and typically include at least 2 or more amino acids. Conformational epitopes are formed by non-contiguous amino acids brought into close proximity by the folding of the target antigen, in particular the target (poly)peptide.

[0095] The inventors have found that the minimal amino acid sequence recognized by the TCR of the application corresponds to the amino acid sequence of PRAME (SEQ ID NO: 1). In particular, as shown in the accompanying examples, the TCR of the application has been shown to (specifically) recognize an amino acid sequence comprising or consisting of the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) or its HLA-A2 binding form. This selective recognition is obtained by the recognition motif of the T cell receptor, showing only a few fixed positions ( Figure 3 ). The amino acids LLQ and especially HLI of the sequence SLLQHLIGL (SEQ ID NO: 1) are part of this recognition motif. In particular, it is envisaged that the TCRs described herein recognize at least one epitope within the above-mentioned amino acid sequence. Furthermore, the TCRs of the application have a recognition motif that is significantly different from the recognition pattern of other TCRs known in the art ( Figure 12 ).

[0096] It is envisaged that the initial TCR as described herein binds its antigenic target (i.e. PRAME, preferably presented on HLA-A*02:01-, HLA-A*02:02- or HLA-A*02:04 encoded molecules by an antigen presenting cell) with high functional avidity. The term "functional avidity" refers to the ability of a TCR-expressing cell, in particular a T cell expressing an initial TCR as described herein, to respond in vitro to a given concentration of a ligand and is considered to correlate with the effector capacity of the TCR-expressing cell in vivo. By definition, a TCR-expressing cell with high functional avidity responds to very low doses of antigen in in vitro tests, whereas said cell with lower functional avidity requires higher amounts of antigen before an immune response is generated that is similar to the immune response of a high avidity TCR-expressing cell. Thus, functional avidity can be regarded as a quantitative determinant of the activation threshold of a TCR-expressing cell. It is determined by exposing said cell in vitro to different amounts of a cognate antigen. A TCR-expressing cell with high functional avidity responds to low doses of antigen.

[0097] For example, if TCR-expressing cells secrete at least about 200 pg / mL or more (e.g., 200 pg / mL or more, 300 pg / mL or more, 400 pg / mL or more, 500 pg / mL or more, 600 pg / mL or more, 700 pg / mL or more, 1000 pg / mL or more, 5,000 pg / mL or more, 7,000 pg / mL or more, 10,000 pg / mL or more, or 20,000 pg / mL or more) of interferon-γ (IFN-γ) when co-cultured with antigen-negative HLA-A2-expressing target cells, the TCR-expressing cells are generally considered to bind to their antigenic targets with “high” functional affinity, and the antigen-negative HLA-A2-expressing target cells are loaded with about 10 -5 M to approximately 10 -11 Low concentrations of PRAME peptide within the M range (i.e., about 0.05 ng / mL to about 5 ng / mL, 0.05 ng / mL, 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, or 5 ng / mL), and the molecular weight of the PRAME peptide is 956 g / mol. Therefore, the TCR of the present invention is a high-affinity TCR that produces less than 10 [units] as measured by IFN-γ immunoassay. -7 M's half-maximal relative IFN-γ secretion (EC) 50 Value). Preferably, as measured by an IFN-γ immunoassay, the induced half-maximal relative IFN-γ secretion (EC50) is... 50 Value) less than 10 -8 M( Figure 2 By determining the EC for each TCR 50 The value, compared with other TCRs disclosed in the art, further demonstrates the high affinity of the TCR of the present invention. Figure 13 ).

[0098] The present application comprises binding of the sequence SLLQHLIGL (SEQ ID NO: 1) or a part thereof or its HLA-A2 binding form induces IFN-g secretion by TCR transduced or transfected cells. IFN-g secretion induced by binding of the TCR of the present application expressed on effector cells to the amino acid sequence SEQ ID NO: 1 presented by HLA-A*02:01-, HLA-A*02:02- or HLA-A*02:04 encoding molecules can be 100-fold, preferably 500-fold, more preferably 2000-fold, compared to IFN-g secretion induced by binding of the TCR of the present application expressed on effector cells to an unrelated peptide (amino acid sequence GLSNTHVL, depicted in SEQ ID NO: 25) presented by HLA-A*02:01-, HLA-A*02:02- or HLA-A*02:04 encoding molecules, when bound to the amino acid sequence SEQ ID NO: 1 presented by HLA-A*02:01-, HLA-A*02:02- or HLA-A*02:04 encoding molecules. IFN-g secretion can be greater than, e.g., 100 pg / ml, such as greater than 500 pg / ml or greater than 2000 pg / ml.

[0099] Cytokine release, such as IFN-g secretion, can be measured using in vitro assays, wherein K562 cells (Greiner et al., 2006, Blood. 2006 Dec 15; 108(13):4109-17) are transfected or transduced with ivtRNA, respectively, to express the amino acid sequence of SEQ ID NO: 1 or an unrelated peptide, and incubated with CD8 + and / or CD8 + depleted PBMC expressing the TCR to be investigated, or T2 cells externally loaded with SEQ ID NO: 1 or an unrelated peptide are used in an in vitro assay and subsequently co-incubated with CD8 + and / or CD8 + depleted PBMC expressing the TCR to be investigated.

[0100] Some embodiments relate to an isolated TCR as described herein, a polypeptide as described herein or a multivalent TCR complex as described herein, wherein IFN-γ secretion induced by binding of a TCR of the application expressed on an effector cell to the amino acid sequence SEQ ID NO: 1 or, in particular, to the amino acid sequence SEQ ID NO: 1 presented by a HLA-A*02:01 -, HLA-A*02:02- or HLA-A*02:04 encoding molecule is below a predetermined threshold. The threshold can be determined by using a specific effector to target ratio of at least 2:1. The "effector cell" can be a peripheral blood lymphocyte (PBL) or a peripheral blood mononuclear cell (PBMC). Typically, the effector cell is an immune effector cell, such as a T cell. Particular suitable effector cells include cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells as described elsewhere herein.

[0101] IFN-γ secretion upon binding of a TCR of the application expressed on an effector cell to the amino acid sequence SEQ ID NO: 1 presented by a HLA-A*02:01 -, HLA-A*02:02- or HLA-A*02:04 encoding molecule can be at least 10 -7 M, preferably at least 10 -8 M, more preferably 10 -9 M of PRAME SLL IFN-γ secretion induced by binding of a TCR of the application expressed on an effector cell to the amino acid sequence SEQ ID NO: 1 presented by a HLA-A*02:01 - encoding molecule can be at least 10 -7 M, preferably at least 10 -8 M, more preferably 10 -9 M of PRAME SLL IFN-γ secretion induced by binding of a TCR of the application expressed on an effector cell to the amino acid sequence SEQ ID NO: 1 presented by a HLA-A*02:01 - encoding molecule can be at least 10

[0102] variant

[0103] As previously mentioned, the term "TCR" includes TCR variants, which include TCR sequence variants, fragments, and constructs. It is contemplated that all TCR variants are functional variants of the TCRs of the present application. The term "functional variant" as used herein refers to a TCR, polypeptide, or protein having substantial or significant sequence identity or similarity to a parent TCR, to its variable region, or to its antigen binding region, and shares its biological activity, i.e., its ability to specifically bind an antigenic target, the parent TCR of the present application having a similar, identical, or even higher degree of antigenic specificity to the TCRs disclosed herein and evaluated in the appended examples. The present application also includes TCR sequence variants.

[0104] The term "TCR variant" includes "sequence variants" of the TCRs disclosed herein, i.e., variants that essentially contain the amino acid sequence of a TCR of the present application as described above (also referred to as the "parent" TCR), but contain at least one amino acid modification (i.e., substitution, deletion, or insertion) as compared to the "parent" TCR amino acid sequence, provided that the variant preferably retains the antigenic specificity of the "parent" TCR of the present application. TCR sequence variants of the present application are typically prepared by introducing appropriate nucleotide changes into the nucleic acid encoding the "parent" TCR, or by peptide synthesis. Typically, the above-mentioned amino acid modifications can be introduced into or present in the variable region or constant region of the TCR, and can be used to modulate properties such as binding strength and specificity, post-translational processing (e.g., glycosylation), thermodynamic stability, solubility, surface expression, or TCR assembly.

[0105] As previously described, amino acid modifications include, for example, deletions and / or insertions and / or substitutions of residues within the amino acid sequence of the parent TCR. Exemplary insertion variants of the TCRs of the application include fusion products of the TCRs with an enzyme or another functional polypeptide. Exemplary substitution variants of the TCRs of the application are those which comprise amino acid substitutions in the variable region or CDRs, framework regions or constant regions of the alpha chain and / or beta chain. Conservative amino acid substitutions are specifically contemplated herein. Conservative amino acid substitutions are known in the art and include amino acid substitutions in which one amino acid is replaced with another amino acid having certain physical and / or chemical properties. For example, a conservative amino acid substitution can be the substitution of one acidic amino acid for another acidic amino acid (e.g., Asp or Glu), the substitution of one amino acid with a nonpolar side chain for another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Vai, etc.), the substitution of one basic amino acid for another basic amino acid (Lys, Arg, etc.), the substitution of one amino acid with a polar side chain for another amino acid with a polar side chain (Asn, Cys, Gin, Ser, Thr, Tyr, etc.), and the like, which can be made, for example, based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the residues involved.

[0106] In general, it is contemplated that a TCR sequence variant comprises or consists of at least one of a CDR1, CDR2, CDR3, alpha chain variable region, beta chain variable region, alpha chain and / or beta chain as disclosed herein or an amino acid sequence that is at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or identical to an amino acid sequence disclosed herein, provided that the variant exhibits binding characteristics comparable to, identical to or improved over the TCRs evaluated in the accompanying Examples.

[0107] The term "sequence identity" as used herein indicates the extent to which two (nucleotide or amino acid) sequences have identical residues at identical positions in an alignment, and is typically expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of an exact sequence have 100% identity, but sequences that are less conservative and have deletions, additions or substitutions can have a lower degree of identity. The skilled person will recognize that there are several algorithms available for determining sequence identity using standard parameters such as Blast (Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul et al., (1990) J. Mol. Biol. 215:403-410), Smith-Waterman (Smith et al., (1981) J. Mol. Biol. 147:195-197) and ClustalW.

[0108] Thus, the amino acid sequence SEQ ID NO: 10 or 11 can for example be used as the "subject sequence" or "reference sequence", while the amino acid sequence of a CDR3 that differs therefrom can be used as the "query sequence".

[0109] The term "position" when used in accordance with the present disclosure means the position of an amino acid within the amino acid sequence depicted herein or the position of a nucleotide within the nucleic acid sequence depicted herein. The term "corresponding" as used herein also includes that the position is not only determined by the number of the preceding nucleotide / amino acid, but is considered in the context of the surrounding part of the sequence. Thus, the position of a given amino acid or nucleotide according to the present disclosure can vary due to deletions or additions of amino acids or nucleotides elsewhere in the sequence. Thus, when a position is referred to as a "corresponding position", it is understood in accordance with the present disclosure that the nucleotide / amino acid can differ in the specified number, but can still have similar neighboring nucleotides / amino acids. To determine whether an amino acid residue (or nucleotide) in a given sequence corresponds to a certain position in the amino acid sequence of a "parent" amino acid / nucleotide sequence, the skilled person can use ways and means well known in the art, such as manual or by using computer programs such as the ones exemplified herein for sequence alignment.

[0110] The TCR variant used as control herein is TCR receptor 3825. This variant is based on a PRAME-immunized mouse (mouse ID 3825) expressing a TCR receptor against PRAME with a CDR3a sequence as depicted in SEQ ID NO: 23 (CAVEPGGSYIPTF) and a CDR3b sequence as depicted in SEQ ID NO: 24 (CASSPGLSYEQYF). This TCR can be recombinantly expressed and analyzed by means of a TCR library with codon-optimized oligonucleotides (Weis, Manon (2015): Charakterisierung Antigen-spezifischer T-Zellen nach Induktion in TCR-humanisierten Dissertation, LMU München Veterinary Faculty Ludwigs University of Munich).

[0111] Cysteine modifications

[0112] It has been reported that the addition of disulfide bonds to the constant region can strengthen the correct pairing of TCR a and β chains (Kuball J et al., Blood. 2007 Mar 15; 109(6):2331-8). Therefore, the addition of one or more cysteine bonds to the constant region is also envisaged herein.

[0113] Murinization

[0114] As mentioned before, murinization of TCRs (i.e. the exchange of human constant regions in the a and β chains for their murine counterparts) is a technique commonly used to improve the cell surface expression of TCRs in host cells. Without wishing to be bound by a particular theory, it is believed that murinized TCRs associate more efficiently with CD3 co-receptors; and / or preferentially pair with each other and are less prone to form mixed TCRs on ex vivo engineered human T cells to express TCRs with the desired antigen specificity, but still retain and express their “original” TCR.

[0115] Recently, 9 amino acids responsible for the improved expression of murinized TCRs have been identified (Sommermeyer and Uckert, J Immunol. 2010 Jun 1; 184(11):6223-31) and it is envisaged to substitute one or all of the amino acid residues in the constant region of the TCR a and / or β chain with their murine counterpart residues. This technique is also referred to as “minimal murinization” and offers the advantage of enhancing cell surface expression while reducing the number of “foreign” amino acid residues in the amino acid sequence, thereby reducing the risk of immunogenicity.

[0116] Constructs and fragments

[0117] The term "TCR" as used herein also includes TCR constructs. The term "construct" includes proteins or polypeptides comprising at least one antigen binding domain of a TCR of the application, but do not necessarily share the basic structure of the original TCR (i.e. the variable domains in the TCR alpha chain and TCR beta chain incorporated to form a heterodimer). TCR constructs and fragments are typically obtained by routine methods of genetic engineering and are often artificially constructed to comprise additional functional protein or polypeptide domains. In accordance with the above, it is envisaged that TCR constructs and fragments of the application comprise at least one CDR3a and / or at least one CDR3b as disclosed elsewhere herein. It is further envisaged herein that constructs and fragments comprise at least one CDR1a, CDR2a, CDR1b, CDR2b, alpha chain variable region, beta chain variable region, alpha chain and / or beta chain or combinations thereof, optionally in combination with other protein domains or moieties exemplified herein. It is envisaged that the TCR constructs and fragments provided herein are capable of specifically binding to the same antigenic target as the TCRs of the application described above and evaluated in the appended examples.

[0118] Multimers

[0119] TCR constructs of the application include heterodimers and multimers, wherein at least one TCR alpha chain variable region or TCR alpha chain and at least one TCR beta chain variable region are covalently linked to each other to form a TCR heterodimer or multimer. As used in the present application, "multimer" describes molecules of different subunits or functional entities, whereas a heterodimer comprises only two functional entities. A multivalent TCR construct according to the present application in its simplest form comprises two or three or four or more TCRs associated (e.g. covalently or otherwise linked) to each other, preferably by linker molecules. In this context, "covalently linked" means a chemical bond between two molecules which share an electron pair that describes a stable equilibrium between the atoms bonds.

[0120] Suitable linker molecules for the spherical bodies, preferably uniform beads, more preferably polystyrene beads, most preferably biocompatible polystyrene beads. The TCR construct can also comprise a TCR of the application and a bead having incorporated therein a predefined fluorescent dye. Suitable linker molecules include, but are not limited to, multivalent linking molecules such as avidin, streptavidin, neutravidin, and exavidin, each of which has four biotin binding sites. Thus, biotinylated TCRs can form multimers with multiple TCR binding sites. The number of TCRs in the multimer depends on the amount of TCR relative to the amount of linker molecule used to make the multimer, and also on the presence or absence of any other biotinylated molecules. Exemplary multimers are dimers, trimers, tetramers, or pentamers or higher multimer TCR constructs. The multimers of the application can also comprise other functional entities such as labels or drugs or (solid) carriers.

[0121] Fusion proteins

[0122] The TCR heterodimer or multimer also relates to a fusion protein or polypeptide comprising at least one TCR a chain, TCR a chain variable region or CDR3a and / or at least one TCR b chain, TCR b chain variable region or CDR3b; and one or more additional fusion components. It can be at least one TCR a chain as defined herein and / or at least one TCR b chain as defined herein and / or an antibody or single chain antibody fragment (scFv) directed against an antigen or epitope on the surface of a lymphocyte, and the TCR a chain and TCR b chain are also linked to each other and optionally fused to the antibody or scFv by a linker. Useful components include Fc receptors; Fc domains (derived from IgA, IgD, IgG, IgE and IgM); cytokines (such as IL-2 or IL-15); toxins; antibodies or antigen binding fragments thereof (such as anti-CD3, anti-CD28, anti-CD5, anti-CD16 or anti-CD56 antibodies or antigen binding fragments thereof); CD247 (CD3-zeta), CD28, CD137, CD134 domains; or any combination thereof.

[0123] Exemplary antibody fragments useful as fusion components include fragments of full-length antibodies such as (s)dAbs, Fv, Fd, Fab, Fab', F(ab')2, or "r IgG" ("half-antibodies"); modified antibody fragments such as scFv, di-scFv or bis-(double)-scFv, scFv-Fc, scFv-zipper, scFab, Fab2, Fab3, diabodies, single-chain diabodies, tandem diabodies (Tandabs), tandem di-scFv, tandem tri-scFv, minibodies, multibodies (such as triabodies or tetrabodies), and single-domain antibodies such as nanobodies or single variable domain antibodies comprising only one variable domain, which can be VHH antibodies, VH antibodies or VL antibodies.

[0124] The TCR constructs of the application can be fused to one or more antibodies or antibody fragments, thereby generating monovalent, bivalent and polyvalent / multivalent constructs, and thus monospecific constructs that specifically bind only one target antigen, as well as polyspecific / multispecific constructs that specifically bind more than one target antigen, e.g. two, three or more target antigens, through different antigen binding sites.

[0125] Optionally, a linker can be introduced between one or more domains or regions of the TCR constructs of the application, i.e. between the TCR a chain CDR3, the TCR a chain variable region and / or the TCR a chain, the TCR b chain CDR3, the TCR b chain variable region and / or the TCR b chain and / or one or more of the fusion components described herein. Linkers are known in the art and have been reviewed, inter alia, by Chen et al., Adv Drug Deliv Rev. 2013 Oct 15;65(10): 1357-1369. In general, linkers include flexible, cleavable and rigid linkers and will be selected depending on the type of construct and the intended use / application. For example, for therapeutic applications, a non-immunogenic flexible linker is generally preferred to ensure a certain degree of flexibility or interaction between the domains, while reducing the risk of adverse immunogenic reactions. The linker is typically composed of small, non-polar amino acids, such as Gly, or polar amino acids, such as Ser or Thr, and includes the “GS” linker composed of Gly and Ser residues.

[0126] Particularly useful TCR constructs envisaged according to the present application are those comprising at least one TCR a chain, TCR a chain variable region or CDR3a as defined herein, at least one TCR β chain, TCR β chain variable region or CDR3β as defined herein, optionally linked to each other and optionally fused via a linker to at least one antibody or antibody fragment, such as a single chain antibody fragment (scFv), directed against an antigen or epitope on the surface of a lymphocyte. Useful antigenic targets recognized by the antibody or antibody fragment, e.g. scFv, include CD3, CD28, CD5, CD16 and CD56. The construct can generally have any structure as long as the "TCR part" (i.e. TCR a and β chains or their variable regions or CDR3s) retains its ability to recognize the antigenic target defined herein and the "antibody part" binds the desired surface antigen or epitope, thereby recruiting and targeting the respective lymphocyte to the target cell. The construct can advantageously be used as an "engager" that brings together an antigen-presenting cell, such as a tumor cell, displaying the antigenic target and a lymphocyte, such as a cytotoxic T cell or NK cell. An example of such a fusion protein is a construct engineered according to the principles of the bi-specific T cell engager (BiTE) technology, on a single polypeptide chain of about 55 kilodaltons (kDa). Thus, the TCR constructs of the present application can comprise at least one TCR antigen binding domain as described herein (e.g. a TCR variable a chain and a variable β chain fused to each other) linked to a scFv (or other binding domain) with the desired binding specificity, e.g. CD3 or CD56. The scFv (or other binding domain) such as binds T cells via the CD3 receptor, or binds CD56 for NK cell activation, and the other binds the tumor cell via an antigenic target specifically expressed on the tumor cell. Also envisaged herein are triabodies comprising at least one TCR antigen binding domain as described herein, a scFv (or other binding domain) and a further domain, e.g. a domain for targeting the construct to the site of action in the body (e.g. an Fc domain).

[0127] isolated form

[0128] The TCRs of the application can be provided in "isolated" or "substantially pure" form. "Isolated" or "substantially pure" when used herein in relation to a TCR means that the TCR has been identified, separated and / or recovered from a component of its producing environment, such that the "isolated" TCR is free or substantially free of other contaminant components of its producing environment which would interfere with its therapeutic or diagnostic use. Contaminant components can include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. Thus, an "isolated" TCR will be prepared by a process comprising obtaining the TCR by incubating a host cell under conditions which result in expression of the TCR and purifying the TCR, whereby at least one purification step is performed which removes or substantially removes these contaminant components. The above-mentioned definition applies equally to "isolated" polynucleotides / nucleic acids mutatis mutandis.

[0129] Soluble forms

[0130] The TCRs of the application can be provided in soluble form. Soluble TCRs can be used as diagnostic tools, as well as vehicles or "adapters" to specifically target therapeutic agents or effector cells to, for example, cancer cells expressing the antigenic target recognised by the soluble TCR. Soluble TCRs (sTCRs) are typically fragments or constructs comprising a TCR a chain and / or β chain or variable regions or CDRs thereof, and are optionally stabilised by disulphide bonds or covalently linked by suitable linker molecules, e.g. as described above in the context of TCR constructs of the application. They typically do not comprise, for example, transmembrane regions. In some cases, amino acid modifications can be introduced into the polypeptide sequence to enhance solubility of the molecule, and / or to correct folding and pairing of the a and β chains, if necessary, particularly when produced in recombinant host cells which do not provide the features mentioned above. When E. coli is used as the production host cell, for example, folding and pairing of the TCR a and β chains is typically completed in vitro. Thus, TCRs according to the application may, for example, comprise additional cysteine residues, as described elsewhere herein.

[0131] In addition to additional cysteine bridges, other useful modifications include, for example, the addition of leucine zippers and / or ribosomal skip sequences, e.g. sequence 2A from a picornavirus as described in Walseng et al. (2015), PLoS ONE 10(4): e0119559, to increase folding, expression and / or pairing of the TCR a chain and / or β chain.

[0132] Modifications

[0133] The TCRs of the application can further comprise one or more modifications as described herein below. The modifications described below are typically covalent modifications and can be accomplished using standard techniques known in the art. In some cases, amino acid modifications of the TCR can be required to facilitate introduction of the modification.

[0134] Molecular label

[0135] The TCR, in particular the (soluble) TCR of the application can be labeled with at least one molecular label. Useful molecular labels are known in the art and can be coupled to the TCR or TCR variant using conventional methods, optionally via linkers of various lengths.

[0136] Generally, different labels belong to different classes, depending on the assay with which they are detected - the following examples include but are not limited to: isotopic labels, which can be radioactive or heavy isotopes, such as radioisotopes or radionuclides (e.g. <3>H, <14>, <15>N, <35>S, <89>Zr, <90>Y, <99>Tc, <111>In, <125>I, <131>I); magnetic labels (e.g. magnetic particles); redox-active moieties; optical dyes (including but not limited to chromophores, phosphors and fluorophores), such as fluorescent groups (e.g. FITC, rhodamine, lanthanide phosphors), chemiluminescent groups, and fluorophores which can be "small molecule" fluorophores or proteinaceous fluorophores; enzymatic groups (e.g. horseradish peroxidase, p-galactosidase, luciferase, alkaline phosphatase; biotinylated groups; or predetermined polypeptide epitopes recognized by secondary reagents (e.g. leucine zipper pairs, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.). Labeling with molecular labels is particularly envisaged when the TCR, TCR variant or especially soluble TCR construct (such as those comprising at least one TCR a chain and / or TCR β chain as described herein) is intended for diagnostic use.

[0137] Functional moiety

[0138] The TCR, in particular the soluble TCR of the application can be modified by attachment of additional functional moieties, e.g. for reducing immunogenicity, increasing hydrodynamic size (size in solution) solubility and / or stability (e.g. by enhancing protection against proteolytic degradation) and / or prolonging serum half-life.

[0139] Exemplary functional moieties for use according to the present application include peptide or protein domains that bind to other proteins in the human body, such as serum albumin, immunoglobulin Fc regions or neonatal Fc receptor (FcRn), polypeptide chains of varying lengths (e.g. XTEN technology or ), non-protein polymers, including but not limited to various polyols, such as polyethylene glycol (PEGylation), polypropylene glycol, polyoxyalkylene or copolymers of polyethylene glycol and polypropylene glycol, or carbohydrates, such as hydroxyethyl starch (e.g. ) or polysialic acid (e.g. technology).

[0140] Other useful functional moieties include a "suicide" or "safety switch" which can be used to shut down effector host cells carrying the TCR of the application in a patient. An example is the inducible caspase 9 (iCasp9) "safety switch" described by Gargett and Brown Front Pharmacol. 2014; 5: 235. Briefly, effector host cells are modified by well-known methods to express a caspase 9 domain which dimerizes dependent on a small molecule dimerizer drug (such as AP1903 / CIP) and leads to rapid induction of apoptosis in the modified effector cells. Systems are described, for example, in EP2173869(A2). Examples of other "suicide", "safety switch" are known in the art, for example the expression of herpes simplex virus thymidine kinase (HSV-TK), the expression of CD20 and subsequent depletion using anti-CD20 antibodies or the myc tag (Kieback et al., Proc Natl Acad Sci USA. 2008 Jan 15; 105(2): 623-8). The TCR of the application can also be modified by introducing an inducible so-called "on switch" (described, for example, in WO2019175209A1), wherein the modified alpha and beta chains of the TCR of the application dimerize only upon interaction with a small dimerizer drug, followed by the production of a functional TCR expressed on the cell surface only in the presence of the dimerizer drug.

[0141] glycosylation

[0142] Also contemplated herein are TCRs with altered glycosylation patterns. As is known in the art, the glycosylation pattern can depend on the amino acid sequence (e.g., the presence or absence of particular glycosylation amino acid residues, as discussed below) and / or the host cell or organism in which the protein is produced. Glycosylation of polypeptides is typically N-linked or O-linked. N-linked refers to the attachment of a carbohydrate moiety to a side chain of an asparagine residue. N-linked glycosylation sites are conveniently added to a binding molecule by altering the amino acid sequence so that it contains one or more tripeptide sequences selected from the group consisting of asparagine-x-serine and asparagine-x-threonine, where x is any amino acid except proline. O-linked glycosylation sites can be introduced by adding or substituting one or more serine or threonine residues into the starting sequence.

[0143] Another way of glycosylating a TCR is by chemical or enzymatic coupling of a glycoside to the protein. Depending on the coupling procedure used, the sugar can be linked to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteine, (d) free hydroxyl groups such as those of serine, threonine, or hydroxyproline, (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan, or (f) the amide group of glutamine.

[0144] Similarly, deglycosylation, i.e. removal of carbohydrate moieties present on the binding molecule, can be accomplished chemically, e.g. by exposing the TCR to trifluoromethanesulfonic acid, or enzymatically by employing endo- and exoglycosidases.

[0145] Drug conjugates

[0146] It is also conceivable to add a drug, such as a small molecule compound, to the TCR, in particular to the soluble TCR of the present application. The linkage can be achieved by covalent bonds or non-covalent interactions such as by electrostatic forces. Various linkers known in the art can be employed to form the drug conjugate.

[0147] Labels

[0148] The TCR, in particular the soluble TCR, of the present disclosure can be modified to introduce additional domains that facilitate the identification, tracking, purification and / or isolation of the respective molecule (label). Non-limiting examples of such labels include peptide motives known as Myc tag, HAT tag, HA tag, TAP tag, GST tag, chitin binding domain (CBD tag), maltose binding protein (MBP tag), Flag tag, Strep tag and variants thereof (e.g. Strep II tag), His-tag, CD20, Her2 / neu tag, myc tag, FLAG tag, T7 tag, HA (hemagglutinin) tag or GFP tag.

[0149] Epitope tags are a useful example of labels that can be incorporated into the TCR of the present disclosure. Epitope tags are short amino acid fragments that allow binding of specific antibodies, thus enabling the identification and tracking of the binding and movement of the soluble TCR or host cell within a patient or cultured (host) cell. The detection of the epitope tag and thus the labeled TCR can be accomplished using a variety of different techniques. Examples of such techniques include immunohistochemistry, immunoprecipitation, flow cytometry, immunofluorescence microscopy, ELISA, immunoblotting ("Western blotting"), and affinity chromatography. The epitope tag may, for example, have a length of 6 to 15 amino acids, in particular 9 to 11 amino acids. More than one epitope tag can also be included in the TCR of the present application.

[0150] By culturing the cells in the presence of a binding molecule (antibody) specific for the tag, the tag can also be used to stimulate and expand host cells carrying the TCR of the present application.

[0151] Nucleic acids

[0152] The present application further provides nucleic acids encoding the TCRs described herein or polynucleotides encoding the TCRs as described herein. These nucleic acids are codon-optimized, which means that one protein can be encoded by many alternative nucleic acid sequences. Codon preference (codon usage bias) varies among each organism and presents a challenge for expressing recombinant proteins in heterologous expression systems, resulting in low and unreliable expression. This can also be true for autologous expression, as wild-type sequences are not necessarily optimized for expression yield, but also for degradation, regulation, and other properties. Therefore, codon optimization is used herein to provide efficient protein expression. Table 1 below indicates the nucleotide sequences encoding the respective amino acid sequences:

[0153] Table 1

[0154]

[0155]

[0156]

[0157]

[0158] In particular, provided herein are polynucleotides encoding the TCR a or b chain, TCR a or b chain variable region, TCR CDR 3a and CDR 3b, and TCR variants, constructs, and fragments of the present application, and the sequences are depicted in SEQ ID NO: 13, 14, 15, 16, 17, 18, 19, 20, 21, and 22.

[0159] The term "polynucleotide" or "nucleic acid" as used herein includes polynucleotides of ribonucleotides and deoxyribonucleotides, e.g., modified or unmodified RNA or DNA, each in either single- or double-stranded form and in linear or circular form, or mixtures thereof, including hybrid molecules. Thus, nucleic acids according to the present application include DNA (such as dsDNA, ssDNA, cDNA), RNA (such as dsRNA, ssRNA, mRNA ivtRNA), combinations thereof, or derivatives thereof (such as PNA).

[0160] A polynucleotide can comprise conventional phosphodiester bonds or non-conventional bonds (e.g., amide bonds such as found in peptide nucleic acids (PNAs)). The polynucleotides of the application can also contain one or more modified bases, e.g., tritylated bases and unusual bases such as inosine. Other modifications, including chemical modifications, enzymatic modifications, or metabolic modifications, are also contemplated, so long as the binding molecule of the application can be expressed from the polynucleotide. The polynucleotides can be provided in isolated form as defined elsewhere herein. The polynucleotides can include regulatory sequences, such as transcriptional control elements (including promoters, enhancers, operators, repressors, and transcriptional termination signals), ribosomal binding sites, introns, and the like.

[0161] In particular, the application provides a polynucleotide comprising or consisting of a nucleic acid that is at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a reference polynucleotide sequence selected from the group consisting of the sequences depicted in SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, and 22.

[0162] The above polynucleotides can or can not comprise additional or altered nucleotide sequences encoding, e.g., altered amino acid residues, signal peptides directing secretion of encoded TCRs, constant regions, or other heterologous polypeptides as described herein. The polynucleotides can thus encode fusion polypeptides, fragments, variants, and other derivatives of the binding molecules described herein.

[0163] The nucleic acid sequences of the application can be codon-optimized for optimal expression in desired host cells (e.g., human lymphocytes); or for expression in bacterial, yeast, or insect cells specifically contemplated for expression of soluble TCRs of the application. Codon-optimization refers to the exchange of codons that are normally rare in highly expressed genes of a given species with codons that are normally common in highly expressed genes of the species, the codons encoding the same amino acids as the exchanged codons. The selection of optimal codons thus depends on the codon usage of the host genome and the presence of several desirable and undesirable sequence motifs.

[0164] Vectors

[0165] Further provided herein are vectors comprising one or more nucleic acids as described herein. A "vector" is a nucleic acid molecule that serves as a vehicle for transfer of (exogenous) genetic material into a host cell, in which the genetic material can, e.g., be replicated and / or expressed.

[0166] The term "vector" includes, but is not limited to, plasmids, viral vectors (including retroviral vectors, lentiviral vectors, adenoviral vectors, vaccinia viral vectors, polyoma viral vectors, and adenovirus-associated vectors (AAV)), phage, phagemid, cosmid, and artificial chromosomes (including BACs and YACs). A vector is typically a nucleotide sequence, usually a DNA sequence, that comprises an insert (transgene) and a larger sequence that serves as the "backbone" of the vector. Engineered vectors typically comprise an origin of replication for autonomous replication in a host cell (if stable expression of the polynucleotide is desired), a selection marker, and restriction enzyme cleavage sites (e.g., a multiple cloning site, MCS). Vectors can additionally comprise promoters, genetic markers, reporter genes, targeting sequences, and / or protein purification tags. As is known to those of skill in the art, a large number of suitable vectors are known to those of skill in the art, and many are commercially available.

[0167] Targeting vectors

[0168] Targeting vectors can be used to integrate a polynucleotide into the chromosome of a host cell by methods known in the art, for example as described by J. Sambrook et al., Molecular Cloning: A Laboratory Manual (4th ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2012). Briefly, suitable means include homologous recombination or the use of a hybrid recombinase that is specific for a targeting sequence at the integration site. Targeting vectors are typically circular and will be linearized prior to use for homologous recombination. As an alternative, the exogenous polynucleotide can be a DNA fragment joined by fusion PCR or a synthetically constructed DNA fragment, which is then recombined into the host cell. Heterologous recombination leading to random or non-targeted integration can also be used.

[0169] Expression vectors

[0170] Vectors of the application can also be expression vectors. An "expression vector" or "expression construct" can be used for the transcription of a heterologous polynucleotide sequence (e.g., those sequences encoding TCRs of the application), and the translation of their mRNA in a suitable host cell. This process is also referred to herein as the "expression" of a TCR of the application.

[0171] In addition to an origin of replication, a selection marker, and a restriction enzyme cleavage site, an expression vector typically includes one or more regulatory sequences operably linked to the heterologous polynucleotide to be expressed.

[0172] The term "regulatory sequence" refers to nucleic acid sequences necessary for the expression of an operably linked coding sequence of a (heterologous) polynucleotide in a particular host organism or host cell, and thus includes transcriptional and translational regulatory sequences. Generally, regulatory sequences required for expression of a heterologous polynucleotide sequence in prokaryotes include a promoter, an optional operator sequence, and a ribosome binding site. In eukaryotes, generally a promoter, a polyadenylation signal, an enhancer, and optionally a splice signal are needed. In addition, specific initiation and secretion signals can also be incorporated into the vector to permit secretion of the desired polypeptide into the culture medium.

[0173] A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence, in particular on the same polynucleotide molecule. For example, a promoter is operably linked to a coding sequence of a heterologous gene when it is capable of effecting the expression of that coding sequence. The promoter is typically located upstream of a gene encoding a polypeptide of interest and regulates the expression of that gene.

[0174] Exemplary regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as those derived from cytomegalovirus (CMV), (such as the CMV promoter / enhancer), Simian Virus 40 (SV40) (such as the SV40 promoter / enhancer), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)), and polyoma. As previously described, the expression vector can also include an origin of replication and selectable markers.

[0175] As previously mentioned, the vectors of the present application can further comprise one or more selectable markers. Selectable markers suitable for use in eukaryotic host cells include, but are not limited to, the herpes simplex virus thymidine kinase (tk), hypoxanthine-guanine phosphoribosyltransferase (hgprt), and adenine phosphoribosyltransferase (aprt) genes. Further genes include dhfr (methotrexate resistance), gpt (mycophenolic acid resistance), neo (G-418 resistance), and hygro (hygromycin resistance). Vector amplification can be used to increase expression levels. Generally, the selectable marker gene is directly linked to the polynucleotide sequence to be expressed, or introduced into the same host cell by co-transformation.

[0176] In view of the above, the present application thus further provides one or more nucleotide sequences of an insert vector (i.e. comprising a vector) as described herein. In particular, the present application provides a (replicable) vector comprising a nucleotide sequence encoding a TCR of the present application, or an alpha or beta chain thereof, or an alpha or beta variable domain, or a CDR3a or CDR3b operably linked to a promoter.

[0177] The skilled person will be able to readily select a suitable expression vector based on, for example, the host cell intended for TCR expression. Examples of suitable expression vectors are viral vectors, such as retroviral vectors, for example MP71 vectors or retroviral SIN vectors; and lentiviral vectors or lentiviral SIN vectors. Viral vectors comprising a polynucleotide encoding a TCR of the application are, for example, able to infect lymphocytes, envisaging that said lymphocytes subsequently express the heterologous TCR. A further example of a suitable expression vector is the Sleeping Beauty (SB) transposon transposase DNA plasmid system, SB DNA plasmid. The nucleic acids and / or in particular the expression constructs of the application can also be transferred into cells by transient RNA transfection.

[0178] Viral vectors currently used for initial TCR expression typically link TCR-alpha and TCR-beta chain genes in one vector with an internal ribosome entry site (IRES) sequence or a 2A peptide sequence derived from a porcine tsechovirus, resulting in the expression of a single messenger RNA (mRNA) molecule under the control of the viral promoter within the transduced cell.

[0179] Host cells

[0180] The present application further provides a host cell comprising a TCR, nucleic acid or vector as described herein.

[0181] A variety of host cells can be used in accordance with the present application. The term "host cell" as used herein includes a cell that can be or has been the recipient of a polynucleotide or vector as described herein and / or that expresses (and optionally secretes) a TCR of the application. The terms "cell" and "cell culture" are used interchangeably to denote the source of a TCR, unless explicitly otherwise stated. The term "host cell" also includes a host cell line. In general, the term "host cell" includes prokaryotic or eukaryotic cells, and also includes, but is not limited to, bacterial, yeast, fungal, plant, and animal cells, such as insect cells and mammalian cells, for example murine, rat, rhesus or human cells.

[0182] In view of the above, the present application thus provides, inter alia, a host cell comprising a polynucleotide or vector, for example an expression vector comprising a nucleotide sequence encoding a TCR or TCR construct as described herein. The polynucleotides and / or vectors of the present application can be introduced into a host cell using conventional methods known in the art, for example by transfection, transformation, etc.

[0183] "Transfection" is the process of intentionally introducing a nucleic acid molecule or polynucleotide, including a vector, into a target cell. An example is RNA transfection, the process of introducing RNA, such as in vitro transcribed RNA, ivtRNA, into a host cell. The term is used primarily for non-viral methods in eukaryotic cells. The term "transduction" is generally used to describe the viral-mediated transfer of nucleic acid molecules or polynucleotides. Transfection of animal cells typically involves opening transient pores or "holes" in the cell membrane to allow uptake of material. Transfection can be performed using calcium phosphate, by electroporation, by cell squeezing, or by mixing a cationic lipid with the material to produce a liposome that fuses with the cell membrane and deposits its cargo inside. Exemplary techniques for transfecting eukaryotic host cells include liposome-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (co-precipitation of DNA with calcium phosphate), microinjection, and electroporation.

[0184] The term "transformation" is used to describe the non-viral transfer of nucleic acid molecules or polynucleotides, including vectors, to bacteria and to non-animal eukaryotic cells, including plant cells. Thus, transformation is a genetic alteration of a bacterium or non-animal eukaryotic cell that results from the direct uptake from its surroundings, through the cell membrane, and subsequent incorporation of exogenous genetic material (nucleic acid molecules). Transformation can be achieved by artificial means. In order for transformation to occur, the cell or bacterium must be in a competent state, which can occur as a time-limited response to environmental conditions such as starvation and cell density. For prokaryotic transformation, techniques can include heat shock-mediated uptake, fusion of bacterial spheroplasts with intact cells, microinjection, and electroporation. Techniques for plant transformation include Agrobacterium-mediated transfer, such as by A. tumefaciens, tungsten or gold microprojectiles propelled at high velocity, electroporation, microinjection, and polyethylene glycol-mediated uptake.

[0185] In view of the above, the present application thus further provides a host cell comprising at least one polynucleotide sequence and / or vector as described herein.

[0186] For expression of the TCRs of the application, the host cell into which the polynucleotide sequence is to be introduced can be chosen, as appropriate, to provide appropriate expression of inserted polynucleotide sequences and / or to modify and process the gene product (i.e., RNA and / or protein) in a desired fashion. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of the gene product can be important for the function of the TCR. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the product. To this end, eukaryotic host cells can be used which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product.

[0187] It is envisaged herein to provide (a) host cells for expressing and obtaining TCRs of the application, particularly in soluble form ("producer host cells") and (b) host cells expressing TCRs of the application and having an effector function ("effector host cells"). The "effector host cells" are particularly useful for therapeutic applications and are envisaged for administration to a subject in need thereof. Preferred "effector host cells" include lymphocytes, such as cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells.

[0188] "Producer host cells"

[0189] Cells

[0190] "Producer host cells" for expressing soluble TCRs of the application are preferably capable of expressing high amounts of recombinant proteins.

[0191] In accordance with the above, envisaged expression systems (i.e. host cells comprising expression vectors as described above) include microorganisms, such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors; yeast (e.g. Saccharomyces, Pichia) transformed with recombinant yeast expression vectors; insect cell systems infected with recombinant virus expression vectors (e.g. baculovirus); plant cell systems infected with recombinant virus expression vectors (e.g. cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid). Mammalian expression systems with recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g. adenovirus late promoter; vaccinia virus 7.5K promoter, cytomegalovirus (CMV) major immediate early promoter (MIEP) promoter are generally preferred. Suitable mammalian host cells can be selected from known cell lines (e.g. COS, CHO, BLK, 293, 3T3 cells), however it is also envisaged to use lymphocytes, such as cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells.

[0192] Exemplary mammalian host cells that can be used as "production host cells" include Chinese hamster ovary (CHO cells), including DHFR minus CHO cells such as DG44 and DUXB 11, NSO, COS (a derivative of CVI with SV40 T antigen), HEK 293 (human embryonic kidney), and SP2 (mouse myeloma) cells. Other exemplary host cell lines include, but are not limited to, HELA (human cervical carcinoma), CVI (monkey kidney line), VERY, BHK (baby hamster kidney), MDCK, 293, WI38, R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), P3 x 63-Ag3.653 (mouse myeloma), BFA-lcIBPT (bovine endothelial cell), and RAJI (human lymphoblast). Host cell lines are typically available from commercial service agencies, the American Tissue Culture Collection (ATCC), or published literature.

[0193] Non-mammalian cells, such as bacterial, yeast, insect, or plant cells, are also readily available and can also be used as "production host cells" as described above. Exemplary bacterial host cells include Enterobacteriaceae, such as Escherichia coli, Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenza. Other host cells include yeast cells, such as Saccharomyces cerevisiae and Pichia pastoris. Insect cells include, but are not limited to, Spodoptera frugiperda cells.

[0194] In accordance with the above, the present application also provides a method of producing and obtaining a TCR as described herein, the method comprising the steps of: (a) incubating a host cell (i.e. a production host cell) under conditions which cause expression of the TCR and (b) purifying the TCR.

[0195] Culturing

[0196] Host cells harboring expression vectors are grown under conditions suitable for production of the TCRs provided herein, particularly the alpha and / or beta chains as described elsewhere herein, and alpha and / or beta chain protein synthesis is determined. For expression of a two-chain TCR, vectors encoding both the alpha and beta chains can be co-expressed in the host cell to express the entire molecule.

[0197] Purification

[0198] Once the TCR of the application has been expressed, it can be purified by any of the purification methods known in the art, for example by chromatography (e.g. ion-exchange chromatography (e.g. hydroxyapatite chromatography), affinity chromatography, particularly protein A, protein G or lectin affinity chromatography, size-fractionation column chromatography), centrifugation, differential solubility, hydrophobic interaction chromatography, or by any other standard technique for the purification of proteins. The skilled person will be able to readily select a suitable purification method based on the individual characteristics of the TCR to be recovered.

[0199] “Effector host cell”

[0200] As mentioned previously, the application also provides an “effector host cell” comprising a nucleotide sequence, vector or TCR of the application. The effector host cell is modified using conventional methods to comprise a nucleic acid sequence encoding a TCR of the application, and is envisaged to express the TCR described herein, particularly on the cell surface. For the purposes of the present application, a “modified host cell expressing a TCR of the application” generally refers to a (effector or producer) host cell that has been treated or altered to express a TCR according to the application, for example by RNA transfection as described in the appended examples. Other methods of modification or transfection or transduction are also envisaged, for example those described elsewhere herein. Thus, the term “modified host cell” includes “transfected”, “transduced” and “genetically engineered” host cells that preferably express a TCR of the application.

[0201] Preferably, the “(modified) effector host cell” (in particular the “(modified) effector lymphocyte”) is capable of mediating effector functions upon binding of the TCR to its specific antigenic target through intracellular signal transduction. The effector functions include, for example, the release of perforin (which creates holes in the target cell membrane), granzymes (which are proteases that act intracellularly to trigger apoptosis), expression of Fas ligand (which activates apoptosis in FAS-bearing target cells) and release of cytokines (preferably Th1 / Tc1 cytokines such as IFN-g, IL-2 and TNF-a). Thus, an effector host cell engineered to express a TCR of the application capable of recognizing and binding to its antigenic target in a subject to be treated is envisaged to perform the above-mentioned effector functions, thereby killing the target (e.g. cancer) cell. The cytolysis of the target cell can be assessed, for example, with a CTL Fluorocytolysis assay (CTL, USA) that detects the disappearance of fluorescently labeled target cells during co-culture with TCR-transfected recipient T cells.

[0202] In view of the above, the effector host cell preferably expresses a functional TCR, i.e. it typically comprises a TCR a and β chain as described herein; and the signaling subunits CD3γ, δ, ε and ζ (CD3 complex). Furthermore, expression of the co-receptor CD4 or CD8 can also be required. In general, lymphocytes, T cells with the required genes involved in antigen binding, receptor activation and downstream signaling (e.g. Lck, FYN, CD45 and / or Zap70) are particularly suitable as effector host cells. However, it is also envisaged herein that the TCR of the application is expressed as a "binding domain" without the CD3 signaling subunits and / or the downstream signaling molecules mentioned above (i.e. capable of recognizing the antigenic target described herein, but not affecting the functions mediated by CD3 and / or the downstream signaling molecules mentioned above). It is envisaged that the effector cell is capable of recognizing the antigenic target described herein and, optionally, of effecting other functions not related to signaling with CD3 signaling and / or the downstream signaling molecules mentioned above. Examples include NK or NKT cells expressing the TCR of the application and capable of, e.g., releasing cytotoxic granules upon recognition of their antigenic target.

[0203] Thus, cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells are considered useful lymphocyte effector host cells. Said lymphocytes expressing the recombinant TCR of the application are also referred to herein as "modified effector lymphocytes". However, the skilled person will readily recognize that, in general, any component of the TCR signaling pathway leading to the desired effector function can be introduced into a suitable host cell by recombinant genetic engineering methods known in the art.

[0204] The effector host cell, in particular a lymphocyte such as a T cell, can be an autologous host cell obtained from the subject to be treated and transformed or transduced to express the TCR of the application. Typically, recombinant expression of the TCR will be achieved by using viral vectors as described in the appended examples. Techniques for obtaining and isolating cells from a patient are known in the art.

[0205] As mentioned previously, the effector host cells provided herein are particularly envisaged for therapeutic applications. Further genetic modifications of the host cell can be required to improve therapeutic efficacy. For example, when autologous CD8+ T cells are used as "effector host cells", suitable additional modifications include down-regulation of endogenous TCR, CTLA-4 and / or PD-1 expression; and / or expansion of co-stimulatory molecules such as CD28, CD134, CD137. Means and methods for achieving the genetic modifications mentioned above have been described in the art.

[0206] Methods for targeted genome engineering of host cells are known in the art and comprise, in addition to gene knock-out with siRNAs, the use of so-called "programmable nucleases", such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and RNA-guided engineered nucleases (RGENs) derived from the bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-Cas (CRISPR-associated) system, inter alia as reviewed in Kim & Kim Nature Reviews Genetics 15, 321-334 (2014). For example, programmable nucleases, such as TALENs, can be used to cut the DNA region encoding an "unwanted" protein, such as PD-1, CTLA-4 or an endogenous TCR, thereby reducing its expression. When T cells are used as (effector) host cells, downregulation of endogenous TCRs has the benefit of reducing unwanted "mispairing" of endogenous and exogenous TCR alpha / beta chains.

[0207] Pharmaceutical composition

[0208] The present application further provides a pharmaceutical composition comprising the TCR, the nucleic acid, the vector and / or the host cell as described herein as one or more active agents, and optionally one or more pharmaceutical excipients. Thus, the use of the TCR, the nucleic acid, the vector and the host cell for the manufacture of a pharmaceutical composition or a medicament is also envisaged herein.

[0209] The term "pharmaceutical composition" particularly refers to a composition suitable for administration to a human being. However, the term generally also includes compositions suitable for administration to non-human animals.

[0210] The pharmaceutical composition envisaged by the present application can further comprise one or more checkpoint inhibitors, preferably selected from the group consisting of a CTLA-4 inhibitor, a PD-1 inhibitor and a PD-L1 inhibitor. All of the above-mentioned inhibitors are immune checkpoint inhibitors capable of downregulating the immune response. The cytotoxic lymphocyte-associated protein 4 (CTLA-4) inhibitor is a protein receptor constitutively expressed in regulatory T cells, but only upregulated in conventional T cells upon activation. The PD-1 and PD-L1 inhibitors are used to inhibit the association of the programmed death-ligand 1 (PD-L1) with its receptor, the programmed cell death protein 1 (PD-1). The interaction of these cell surface proteins is involved in the suppression of the immune system and occurs after infection to limit the killing of bystander host cells and to prevent autoimmune diseases. Therefore, the checkpoint inhibitors are preferably combined into the pharmaceutical composition according to the present application.

[0211] Other checkpoint inhibitors encompassed by the present application are LAG3, ICOS, TIM3, VISTA, and CEACAM1. LAG3 is an inhibitory receptor on antigen-activated T cells. ICOS protein belongs to the CD28 and CTLA-4 family of cell surface receptors. It forms homodimers and plays an important role in cell-cell signaling, immune response, and regulation of cell proliferation. TIM3 or hepatitis A virus cellular receptor type A encodes a protein belonging to the immunoglobulin superfamily and the TIM family of proteins. CD4-positive T helper lymphocytes can be divided into type 1 (Thl) and type 2 (Th2) based on their cytokine secretion patterns. VISTA or V-Set immunomodulator receptor encodes an immunomodulator receptor that inhibits T cell responses. The CEACAM1 gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. These checkpoint inhibitors can also be combined with the pharmaceutical composition.

[0212] The pharmaceutical composition and its components (i.e., the active agent and optional excipients) are preferably pharmaceutically acceptable, i.e., capable of eliciting the desired therapeutic effect without causing any undesirable local or systemic effects in the recipient. The pharmaceutically acceptable compositions of the present application can, for example, be sterile. In particular, the term "pharmaceutically acceptable" can mean approved by a regulatory agency or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.

[0213] The active agent (e.g., host cell or TCR) described above is preferably present in the pharmaceutical composition in a therapeutically effective amount. A "therapeutically effective amount" means the amount of the active agent that elicits the desired therapeutic effect. Therapeutic efficacy and toxicity can be determined by standard procedures in cell culture or test animals, e.g., ED 50 (the dose effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio ED 50 / LD 50 Pharmaceutical compositions that exhibit large therapeutic indices are preferred.

[0214] Dose

[0215] The exact dose of the TCR polynucleotide, vector, or host cell can be determined by one skilled in the art using known techniques. A suitable dose provides a sufficient amount of the active agent of the present application, and is preferably therapeutically effective, i.e., elicits the desired therapeutic effect.

[0216] Adjustments for therapeutic purposes (e.g., to alleviate maintenance versus acute attack of disease), route and frequency of administration, time and frequency of administration of formulation, age, body weight, general health, sex, diet, severity of the disease state, drug combinations, reaction sensitivities, and tolerance / response to treatment are made as is known in the art. Dosage regimens suitable for soluble TCRs, e.g., as described herein, can be determined using data from cell culture assays and animal studies and can include ED 50 Generally, dosage values can range from 0.1 microgram to 100,000 micrograms, with the total dose being about 2 grams, depending upon the route of administration. Exemplary dosages of the active agents of the present application are in the range of about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 1 mg / kg, or about 0.1 mg / kg to about 1 mg / kg. Guidance as to particular dosages and methods of delivery is provided in the literature. It is appreciated that the treatment can require a single administration of a therapeutically effective dose, or multiple administrations of a therapeutically effective dose of the active agents of the present application. For example, some pharmaceutical compositions can be administered every 3-4 days, every week, or every two weeks, or once within a month, depending upon the formulation, half-life, and clearance rate of the particular composition. As previously indicated, the pharmaceutical compositions can optionally comprise one or more excipients and / or additional active agents.

[0217] Excipients

[0218] The term "excipient" includes fillers, binders, disintegrants, coatings, adsorbents, antiadherents, glidants, preservatives, antioxidants, flavoring agents, coloring agents, sweetening agents, solvents, cosolvents, buffers, chelating agents, viscosity conferring agents, surfactants, diluents, humectants, carriers, diluents, preservatives, emulsifiers, stabilizers, and tonicity adjusting agents. The selection of excipients suitable for the preparation of the desired pharmaceutical compositions of the present application is within the knowledge of those skilled in the art. Exemplary carriers for the pharmaceutical compositions of the present application include saline, buffered saline, dextrose, and water. Generally, the selection of suitable excipients depends, inter alia, on the active agent used, the disease to be treated, and the desired formulation of the pharmaceutical composition.

[0219] Additional Active Agents

[0220] The present application further provides pharmaceutical compositions comprising one or more of the above-identified active agents of the present application (e.g., host cells or TCR constructs), together with one or more additional active agents suitable for treating and / or preventing the disease to be treated. Preferred examples of active ingredients suitable for combination include known anti-cancer drugs such as cis-platin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photofrin II, temozolmide, topotecan, trimetreate glucuronate, auristatin E vincristine and doxorubicin; and peptide cytotoxins such as ricin, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNase and RNase; radionuclides such as iodine 131, rhenium 186, indium 111, yttrium 90, bismuth 210 and 213, actinium 225 and bismuth 213; prodrugs such as antibody directed enzyme prodrugs; immunostimulants such as IL-2, chemotactic factors such as IL-8, platelet factor 4, melanoma growth stimulatory protein, etc., antibodies or fragments thereof such as anti-CD3 antibodies or fragments thereof, complement activators, xenogeneic protein domains, allogeneic protein domains, viral / bacterial protein domains and viral / bacterial peptides.

[0221] Administration

[0222] A variety of routes can be used for administration of the pharmaceutical compositions according to the present application. Typically, administration is accomplished parentally. Parenteral delivery methods include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual or intranasal administration.

[0223] Formulations

[0224] The pharmaceutical compositions of the present application can be formulated in a variety of forms, depending inter alia on the active agent used (e.g. soluble TCR), e.g. in solid, liquid, gaseous or lyophilized form, and in particular in the form of an ointment, cream, transdermal patch, gel, powder, tablet, solution, aerosol, granule, pill, suspension, emulsion, capsule, syrup, liquid, elixir, extract, tincture or liquid extract, or in a form particularly suitable for the desired method of administration. Methods known per se for producing pharmaceuticals are indicated in the 22ndedition of Remington’s Pharmaceutical Sciences (Ed. Maack Publishing Co, Easton, Pa., 2012) and can include, for example, conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical compositions comprising, for example, host cells or soluble TCR as described herein are typically provided in liquid form and preferably comprise a pharmaceutically acceptable buffer.

[0225] After the pharmaceutical compositions of the present application have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.

[0226] Treatment

[0227] In view of the above, the present application thus provides TCR, nucleic acid, vector and / or host cell as described herein for use as a medicament for the detection, diagnosis, prognosis, prevention and / or treatment of cancer.

[0228] The TCR, nucleic acid, vector and / or host cell can generally be used for the therapeutic detection, diagnosis, prognosis, prevention and / or treatment of a disease or disorder. The term “treatment” in all its grammatical forms includes therapeutic or prophylactic treatment of a subject in need. “Therapeutic or prophylactic treatment” includes prophylactic treatment, which is aimed at completely preventing clinical and / or pathological manifestations, or therapeutic treatment, which is aimed at improving or alleviating clinical and / or pathological manifestations. The term “treatment” thus also includes improvement or prevention of a disease.

[0229] The disease contemplated for treatment when using the pharmaceutical composition of the application is preferably a cancer selected from the group consisting of melanoma, bladder cancer, colon and breast cancer, sarcoma, prostate cancer, uterine cancer, uveal cancer, uveal melanoma, squamous head and neck cancer, synovial cancer, Ewing's sarcoma, triple negative breast cancer, thyroid cancer, testicular cancer, kidney cancer, pancreatic cancer, ovarian cancer, esophageal cancer, non-small cell lung cancer, non-Hodgkin's lymphoma, multiple myeloma, melanoma, hepatocellular carcinoma, head and neck cancer, gastric cancer, endometrial cancer, colorectal cancer, biliary tract cancer, breast cancer, bladder cancer, myeloid leukemia and acute lymphoblastic leukemia, preferably wherein the cancer is selected from the group consisting of NSCLC, SCLC, breast cancer, ovarian cancer or colorectal cancer, sarcoma or osteosarcoma.

[0230] The terms "subject" or "individual" or "animal" or "patient" are used interchangeably herein to refer to any subject, particularly a mammalian subject, in need of therapy. Mammalian subjects generally include humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, bovines, and the like. However, it should be readily appreciated that the TCRs, nucleic acids, vectors, host cells, and pharmaceutical compositions provided herein are particularly contemplated for use in treating human subjects, particularly HLA-A2 positive subjects.

[0231] Direct administration

[0232] For therapy, the TCRs of the application, particularly the soluble TCRs of the application, nucleic acids, vectors, such as viral vectors, or host cells can be administered directly to a subject in need thereof. Accordingly, the application provides a TCR, nucleic acid, vector, or host cell in a method for detecting, diagnosing, prognosing, preventing, and / or treating cancer. The method can comprise the steps of: (a) providing one or more of (i) a TCR, (ii) a nucleic acid, (iii) a vector, (iv) a host cell, and / or (v) a pharmaceutical composition of the application; and (b) administering one or more of (i)-(v) to a subject in need thereof. Optionally, the method can comprise a further step of cancer therapy, such as radiation, or administration of one or more anti-cancer agents.

[0233] Ex vivo therapy

[0234] The treatment according to the application can also comprise the steps of: (a) providing a sample of a subject, said sample comprising lymphocytes; (b) providing one or more of (i) a TCR, (ii) a nucleic acid, (ii) a vector, (iv) a host cell, and / or (v) a pharmaceutical composition of the application, (c) introducing one or more of (i)-(v) of step (b) into the lymphocytes of step (a), thereby obtaining modified lymphocytes, (d) administering the modified lymphocytes of step (c) to a subject or patient in need thereof.

[0235] It is particularly envisaged that the lymphocytes provided in step (a) are "effector host cells" as described hereinbefore, and are advantageously selected from T cells, NK cells and / or NKT cells, in particular CD8 + T cells; and can be obtained from a sample, in particular a blood sample, of the subject in a previous step by conventional methods known in the art. However, it is also conceivable to use other lymphocytes which are preferably capable of expressing a TCR of the application and exerting the desired biologic effector function as described herein. Furthermore, the lymphocytes are typically selected to be compatible with the immune system of the subject, i.e. they will preferably not elicit an immunogenic response. For example, it is conceivable to use "universal recipient cells", i.e. universal compatible lymphocytes which can be grown and expanded in vitro and exert the desired biologic effector function. Thus, the use of such cells will avoid the need to obtain and provide the subject's own lymphocytes in step (a).

[0236] The ex vivo introduction of step (c) can be performed by introducing the nucleic acid or vector described herein into the lymphocytes by electroporation, or by infecting the lymphocytes with a viral vector, such as a lentiviral or retroviral vector as described previously in the context of effector host cells. Other conceivable methods include the use of transfection reagents, such as liposomes, or transient RNA transfection. The transfer of antigen-specific TCR genes into (primary) T cells by, e.g., (retro) viral vectors or transient RNA transfection represents a promising tool for the generation of tumor-associated antigen-specific T cells which can subsequently be re-introduced into a donor, in which they specifically target and destroy tumor cells expressing said antigen. In the present application, the tumor-associated antigen is PRAME as defined herein, in particular the HLA-A*02 binding form thereof.

[0237] The treatment according to the application can also comprise the following steps: (a) providing a sample of a subject, said sample comprising lymphocytes; and the treatment consists of: (b) providing one or more of (i) a TCR, (ii) a nucleic acid, (iii) a vector, (iv) a host cell and (v) a pharmaceutical composition; (c) introducing one or more of (i) to (v) of step (b) into the lymphocytes of step, thereby obtaining modified lymphocytes, (d) administering the modified lymphocytes of step (c) to a subject or patient in need thereof.

[0238] In view of the above, the present application therefore also relates to the use of a TCR, a nucleic acid sequence, a vector and / or a host cell as described elsewhere herein for the production of modified lymphocytes. Means and methods for introducing e.g. nucleic acids and vectors into lymphocytes have been described elsewhere herein.

[0239] Diagnostic composition

[0240] The present application also provides diagnostic compositions comprising as one or more diagnostic agents a TCR, nucleic acid, vector and / or host cell as described herein. Typically, the diagnostic agent will comprise a means for detecting its binding to its antigenic target, for example a label as described in the context of the TCR constructs of the present application. With respect to host cells, it is for example conceivable to use a modified host cell which comprises a dye or contrast agent which is released upon antigen recognition (rather than a cytotoxic particle).

[0241] Use

[0242] The present application envisages the use of the diagnostic agents described hereinbefore for detecting, diagnosing and / or prognosing cancer in a subject, which can be done in vivo or in vitro.

[0243] The present application therefore provides a diagnostic composition for detecting, diagnosing cancer in a subject in vivo, said composition comprising as a diagnostic agent a TCR, nucleic acid, vector and / or host cell of the present application. The method typically comprises (a) administering the diagnostic agent to the subject, and (b) detecting the binding of the diagnostic agent to its antigenic target.

[0244] Furthermore, the present application provides a method for detecting, diagnosing and / or prognosing cancer in a subject in vitro. According to the present application, there is also provided a method of detecting the presence of cancer in a subject, said method comprising the steps of: (a) providing a sample of the subject, said sample comprising one or more cells; (b) contacting the sample with a TCR, host cell and / or pharmaceutical composition of the present application; thereby forming a complex, and (c) detecting the complex. It is envisaged that the complex is indicative of the binding of the diagnostic agent to its antigenic target, and of the presence of a (cancer) cell expressing said antigenic target.

[0245] In both methods, the binding of the diagnostic agent to its antigenic target is detectable by using conventional methods known in the art, and will depend inter alia on the specific diagnostic agent used. Suitable labels which can be coupled to the diagnostic agents of the present application are exemplified in the section relating to labeled TCR constructs.

[0246] Furthermore, the present application envisages the use of a TCR, nucleic acid or vector as described herein for the production of a modified lymphocyte. As described elsewhere herein, preferred lymphocytes include, but are not limited to, cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells.

[0247] It must be noted that, as used herein, the singular articles "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a reagent" includes one or more of the different reagents, and reference to "the method" includes reference to equivalent steps and methods known to those with ordinary skill in the art that could be substituted or modified for the methods described herein.

[0248] The term "at least" preceding a series of elements, unless otherwise indicated, is to be understood to refer to every element in the series. One skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. The application is intended to include all such equivalents.

[0249] As used herein, the term "and / or" includes the meanings "and", "or", and "any or all of the elements connected by the term.

[0250] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It also includes the specific number, however. For example, "about 20" includes 20.

[0251] The term "less than" or "greater than" includes the specific number. For example, less than 20 means less than or equal to. Similarly, more than or greater than means more than or equal to, or greater than or equal to, respectively.

[0252] Throughout this specification and the claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The term "comprising" as used herein to describe the composition of a product, process, method or apparatus is to be construed as "including" rather than "consisting of". The term "consisting of" is to be construed as "including the recited elements only and excluding any other element".

[0253] "Consisting of" excludes any element, step, or ingredient not specified in the claim. "Consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0254] In each instance herein, any of the terms "including", "consisting essentially of" and "consisting of" can be replaced with either of the other two terms.

[0255] It is to be understood that this application is not limited to the particular methodology, protocols, materials, reagents, and substances etc. described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present application which is limited only by the claims.

[0256] All publications and patents (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) cited herein are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the application is not entitled to antedate such disclosure by virtue of prior application. To the extent the material incorporated by reference contradicts or contradicts any portion of this specification, the present specification shall control.

[0257] A better understanding of the present application and of its advantages will be gained from the following examples, which are provided for illustrative purposes only. The examples are not intended to limit the scope of the present application in any way.

[0258] Embodiments of the present application

[0259] The following examples illustrate the present application but are not to be construed as limiting the scope of the present application.

[0260] Table 2: Overview of TCRs tested in the examples.

[0261]

[0262] Example 1 : Peptide specificity

[0263] T2 cells were loaded with the specific SLL peptide (SLLQHLIGL) or an unrelated peptide (GLSNTHVL) at a concentration of 10 -5 M for 1.5 h at 37°C. These cells were then co-cultured with TCR transduced T cells at an effector: target ratio of 1 : 1 (using 10.000 effector cells / 96 well). After 20 h, IFN-g levels in the cell culture supernatant were measured using a standard IFN-g ELISA. All TCR transduced effector cells showed recognition of the specific SLL peptide, but not the unrelated peptide, when loaded on T2 cells (Figure 1). Figure 1

[0264] Example 2: Functional avidity

[0265] ​The goal of this experiment was to measure the functional avidity of SLL peptide specific TCRs. Functional avidity refers to the cumulative strength of multiple avidities such as individual non-covalent binding interactions between transgenic TCRs and pMHC complexes. The functional avidity of a population of TCR transgenic T cells was measured as the half maximal relative IFN-g release (EC -5 M to 10 -12 M; co-cultures with T2 cells (effector: target 1 : 1, 10.000 effector cells / 96 well) loaded with different peptides (10 50 M at 37°C for 1.5 hours) were performed.

[0266] The readout used was a standard IFN-g ELISA after 20 hours of co-culture (values above 4000 pg were extrapolated using a cubic polynomial).

[0267] Results:

[0268] 027-004 TCR transduced T cells showed higher functional avidity compared to 3825 TCR transduced T cells, indicating a higher sensitivity to very low amounts of target peptide Figure 2 .

[0269] 027-004 TCR transduced T cells showed higher functional avidity compared to T cells transduced with TCRs published in the art, indicating a higher sensitivity to very low amounts of target peptide Figure 13 .

[0270] Example 3: TCR recognition motifs (serine and threonine scanning)

[0271] The goal of this experiment was to evaluate key residues in the SLL epitope sequence that are essential for direct recognition by the TCR or peptide binding to HLA-A*02:01 encoded molecules. Amino acid substitution scanning was used to define key amino acids in the epitope sequence that abolish recognition by the TCR whenever these residues are exchanged for the amino acids serine or threonine. These "fixed" amino acids can be used to define a unique TCR recognition motif. Serine or threonine residues were used to systematically replace individual amino acids in the PRAME peptide (serine and threonine scanning).

[0272] In vitro co-cultures of TCR transduced T cells with T2 cells were loaded (1.5 hours at 37°C) with 10 -5 M of different peptides at a 1 : 1 E:T ratio (10.000 effector cells / 96 well).

[0273] Readout: standard IFN-g ELISA after 20 hours of co-culture (values above 4000 pg were extrapolated using a cubic polynomial).

[0274] Results:

[0275] In the serine scan, 027-004 TCR transduced T cells showed different recognition motifs with less fixed positions compared to 3825 TCR transduced T cells Figure 3 ).

[0276] In the threonine scan, 027-004 TCR transduced T cells showed different recognition motifs compared to other TCRs published in the art Figure 12 ).

[0277] Table 3: Overview of target cells used for tumor cell recognition. *Data derived from http: / / celllines.tron-mainz.de / .

[0278]

[0279] Table 4: Overview of target cells used for tumor cell killing. *Data derived from http: / / celllines.tron-mainz.de / .

[0280]

[0281] Example 4: Tumor cell recognition and tumor cell killing

[0282] For tumor cell recognition, effector cells transduced with TCR 027-004 or TCR 3825 were co-cultured with PRAME SLL positive or PRAME SLL negative tumor cells at an E:T ratio of 1 : 1 (10.000 effector cells / 96 well) for 20 hours at 37°C, 6% C02. IFN-g secretion of effector cells was determined using a standard IFN-g ELISA (using a cubic polynomial extrapolation for values above 4000 pg).

[0283] Results:

[0284] TCR 027-004 transduced effector cells showed better recognition of tumor cells (e.g. MeIA375) compared to 3825 TCR transduced T cells Figure 4 ).

[0285] TCR 027-004 transduced effector cells showed better recognition of tumor cells (MeIA375, NCI-H1650 and NCI-H1703) compared to T cells transduced with TCRs known in the art Figure 14 ).

[0286] For tumor cell killing, effector cells transduced with TCR 027-004 or TCR 3825 were seeded in flat bottom wells NucLightRed lentivirus transduced tumor cells.

[0287] After addition of 20.000 effector cells per well, tumor cells (2.500 cells in case of 647V, 5.000 cells for all other tumor cell lines) were added and the plates were transferred to the IncuCyte device and the expansion of red fluorescent cells was monitored for 100 hours at 37°C and 6% C02, taking pictures every 4 hours.

[0288] All TCR transduced effector cells lysed PRAME SLL positive tumor cells (PRAME-pos) and did not affect the growth of PRAME SLL negative tumor cells (PRAME-neg).

[0289] Results:

[0290] TCR 027-004 transduced effector cells showed better killing of tumor cells (e.g. MeIA375) compared to 3825 TCR transduced T cells Figure 5 .

[0291] TCR 027-004 transduced effector cells showed better killing of tumor cells (MeIA375 and NCI-H1650) compared to T cells transduced with a TCR known in the art Figure 15 .

[0292] Example 5: Normal cell recognition

[0293] The goal of this set of experiments was to evaluate potential on-target / off-tumor and off-target toxicities that can be caused by effector cells transduced with PRAME specific TCRs. To this end, it was tested whether primary cells expressing HLA-A*02:01 and induced pluripotent stem cell (iPS) derived cell lines representing essential tissues or organs are recognized by TCR transduced T cells.

[0294] In vitro co-culture experiments were performed at adjusted E:T ratios according to the individual target cell type (40.000 effector cells / 96 well). Depending on the nature of the individual target, cells were seeded at cell densities according to the manufacturer's instructions 1 to 7 days before the start of the co-culture and were cultured in monolayers in flat bottom wells. Low dose IFN-γ was used in the culture medium to induce HLA-A2 expression on neurons.

[0295] PRAME mRNA expression of all tested normal cells was analyzed by quantitative real-time polymerase chain reaction (qPCR) to distinguish on-target / off-tumor toxicities from potential off-target toxicities. 10 -5Target cells for M peptide were used as internal positive control (SLL peptide).

[0296] Readout: standard IFN-gamma / IL-2 ELISA after 20 hours of co-culture.

[0297] Results: TCR transduced T cell populations do not recognize un-loaded normal cells in a way that leads to high levels of IFN-gamma production. However, if the cells are loaded with the specific SLL peptide, they are recognized. Co-cultures with un-loaded RPTECs produce minimal IFN-gamma production in both samples, as the known endogenous expression of PRAME in this cell type is known to be low Figure 6 ).

[0298] Example 6: HLA-A*02 fine typing

[0299] The aim of the experiment was to determine if common HLA-A2 suballeles (HLA-A*02:xx; allele nomenclature according to: www.hla.alleles.org) other than HLA-A*02:01, which are able to present the PRAME SLL epitope and can be recognized by the SLL specific TCR alone (HLA restriction fine-typing), are present in the patient cohort. Therefore, patients expressing these recognized HLA-A2 suballeles can also be included in the study cohort Figure 7 ).

[0300] TCR transduced T cells with an E:T ratio of 1 :2 (10.000 effector cells / 96 well) were co-cultured in vitro with selected HLA-A2 suballele positive lymphoblastoid cell lines (LCLs; EBV transformed B cells) for 20 hours at 37°C, 6% CO2. TCR transduced PBLs of one donor were used as effector cells. All individual LCLs were loaded with 10 - 5 M SLL peptide for 1.5 hours and co-cultured with the respective effector cells and tested for IFN-gamma secretion to determine the unique TCR suballele recognition of the transduced T cells. Un-loaded target cells were used as negative control.

[0301] Readout: standard IFN-gamma ELISA after 20 hours of co-culture.

[0302] Results: 027-004 efficiently recognized the PRAME peptide presented by 3 out of 10 tested HLA-A2 suballeles A*02: xx) HLA-A2 suballeles A*02:02 and A*02:04 at levels comparable to A*02:01. Control 3825 efficiently recognized the PRAME peptide presented by 10 out of 10 tested HLA-A2 suballeles (A*02: xxPRAME peptide presented in complex with one of the 1 peptides recognized by HLA-A2 suballeles A*02:01 Figure 8-10 ) and A*02:05

[0303] References:

[0304] Altschul, et al., (1997) Nucleic Acids Res. 25:3389-3402,

[0305] Altschul, et al., (1990) J. Mol. Biol. 215:403-410,

[0306] Chen et al., Adv Drug Deliv Rev. 2013 Oct. 15;65(10):1357-1369

[0307] Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2012)

[0308] EP2173869 (A2)

[0309] Gargett and Brown Front Pharmacol. 2014;5:235

[0310] Kieback et al, Proc Natl Acad Sci USA. 2008 Jan. 15;105(2):623-8

[0311] Maack Publishing Co, Easton, Pa., 2012

[0312] Sambrook et al., Molecular Cloning: A Laboratory Manual (4th edition),

[0313] Schmitt et al., Hum Gene Ther. 2009 November;20(11):1240-1248

[0314] Smith, et al., (1981) J. Mol. Biol. 147:195-197

[0315] Sommermeyer and Uckert, J Immunol. 2010 Jun. 1 ; 184(11):6223-31

[0316] Walseng et al., (2015), PLoS ONE 10(4): e0119559

[0317] Weis, Manon (2015): Charakterisierung Antigen-spezifischer T-Zellen nach Induktion in TCR-humanisierten Dissertation, LMU München Veterinary Faculty Ludwigs University of Munich.

[0318] Xue et al., Clin Exp Immunol. 2005 February; 139(2): 167-172;

[0319] Fiedl et al., Clin Cancer Res 2016 March; 22(5): 1234-1242 for DLBCL

[0320] Mitsuhashi et al., Hematology 2014, 1 / 2014

[0321] Al-Khadairi et al., Journal of Translational Medicine 2019; 17: 9

[0322] WO2019 / 175209A1 SEQUENCE LISTING <110> Medigene Immunotherapies GmbH <120> PRAME TCR receptors and uses thereof <130> MED16815PCT <150> EP19209757.4 <151> 2019-11-18 <160> 33 <170> PatentIn version 3.5 <210> 1 <211> 9 <212> PRT <213> Artificial <220> <223> PRAME epitope, tumor associated antigen <400> 1 Ser Leu Leu Gln His Leu lie Gly Leu 1 5 <210> 2 <211> 5 <212> PRT <213> Artificial <220> <223> CDR1 alpha, human modified <400> 2 Ser lie Phe Asn Thr 1 5 <210> 3 <211> 5 <212> PRT <213> Artificial <220> <223> CDR1 beta, human modified <400> 3 Ser Gly Asp Leu Ser 1 5 <210> 4 <211> 7 <212> PRT <213> Artificial <220> <223> CDR2 alpha, human modified <400> 4 Leu Tyr Lys Ala Gly Glu Leu 1 5 <210> 5 <211> 6 <212> PRT <213> Artificial <220> <223> CDR2 beta, human modified <400> 5 Tyr Tyr Asn Gly Glu Glu 1 5 <210> 6 <211> 16 <212> PRT <213> artificial <220> <223> CDR3 alpha, human modified <400> 6 Cys Ala Gly Leu Ala Asp Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe 1 5 10 15 <210> 7 <211> 15 <212> PRT <213> artificial <220> <223> CDR3 beta, human modified <400> 7 Cys Ala Ser Ser Val Trp Ala Ser Gly Gly Tyr Glu Gln Tyr Phe 1 5 10 15 <210> 8 <211> 108 <212> PRT <213> artificial <220> <223> TCR alpha variable region, human modified <400> 8 Met Leu Leu Glu His Leu Leu Ile Ile Leu Trp Met Gln Leu Thr Trp 1 5 10 15 Val Ser Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln 20 25 30 Glu Gly Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn 35 40 45 Thr Trp Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu 50 55 60 Ile Ala Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr 65 70 75 80 Ala Gln Phe Gly Ile Thr Arg Lys Asp Ser Phe Leu Asn Ile Ser Ala 85 90 95 Ser Ile Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala 100 105 <210> 9 <211> 114 <212> PRT <213> Artificial (artificial) <220> <223> TCR beta variable region, human modified <400> 9 Met Gly Phe Arg Leu Leu Cys Cys Val Ala Phe Cys Leu Leu Gly Ala 1 5 10 15 Gly Pro Val Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr 20 25 30 Ala Thr Gly Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp 35 40 45 Leu Ser Val Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe 50 55 60 Leu Ile Gln Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu 65 70 75 80 Glu Arg Phe Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn 85 90 95 Leu Ser Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser 100 105 110 Ser Val <210> 10 <211> 273 <212> PRT <213> Artificial (artificial) <220> <223> TCR alpha chain (mmC), human modified <400> 10 Met Leu Leu Glu His Leu Leu Ile Ile Leu Trp Met Gln Leu Thr Trp 1 5 10 15 Val Ser Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln 20 25 30 Glu Gly Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn 35 40 45 Thr Trp Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu 50 55 60 Ile Ala Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr 65 70 75 80 Ala Gin Phe Gly lie Thr Arg Lys Asp Ser Phe Leu Asn lie Ser Ala 85 90 95 Ser lie Pro Ser Asp Val Gly lie Tyr Phe Cys Ala Gly Leu Ala Asp 100 105 110 Tyr Gly Gly Ser Gin Gly Asn Leu lie Phe Gly Lys Gly Thr Lys Leu 115 120 125 Ser Val Lys Pro Asn lie Gin Asn Pro Asp Pro Ala Val Tyr Gin Leu 130 135 140 Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe 145 150 155 160 Asp Ser Gin Thr Asn Val Ser Gin Ser Lys Asp Ser Asp Val Tyr lie 165 170 175 Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn 180 185 190 Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala 195 200 205 Phe Asn Asn Ser lie lie Pro Gin Asp Thr Phe Phe Pro Ser Ser Asp 210 215 220 Val Pro Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 225 230 235 240 Asn Leu Asn Phe Gin Asn Leu Ser Val lie Gly Phe Arg lie Leu Leu 245 250 255 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 270 Ser <210> 11 <211> 312 <212> PRT <213> Artificial <220> <223> TCR beta chain mmC, human modified <400> 11 Met Gly Phe Arg Leu Leu Cys Cys Val Ala Phe Cys Leu Leu Gly Ala 1 5 10 15 Gly Pro Val Asp Ser Gly Val Thr Gin Thr Pro Lys His Leu lie Thr 20 25 30 Ala Thr Gly Gin Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp 35 40 45 Leu Ser Val Tyr Trp Tyr Gin Gin Ser Leu Asp Gin Gly Leu Gin Phe 50 55 60 Leu lie Gin Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn lie Leu 65 70 75 80 Glu Arg Phe Ser Ala Gin Gin Phe Pro Asp Leu His Ser Glu Leu Asn 85 90 95 Leu Ser Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser 100 105 110 Ser Val Trp Ala Ser Gly Gly Tyr Glu Gin Tyr Phe Gly Pro Gly Thr 115 120 125 Arg Leu Thr Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val 130 135 140 Ala Val Phe Glu Pro Ser Lys Ala Glu He Ala His Thr Gin Lys Ala 145 150 155 160 Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu 165 170 175 Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp 180 185 190 Pro Gin Pro Leu Lys Glu Gin Pro Ala Leu Asn Asp Ser Arg Tyr Cys 195 200 205 Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gin Asn Pro Arg 210 215 220 Asn His Phe Arg Cys Gin Val Gin Phe Tyr Gly Leu Ser Glu Asn Asp 225 230 235 240 Glu Trp Thr Gin Asp Arg Ala Lys Pro Val Thr Gin He Val Ser Ala 245 250 255 Glu Ala Trp Gly Arg Ala Asp Cys Gly lie Thr Ser Arg Ser Tyr His 260 265 270 Gln Gly Val Leu Ser Ala Thr lie Leu Tyr Glu lie Leu Leu Gly Lys 275 280 285 Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met 290 295 300 Val Lys Arg Lys Asp Ser Arg Gly 305 310 <210> 12 <211> 27 <212> DNA <213> artificial <220> <223> PRAME epitope, tumor associated antigen <400> 12 agcctgctgc agcatctgat tggcctg 27 <210> 13 <211> 15 <212> DNA <213> artificial <220> <223> CDR1 alpha, human modified <400> 13 agcatattta acacc 15 <210> 14 <211> 15 <212> DNA <213> artificial <220> <223> CDR1 beta, human modified <400> 14 tctggagacc tctct 15 <210> 15 <211> 21 <212> DNA <213> artificial <220> <223> CDR2 alpha, human modified <400> 15 ttatataagg ctggtgaatt g 21 <210> 16 <211> 18 <212> DNA <213> artificial <220> <223> CDR2 beta, human modified <400> 16 tattataatg gagaagag 18 <210> 17 <211> 48 <212> DNA <213> artificial <220> <223> CDR3 alpha, human modified <400> 17 tgtgctgggc ttgctgatta tggaggaagc caaggaaatc tcatcttt 48 <210> 18 <211> 45 <212> DNA <213> artificial <220> <223> CDR3 beta, human modified <400> 18 tgtgccagca gcgtatgggc ctccggcggc tacgagcagt acttc 45 <210> 19 <211> 324 <212> DNA <213> artificial <220> <223> TCR alpha variable region, human modified <400> 19 atgctgctgg aacatctgct gatcatcctg tggatgcagc tgacctgggt ttccggccag 60 cagctgaatc agagccctca gagcatgttc atccaagaag gcgaggacgt ttccatgaat 120 tgcaccagca gcagcatctt caacacctgg ctgtggtaca agcaggaccc tggcgaagga 180 ccagtgctgc tgatcgcctt gtacaaagcc ggcgagctga ccagcaacgg cagactgaca 240 gcccagttcg gcattacccg gaaggacagc ttcctgaaca tctccgccag cattccctcc 300 gacgtgggca tctatttttg tgcc 324 <210> 20 <211> 342 <212> DNA <213> Artificial <220> <223> TCR beta variable region, human modified <400> 20 atgggcttca gactgctgtg ctgcgtggcc ttttgtctgc ttggagccgg acctgtggat 60 agcggcgtta cccagacacc taagcacctg atcacagcca caggccagcg cgtgaccctg 120 agatgttctc ctagaagcgg cgacctgagc gtgtactggt atcagcagtc tctggaccag 180 ggcctgcagt tcctgatcca gtactacaac ggcgaggaaa gagccaaggg caacatcctg 240 GAACGGTTCA GC GCC CAG CATTCCCAGATCTGCACAGCG AGCTGAA CCT GAGCAGCCTG 300 GAACGGTTCA GC GCC CAG CATTCCCAGATCTGCACAGCG AGCTGAA CCT GAGCAGCCTG 300 <210> 21 <211> 819 <212> DNA <213> Artificial <220> <223> TCR alpha chain (mmC), human modified <400> 21 ATGCTGCTGGA AC ATCTGCTGA TC ATCCTGTGG ATGCAGCTGA CCTGGGTTCC GGCCAG 60 CAGCTGAA TC AGAGCCCTC AGAGCATGTT CATCCAAGAAGGCGAGGACGTTTCC ATGAA T 120 TGCACCAGCAGCATCTTCAACACCTGGCTGTGGTACAAGCAGGACCC TGGCGAAGGA 180 CCAGTGCTGCTGATCGCCTTGTACAAAGCCGGCGAGCTGACCAGCAACGGC AGACTGACA 240 GCCCAGTTCGGCATTACCCGGAAGGACAGCTTCCTGAACATCTCCGCCAG CATTCCCTCC 300 GACGTGGGCA TCTATTTTTG TGCCGGCCTG GCCGATTACGGCGGCTCTC AGGGAAATCTG 360 ATCTTCGGCA AGGGCACCAAGCTGAGCGTG AAGCCC A AC ATTC AGAACCCCGATCCTGCC 420 GTGTACCAGCTGAGAGACAGC AAGAGCAGCGACAAGAGCGTGTGCCTGTT CACCGACTTC 480 gacagccaga ccaacgtgtc ccagagcaag gacagcgacg tgtacatcac cgacaagacc 540 gtgctggaca tgcggagcat ggacttcaag agcaacagcg ccgtggcctg gtccaacaag 600 agcgatttcg cctgcgccaa cgccttcaac aacagcatta tccccgagga cacattcttc 660 cccagctccg atgtgccctg cgacgtgaag ctggtggaaa agagcttcga gacagacacc 720 aacctgaact tccagaacct gtccgtgatc ggcttcagaa tcctgctgct gaaggtggcc 780 ggcttcaacc tgctgatgac actgagactg tggtccagc 819 <210> 22 <211> 936 <212> DNA <213> artificial <220> <223> TCR β-chain (mmC), human modified <400> 22 atgggcttca gactgctgtg ctgcgtggcc ttttgtctgc ttggagccgg acctgtggat 60 agcggcgtta cccagacacc taagcacctg atcacagcca caggccagcg cgtgaccctg 120 agatgttctc ctagaagcgg cgacctgagc gtgtactggt atcagcagtc tctggaccag 180 ggcctgcagt tcctgatcca gtactacaac ggcgaggaaa gagccaaggg caacatcctg 240 gaacggttca gcgcccagca gttcccagat ctgcacagcg agctgaacct gagcagcctg 300 gaactgggag atagcgccct gtacttctgt gcctctagcg tgtgggcctc tggcggctac 360 gagcagtatt ttggccctgg caccagactg accgtgaccg aggatctgaa gaacgtgttc 420 ccacctgagg tggccgtgtt cgagccttct aaggccgaga ttgcccacac acagaaagcc 480 acactcgtgt gtctggccac cggcttctat cccgatcacg tggaactgtc ttggtgggtc 540 aacggcaaag aggtgcacag cggcgtcagc acagatcccc agcctctgaa agaacagccc 600 gctctgaacg acagccggta ctgtctgagc agcagactga gagtgtccgc caccttctgg 660 cagaacccca gaaaccactt cagatgccag gtgcagttct acggcctgag cgagaacgat 720 gagtggaccc aggacagagc taagcccgtg acacagatcg tgtctgccga agcttggggc 780 agagccgatt gtggcatcac cagcagatct taccaccagg gcgtgctgag cgccaccatc 840 ctgtatgaga tcctgctggg caaagccact ctgtacgccg tgctggtgtc tgccctggtg 900 ctgatggcca tggtcaagcg gaaggatagc agaggc 936 <210> 23 <211> 13 <212> PRT <213> artificial <220> <223> 3825 CDR3 alpha, derived from mouse <400> 23 Cys Ala Val Glu Pro Gly Gly Ser Tyr Ile Pro Thr Phe 1 5 10 <210> 24 <211 > 13 <212> PRT <213> artificial <220> <223> 3825 CDR3 beta, derived from mouse <400> 24 Cys Ala Ser Ser Pro Gly Leu Ser Tyr Glu Gin Tyr Phe 1 5 10 <210> 25 <211 > 8 <212> PRT <213> artificial <220> <223> Unrelated peptide, human <400> 25 Gly Leu Ser Asn Thr His Val Leu 1 5 <210> 26 <211 > 140 <212> PRT <213> artificial <220> <223> TCR alpha constant, derived from human <400> 26 Ile Gin Asn Pro Asp Pro Ala Val Tyr Gin Leu Arg Asp Ser Lys Ser 1 5 10 15 Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gin Thr Asn 20 25 30 Val Ser Gin Ser Lys Asp Ser Asp Val Tyr He Thr Asp Lys Thr Val 35 40 45 Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp 50 55 60 Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser He 65 70 75 80 He Pro Gin Asp Thr Phe Phe Pro Ser Pro Gin Ser Ser Cys Asp Val 85 90 95 Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gin 100 105 110 Asn Leu Ser Val He Gly Phe Arg He Leu Leu Leu Lys Val Ala Gly 115 120 125 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 130 135 140 <210> 27 <211> 177 <212> PRT <213> Artificial (artificial) <220> <223> TCR beta-01 constant, derived from Homo sapiens <400> 27 Glu Asp Leu Asn Lys Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 1 5 10 15 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 35 40 45 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 50 55 60 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 65 70 75 80 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 85 90 95 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 100 105 110 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 115 120 125 Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gln Gln Gly Val Leu Ser 130 135 140 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 145 150 155 160 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 165 170 175 Phe <210> 28 <211> 179 <212> PRT <213> artificial <220> <223> TCR beta-02 constant, derived from human <400> 28 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 1 5 10 15 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 35 40 45 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 50 55 60 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 65 70 75 80 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 85 90 95 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 100 105 110 Arg Ala Lys Pro Val Thr Gin He Val Ser Ala Glu Ala Trp Gly Arg 115 120 125 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gin Gin Gly Val Leu Ser 130 135 140 Ala Thr He Leu Tyr Glu He Leu Leu Gly Lys Ala Thr Leu Tyr Ala 145 150 155 160 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 165 170 175 Ser Arg Gly <210> 29 <211> 140 <212> PRT <213> Artificial (artificial) <220> <223> TCR alpha constant, derived from mouse <400> 29 Ile Gin Asn Pro Asp Pro Ala Val Tyr Gin Leu Arg Asp Ser Lys Ser 1 5 10 15 Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gin Thr Asn 20 25 30 Val Ser Gin Ser Lys Asp Ser Asp Val Tyr He Thr Asp Lys Thr Val 35 40 45 Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp 50 55 60 Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile 65 70 75 80 Ile Pro Glu Asp Thr Phe Phe Pro Ser Ser Asp Val Pro Cys Asp Val 85 90 95 Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln 100 105 110 Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly 115 120 125 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 130 135 140 <210> 30 <211> 179 <212> PRT <213> Artificial (artificial) <220> <223> TCR beta constant, derived from mouse <400> 30 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 1 5 10 15 Ser Lys Ala Glu Ile Ala His Thr Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 35 40 45 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gin Pro Leu Lys 50 55 60 Glu Gin Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 65 70 75 80 Arg Val Ser Ala Thr Phe Trp Gin Asn Pro Arg Asn His Phe Arg Cys 85 90 95 Gln Val Gin Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gin Asp 100 105 110 Arg Ala Lys Pro Val Thr Gin He Val Ser Ala Glu Ala Trp Gly Arg 115 120 125 Ala Asp Cys Gly He Thr Ser Arg Ser Tyr His Gin Gly Val Leu Ser 130 135 140 Ala Thr He Leu Tyr Glu He Leu Leu Gly Lys Ala Thr Leu Tyr Ala 145 150 155 160 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 165 170 175 Ser Arg Gly <210> 31 <211> 136 <212> PRT <213> Artificial <220> <223> TCR alpha murC constant, murinized <400> 31 Ile Gin Asn Pro Glu Pro Ala Val Tyr Gin Leu Lys Asp Pro Arg Ser 1 5 10 15 Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp Ser Gin Ile Asn 20 25 30 Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr Asp Lys Thr Val 35 40 45 Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp 50 55 60 Ser Asn Gin Thr Ser Phe Thr Cys Gin Asp Ile Phe Lys Gin Thr Asn 65 70 75 80 Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Gin 85 90 95 Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gin Asn Leu Ser Val 100 105 110 Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu 115 120 125 Met Thr Leu Arg Leu Trp Ser Ser 130 135 <210> 32 <211> 173 <212> PRT <213> Artificial (artificial) <220> <223> TCR beta murC constant, murinized <400> 32 Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Thr Leu Phe Glu Pro 1 5 10 15 Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 35 40 45 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys 50 55 60 Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala 65 70 75 80 Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe 85 90 95 His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro 100 105 110 Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 115 120 125 Ile Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser Ala Thr Ile Leu 130 135 140 Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser 145 150 155 160 Gly Leu Val Leu Met Ala Met Val Lys Lys Lys Asn Ser 165 170 <210> 33 <211> 509 <212> PRT <213> Artificial <220> <223> PRAME full length, derived from human <400> 33 Met Glu Arg Arg Arg Leu Trp Gly Ser Ile Gln Ser Arg Tyr Ile Ser 1 5 10 15 Met Ser Val Trp Thr Ser Pro Arg Arg Leu Val Glu Leu Ala Gly Gln 20 25 30 Ser Leu Leu Lys Asp Glu Ala Leu Ala Ile Ala Ala Leu Glu Leu Leu 35 40 45 Pro Arg Glu Leu Phe Pro Pro Leu Phe Met Ala Ala Phe Asp Gly Arg 50 55 60 His Ser Gln Thr Leu Lys Ala Met Val Gln Ala Trp Pro Phe Thr Cys 65 70 75 80 Leu Pro Leu Gly Val Leu Met Lys Gly Gln His Leu His Leu Glu Thr 85 90 95 Phe Lys Ala Val Leu Asp Gly Leu Asp Val Leu Leu Ala Gln Glu Val 100 105 110 Arg Pro Arg Arg Trp Lys Leu Gin Val Leu Asp Leu Arg Lys Asn Ser 115 120 125 His Gin Asp Phe Trp Thr Val Trp Ser Gly Asn Arg Ala Ser Leu Tyr 130 135 140 Ser Phe Pro Gin Pro Gin Ala Ala Gin Pro Met Thr Lys Lys Arg Lys 145 150 155 160 Val Asp Gly Leu Ser Thr Gin Ala Gin Gin Pro Phe lie Pro Val Gin 165 170 175 Val Leu Val Asp Leu Phe Leu Lys Gin Gly Ala Cys Asp Gin Leu Phe 180 185 190 Ser Tyr Leu lie Gin Lys Val Gin Arg Gin Gin Asn Val Leu Arg Leu 195 200 205 Cys Cys Gin Gin Leu Gin lie Phe Ala Met Pro Met Gin Asp lie Gin 210 215 220 Met lie Leu Lys Met Val Gin Leu Asp Ser lie Gin Asp Leu Gin Val 225 230 235 240 Thr Cys Thr Trp Lys Leu Pro Thr Leu Ala Lys Phe Ser Pro Tyr Leu 245 250 255 Gly Gin Met lie Asn Leu Arg Arg Leu Leu Leu Ser His lie His Ala 260 265 270 Ser Ser Tyr Ile Ser Pro Glu Lys Glu Glu Gin Tyr Ile Ala Gin Phe 275 280 285 Thr Ser Gin Phe Leu Ser Leu Gin Cys Leu Gin Ala Leu Tyr Val Asp 290 295 300 Ser Leu Phe Phe Leu Arg Gly Arg Leu Asp Gin Leu Leu Arg His Val 305 310 315 320 Met Asn Pro Leu Glu Thr Leu Ser Ile Thr Asn Cys Arg Leu Ser Glu 325 330 335 Gly Asp Val Met His Leu Ser Gin Ser Pro Ser Val Ser Gin Leu Ser 340 345 350 Val Leu Ser Leu Ser Gly Val Met Leu Thr Asp Val Ser Pro Glu Pro 355 360 365 Leu Gin Ala Leu Leu Glu Arg Ala Ser Ala Thr Leu Gin Asp Leu Val 370 375 380 Phe Asp Glu Cys Gly Ile Thr Asp Asp Gin Leu Leu Ala Leu Leu Pro 385 390 395 400 Ser Leu Ser His Cys Ser Gin Leu Thr Thr Leu Ser Phe Tyr Gly Asn 405 410 415 Ser Ile Ser Ile Ser Ala Leu Gin Ser Leu Leu Gin His Leu Ile Gly 420 425 430 Leu Ser Asn Leu Thr His Val Leu Tyr Pro Val Pro Leu Glu Ser Tyr 435 440 445 Glu Asp Ile His Gly Thr Leu His Leu Glu Arg Leu Ala Tyr Leu His 450 455 460 Ala Arg Leu Arg Glu Leu Leu Cys Glu Leu Gly Arg Pro Ser Met Val 465 470 475 480 Trp Leu Ser Ala Asn Pro Cys Pro His Cys Gly Asp Arg Thr Phe Tyr 485 490 495 Asp Pro Glu Pro Ile Leu Cys Pro Cys Phe Met Pro Asn 500 505

Claims

1. A T cell receptor (TCR) capable of binding to a PRAME peptide having the amino acid sequence SLLQHLIGL (SEQ ID NO: 1) or a portion thereof or its HLA-A2 binding form, wherein the TCR comprises: a) a CDR3 of a TCR a chain variable region consisting of the amino acid sequence of SEQ ID NO: 6; a CDR1 of a TCR a chain variable region consisting of the amino acid sequence of SEQ ID NO: 2; and a CDR2 of a TCR a chain variable region consisting of the amino acid sequence of SEQ ID NO: 4, and b) a CDR3 of a TCR β chain variable region consisting of the amino acid sequence of SEQ ID NO: 7; a CDR1 of a TCR β chain variable region consisting of the amino acid sequence of SEQ ID NO: 3; and a CDR2 of a TCR β chain variable region consisting of the amino acid sequence of SEQ ID NO:

5.

2. The TCR of claim 1, wherein the PRAME peptide is presented on an HLA-A2 encoding molecule that is HLA-A*02:01, HLA-A*02:02, or HLA-A*02:

04.

3. The TCR of claim 1, wherein binding to the sequence SLLQHLIGL (SEQ ID NO: 1) or a portion thereof or its HLA-A2 binding form induces IFN-γ secretion by a cell transduced or transfected with the TCR.

4. The TCR of claim 3, wherein the half-maximal IFN-γ secretion is less than 10 -7 M.

5. The TCR of claim 1, wherein the TCR comprises: a) a TCR a chain comprising a CDR1 consisting of the amino acid sequence of SEQ ID NO: 2, a CDR2 consisting of the amino acid sequence of SEQ ID NO: 4, and a CDR3 consisting of the amino acid sequence of SEQ ID NO: 6, and b) a TCR β chain comprising a CDR1 consisting of the amino acid sequence of SEQ ID NO: 3, a CDR2 consisting of the amino acid sequence of SEQ ID NO: 5, and a CDR3 consisting of the amino acid sequence of SEQ ID NO:

7.

6. The TCR of claim 1, comprising a) a TCR a chain variable region comprising the amino acid sequence of SEQ ID NO: 8, and b) a TCR β chain variable region comprising the amino acid sequence of SEQ ID NO:

9.

7. The TCR of claim 1, comprising a) a TCR a chain comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 10 or an amino acid sequence at least 80% identical to SEQ ID NO: 10; and b) a TCR β chain comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 11 or an amino acid sequence at least 80% identical to SEQ ID NO:

11.

8. The TCR of claim 7, comprising: a) a TCR a chain comprising or consisting of an amino acid sequence which is at least 90% or 95% identical to SEQ ID NO: 10; and b) a TCR β chain comprising or consisting of an amino acid sequence which is at least 90% or 95% identical to SEQ ID NO:

11.

9. The TCR according to claim 1, which is selected from the group consisting of an original TCR, a TCR variant, a TCR fragment or a TCR construct.

10. A TCR construct comprising a TCR according to claim 1 and at least one molecular tag.

11. The TCR according to claim 1, which is soluble.

12. A nucleic acid encoding a TCR according to any one of claims 1-9 and 11.

13. The nucleic acid according to claim 12, which comprises the nucleic acid sequence of SEQ ID NO: 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.

14. A vector comprising a nucleic acid according to claim 12 or 13.

15. A host cell comprising a TCR according to any one of claims 1 to 9 and 11, a TCR construct according to claim 10, a nucleic acid sequence according to claim 12 or 13 or a vector according to claim 14.

16. The host cell according to claim 15, which is selected from the group consisting of lymphocytes, including but not limited to cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, gamma / delta-T cells.

17. A method of obtaining a TCR according to any one of claims 1-9 and 11, the method comprising a) incubating a host cell according to claim 15 or 16 under conditions which lead to expression of the TCR, b) purifying the TCR.

18. A pharmaceutical or diagnostic composition comprising one or more of: a) a TCR according to any one of claims 1 to 9 and 11 or a TCR construct according to claim 10; b) a nucleic acid according to claim 12 or 13; c) a vector according to claim 14; and / or d) a host cell according to claim 15 or 16, and optionally a pharmaceutical excipient.

19. The pharmaceutical composition according to claim 18, further comprising a checkpoint inhibitor.

20. The pharmaceutical composition according to claim 19, wherein the checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a PD-1 inhibitor and a PD-L1 inhibitor. ​ ​ ​ ​ ​ ​ ​ 21. Use of a TCR according to any one of claims 1 to 9 and 11, a TCR construct according to claim 10, a nucleic acid according to claim 12 or 13, a vector according to claim 14, a host cell according to claim 15 or 16, and / or a pharmaceutical composition according to any one of claims 18 to 20, for the manufacture of a medicament for the prevention and / or treatment of a PRAME-expressing cancer, wherein the PRAME-expressing cancer is a melanoma, bronchioloalveolar carcinoma or lung adenocarcinoma.

22. Use of a TCR according to any one of claims 1 to 9 and 11, a TCR construct according to claim 10, a nucleic acid according to claim 12 or 13, a vector according to claim 14, a host cell according to claim 15 or 16, and / or a pharmaceutical composition according to any one of claims 18 to 20, for the manufacture of a reagent for the detection, diagnosis and / or prognosis of a PRAME-expressing cancer, wherein the PRAME-expressing cancer is a melanoma, bronchioloalveolar carcinoma or lung adenocarcinoma.

23. Use of a lymphocyte for the manufacture of a medicament for the prevention and / or treatment of a PRAME-expressing cancer, wherein the PRAME-expressing cancer is a melanoma, bronchioloalveolar carcinoma or lung adenocarcinoma, wherein the lymphocyte has been modified by introducing into the lymphocyte one or more of (i) to (v), and thereby obtaining a modified lymphocyte: (i) a TCR according to any one of claims 1 to 9 and 11 or a TCR construct according to claim 10; (ii) a nucleic acid according to claim 12 or 13; (iii) a vector according to claim 14; (iv) a host cell according to claim 15 or 16; and (v) a pharmaceutical composition according to any one of claims 18 to 20.

24. Use of (i) a TCR according to any one of claims 1 to 9 and 11 or a TCR construct according to claim 10; (ii) a host cell according to claim 15 or 16; and / or (iii) a pharmaceutical composition according to any one of claims 18 to 20, for the manufacture of a reagent for the detection of the presence of a PRAME-expressing cancer in a subject, wherein the PRAME-expressing cancer is a melanoma, bronchioloalveolar carcinoma or lung adenocarcinoma.

25. Use of a TCR according to any one of claims 1 to 9 and 11, a TCR construct according to claim 10, a nucleic acid according to claim 12 or 13, and / or a vector according to claim 14, for the in vitro production of a modified lymphocyte.

Images