Streptococcus pneumoniae glycoprotein bioconjugate vaccine and methods of making and using the same
By preparing a pneumococcal glycoprotein conjugate vaccine, the shortcomings of existing preparation methods have been overcome, achieving efficient glycoprotein expression and purification, improving the vaccine's immunogenicity, and possessing significant application and promotion value.
Patent Information
- Application Number
- CN202210756857.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-30
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2042-06-30
AI Technical Summary
Existing technologies are insufficient for the effective preparation of pneumococcal glycoprotein conjugate vaccines. The lack of efficient glycosylation systems and purification methods results in poor vaccine immunization efficacy.
Using recombinant plasmid DNA molecules A and B or C, pneumococcal K5 serotype CPS and cholera toxin B subunit were expressed in Escherichia coli W3110△waaL△wbbH-L. The CPS and cholera toxin B subunit were transferred to the carrier protein using the PglL system. Combined with Ni-column affinity chromatography and molecular sieve separation and purification technology, a high-efficiency glycoprotein vaccine was prepared.
This study achieved efficient expression and purification of Streptococcus pneumoniae glycoproteins, enhanced the immunogenicity of vaccines, demonstrated significant and safe immunoprotective effects, and provided important applications for the treatment of diseases caused by Streptococcus pneumoniae.
Smart Images

Figure HDA0003722837490000011 
Figure HDA0003722837490000012 
Figure HDA0003722837490000013
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biological medicine, and relates to a Streptococcus pneumoniae glycoprotein bio-conjugate vaccine, a preparation method and application thereof. BACKGROUND
[0002] Streptococcus pneumoniae was first isolated from sputum of patients by Louis Pasteur and G.M. Sternberg in France and the United States in 1881, respectively. The typical Streptococcus pneumoniae is a gram-positive bacterium with micro-acicular globular shape, double or short chain arrangement, facultative anaerobic, single bacterial diameter between 0.5 to 1.25 μm, with a capsule, no flagellum, no spore formation, and no autonomous movement. The bacterium has high requirements for nutrients, and hemolytic rings are generated due to alpha hemolysis when blood plate is cultured, forming circular, flat, and grayish white colonies. The bacterium has the ability of enzymatic lysis of its own cells, and autolysis occurs after entering the growth slow phase due to nutrient depletion and gradual accumulation of toxins.
[0003] Streptococcus pneumoniae normally colonizes the upper respiratory tract (including throat and nasal cavity) of mammals, and only causes diseases when over-proliferating, mainly causing lobar pneumonia in humans, and the main symptoms are sudden onset, cough with rust-colored sputum, chills, high fever, rapid breathing, and chest pain. A small number of patients can have bacteremia during the high fever period. The pathological manifestations are mainly a large amount of fibrin exudate in the initial alveoli, followed by red blood cells and white blood cells exuding into the alveoli, and finally leading to consolidation of lung tissue at the lesion site. Since the lesion usually involves the entire lung lobe, it is called lobar pneumonia. Streptococcus pneumoniae can also invade other parts of the body, causing acute otitis media, purulent meningitis, sepsis, bacteremia, etc. SUMMARY
[0004] The present application aims to provide a Streptococcus pneumoniae glycoprotein bio-conjugate vaccine, a preparation method and application thereof.
[0005] The present application provides application of the recombinant plasmid with DNA molecule A and the recombinant plasmid with DNA molecule B in preparation of a Streptococcus pneumoniae vaccine;
[0006] The DNA molecule A has a CPS synthesis related gene cluster of Streptococcus pneumoniae K5 serotype;
[0007] The DNA molecule B has a pglL gene and a fusion gene I; the fusion gene I comprises, from upstream to downstream, an NP gene and a gene encoding a glycosylation site.
[0008] The present application also protects application of the recombinant plasmid with DNA molecule A and the recombinant plasmid with DNA molecule C in preparation of a Streptococcus pneumoniae vaccine;
[0009] The DNA molecule A contains gene clusters related to the synthesis of CPS in Streptococcus pneumoniae K5 serotype;
[0010] The DNA molecule C contains the pglL gene and fusion gene II; the fusion gene includes, from upstream to downstream, a gene encoding the cholera toxin B subunit and a gene encoding a glycosylation site.
[0011] This invention also protects the use of recombinant plasmids containing DNA molecule A, recombinant plasmids containing DNA molecule B, and Escherichia coli W3110△waaL△wbbH-L in the preparation of pneumococcal vaccines.
[0012] This invention also protects the use of recombinant plasmids containing DNA molecule A, recombinant plasmids containing DNA molecule C, and Escherichia coli W3110△waaL△wbbH-L in the preparation of pneumococcal vaccines.
[0013] The present invention also protects a recombinant bacterium, which is obtained by introducing a recombinant plasmid containing DNA molecule A and a recombinant plasmid containing DNA molecule B into Escherichia coli W3110△waaL△wbbH-L.
[0014] The present invention also protects a recombinant bacterium obtained by introducing a recombinant plasmid containing DNA molecule A and a recombinant plasmid containing DNA molecule C into Escherichia coli W3110△waaL△wbbH-L.
[0015] This invention also protects the use of any of the above-described recombinant bacteria in pneumococcal vaccines.
[0016] The present invention also provides a method for preparing a pneumococcal vaccine, comprising the following steps: culturing any of the recombinant bacteria described above and collecting glycoproteins to obtain a pneumococcal vaccine.
[0017] The present invention also provides a pneumococcal vaccine, the active ingredient of which is a glycoprotein obtained by culturing any of the recombinant bacteria described above.
[0018] The present invention also provides a kit for preparing a pneumococcal vaccine, comprising a recombinant plasmid having DNA molecule A and a recombinant plasmid having DNA molecule B.
[0019] The present invention also provides a kit for preparing a pneumococcal vaccine, comprising a recombinant plasmid having DNA molecule A and a recombinant plasmid having DNA molecule C.
[0020] The kits described above also include Escherichia coli W3110△waaL△wbbH-L.
[0021] The gene cluster related to CPS synthesis in Streptococcus pneumoniae K5 serotype includes the following genes: wzg, wzh, wzd, wze, wciI, wciJ, wzy, wzx, whaC, whaD, whaE, fnlA, ugd, fnlB, fnlC, and tnp1-5.
[0022] The DNA molecule A described above is specifically shown as nucleotides 201-19765 in sequence 1 of the sequence listing.
[0023] The DNA molecule A described above is specifically shown in Sequence 1 of the sequence listing.
[0024] The recombinant plasmid containing DNA molecule A can be specifically formed by inserting the double-stranded DNA molecule shown in Sequence 1 of the sequence listing between the ApalI and SfiI restriction sites of the pCC1BAC vector (replacing the small fragment between the two restriction recognition sequences), resulting in the recombinant plasmid (recombinant plasmid pBAC-CPS). SpK5 The pCC1BAC vector is a circular plasmid, and its full sequence is shown in Sequence 6 of the sequence listing.
[0025] The DNA molecule B described above is specifically shown in sequence 5 of the sequence listing.
[0026] The recombinant plasmid containing DNA molecule B can be specifically: inserting the double-stranded DNA molecule shown in sequence 5 of the sequence listing between the XbaI and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid (recombinant plasmid pET28a-pglL-NP).
[0027] The DNA molecule described above is specifically shown in sequence 4 of the sequence listing.
[0028] The recombinant plasmid containing DNA molecule C can be specifically: inserting the double-stranded DNA molecule shown in sequence 4 of the sequence listing between the XbaI and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid (recombinant plasmid pET28a-pglL-CTB).
[0029] The method for preparing the pneumococcal vaccine specifically includes the following steps:
[0030] (1) The recombinant bacteria were cultured and IPTG-induced expression was performed during the culture process;
[0031] (2) Collect the bacterial cells and break them up, and collect the supernatant;
[0032] (3) Collect glycoproteins from the supernatant.
[0033] The glycoprotein is used as a pneumococcal vaccine.
[0034] Step (1) specifically involves: inoculating the recombinant bacteria into liquid LB medium and culturing until OD200. 600nm When the value reaches 0.6-0.8, add IPTG and make its concentration in the system 0.5-1 mmol / L, and induce at 30℃ and 220 r / min for 10-12 h.
[0035] Step (1) specifically involves: inoculating the recombinant bacteria into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and culturing at 37°C and 220 r / min; when the OD of the culture system... 600nm When the value reaches 0.6-0.8, add IPTG and make its concentration in the system 0.5-1 mmol / L, and induce at 30℃ and 220 r / min for 10-12 h.
[0036] The specific steps (2) are as follows: centrifuge to collect bacterial cells, use a nano high-pressure homogenizer to break up the bacterial cells, and then collect the supernatant.
[0037] The specific steps (2) are as follows: centrifuge at 8,000 r / min for 10 min, collect the bacterial cells, resuspend the bacterial cells with Buffer A1, then use a nano-high pressure homogenizer to break the bacteria three times at a pressure of 10,000-15,000 psi, then centrifuge at 10,000 r / min for 15 min, collect the supernatant and centrifuge at 10,000 r / min for 15 min, and collect the supernatant.
[0038] The specific steps (3) are as follows: Glycoproteins are collected by sequentially separating and purifying them through Ni-column affinity chromatography and molecular sieve separation.
[0039] The specific parameters for Ni-column affinity chromatography are as follows:
[0040] Ni column packing: Roche's cOmplete His-Tag Purification Resin;
[0041] The Ni column volume is 25 ml;
[0042] Load 400 ml of the supernatant collected in step (2) onto a Ni column at a flow rate of 2 mL / min; then, wash the Ni column with Buffer A1 to remove impurities (after the ionic strength and UV absorbance value have stabilized, continue washing with Buffer A1 for 3-5 column volumes); then, elute with Buffer B1 to collect the target protein (collect the eluent when the UV absorbance value begins to rise, 8-10 ml / tube, until the UV absorbance value reaches its peak and decreases to almost the horizontal line, collect a total of 9 tubes).
[0043] Take the liquids from tubes 2-7 collected by Ni-column affinity chromatography, combine them, and concentrate them by ultrafiltration (the filter membrane has a molecular weight cutoff of 10 kDa). Collect the concentrate and then perform molecular sieve separation and purification.
[0044] The specific parameters for molecular sieve separation and purification are as follows:
[0045] The molecular sieve column had parameters of Ф16mm × 1000mm and was filled with Superdex 200 Prep Grade. The entire purification process involved elution with PBS buffer (flow rate set to 1 mL / min). The sample to be separated was loaded through a sample loop. When the UV absorbance showed a significant increase, the flow-through was collected until the UV absorbance reached its peak and then decreased to almost a horizontal level. The retention volume corresponding to the collected portion was 65-86 mL; this portion constituted the purified nanoglycoprotein solution.
[0046] The pneumococcal vaccine is a pneumococcal glycoprotein conjugate vaccine.
[0047] In this invention, Streptococcus pneumoniae K5 serotype CPS is transferred to a carrier protein using the PglL system, resulting in a glycoprotein with pneumococcal vaccine function. This invention has significant application and promotion value for the prevention and control of Streptococcus pneumoniae and the treatment of diseases caused by Streptococcus pneumoniae. Attached Figure Description
[0048] Figure 1 To detect heterologous expression of K5 polysaccharide from Streptococcus pneumoniae using silver staining.
[0049] Figure 2 For comparison of the efficiency of different glycosylation systems: A. Glycosylation detection of ComP substrates using the PglS system; B. Glycosylation detection of CTB-ComP substrates using the PglS system; C. Comparison of glycosylation efficiency between the PglL and PglS systems.
[0050] Figure 3 Validation of glycosylation in heterologous expression strains of CTB-based glycoproteins.
[0051] Figure 4 Ni-column purification of CTB-carrier glycoproteins.
[0052] Figure 5 To detect the purified CTB-carrier glycoprotein by cologne staining and Western blot.
[0053] Figure 6 Animal evaluation of CTB-based glycoprotein. A. Serum titer after triple immunization measured by ELISA using Streptococcus pneumoniae K5 CPS as substrate; B. Survival of mice after triple immunization challenged with Streptococcus pneumoniae strain 1839.
[0054] Figure 7 To verify the glycosylation of heterologous expression strains of nanoglycoproteins.
[0055] Figure 8 Ni-column purification of nanoglycoproteins.
[0056] Figure 9 For the detection of purified nano-glycoproteins: A. Coq staining and Western blot detection of purified nano-glycoproteins; B. Particle size determination of purified nano-glycoproteins.
[0057] Figure 10 Animal evaluation of K5 serum glycoprotein. A. Serum titer after triple immunization was measured by ELISA using Streptococcus pneumoniae K5 CPS as a substrate; B. Survival of mice after triple immunization challenged with Streptococcus pneumoniae strain 1839.
[0058] Deposit Information
[0059] Streptococcus pneumoniae 1839 was deposited on April 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 24783. Detailed Implementation
[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All recombinant plasmids in the examples have been sequenced and verified.
[0062] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0063] CPS: Capsular polysaccharide. LPS: Lipopolysaccharide. OPS: O antigen polysaccharide. Anti-His, full name Anti-6×His-tagAntibody (HRP Conjugated), Abmart, product number M20020. Anti-K5, full name Streptococcus pneumoniae capsule type identification standard immune serum type 5 (K5 serum for short), Shengyan, product number 215376.
[0064] Escherichia coli W3110△waaL and Escherichia coli W3110△waaL△wbbH-L are described in the following literature: Production of a Promising Biosynthetic Self-assembled Nanoconjugate Vaccine against Klebsiella pneumoniae Serotype O2 in a General Escherichia coli Host; Adv. Sci. 2021, 8, 2100549.
[0065] Buffer A1: Dissolve 30g sodium chloride and 0.6g imidazole in ddH2O, then add 13.3mL of 1.5mol / L Tris-HCl (pH 8.8), adjust the pH to 7.0 with concentrated hydrochloric acid, and finally bring the volume to 1L with ddH2O.
[0066] Buffer B1: Dissolve 30g sodium chloride and 30g imidazole in ddH2O, then add 13.3mL of 1.5mol / L Tris-HCl (pH 8.8), adjust the pH to 7.0 with concentrated hydrochloric acid, and finally bring the volume to 1L with ddH2O.
[0067] In the examples, the anthrone-sulfuric acid method was used to quantify the polysaccharides.
[0068] Example 1: Heterologous expression and silver staining detection of Streptococcus pneumoniae K5 serotype CPS
[0069] I. Construction of recombinant plasmids
[0070] The double-stranded DNA molecule shown in Sequence 1 of the sequence listing was inserted between the ApalI and SfiI restriction sites of the pCC1BAC vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid pBAC-CPS. SpK5The DNA molecule shown in Sequence 1 of the sequence listing contains a gene cluster related to the synthesis of CPS in Streptococcus pneumoniae K5 serotype. In Sequence 1 of the sequence listing, nucleotides 201-1646 constitute the wzg gene, nucleotides 1648-2379 constitute the wzh gene, nucleotides 2388-3080 constitute the wzd gene, nucleotides 3090-3764 constitute the wze gene, nucleotides 4168-4761 constitute the wciI gene, nucleotides 4770-5996 constitute the wciJ gene, nucleotides 6227-7432 constitute the wzy gene, nucleotides 7407-8879 constitute the wzx gene, nucleotides 8876-9757 constitute the whaC gene, and nucleotides 9771-10856 constitute the whaD gene. The genes are as follows: nucleotides 10849-11655 form the whaE gene, nucleotides 11889-12926 form the fnlA gene, nucleotides 12935-14146 form the ugd gene, nucleotides 14165-15394 form the fnlB gene, nucleotides 15395-16579 form the fnlC gene, and nucleotides 16780-19765 form the tnp1-5 gene (which contains 5 coding regions, namely 16780-17491, 17556-17732, 17992-18429, 18505-19134, and 19413-19765 in sequence 1).
[0071] The pCC1BAC vector is a circular plasmid, and its full sequence is shown in Sequence 6 of the sequence listing.
[0072] II. Preparation of Recombinant Bacteria
[0073] The recombinant plasmid pBAC-CPS SpK5 By introducing Escherichia coli W3110, recombinant strain W3110 / pBAC-CPS was obtained. SpK5 (referred to as recombinant strain W3110 / CPS) SpK5 ).
[0074] The pCC1BAC vector was introduced into Escherichia coli W3110 to obtain recombinant bacteria, which served as the empty vector control.
[0075] III. Testing
[0076] The test bacteria was the recombinant strain W3110 / CPS obtained in step two. SpK5 Or empty control bacteria.
[0077] 1. Inoculate the test bacteria into liquid LB medium and incubate at 37℃ and 220r / min for 12-14h.
[0078] 2. After completing step 1, take 1 mL of sample, centrifuge at 8,000 r / min for 2 min, collect the bacterial cells and wash them.
[0079] 3. After completing step 2, take the bacterial cells, lyse them, treat them with proteinase K, and then perform 12% polyacrylamide gel electrophoresis and silver staining detection.
[0080] See results Figure 1 Recombinant strain W3110 / CPS SpK5 The presence of typical ladder-like bands indicates polysaccharide synthesis and attachment to the lipid core. The empty vector control strain did not show typical ladder-like bands. Given that *E. coli* W3110 cannot synthesize its own complete OPS, the recombinant strain W3110 / CPS can be considered... SpK5 The successfully expressed polysaccharide is CPS of Streptococcus pneumoniae K5 serotype, expressed in Escherichia coli in the form of OPS, and can therefore be considered K5-OPS. Therefore, we name it OPS. SpK5 .
[0081] Example 2: Construction of expression vectors with different glycosylation systems and comparison of their glycosylation efficiency
[0082] This embodiment is used to compare the glycosylation efficiency of the PglS-mediated glycosylation system and the PglL-mediated glycosylation system.
[0083] I. Construction of recombinant plasmids
[0084] The double-stranded DNA molecule shown in Sequence 2 of the sequence listing was inserted between the BglⅡ and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid pET28a-pglS-ComP. In Sequence 2 of the sequence listing, nucleotides 174-1820 constitute the pglS gene (encoding the pglS protein), and nucleotides 2478-2918 encode the Comp protein. The Comp protein is a bacterial fimbriae protein of the Acinetobacter genus, which contains glycosylation sites. The pglS protein mediates glycosylation. Under the action of the pglS protein, the Comp protein undergoes glycosylation.
[0085] The double-stranded DNA molecule shown in Sequence 3 of the sequence listing was inserted between the BglⅡ and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid pET28a-pglS-CTB-ComP. In Sequence 3 of the sequence listing, nucleotides 174-1820 constitute the pglS gene (encoding the pglS protein), nucleotides 2477-2842 encode the cholera toxin B subunit, and nucleotides 2855-3211 encode the Comp protein segment. Compared with the Comp protein, the only difference of the Comp protein segment is the absence of 28 amino acid residues at the N-terminus; the glycosylation site is retained in the Comp protein segment. The cholera toxin B subunit and the Comp protein segment exist in the form of a fusion protein.
[0086] The double-stranded DNA molecule shown in Sequence 4 of the sequence listing was inserted between the XbaI and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid pET28a-pglL-CTB. In Sequence 4 of the sequence listing, nucleotides 174-1988 constitute the pglL gene, nucleotides 2646-3011 encode the cholera toxin B subunit, nucleotides 3027-3113 encode the glycosylation site, and nucleotides 3123-3140 encode the His6 tag. The pglL gene encodes an oligosaccharide transferase (also known as the pglL protein). The cholera toxin B subunit, glycosylation site, and His6 tag exist in the form of a fusion protein. Under the action of the pglL protein, the fusion protein undergoes glycosylation.
[0087] II. Construction of Recombinant Bacteria
[0088] The recombinant plasmid pET28a-pglS-ComP was introduced into Escherichia coli W3110△waaL to obtain the recombinant bacteria, which was named recombinant bacteria W3110△waaL / pglS-ComP; the recombinant plasmid pBAC-CPS was then introduced into the recombinant plasmid. SpK5 Recombinant strain W3110△waaL / pglS-ComP was introduced to obtain recombinant strain W3110△waaL / pET28a-pglS-ComP pBAC-CPS. SpK5 .
[0089] The recombinant plasmid pET28a-pglS-CTB-ComP was introduced into Escherichia coli W3110△waaL to obtain the recombinant bacteria, which was named recombinant bacteria W3110△waaL / pglS-CTB-ComP; the recombinant plasmid pBAC-CPS was then introduced into the recombinant plasmid. SpK5Recombinant strain W3110△waaL / pglS-CTB-ComP was introduced to obtain recombinant strain W3110△waaL / pET28a-pglS—CTB-ComP pBAC-CPS. SpK5 .
[0090] The recombinant plasmid pET28a-pglL-CTB was introduced into Escherichia coli W3110△waaL to obtain the recombinant bacteria, which was named recombinant bacteria W3110△waaL / pglL-CTB; the recombinant plasmid pBAC-CPS was then introduced into the recombinant plasmid. SpK5 Recombinant strain W3110△waaL / pglL-CTB was introduced to obtain recombinant strain W3110△waaL / pET28a-pglL-CTB pBAC-CPS. SpK5
[0091] III. Induction and Glycosylation Detection of Recombinant Bacteria
[0092] Test bacteria: the recombinant bacteria obtained in step two.
[0093] The test bacteria were inoculated into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and cultured at 37°C and 220 r / min; when the OD of the culture system... 600nm When the pH reaches 0.6-0.8, add IPTG to a concentration of 0.5-1 mmol / L in the system, and induce at 30℃ and 220 r / min for 10-12 h. Then, take 1 mL of sample, centrifuge at 8,000 r / min for 2 min, collect the bacterial cells, wash and resuspend in 150 μL ddH2O, then add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (using Anti-His primary antibody).
[0094] See results Figure 2 OPS SpK5 Represents the recombinant plasmid pBAC-CPS SpK5 pglL-CTB represents the recombinant plasmid pET28a-pglL-CTB; pglS-ComP represents the recombinant plasmid pET28a-pglS-ComP. From Figure 2 A and Figure 2 B. It can be observed that both carrier proteins can be glycosylated, but under the same conditions, the original substrate ComP is glycosylated more efficiently in the PglS glycosylation system than the CTB carrier protein fused with the ComP glycosylation site. From Figure 2C. It can be observed that both ComP as a substrate in the PglS glycosylation system and CTB as a substrate in the PglL glycosylation system can be successfully glycosylated, with the PglL system exhibiting higher glycosylation efficiency.
[0095] Example 3: Heterologous expression, glycosylation verification, and expression purification of PglL-mediated CTB-based glycoproteins.
[0096] Polysaccharide expression vector: recombinant plasmid pBAC-CPS SpK5 .
[0097] Glycosylation system expression vector: recombinant plasmid pET28a-pglL-CTB.
[0098] Highly efficient glycoprotein expression strain: Escherichia coli W3110△waaL△wbbH-L.
[0099] I. Preparation of recombinant bacteria
[0100] 1. The recombinant plasmid pET28a-pglL-CTB was electroporated into Escherichia coli W3110△waaL△wbbH-L to obtain the recombinant bacteria, which was named W3110△waaL△wbbH-L / pglL-CTB.
[0101] 2. The recombinant plasmid pBAC-CPS SpK5 Electroporation was used to introduce the recombinant bacteria obtained in step 1, resulting in recombinant bacteria named W3110△waaL△wbbH-L / pET28a-pglL-CTB.pBAC-CPS. SpK5 (recombinant strain W3110△△ / pglL-CTB.CPS) SpK5 Recombinant strain W3110△△ / pglL-CTB.CPS SpK5 This refers to a strain of Streptococcus pneumoniae K5 serotype polysaccharide protein that expresses high efficiency.
[0102] II. Induction and Glycosylation Verification of Recombinant Bacteria
[0103] Test bacteria: the recombinant bacteria prepared in step one.
[0104] The test bacteria were inoculated into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and cultured at 37°C and 220 r / min; when the OD of the culture system... 600nmWhen the pH reaches 0.6-0.8, add IPTG to a concentration of 0.5-1 mmol / L in the system, and induce at 30℃ and 220 r / min for 10-12 h. Then, take 1 mL of sample, centrifuge at 8,000 r / min for 2 min, collect the bacterial cells, wash and resuspend in 150 μL ddH2O, then add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (using Anti-His primary antibody).
[0105] See results Figure 3 OPS SpK5 Represents the recombinant plasmid pBAC-CPS SpK5 The CTB carrier protein is approximately 15 kDa. Recombinant strain W3110△△ / pglL-CTB.CPS SpK5 After performing the above steps, two glycosylated ladder-like bands can be detected above the CTB carrier protein by the Anti-His antibody, but the glycosylation efficiency is still not high.
[0106] III. Induction of Recombinant Bacterial Expression and Purification of Glycoproteins
[0107] 1. IPTG-induced expression
[0108] The recombinant strain W3110△△ / pglL-CTB.CPS SpK5 Inoculate into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and incubate at 37°C and 220 rpm; when the OD of the culture system... 600nm When the value reaches 0.6-0.8, add IPTG and make its concentration in the system 0.5-1 mmol / L, and induce at 30℃ and 220 r / min for 10-12 h.
[0109] 2. After completing step 1, centrifuge at 8,000 rpm for 10 min, collect the bacterial cells, resuspend the bacterial cells in Buffer A1 (10 mL Buffer A1 per gram of bacterial cells), and then use a nano-high pressure homogenizer (D-3L model, PhD Technology, USA) to break the bacteria three times at a pressure of 10,000-15,000 psi, then centrifuge at 10,000 rpm for 15 min and collect the supernatant.
[0110] 3. Take the supernatant obtained in step 2, centrifuge at 10,000 r / min for 15 min, and collect the supernatant.
[0111] 4. Ni-column affinity chromatography:
[0112] Ni column packing: Roche's cOmplete His-Tag Purification Resin, product number: 5893681001.
[0113] The Ni column has a volume of 25 ml.
[0114] Load 400 ml of the supernatant obtained in step 3 onto a Ni column at a flow rate of 2 mL / min; then, wash the Ni column with Buffer A1 to remove contaminating proteins (after the ionic strength and UV absorbance value have stabilized, continue washing with Buffer A1 for 3-5 column volumes); then, elute with Buffer B1 to collect the target protein (collect the eluent when the UV absorbance value begins to rise, 8-10 ml / tube, until the UV absorbance value reaches its peak and decreases to almost the horizontal line, a total of 8 tubes were collected).
[0115] 5. Take the eluent collected in step 4, add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (the primary antibody used is anti-His).
[0116] See results Figure 4 Lanes 1 to 8 correspond to the eluent collected from each tube after column chromatography. The purified target glycoprotein was detected by codonopsis pilosula and Western blot. Glycoproteins using CTB as a carrier were mainly concentrated in the molecular weight range of 15-40 kDa on SDS-PAGE.
[0117] 6. Molecular sieve separation and purification
[0118] (1) Take the Ni-column purified sample (liquids from collection tubes 3-8 combined) with the above test results showing a high concentration of glycoprotein and perform ultrafiltration concentration (the filter membrane has a molecular weight cutoff of 10 kDa), and collect the concentrate.
[0119] (2) Take the concentrated solution collected in step (1) and perform molecular sieve purification to remove impurities.
[0120] The molecular sieve column had parameters of Ф16mm × 1000mm and was filled with Superdex 200 Prep Grade. The entire purification process used PBS buffer elution (flow rate set to 1mL / min). The sample to be separated was loaded through a sample loop. When the UV absorbance showed a significant increase, the flow-through was collected until the UV absorbance reached its peak and then decreased to almost a horizontal level. The retention volume corresponding to the collected portion was approximately 90-102ml; this portion constituted the purified glycoprotein solution.
[0121] (3) Take the glycoprotein solution obtained in step (2), add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (the primary antibody used is Anti-His or Anti-K5).
[0122] The results are as follows Figure 5 Western blot showed that the glycoprotein had a ladder-like band at approximately 15 kDa and above, which could be recognized by the Anti-his antibody; in the Western blot using Anti-K5, only the corresponding area of the glycoprotein ladder showed a band, indicating that the glycan chain could be specifically recognized by Anti-K5.
[0123] Example 4: Determination of intraperitoneal challenge dose of Streptococcus pneumoniae strain 1839 and extraction of Streptococcus pneumoniae CPS.
[0124] Streptococcus pneumoniae strain 1839 was isolated by a related laboratory at Peking University Hospital. The CPS-related sequence obtained by genome sequencing was consistent with the sequence of the K5 serotype strain Ambrose (Accession: CR931637.1; GI: 68642374) in NCBI.
[0125] Streptococcus pneumoniae strain 1839.
[0126] Streptococcus pneumoniae 1839 was deposited on April 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 24783.
[0127] I. Determination of dose-related factors for intraperitoneal challenge of 1839 strains of Streptococcus pneumoniae
[0128] 1. 1839 strains of Streptococcus pneumoniae were resuspended in physiological saline and used to challenge BALB / c mice via intraperitoneal injection. Four different doses were administered: 0.1 × 10⁻⁶... 7 1.0×10 7 5.0×10 7 10×10 7 CFU. The approximate maximum whole-life dose was 0.1 × 10⁻⁶. 7 The minimum total lethal dose of CFU is 5.0 × 10⁻⁶. 7 CFU.
[0129] 2. The dose gradient was reset according to the approximate maximum live dose and minimum lethal dose. Streptococcus pneumoniae strain 1839 was resuspended in physiological saline and administered intraperitoneally to BALB / c mice. Animal mortality was recorded within 7 days, and the results are shown in Table 1. A more precise minimum lethal dose of Streptococcus pneumoniae strain 1839 under intraperitoneal challenge was determined to be 4.5 × 10⁻⁶. 7 The maximum non-lethal dose of CFU is 1.0 × 10⁻⁶. 6 CFU.
[0130] Table 1. Specific data from intraperitoneal challenge-related dose determination of 1839 strains of Streptococcus pneumoniae.
[0131] Group Dose (CFU) Number of Animals (n) Number of Deaths (r) Mortality (P) A 0.10E+07 8 0 0.00% B 0.50E+07 8 2 25.00% C 0.75E+07 8 5 62.50% D 2.30E+07 8 6 75.00% E 3.20E+07 8 6 75.00% F 4.50E+07 8 8 100.00% G 6.50E+07 8 8 100.00%
[0132] II. Extraction of Streptococcus pneumoniae CPS
[0133] 1. Streptococcus pneumoniae strain 1839 was inoculated into BHI liquid medium (initial concentration OD of Streptococcus pneumoniae strain 1839 in the culture system after inoculation). 600nm The value is 0.3-0.4), and the mixture is incubated statically at 37℃ and 5% CO2 for 8-10 hours.
[0134] 2. After completing step 1, centrifuge at 8,000 r / min for 10 min and collect the supernatant and bacterial precipitate respectively.
[0135] 3. Add an equal volume of 0.12% sodium deoxycholate aqueous solution to the bacterial precipitate from step 2, resuspend and mix well, treat in a 37°C water bath for 3 hours (invert and mix once every 30 minutes), then let stand at room temperature for 6 hours, then centrifuge at 8,000 r / min for 10 minutes and collect the supernatant.
[0136] 4. Combine the supernatant obtained in step 2 and the supernatant obtained in step 3, and then concentrate by ultrafiltration (the molecular weight cutoff of the filter membrane is 100kDa). Then add anhydrous ethanol to a final concentration of 25%, let stand overnight at 4°C to precipitate nucleic acids, and then centrifuge at 12,000 r / min for 15 min and collect the supernatant.
[0137] 5. Take the supernatant obtained in step 4, add 4 times the volume of anhydrous ethanol and stir gently for 10 min to precipitate the polysaccharide, then let it stand overnight at 4℃, then centrifuge at 8,000 r / min for 15 min and collect the precipitate.
[0138] 6. Take the precipitate obtained in step 5, dry the surface ethanol, redissolve it in water, and then extract it 2-3 times with 90% phenol aqueous solution to remove protein. Then transfer the upper aqueous phase to a dialysis bag with a molecular weight cutoff of 15kDa and dialyze it in ddH2O for three days (replace ddH2O every 8 hours to remove phenol). Collect the liquid phase in the dialysis bag, which is the crude CPS extract.
[0139] 7. Take the liquid phase obtained in step 6, add Dnase I (Solarbio, D8071) and Rnase A (Solarbio, R8021) to a concentration of 0.5 mg / ml, treat in a 37°C water bath for 5 h, then centrifuge at 18°C and 12,000 r / min for 20 min, collect the supernatant, which is the CPS solution, and use the anthrone-sulfuric acid method to detect the polysaccharide content, and then use it for ELISA coating.
[0140] Example 5: Animal immunization with CTB as a carrier glycoprotein, serum titer determination and verification of its immunoprotective effect.
[0141] C-OPS SpK5 The glycoprotein vaccine using K5 serotype CTB as a vector is the purified glycoprotein solution prepared in Example 3. The dosage is calculated based on the polysaccharide content (micrograms). CPS SpK5 Purchased from Pfizer, product name Pneumococcalpolysaccharide powder Type 5, product number 38-X. Al represents aluminum hydroxide adjuvant, InvivoGen, product catalog number vac-alu-250; aluminum hydroxide adjuvant was added at 10% of the immunization volume.
[0142] To verify C-OPS SpK5 Can it effectively activate the immune system to produce high-titer antibodies? BALB / c mice were divided into three groups of 10 mice each. Immunization was administered on days 0, 14, and 28. Group 1: Subcutaneous immunization with C-OPS SpK5 A mixture of Al and C-OPS, administered via single-dose, single-animal immunization. SpK5 The dosage was 2.5 micrograms. Group Two: Subcutaneous CPS Immunization SpK5 A mixture of Al and CPS, a single, single-dose immunization. SpK5 The dose was 2.5 micrograms. Group 3: Subcutaneous immunization with PBS buffer. Seven days after the third immunization, blood was collected from mouse tails, and immune serum was separated. Using *Streptococcus pneumoniae* CPS prepared in step two of Example 4 as a substrate (substrate coating concentration 10 μg / 100 μl, calculated as polysaccharide), ELISA was performed to detect serum titer (primary antibody was serum, secondary antibody was HRP-labeled goat anti-mouse serum). Results are as follows... Figure 6 As shown in Figure A, the highest titer was observed in the glycoprotein group with CTB as the carrier, followed by the CPS polysaccharide group. This indicates that the immunogenicity of the polysaccharides is slightly enhanced after being linked to the carrier protein CTB, which can stimulate the body to produce IgG antibodies with higher titers.
[0143] To verify whether the glycoprotein vaccine based on K5 serotype CTB could provide effective protection after immunization, mice were challenged intraperitoneally with Streptococcus pneumoniae strain 1839 on day 14 after the third immunization, with a challenge dose of 7.5 × 10⁻⁶ per mouse. 7 CFU. The results of the challenge were as follows: Figure 6 As shown in Figure B, all mice in the PBS group died after challenge, while the survival rates of the CPS polysaccharide group and the CTB-based glycoprotein group were the same, between 60% and 70%. This indicates that CPS immunization itself provides some immunoprotection; the CTB-based glycoprotein vaccine did not provide significantly different immunoprotection against systemic infection induced by the strain compared to CPS.
[0144] Example 6: Construction of PglL-mediated heterologous expression strains for nanoglycoproteins and verification of their glycosylation
[0145] Polysaccharide expression vector: recombinant plasmid pBAC-CPS SpK5 .
[0146] Nano-B5 glycosylation system expression vector: recombinant plasmid pET28a-pglL-NP.
[0147] Highly efficient glycoprotein expression strain: strain W3110△waaL△wbbH-L.
[0148] The double-stranded DNA molecule shown in Sequence 5 of the sequence listing was inserted between the XbaI and XhoI restriction sites of the pET-28a(+) vector (replacing the small fragment between the two restriction recognition sequences) to obtain the recombinant plasmid pET28a-pglL-NP. In Sequence 5 of the sequence listing, nucleotides 174-1988 constitute the pglL gene, nucleotides 2646-3161 encode the NP protein, and nucleotides 3174-3260 encode the glycosylation site. The pglL gene encodes an oligosaccharide transferase (also known as the pglL protein). The NP protein, the glycosylation site, and the His6 tag (the coding sequence is located in the vector backbone) exist as a fusion protein. The fusion protein undergoes glycosylation under the action of the pglL protein.
[0149] I. Preparation of recombinant bacteria
[0150] 1. The recombinant plasmid pET28a-pglL-NP was electroporated into Escherichia coli W3110△waaL△wbbH-L to obtain the recombinant bacteria, which was named recombinant bacteria W3110△waaL△wbbH-L / pglL-NP.
[0151] 2. The recombinant plasmid pBAC-CPS SpK5Electroporation was used to introduce the recombinant bacteria obtained in step 1, resulting in recombinant bacteria named W3110△waaL△wbbH-L / pET28a-pglL-NP.pBAC-CPS. SpK5 (recombinant strain W3110△△ / pglL-NP.CPS) SpK5 Recombinant strain W3110△△ / pglL-NP.CPS SpK5 This refers to a strain of Streptococcus pneumoniae K5 serological nanopolysaccharide protein that expresses high efficiency.
[0152] II. Induction and Glycosylation Verification of Recombinant Bacteria
[0153] Test bacteria: the recombinant bacteria prepared in step one.
[0154] The test bacteria were inoculated into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and cultured at 37°C and 220 r / min; when the OD of the culture system... 600nm When the pH reaches 0.6-0.8, add IPTG to a concentration of 0.5-1 mmol / L in the system, and induce at 30℃ and 220 r / min for 10-12 h. Then, take 1 mL of sample, centrifuge at 8,000 r / min for 2 min, collect the bacterial cells, wash and resuspend in 150 μL ddH2O, then add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (using Anti-His primary antibody).
[0155] The results are as follows Figure 7 As shown, the nano-NP carrier protein is approximately 25 kDa, and three weak glycosylated ladder-like bands can be detected above it by the Anti-His antibody.
[0156] III. Induction and expression of recombinant bacteria and purification of nanoglycoproteins
[0157] 1. IPTG-induced expression:
[0158] The recombinant strain W3110△△ / pglL-NP.CPS SpK5 Inoculate into liquid LB medium containing antibiotics (50 μg / ml kanamycin and 50 μg / ml chloramphenicol) and incubate at 37°C and 220 rpm; when the OD of the culture system... 600nm When the value reaches 0.6-0.8, add IPTG and make its concentration in the system 0.5-1 mmol / L, and induce at 30℃ and 220 r / min for 10-12 h.
[0159] 2. After completing step 1, centrifuge at 8,000 rpm for 10 min, collect the bacterial cells, resuspend the bacterial cells in Buffer A1 (10 mL Buffer A1 per gram of bacterial cells), and then use a nano-high pressure homogenizer (D-3L model, PhD Technology, USA) to break the bacteria three times at a pressure of 10,000-15,000 psi, then centrifuge at 10,000 rpm for 15 min and collect the supernatant.
[0160] 3. Take the supernatant obtained in step 2, centrifuge at 10,000 r / min for 15 min, and collect the supernatant.
[0161] 4. Ni-column affinity chromatography:
[0162] Ni column packing: Roche's cOmplete His-Tag Purification Resin, product number: 5893681001.
[0163] The Ni column has a volume of 25 ml.
[0164] Load 400 ml of the supernatant obtained in step 3 onto a Ni column at a flow rate of 2 mL / min; then, wash the Ni column with Buffer A1 to remove impurities (after the ionic strength and UV absorbance value have stabilized, continue washing with Buffer A1 for 3-5 column volumes); then, elute with Buffer B1 to collect the target protein (collect the eluent when the UV absorbance value begins to rise, 8-10 ml / tube, until the UV absorbance value reaches its peak and decreases to almost the horizontal line, a total of 9 tubes were collected).
[0165] 5. Take the eluent collected in step 4, add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (the primary antibody used is anti-His).
[0166] See results Figure 8 Lanes 1 to 9 correspond to the eluent collected from each tube after column chromatography. The target glycoprotein can be purified from the purified coumarin and Western blot. The nanoglycoproteins mainly concentrated in the molecular weight range of 25-50 kDa on the SDS-PAGE spectrum.
[0167] 6. Molecular sieve separation and purification
[0168] (1) Take the Ni-column purified sample (liquids from collection tubes 2-7 combined) with the above test results showing a high concentration of glycoprotein and perform ultrafiltration concentration (the filter membrane has a molecular weight cutoff of 10 kDa). Collect the concentrate.
[0169] (2) Take the concentrated solution collected in step (1) and perform molecular sieve purification to remove impurities.
[0170] The molecular sieve column had parameters of Ф16mm × 1000mm and was filled with Superdex 200 Prep Grade. The entire purification process involved elution with PBS buffer (flow rate set to 1 mL / min). The sample to be separated was loaded through a sample loop. When the UV absorbance showed a significant increase, the flow-through was collected until the UV absorbance reached its peak and then decreased to almost a horizontal level. The retention volume corresponding to the collected portion was approximately 65-86 ml; this portion constituted the purified nanoglycoprotein solution.
[0171] (3) Take the nano glycoprotein solution collected in step (2), add an equal volume of 2×SDS lysis buffer, treat in a boiling water bath for 10 min, and then perform 12% polyacrylamide gel electrophoresis and Western blot detection (the primary antibody used is Anti-His or Anti-K5).
[0172] The results are as follows Figure 9 As shown in Figure A, the nanoglycoprotein exhibits ladder-like bands at approximately 25 kDa and above, which can be recognized by the Anti-his antibody. In the Western blot analysis using Anti-K5, only the corresponding ladder region of the glycoprotein shows a band, indicating that this glycan chain can be specifically recognized by Anti-K5. Furthermore, the DLS particle size distribution of this nanoglycoprotein sample is shown in Figure A. Figure 9 As shown in B, the particle size of the nano-glycoprotein is around 25 nm.
[0173] Example 7: Animal immunization, serum titer determination and immunoprotective verification of PglL-mediated nanoglycoproteins
[0174] NP-OPS SpK5 The glycoprotein vaccine using K5 serotype CTB as a vector, specifically the purified nano-glycoprotein solution prepared in Example 6, is used at a dosage based on polysaccharide content (micrograms). C-OPS SpK5 The glycoprotein vaccine using K5 serotype CTB as a vector is the purified glycoprotein solution prepared in Example 3. The dosage is calculated based on the polysaccharide content (micrograms). CPS SpK5 Purchased from Pfizer, product name Pneumococcal polysaccharide powder Type 5, product number 38-X. Al represents aluminum hydroxide adjuvant, InvivoGen, product catalog number vac-alu-250; aluminum hydroxide adjuvant was added at 10% of the immunization volume.
[0175] To verify whether the two K5 serotype glycoprotein vaccines mentioned above can effectively activate immune cells to produce high-titer antibodies, BALB / c mice were divided into four groups of 10 mice each. Immunization was administered on days 0, 14, and 28. Group 1: Subcutaneous immunization with NP-OPS SpK5 A mixture of Al, for single-dose immunization of NP-OPS SpK5 The dosage was 2.5 micrograms. Group Two: Subcutaneous C-OPS Immunization SpK5 A mixture of Al and C-OPS, administered via single-dose, single-animal immunization. SpK5 The dosage was 2.5 micrograms. Group 3: Subcutaneous CPS Immunization SpK5 A mixture of Al and CPS, a single, single-dose immunization. SpK5 The dosage was 2.5 micrograms. Group 4: Subcutaneous immunization with PBS buffer. Seven days after the third immunization, blood was collected from mouse tails, and immune serum was separated. Using *Streptococcus pneumoniae* CPS prepared in step two of Example 4 as a substrate (substrate coating concentration 10 μg / 100 μl, calculated as polysaccharide), ELISA was performed to detect serum titer (primary antibody was serum, secondary antibody was HRP-labeled goat anti-mouse serum). Results are as follows... Figure 10 As shown in Figure A, the highest potency was observed in the nano-glycoprotein group, followed by the CTB-carrier glycoprotein group, and then the CPS polysaccharide group. This indicates that the nano-glycoprotein vaccine, without adjuvants, can induce IgG production more effectively than traditional CTB-carrier glycoprotein vaccines.
[0176] To verify whether the K5 serotype CTB-based glycoprotein vaccine could provide effective protection after immunization, mice were challenged intraperitoneally with Streptococcus pneumoniae strain 1839 on day 14 after the third immunization, with a challenge dose of 1 × 10⁻⁶ per mouse. 8 CFU. The results of the challenge were as follows: Figure 10 As shown in Figure B, all mice in the PBS group died after challenge. The survival rates of the CPS polysaccharide group and the glycoprotein group with CTB as the carrier were significantly improved, but still did not exceed 60%. The survival rate of the nanoglycoprotein group was the highest, reaching 100%. This indicates that the nanoglycoprotein vaccine exhibits the best protective effect under the same lethal dose of challenge-induced systemic infection.
[0177] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Military Medical Research Institute of the Academy of Military Sciences of the Chinese People's Liberation Army <120> Streptococcal glycoprotein conjugate vaccine, its preparation method and application <130> GNCYX212272 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20193 <212> DNA <213> Artificial Sequence <400> 1 acctttgctt ctaaaacatt gttagaaatc gattggactg tcctgaacga tttgttctgt 60 tcttatttca ttttactata tttttgtttc gcgggaagtc tactaagata cttaaagatg 120 cagatagtaa aaataaaggt gtagacatta ccgtaaaaaa gtgatataat cgtacagtgt 180 tcaatgtata ggtattaatc atgagtagac gttttaaaaa atcacgttca cagaaagtga 240 agcgaagtgt taatatcgtt ttgctgacta tttatttatt gttagtttgt tttttatttgt 300 tcttaatctt taagtacaat atccttgctt ttagatatct taatctagtg gtaactgcat 360 tagtcctact agttaccttg gtagggctac tcttgattat ctacaaaaaa gctgaaaaat 420 ttactatttt tctgttggtg ttctctattc ttgtcagctc tgtgtcgctc tttgcagtac 480 agcagtttgt tggactgacc aatcgtttaa atgtgacttc taattactca gaatattcaa 540 tcagtgtcgc tgttttagca gatagtgaga tcgaaaatgt tacgcaactg acgagtgtga 600 cagcaccgac tgggactgat aatgaaaata ttcaaaaatt actagctgat atcaagtcaa 660 gtcagaatac cgatttgacg gtcaaccaga gttcgtctta cttggcagct tacaagaatt 720 tgattgcagg ggagactaag gccattgtcc taaatagtgt ctttgaaaac atcatcgagt 780 cagagtatcc aggctacgca tcgaagataa aaaagattta taccaaggga ttcactaaaa 840 aagtagaagc tcctaagacg tctaagaatc agcttttcaa tatctatgtt agtggaattg 900 acacctatgg tcctattagt tcggtgtcgc gatcagatgt caatatcctg atgactgtca 960 atcgagatac caagaaaatc ctcttgacca caacgccgcg tgatgcctat gtaccaatcg 1020 cagatggtgg aaataatcaa aaagataaat tgactcatgc gggcatttat ggagttgatt 1080 cgtccattca caccttagaa aatctctatg gagtagatat caattactat gtgcgattga 1140 acttcacttc gtttttgaaa atgattgatt tgttgggtgg aattgatgtt tataatgatc 1200 aagaatttac tgcccataca aatggaaagt attaccctgc aggcaatgtt catcttgatt 1260 cagaacaggc tctcggtttt gttcgtgagc gctactcact agcagatggc gatcgtgacc 1320 gtgggcgcaa tcaacaaaag gtgattgtgg ctatccttca aaaattaacg tcaaccgaag 1380 cactgaaaaa ttatagtacg atcattaata gcttgcaaga ttctatccaa acaaatatgc 1440 cacttgagac catgataaat ttggtcaatg ctcagttaga aagtggaggg aattataaag 1500 taaattctca agatttaaaa gggacaggtc ggatggatct tccttcttat gcaataccag 1560 acagtaacct ctatgtgatg gaaatagatg atagtagttt agctgtagtt aaagcagcta 1620 tacaggatgt gatggagggt agatgaaatg atagacatcc attcgcatat cgtttttgat 1680 gtagatgacg gtcccaagtc aagagaggaa agcaaggctc tcttggcaga agcctacaga 1740 cagggggtgc gaaccattgt ctctacctct caccgtcgca agggcatgtt tgaaactccg 1800 gaagagaaga tagcagaaaa ctttcttcaa gttcgggaaa tagctaagga agtggcgagt 1860 gacttagtca ttgcttatgg cgcagagata tactatactc tggatgctct agaaaagcta 1920 gaaaaaaaag aaattcctac ccttaatgat agtcgttatg ctttgattga gtttagcatg 1980 catacttcct atcgtcagat tcatacggga ttgagcaata ttttgatgtt gggaatcacg 2040 ccagtaattg ctcatattga acggtatgat gctttagaga ataacgaaaa acgtgttcgt 2100 gaactgattg atatgggatg ctatactcag ataatatagtt atcatgtttt aaaacctaag 2160 ttctttggtg aaaataataa attcatgaaa aagagagctc ggtatttttt ggaacgtgat 2220 ttagttcatg tagttgcaag tgacatgcac aatttagaca gtagacctcc atatatgcaa 2280 caggcatatg atatcattgc taagaaatat ggagcgaaaa aagcgaaaga actttttgta 2340 gataatccca gaaaaattat aatggatcaa ttaatttagg agaaaatatg gagaaacaaa 2400 acactttgga aatcgatgta ttgcaactat tcagatcttt atggaaaaga aagttggtca 2460 ttttagt ggcaattata acttcttcag ttgctttgc ctacagtact ttgttatca 2520 aacctgagtt tactagtacg actcggattt atgtagttag ccgtgatcag ggagagaagt 2580 ctggtttaac caatcagac ttgcaggcag gatcgtactt gactaagac tatcgtgaaa 2640 ttatcctatc gcaggatgtt ttggaggag ttgttttctga tttgaaacta gatttgacgc 2700 caaaggttt ggctaataa attaaagtgg cagtaccagt tgatacccgt atcgtgtcta 2760 tttcggttaa tgatcaagtt cctgaagggg caagccgtat cgctactct ttgagagag 2820 tggcggctca aaaaattatc agtattactc gtgtttctga tgtgacaca ctggaggagg 2880 caagaccagc gatatcaccg tctcgccaa atattaact caatacacta attggttttt 2940 tggtaggatt gattgtcata atgttacag ttctcttct tgaactttg gandacacgag 3000 tgaaacgtcc ggaagatatc gagatgcac tacagatgac acttttgggg gttgtaccaa 3060 acttggataa gttgaataag gagagagaga tgccgacatt agaataagta CAAAAAAAAC 3120 tggagttcat windowgaca gaggaatatt acaatgcctt gtgtacaaac atacagttga 3180 gcggagataa actaaaagtg atttccgtta cttctgttaa ccctggagaa gggaaaacaa 3240 ctacttctat aaatatagca tggtcttttg cgcgtgcagg atataaaact cttttgatag 3300 atggcgatat ccgaaattcg gtgatgtcag gagtttttaa atctcgtgaa aaaattacag 3360 gcttaacaga atttttatct ggtacaactg atttatctca cggtttatgt gatacaaata 3420 ttgaaaattt atttgtagtt caatcgggag ctgtatcacc aaaccctaca gccttgttac 3480 aaagtaaaaa ttttaatgat atgattgaaa ccttgcgtaa atattttgat tatatcattg 3540 ttgatacagc acctattgga gttgttattg attcggcaat tatcactcaa aagtgtgatg 3600 cgtctatctt ggtaacggca acgggtgagg tgaataaacg tgatgtccca aaagcgaaac 3660 aacaattaga acaaacaggg aaactatttt taggtgtcgt tctcaataaa tttaatgttc 3720 aacatgaaaa atatggttct tacggtaatt atggtaaaag ataaaatgaa tatagtatgg 3780 aaggggctac aatataactc tggcattctg aactgcaccc caaaagttag acagaaaaaa 3840 tctaactttt gggggtcagt acattcttac agggtacact tgttagttta ttagcttaga 3900 tactgattgc aatttcagaa accgatattt ttcaataa atattcggtc tgtttggaag 3960 tgcaatcgaa ctgaactttc caatgcttta ttgggcatca tatattaccg aaacaaataa 4020 atttgttat attggatgat gttgttatgt tattgtaaaa atttgtgtg accaaatata 4080 ttgagtcttt gtggtctaat aggctgatat atttaatttg aataaaa ataagatgaa 4140 gtttgaattt aggatgagag atagtttatg tatagtatat taaaacggtt aggagatata 4200 tctatatctt taatagttat aacgttattt tgtccatttt ttatcctaat tgcaattgcg 4260 attaagttg attcaaagg acctgtatata ttaaacaa aacgttttg aatcacaaa 4320 aaaacttttt atgtttttta atttcggact atgaagtgg agacaccaaa aaatgtggca 4380 actcgagatt tacaaatcc agagcagtgg atcactagag tgggaacttt cttaaggaaa 4440 acatctctag atgaattgcc tcattatgt atattcttg tggtgatat gagtattgta 4500 ggaccagac ctgccctttg gatcaattt gatttgattg aagaagaga caatatgga 4560 gcaatgata ttttacctgg tttacaggt tggcacaa tcaatggtcg tgataatcta 4620 tcaatagata tgaagctga attggatga tactatgtga cacataaatc gttgctaatg 4680 gatttagat gtatagtag aacaatacct tatgtgctga aacgcaagg aattgtag 4740 ggaagtcaa aagagagtta agttgtacga tgaaaattttt atttgttagt spider 4800 gaccagaacc ttttagatta tcagatattt gtgaggatct tgttgagaga ggtcatgaag 4860 ttactgtttt gatattc cctaatc ctgaggtaa aacatatgcg gatttacgga 4920 atacaaaaa tagacgagag actatagaag gagttactgt tttcgttcc tatacaatc 4980 caggggaaa agtacttta cataggatat taaattttt tagttttgct atcagttcct 5040 cgataggggt tctactggga cagtataaag caaagatgg atcagaattt gattgtattt 5100 ttgtaaatca atcgtctcca gttatgatgg catgggctgc tatggcttat aaaaataaat 5160 ataagaaacc tatgttctg tattgtatgg atgttttggcc agatagttta actgtaggtg 5220 gagtgaaca agatggcttg atttcaagt tgtttaaatt tatatcgaaa aaagtttatc 5280 gagctagtga ttatatattt gttactagtc catcatttaa gatttattt gtgaaccaat 5340 ttgacataac agaacaaaag attacttatt tgccacaata tgcagaagat ctttttatcc 5400 ctgatgaatc tagagttaat aaagaaagtg ttgacctaac ttttgctggt aatattggca 5460 aagcacaaaa tttggaaact atttgaaag ctgccagttt gatagagaag aataccgatc 5520 tacccaagaa aattcaattt cattttgttg gagatggtac ggaattgcta agtatgaaag 5580 cattagctca tgaattggag ttaaagaatg tttccttcta tggaagacgt tctttggaag 5640 aaatgcctac cttctataaa aaatcagatg ctatgttagt ttctttaata ggagactcga 5700 tagttctcg tactatacct gggaaggtac aatcttacat ggcggcaggg aaaccaatta 5760 taggtgcaat ttcaggagat actaaaacaa ttgtagaaga agcaaagtgt ggttttgtca 5820 gtcctgaaca agatgtggaa caattggcac aaaatatttg taaatttagt atgttgtcta 5880 cggaagaaca aagagagtta ggaaagcaag ctcgttgtta ctatgggaag cacttttcta 5940 aagagcagtt tatgacacag ttagaaaatt atttgagaga gggctttcc tcatgagaat 6000 tttaatgatt aatactgttt gtggtattag gagtatagat actttgttaa agaaatttgc 6060 tgagatttgg cgttcaattt taggattt gaagttttag taagtaattt tagtatttt 6120 ctgtaagata ataagttctt aatgacttat taactattgt ataatagctg taattccaaa 6180 taaaagtaca taggtactga catgttgacg atagtagga ggaggaatgg atcccgaaa 6240 gaaatttgtt tgttttccca atagtagttt gcgtttttat attttgcagg cagcgattgc 6300 cttatctatt ttatcgcaga ctccctatat ctggaagttt agtgggatc ctacacaact 6360 tctgattg cctttgtgga tcctgttggg agtagtgtct attttcta gattgacat 6420 ggaacgatca ttcctatttt ttttac ataggttgt ttattagca ctattgcttt 6480 gttagatata gttacgggag tatcttatgt ctttaatggt tgtctcagc aactctattt 6540 ggctgtggga attctagttt taggctactg gatgctgat gtgattgttc attattgga 6600 aatcatcacc atgacttt tgggagcatg attgctgat tcagtggata tttattca 6660 ctactttcaa ggacatactt ttcaatt tgattgtt tatcgagcta agaattcagc 6720 ggcatctatc ttttatcgg cagttattct caactgtct ctatataatc gcaagtgggc 6780 actgtggaga aaagtattgt tattagctag tagcggattg ctgatttaca tgtgcatcct 6840 tatgcggtca cgagcagttc tgttagcagc tgcagtactt ccgctagttt atatatggtt 6900 tcaggagacg tctttggggc ataagattgg acggacatta ggagtttcaa cagtagtagg 6960 tgcgttttg ctcaattcag ctatttatga tttttttatc aataatctat ttttaagggt 7020 cacatctgaa tatcgaccat ctagtctgac tttggactac gtttcctcca accgttttgt 7080 gtattttgag atctttgcta aagaaatttc aggacatgaa ttaacaggga ttggttatta 7140 ttatatggat aatttttttc tagagagttt tctcaattat ggttatatag tagggactgc 7200 ttttgtttta atagccttgt ctcccatgat ttgccctc ttgcaacgtt cttcttctca 7260 tcgtttccgc atgcttttt tagcccttgc ttttcttat actgtcaatg ccttatttga 7320 aggttacgcg ccatttggtc ccggtgccaa gagttttatt cttttggttag ttttttggttg 7380 ccttctgaat acacgaattg gaaaggttgg tgaacattct gaaacaagtt agtctaaagt 7440 ggaactatgt gttaatctt gccaataaac tattttctct aactattcca cttattgtta 7500 ctccctatgt cactcgagtc ttttcttcag atcattttgg gatttatact tataccaata 7560 cagttgcttc ttactttgtt acctttacat tgatggggat aagtatgtat ggaagtaaga 7620 aaatttctct taaaagacat gatgagatag cagtcaatga tgaatatgct tccttactga 7680 ctgtccagct gcttaatgta ggtctagcca cgttaactta ctttctctat gtgacctttt 7740 ttgtcaataa taatcaagtt atttattgga tccagatgtt gtatgtgatt tctgctggtt 7800 ttgatatgac ttggttttta tcaggattgg aacgttttcg tgaaattgct gttcgaaata 7860 tcattgtaaa tgtcttatca gccctcatga tttttttctt tgtgcatacg gaggctgatt 7920 tggctatcta taccttaata aaggtaggga cgatttttat cagtcagatt gttattttt 7980 taccagttgt tcggatgcaa cggtttatc ttgcaggagc tgaacatatt cgacgtacct 8040 atcgaggctt gcttttgttg tttatccctg ttttggcaga cacccttttt caaactatgg 8100 ataagatcat gctaggtatc tatgcatcct atactgctgt gggtttgtat tactcaagta 8160 ggatggttgc tgacatcccg caaactgtca ttacttctct caatataatc ttatttccac 8220 gaataacaca tcttttaagt cagaataaaa aagttgaatc taataaactt tttatcagt 8280 cttttatctt aattattgct ttatctctag ctacagcttt tggagttagt gctattgcta 8340 gggttttgt aggtattttt tttggatctt catatggtgc ggtagcagat tatgtgccta 8400 gtttatcgct ctatatctgc cttgctgcct ggagtggaac gatacgttac caatatctga 8460 ttcctcattc acttgagaga gtctatgtag tagcgattat tttgggaagt gggatcaatc 8520 tagttttaaa ctctctctta attccttttt tgggagtata cggttccatt ttagctacta 8580 ttatatcaga attagtgatt tgtgtttacc agacatatcc tattcgaaag gaaattcctc 8640 ttaaaggatt gttaggatat gtgatcattt ttgcaggctt gtcttttctt atgtatctat 8700 cgcttggttg gctacgattg ttattgctag gccgcctatc cacagtattg ctattggcaa 8760 gtgaaataat atttggtatc cttgttttta ctatcgcaac tataacctat atttatctag 8820 gtaacccaat tttatggcaa gctattaaaa aatatataga aagtaggaaa aacgtatgat 8880 ctctatcatt atgccagctt ataatgaaga aaaaaatatc ggagcagtta ttgccggtat 8940 tcaacagcaa acctatgcgg actttcagtt gattatcgtc aatgatggat ctacagatga 9000 tacggcagct attgtacagg aaaaaatcat gggagatgag cgaattgtct ttttgaatcc 9060 tggaaagatt ggcaaggtac cagcttataa cttggcttca cagtatgtaa aaggagactg 9120 gatatatttt atgggagcgg atgaccagtt gccattggat gcctttgaaa agtggaacaa 9180 ggaggctcaa aagtggaatc ctgctgaaaa ggtggcttta agagctcgca tgcggatggt 9240 ttctgactct cacaagtatg atggattggt attaccaaag aaaaatacag ttcgcaattt 9300 tagtggacct cttaccttgc tttcaaaaga gatgcaccgt tttatccttc ctatacctga 9360 ggcctatccg aacgaagata tttggtgggg gctatgtatt gagtatttcg gagatcgtgt 9420 ttcgttgatt gaggatgttg tggtttatta tcgtgttcat gaggggaatt ctatatcccg 9480 aacctcaact tttgaacctt ttaacgagaa atatcatatc cgtcagatta tccgtcgtga 9540 ttttttagag agatttagca atcacttaac agcagaccag aagactaaac ttcagcgtga 9600 attgaaacta gaagaagcac gctataaagg aatagattg caattcttc tgatgccagg 9660 tattctgca gtacacagac ttcgattact tttttatcg ggtaggcgtt catatgtact 9720 taaagtcaa ttggatcgct tttcttagg acattagaaa gaaggagag atgtcaaga 9780 aaaaaatttc ttgttaca aaatattg ctccttttag ggttatgtta ttagatgagt 9840 tagccaagca tgcagaagtg actcttttt atgtgcacga aattgaggcg ggggtaaagg 9900 ctgagtagt caagctacga cctgttcgta ccaagctcca atcaatcaca gaactaggtt 9960 tattcagac gttcaatg ttgaagaga tggatatggt cttctttgat ggctatactg 10020 ggtgggaaaa gatgttcttg atgagcagta tgtggctaac aagacggcag tacgctattt 10080 ctgttgatgg tataataat catagtaata tctcacttaa gcagagactg ttggatttta 10140 ttaagtctgt tgctctaagc aaagcggagt tgtgctg caccaatacc ccaacagatg 10200 cttatataca gcaattagct cccaaggcaa agattaacg acacatattt tcaactcttt 10260 cacaatga ttcaaaac atgatagagg ttgcctcgga tacggttttc acagatata 10320 gtattcgaaa atctgagaaa aatctgcttt ttgtgggaca gtttatcaat agaaaaggag 10380 tcgatgagct tttggctttt atgaaagagc acgaagctga tacttcgttg cagttaatta 10440 tggtcggagg tacaagagaa gaattgtcag tttttgaaac agagattcct tctaatatac 10500 atataattcc ttttctagaa aaaactgata tcctagagtt gatgcgggtg gcagatgtct 10560 ttgttttgcc cactcgagaa gatatttggg gactggttat tatagaggcg ctatcaatgg 10620 gcattcctat tgtttctacg gatcgttgta acgcagcctt ggagtttgtt agggatggcg 10680 aaaatggtta tctgatgcag gaagtgactg cggtagaatt ggctaacaag cttaaggcta 10740 cctttaaact agatgctgag catgttgctc gctatgatca aaaactgatg caagactata 10800 atctggaagg ttcagcaaaa aatattatgg acatcttgga gggaattcat gtttaattca 10860 tcttgtgctt tatttattgt tagttgcgag actaatcagc aggtagtcaa tctcctcatc 10920 cagtccatgc gtcagcagat ttctcatatg gtatccattt atgtatcatc agatggccca 10980 ttgttaatca cggatcctag cgtaagggtt ttgattggtc aggaagaagt ttttggagat 11040 cgtgttgcaa ctgctttgga acaagttact gaagagcgag tcattgtttt ttgtgatgac 11100 tttatcgtag aaaaaccagc taaaattgaa gaattagaag aactactgtc tctaatggaa 11160 gaggatacaa gtattgctag tattgccctg tcacaaatat ctggagggaa tacacctgag 11220 cgtattgctg agcattatat aagacgcacg aaatatgccc cctataagac aactcttcaa 11280 tgcgctattt ggaagaagtc tagtttgatt caattcatga aggggagtcc ctctccttgg 11340 gaatttgaga tttatcataa ctttaaaact tacctgacga aagagaaatt ttatgcttta 11400 gaggatgata tgttccaacc tatcccttat aatagaggaa agttgattat tcgaggtaaa 11460 gttgttaaac ctgaaaaaga acgtttggag gaacttttgg gttatcatt agatttatcg 11520 gatttcccag aaacggagtc tttatccag ggggaaaatc ttactgtagg ctatcggttg 11580 aagagaaaga ttaaattgtt agaaaaaagaa attatttatc gtttgaaatc taaaataaag 11640 aataagaaaa aatagtgaaa aagaaagttt samaaatttg gtggatgcaa aagatttaaa 11700 gattgagtta tccttatttc tacaccttta aaaaaatatag cttttctttt ggataaggtg 11760 tatgttgaaa ttctcaccaa tattatcagt cagaaaaata ttgtagtgcg ttatttttca 11820 tgttgttaag ctttaaattt atttaaaaag cattatgctg aacatcatta tagataggag 11880 tataactat gtttacaaag aaaactctcc ttattacagg ggggacaggt tcattcggga 11940 atgcagttct caaacgattt ttgggaacag atattcgga ggtacgtatc ttttcaagag 12000 atgagaagaa acaggatgat atgcgtcatg aatttcaagc aaaaatgcca gaagtagctg 12060 ataagatacg ttttactta ggagatgtgc gtgatttagc ttctgttaaa aatgctatga 12120 tcggtgtgga ttacgtattt catgctgctg cattaaaaca agtcccttct tgtgaattttt 12180 tccctgtgga agcagtcaaa actaacgttc taggaactga aaatattctc actgcagcta 12240 tagaagctgg agtaaaaaa gtcatctgcc tttctacaga taaggcagcc tatcctgtta 12300 atgcgatggg aacctctaag gctatgatgg aaaagattgc tgttgctaag tcaaggacgg 12360 tagaagaaga tcagacaaaa gtctgtgtaa ctcgctacgg caatgttcta tgtagtcgtg 12420 gttctgtgat tcccctatgg attgatcaaa taaagcaagg gaatcctata acgattacgg 12480 aacctagtat gactcgtttt attatgtcct tagaagaagc ggtagaccta gttctgtttg 12540 cttttgaaaa aggaaaaaca ggagatatcc tagtacagaa agcaccagca tgtaccattg 12600 aagtgttggc gcaagctgtt acggaacttt ttgcacctaa tcaagatatt aaagtaatcg 12660 ggattcgcca cggtgaaaag atgtatgaaa cgttgttgac tactgaagaa tgtacgaatg 12720 ccattgattt aggcggcttt tatcgtgtgc ctagcgataa tcgagatctt aactatgata 12780 agtatttcaa cgaaggggat gccaaacgca atcccttaat agagtttaac agtagtaata 12840 cagaactctg gaatgtcgag caggttaagg aaaaactctt acttttgccc tatattaggg 12900 aagaattagc atctttaaat cagtgaggta tcctatgaaa atagcagtag cagggacagg 12960 ttatgtgggt ttatctattg caattctatt agcgcaatat cataaggtta tagcggtaga 13020 tgttatcct gaaaaagtag agcttatcaa tcgtcgccaa tctcccatta aggatgatga 13080 tattgaaact tatttagtgg aaaaggaatt agacttagtt gcaacattag atggtaatga 13140 agcttatcga gatgctgact ttgtcataat tgctgtccca actaactatg acagtaaaaa 13200 aaattatttt gatacatctg ttgtggaagc agttattgag cagattattg cggttaattt 13260 gaaggcaaca attgtcataa aatccacaat tcctgtggga tatacagaaa gtctccgaac 13320 acgttttgg caatttaaga ttctctttag tcctgaattt ttaacgggagt ctaaagcact 13380 ttatgataat ctctatccta gtcgaatcat cgttggagca gatttgagag atacggagca 13440 ggtagttcag gctgagcggt ttgcaactct tttgcaggaa ggttcactta aacctgatgt 13500 tgagacctta attatgggtg taacagaggc agaagcagtc aaactatttg ccaacaccta 13560 tttggctttg cgggtttctt actttaacga attggatacc tatgcggaga taaagggatt 13620 ggacactaaa tccatcattg acggagtagg gttagatcca cgaattggta gccattataa 13680 caatccgtca tttggttatg gaggttattg tcttcccaaa gatagtaagc agttgctggc 13740 gaattatcat gatgtaccac aaaatatgat gacagctatt gtagaaagta accgtactcg 13800 caagtatttt attgccgatc gtattttgaa aaatgcgttg gagctttcag acggtaatca 13860 aacaatcata gtaggtgttt accgcttaac tatgagagt ggttcggata atttccgtca 13920 atcatcaatc caagtgtta taaaatgttt aaggccaaa ggtgtagaag taattatcta 13980 girl ttggagatc atagctttttttttggtaat caggtggtta atgatttgga 14040 agtttttaag tcttatatga 14100 tgtgctagaa aaagtttata cagagat tttcagcga gattagtat atggaggga 14160 aaatatgcca ttaaaaattt tagtgactgg ttctaaagga tttgtaggaa aaatcttat 14220 ctgtactctg gaagctttga aagatggacg agataggact cgtcctaatt tagagattgg 14280 agagattttt cagtatgatc gtgatacaga tccgatttta ttagatgaat attgtaagaa 14340 ggccgatttc gtattccatt tagctgtgt caatcgtcca cagaatcctg atgaattcat 14400 ggagggaat tacggtttt caagtagatt attggagatt taggaaagt atgaaaacac 14460 ttgtcctgtt ctactctcaa gttctactca agctagttta gaaggccgat ttcaactc 14520 tatatatgga caatctaagc tagtagggga agaactcttc tttgaatatg gaaagaaaac 14580 gggagcacct gtcttagttt accgtttccc gaatctttat gggaagtggt gccgtcctaa 14640 ctacaattct gctgtagcaa ctttctgtca taatctagct cacgatttac ctattcaagt 14700 aaatgatcca agtgtagaat tggagttgct gtatattgat gatttgatac aagagtgtct 14760 aactgcattg gaaggaaatc ctcatcgttg taatctagat ggattacaaa tcttacctag 14820 cccatcagga aactactgct acgtaccaac gactcatcgt gcaaccttag gagagattgt 14880 ctctctatta gaaacattta aaaaacagcc tatagttta attatgcctg aaattcctca 14940 aggatcgttt aaaaagaaat tgtattctac ctacctatct tatttaccag tagataagtt 15000 taagtttcct ctaaaaatga atatagatga acgaggtagt tttacggaat tattaaaaac 15060 agaaaataag ggtcaatttt ctgttaatat ttctaaacct ggcattacca aagggcaaca 15120 ttggcatcat tctaagtggg aatttttcat ggttgtttct ggtcgtgctt tatacaaga 15180 gcgtaggata gggctggatg aaaacggtca agagtatcct attctgaact ttgaagtgtc 15240 gggcgataag attgaagcaa tacatatgat accgggctat gcacataata ttattaatct 15300 ttctgataca gaaaatctag ttactgtcat gtgggctaat gagtcatttg atcctagaca 15360 tccagatact ttttttgaac aagtggagaa ataaatgaaa attaagacag attatagtga 15420 tattcacttt aaagataatg gcaaacttaa gttattgatt attgtgggaa cacgtccaga 15480 gattatacgt ctaagtagtg ttatcactaa atgtcgaaag tattttgatg ttattttggc 15540 acatactgga caaaactatg attacaattt aaatggtatt ttctttgata attagggtt 15600 agacactccg gatgtataca tggatgctgt tggagatgat cttggtgcta ctgtagggaa 15660 tattattaat acttcataca aattgatgaa tcaaattaaa ccagatgctt tattgatttt 15720 aggggataca aattcttgtt tatcagctat tactgccaag cgtttacata ttccaatttt 15780 tcatatggag gctggcaatc gctgtaagga tgagtgcctg ccggaagaga ctaatcgtcg 15840 gattgttgat attatttcag atgttaactt agcatactct gaacatgcac gtaagtattt 15900 acatgagtgt ggtttaccta aagagcgcac atatgtaca ggttctccta tggcagaagt 15960 gttacataaa atttatctg ccattgagtc ttcagatc catgaacgtt tgggattgaa 16020 aaaaggaggt tatatcttac ttcagctca ccgtgaggaa atattgata cagataaaaa 16080 ttttattct ctctttacag cattaatca attagctgaa aagtataata tgccaatctt 16140 atattcttgc catcctagat caagaaag gctacaagag agcggtttta actagataa 16200 acgtgtgatt cagcatgagc cactaggatt ccatgactat aattgtttac agatgaatgc 16260 atttgttgta gtatctgatt cgggaacttt accggaagaa agtagttttct ttactagtca 16320 aggttatcct tttcctgctg tatgtattcg tacaagtaca gaacgtcctg agtccttaga 16380 cagcagga tttattgg caggcattga tgaaaatttct cttctcag cagttgaac 16440 tgctgttagc ttggcagag atgattt tggattaccg gttccagatt atgttgagga 16500 aaatgtctct actaaagttg tgaataat acagagctat acaggtag tggataaat 16560 agtttggagg aaagctgaa ttgtatattt ttaataatc aaacgagat gatttattct 16620 tagged atagtaaat tgaacgtatt tgatggaaat gtcttacttg atagtcgagg gatagccatt ctatcggatt tttggcttgt ttttgcgctt catgtttgat agaataaagg gctctttgtt aactgtagtg ggttgaaga aagctaagct tgagaagga caaatttcgt cctttctttt ttgatgttca gagcgatgaa aatccgtttt ttgaagtttt caaagttccg aaaaccaaag gcattgcgct tgataagtgt aagcgcgtca taacaaggta tctatcattc atggagctcc tcctgtatac tattagtaaa gtaaaactat tggaggatat tttaatgcca cacctattg ttcctgtaga gattccaca tctcgtcgtt ttgattctaa aaagagaaat gatattctac ttaaaattcg tattggcaag cttgaagtaa gttttttca atctctcaat ctcgaaatga tagacagct tttggataag gtgttgctct atgacaattc atctatctag cctagggcag gtctatctcg tatgtggga aacggatatg aggcaaggca ttgattcact ggcttatctg gttaaaccc actttgaat agatcctttc tcaggtcaag tttttctctt ttgtggtgga cgtaaagacc gctttaaagc cctttactgg gatggtcaag gattttggct 17340 actatataaa cgctttgaga acggcagact gacttggccc agtacagaaa aggatgtcaa 17400 agctctcaca cctgaacaag tagactggct tatgaagagc ttttctatca ctcccaaaat 17460 aaactcatca gaaagtcgtg atttctattg aaatgaggac tttcttttta gtataataaa 17520 gttagaaaac agagagggaa gctcatggaa gaagattgaa aatcattcaa caacagagtg 17580 ctacaattga tagtctcacc aatgaacttg cccttcttcg tgaacaagtg gcttatctga 17640 ctcaaaagct ctatggaaaa tcctctgaga aaagtgtttg cccctctgga caactcaacc 17700 tttttgagga agatggagat gttcccagtt gaaacagagg aaattaccca caaacgtaag 17760 aaatctaaag ggaaacgcca agctcttctt gcccaatttg attcagaaga agttcatcat 17820 caagtagaag agagcatttg ccctgattgt cagggagatc taaaagagat tggagcaacc 17880 cttcaacgac aagaattagt ctttattcct gcgcaattaa aacgaataga tcatatccaa 17940 cacgcttata agtgccaagc atgcagtgat aaaaatccga gtgataaaat cgtgaaagct 18000 cctattccta aagccccttt ggcgcatagc tttggctcag cttcttattat cgctcacacc 18060 atccatcaga agtttaatct gaaggtaccc aattatcgcc aagaagaaga ttgggctagg 18120 atgggtttac caatcacacg taaggaaatc tctaattggc atatcaaggc aagtcaatac 18180 tatttagagt ccctttataa ccttttacga gaaaagttgt tagaacaacc tcttcttcat 18240 gcggatgaaa cctcctatcg ggttctagag agtgatagtc agctgactta ctattggact 18300 ttttgtcag gtaaagctga gaatcaagca atcacgctgt accaccatga tcagcgtcgg 18360 agtggttcgg tagtgcaaga attcctagga aattattctg gctatgtgca ttgtgatatg 18420 ttgcggcagt aacttaggac tttagtcctc tagttctgcc tatgcgatag cagtccaagg 18480 tttaggagca aggcgacgct aagcttggta aactgcgaac cgctagaagc ttatcgtcaa 18540 ctggaagaag ctgaacttgt tggatgttgg gcgcatgtga gaaggaaatt ttttgaagcg 18600 ccccccaagc aagcggataa atcatcgtta ggagctaaag gtttagctta ttgtgatcag 18660 ttattttcct tggaaagaga ctgggaggct ttgccagctg atgaacgact acagaaacgt 18720 caagaacatc tccaacccct actggaagac ttctttgctt ggtgccgtcg tcagtcagtt 18780 ttatcgggtt caaaactagg aagggcaatt gaatacagcc tcaagtatga agaaaccttt 18840 aagaccattt taaaagacgg acatctggtc ctttccaata atctagctga acgcgccatt 18900 aaatcattgg ttatgggacg taaaattgg ttgtttctc aaagtttga aggagctaaa 18960 gcaagagcta ttattatgag cttatggaa acagctaaac gtcatcaact aaatagtgag 19020 aaatatctat cctatcttcc agaatgtctt ccaaacgagg aaactctcgt aaacaaagag 19080 gttttagagg cctatttacc gtggactaaa gttgtacaag aaaagtgcaa ataagaaatc 19140 tccagattag gaactatata tgagttctct agtctggaga tttttcaata tacttcgtta 19200 ttgggcggtt acgatattca acccaaatca ttcatacccc tctcaactag atgtaactta 19260 caaaacccct gacctcatga gccactttct tcctcctcat gaggtcagtt ttactttctg 19320 ctgttccagt atcgtttttc ctcgctagat ttcctcaaaa gggcagactt ctcccttggt 19380 gcatcacacg attttttcat ctcgactgtt ctttaatgca tcattaacga cgcttttctt 19440 ccaggtggtt cataaggaac aggaagattc aggttgactt ttctaatcct agaataaaagt 19500 gctgaaaaca attcggaata ggcatagaga ctagacaatt tgaggagctg cttgcgtcct 19560 gttcgaacac attttcctac cacgtgaaga aaaagatggc ggaagcgttt gattgttaaa 19620 gtttggaagt cacctctttt agtttcaact gggaaaaaag ttcctgaaaa aagataagac 19680 caccatactg ggttaaatga cctccatcga aagatagttg gtaaaagac ttgttttgga 19740 agtgatgatt tggtaaactg ttcatgtgag tttcctttct ttttgtgttt ttttctacac 19800 ttataccata aaggggaaac tctttttgt ctagtaaaaa acacccattg ggtgaaaaaa 19860 gaaaccatcc aggatctaag ctaaggcaag gattctggat ggttttaga ttaggggtga 19920 ataattgggg atattttttg aaaagatgtt gtttgaaaaa taattttcaa aaattctgaa 19980 aattctgttg acatctttct gaaaagagtt tataatggag agaaagtttt aaaggagaaa 20040 atgatgaaaa gttcaagact acttgccctt gcgggcgtga cattattgac ggcgactact 20100 atgatgaaaa gttcaagact acttgccctt gcgggcgtga cattattgac ggcgactact 20100 ttagctgcat gctctggatc aggttcaagc actaaaggtg agaagacatt ctcatacatt 20160 ttagctgcat gctctggatc aggttcaagc actaaaggtg agaagacatt ctcatacatt 20160 tatgagacag accctgataa cctcaactat ttg 20193 tatgagacag accctgataa cctcaactat ttg 20193 <210> 2<210> 2 <211> 2918<211> 2918 <212> DNA<212> DNA <213> 人工序列(Artificial Sequence)<213> Artificial Sequence <400> 2<400> 2 actgcataat tcgtgtcgct caaggcgcac tcccgttctg gataatgttt tttgcgccga 60 actgcataat tcgtgtcgct caaggcgcac tcccgttctg gataatgttt tttgcgccga 60 catcataacg gttctggcaa atattctgaa atgagctgtt gacaattaat catcggctcg 120 catcataacg gttctggcaa atattctgaa atgagctgtt gacaattaat catcggctcg 120 tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagaa ttcatgaata 180 tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagaa ttcatgaata 180 gtatttttaa aaaaatcaaa aattacacga tagtttctgg tgtatttttc cttggtagtg 240 gtatttttaa aaaaatcaaa aattacacga tagtttctgg tgtatttttc cttggtagtg 240 cttttataat tccaaatact tcaaatttat cttctacttt atataaagag ctaattgcag 300 cttttataat tccaaatact tcaaatttat cttctacttt atataaagag ctaattgcag 300 ttttaggttt gctaatattg ctaactgtga agtcctttga ttataaaaaa attctaattc 360 ttttaggttt gctaatattg ctaactgtga agtcctttga ttataaaaaa attctaattc 360 ctaaaaattt ttactggttc ttatttgtca tattcataat ttttattcag ttaattgtag 420 ctaaaaattt ttactggttc ttatttgtca tattcataat ttttattcag ttaattgtag 420 gtgagattta ttttttccaa gattttttct tttcaatttc atttttagta attctatttc 480 gtgagattta ttttttccaa gattttttct tttcaatttc atttttagta attctatttc 480 tgagttttct tttaggtttt aatgaagat taatggtga tgacctaata gtaaaaaaga 540 ttgcttggat ttttatt gtggttcaga ttcattctct tattgctata aatcaaaaaa 600 tagaaatagt tcaaattttt tttctattta gctcctcata taatggtcgt tctactgcta 660 atctgggtca accaaatcaa ttttcgactt tgattttaat aactttatt cttattatgct 720 atttaagaga aaaaatagt tattaata tggtattta tattttatct tttgttttga 780 tttttgctaa tgtaatgacg cagtctagaa gtgcatggat aagtgtaatt ctgatttctc 840 tattatatct tttaaattt CAaaaaaga taggattag aagagttatt tttttcaata 900 ttgtattttg gatagtt tattgtgttc cattactatt taatttaattt tttttcaaa 960 aaatagcta ttctacgttt gatcgtctta ctatgggatc ttctcggttt gaaatttggc 1020 ctcaattatt aaagctgta ttcataac catttatcgg atatggttgg ggtcagacag 1080 gagtagcaca attagaaca attaataat cttcacaa aggagaatgg tttacatact 1140 cacacaattt gttcttagat ttaatgttat ggaatggtttt ttttataggt ttaataatct 1200 ctattttaat tttagcttt ttgattgagc tatattcttc aattaaaaat aaatctgatt 1260 tattttatt ttttgtgtt gtggcttttttgtacattg tttattgga tattccttttg 1320 catatactta ctttaatt cctgttggct ttctatgtgg tatatactct actcaaata 1380 tcaaaaatttc tatatctt ttatttat caaaaagaaa attgacttg tttcttgggt 1440 gttgttggtt aggctatgta gctttttggg tgaagtttt agatatttca aagaaaaatg 1500 aaatatatgc tagacaattt ctttttagta atcatgttaa attttataat atagaaact 1560 atatacttga maximum aacaattga maximum maximum 1620 aagaataata tcaactatta gatttaaga aagttgctta tcgatatcca atgcatcta 1680 ttgtttataa gtattattca atttctgctg aaatgaaaat ggatcaaaa agtgcaaatc 1740 aaattataag agcatatagt gtaaaaaa atcaaaaaat tataaaacct aagttaaaat 1800 ttgttcaat agaatattga aagcttggct gttttggcgg atgagagaag attttcagcc 1860 tgatacagat taaatcagaa cgcagaagcg gtctgataa acagaatttg cctggcggca 1920 gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg 1980 atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca aataaaacga 2040 aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc 2100 ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg gcccggaggg 2160 tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg 2220 acggatggcc tttttgcgtt tctacaaact cttttgttta tttttctaaa tacattcaaa 2280 tatgtatccg ctcatgagac gagctctgca taattcgtgt cgctcaaggc gcactcccgt 2340 tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc 2400 tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca 2460 cacaggaaac agaattcatg aatgcacaaa agggttttac cttaattgaa ttgatgattg 2520 tcattgcgat cattggtatt ttggcagcga ttgcgattcc tgcttataca gattatacag 2580 tccgtgcacg tgtttctgaa ggattaacag cagcatcatc catgaaaacg acggtttcag 2640 aaaatatttt aaatgcaggt gcattagttg caggtactcc ttcaactgca ggctcatctt 2700 gcgttggagt ccaagaaatt tcagcaagta atgccactac gaacgtagca actgctacat 2760 gtggagcgag tagtgctgga caaatcattg taactatgga tactactaag gctaagggcg 2820 ctaatataac attaacgcca acatatgcta gtggcgctgt aacatggaaa tgtacgacaa 2880 cttctgataa aaaatatgta ccatcagaat gtcgtggt 2918 <210> 3 <211> 3211 <212> DNA <213> Artificial Sequence <400> 3 actgcataat tcgtgtcgct caaggcgcac tcccgttctg gataatgttt tttgcgccga 60 catcataacg gttctggcaa atattctgaa atgagctgtt gacaattaat catcggctcg 120 tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagaa ttcatgaata 180 gtatttttaa aaaaatcaaa aattacacga tagtttctgg tgtatttttc cttggtagtg 240 cttttataat tccaaatact tcaaatttat cttctacttt atataaagag ctaattgcag 300 ttttaggttt gctaatattg ctaactgtga agtcctttga ttataaaaaa attctaattc 360 ctaaaaattt ttactggttc ttatttgtca tattcataat ttttattcag ttaattgtag 420 gtgagattta ttttttccaa gattttttct tttcaatttc atttttagta attctatttc 480 tgagttttct tttaggtttt aatgaaagat taaatggtga tgacctaata gtaaaaaaga 540 ttgcttggat ttttattatt gtggttcaga ttcatttct tattgctata aatcaaaaaa 600 tagaaatagt tcaaaattt tttctattta gctcctcata taatggtcgt tctactgcta 660 atctgggtca accaaatcaa ttttcgactt tgattttaat aactttattt ctattatgct 720 attaagaga aaaaaatagt ttaaataata tggtatttaa tattttatct ttttgtttga 780 ttttgctaa tgtaatgacg cagtctagaa gtgcatggat aagtgtaatt ctgatttctc 840 tattatatct tttaaaattt caaaaaaaga tagaattaag aagagttatt ttttcaata 900 ttgtattttg gacattagtt tattgtgttc cattactatt taatttaatt ttttttcaaa 960 aaatagcta ttctacgttt gatcgtctta ctatgggatc ttctcggttt gaaatttggc 1020 ctcaattatt aaaagctgta tttcataaac catttatcgg atatggttgg ggtcagacag 1080 gagtagcaca attagaaca attaataat cttcacaa aggagaatgg tttacatact 1140 cacacaattt gttcttagat ttaatgttat ggaatggtttt ttttataggt ttaataatct 1200 ctattttaat tttagcttt ttgattgagc tatattcttc aattaaaaat aaatctgatt 1260 tattttatt ttttgtgtt gtggcttttttgtacattg tttattgga tattccttttg 1320 catatactta ctttaatt cctgttggct ttctatgtgg tatatactct actcaaata 1380 tcaaaaatttc tatatctt ttatttat caaaaagaaa attgacttg tttcttgggt 1440 gttgttggtt aggctatgta gctttttggg tgaagtttt agatatttca aagaaaaatg 1500 aaatatatgc tagacaattt ctttttagta atcatgttaa attttataat atagaaact 1560 atatacttga maximum aacaattga maximum maximum 1620 aagaataata tcaactatta gatttaaga aagttgctta tcgatatcca atgcatcta 1680 ttgtttataa gtattattca atttctgctg aaatgaaaat ggatcaaaa agtgcaaatc 1740 aaattataag agcatatagt gtaaaaaa atcaaaaaat tataaaacct aagttaaaat 1800 tttgttcaat agaatattga aagcttggct gttttggcgg atgagagaag attttcagcc 1860 tgatacagat taaatcagaa cgcagaagcg gtctgataaa acagaatttg cctggcggca 1920 gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg 1980 atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca aataaaacga 2040 aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc 2100 ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg gcccggaggg 2160 tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg 2220 acggatggcc tttttgcgtt tctacaaact cttttgttta tttttctaaa tacattcaaa 2280 tatgtatccg ctcatgagac gagctcgcat aattcgtgtc gctcaaggcg cactcccgtt 2340 ctggataatg ttttttgcgc cgacatcata acggttctgg caaatattct gaaatgagct 2400 gttgacaatt aatcatcggc tcgtataatg tgtggaattg tgagcggata acaatttcac 2460 acaggaaaca gaattcatga agaaaatttg gctggcctta gccggcctgg ttctggcatt 2520 cagcgccagc gcaccccgc agaaccac cgacctgtgc gccgagtacc acacaccca 2580 aatttatacc ctgaacgaca aaatttttag ctacaccgag agcctggcag gcaagcgcga 2640 gatggccatc atcaccttca agaacggcgc cattttccag gtggaggtgc cggggcagcca 2700 gcacatcgac agtcagaaga aggccatcga gcgcatgaag agamccctgc gcatcgccta 2760 cctgaccgag gccaaggtgg agaagctgtg cgtgtggaac aacagaccc cgcacgccat 2820 cgccgcaatc agcatggcca acggcggatc cggcgcttat acgattata cagtccgtgc 2880 acgtgttttct gaaggattaa cagcagcatc atccatgaaa acgacggtttt cagaaaatat 2940 tttaaatgca gtgcattag tgcaggtac tccttcact gcaggctcat cttgcgttgg 3000 agtccaagaa atttcagcaa gtaatgccac tacgaacgta gcaactgcta catgtggagc 3060 gagtagtgct ggacaatca ttgtaactat ggatactact aaggctagg gcgctatat 3120 aacattaacg ccaacatatg ctagtggcgc tgtaacatgg aaatgtacga caactctga 3180 taaaaaatat gtaccatcag atgtcgtgg t 3211 <210> 4 <211> 3536 <212> DNA <213> Artificial Sequence <400> 4 actgcataat tcgtgtcgct caaggcgcac tcccgttctg gataatgttt tttgcgccga 60 catcataacg gttctggcaa atattctgaa atgagctgtt gacaattaat catcggctcg 120 tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagaa ttcatgcccg 180 ctgaaacgac cgtatccggc gcgcaccccg ccgccaaact gccgatttac atcctgccct 240 gcttcctttg gataggcatc gtccccttta ccttcgcgct caaactgaaa ccgtcgcccg 300[[ID=*]] acttttacca cgatgccgcc gccgcagccg gcctgattgt cctgttgttc ctcacggcag 360 gaaaaaaact gtttgatgtc aaaatccccg ccatcagctt ccttctgttt gcaatggcgg 420 cgttttggta tcttcaggca cgcctgatga acctgattta ccccggtatg aacgacatcg 480 tctcttggat tttcatcttg ctcgccgtca gcgcgtgggc ctgccggagc ttggtcgcac 540 acttcggaca agaacgcatc gtgaccctgt ttgcctggtc gctgcttatc ggctccctgc 600 ttcaatcctg catcgtcgtc atccagtttg ccggctggga agacacccct ctgtttcaaa *660 acatcatcgt ttacagcggg caaggcgtaa tcggacacat cgggcagcgc aacaacctcg gacactacct catgtggggc atactcgccg ccgcctacct caacggaca cgaaaaatcc ccgccgccct cggcgtaatc tgcctgatta tgcagaccgc cgttttaggt ttggtcaact 840 cgcgcaccat cttgacctac atagccgcca tcgccctcat ccttcccttc tggtatttcc 900 gttcggacaa atccaacagg cggacgatgc tcggcatagc cgcagccgta ttccttaccg 960 cgctgttcca attttccatg aacaccattc tggaaacctt tactggcatc cgctacgaaa ctgccgtcga acgcgtcgcc aacggcggtt tcacagactt gccgcgccaa atcgaatgga 1080. ataaagccct tgccgccttc cagtccgccc cgatattcgg gcacggctgg aacagttttg 1140 cccaacaaac cttcctcatc aatgccgac agcacaacat attackcgacac ctcctcagca acttgttcac ccattcccac aacatcgtcc tccaactcct tgcagagatg ggaatcagcg gcacgcttct ggttgccgca accctgctga cgggcattgc cgggctgctt aaacgccccc tgacccccgc atcgcttttc ctaatctgca cgcttgccgt cagtatgtgc cacagtatgc 1380. tcgaatatcc tttgtggtat gtctatttcc tcatcccttt cggactgatg ctcttcctgt 1440 cccccgcaga ggcttcagac ggcatcgcct tcaaaaaagc cgccaatctc ggcatactga 1500 ccgcctccgc cgccatattc gcaggattgc tgcacttgga ctggacatac acccggctgg 1560 ttaacgcctt ttcccccgcc actgacgaca gtgccaaaac cctcaaccgg aaaatcaacg 1620 agttgcgcta tatttccgca aacagtccga tgctgtcctt ttatgccgac ttctccctcg 1680 taaacttcgc cctgccggaa taccccgaaa cccagacttg ggcggaagaa gcaaccctca 1740 aatcactaaa ataccgcccc cactccgcca cctaccgcat cgccctctac ctgatgcggc 1800 aaggcaaagt tgcagaagca aaacaatgga tgcgggcgac acagtcctat tacccctacc 1860 tgatgccccg atacgccgac gaaatccgca aactgcccgt atgggcgccg ctgctacccg 1920 aactgctcaa agactgcaaa gccttcgccg ccgcgcccgg tcatccggaa gcaaaaccct 1980 gcaaatgaaa gcttggctgt tttggcggat gagagaagat tttcagcctg atacagatta 2040 aatcagaacg cagaagcggt ctgataaaac agaatttgcc tggcggcagt agcgcggtgg 2100 tcccacctga ccccatgccg aactcagaag tgaaacgccg tagcgccgat ggtagtgtgg 2160 ggtctcccca tgcgagagta gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg 2220 aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct gagtaggaca 2280 aatccgccgg gagcggattt gaacgttgcg aagcaacggc ccggagggtg gcgggcagga 2340 cgcccgccat aaactgccag gcatcaaatt aagcagaagg ccatcctgac ggatggcctt 2400 tttgcgtttc tacaaactct tttgtttatt tttctaaata cattcaaata tgtatccgct 2460 catgagacga gctctgcata attcgtgtcg ctcaaggcgc actcccgttc tggataatgt 2520 tttttgcgcc gacatcataa cggttctggc aaatattctg aaatgagctg ttgacaatta 2580 atcatcggct cgtataatgt gtggaattgt gagcggataa caatttcaca caggaaacag 2640 aattcatgaa gaaaatttgg ctggccttag ccggcctggt tctggcattc agcgccagcg 2700 caacccgca gaacatcacc gacctgtgcg ccgagtacca caacacccaa atttataccc 2760 tgaacgacaa aatttttagc tacaccgaga gcctggcagg caagcgcgag atggccatca 2820 tcaccttcaa gaacggcgcc attttccagg tggaggtgcc gggcagccag cacatcgaca 2880 gtcagaagaa ggccatcgag cgcatgaagg acaccctgcg catcgcctac ctgaccgagg 2940 ccaaggtgga gaagctgtgc gtgtggaaca acaagacccc gcacgccatc gccgcaatca 3000 gcatggccaa cgaccagaac gccaccagcg ccgtgaccga gtactatctg aaccatggcg 3060 agtggccggg taataacacc agcgccggcg tggccacaag cagtgagatc aagggcggcg 3120 gccaccatca ccaccaccat taaaagcttg gctgttttgg cggatgagag aagattttca 3180 gcctgataca gattaaatca gaacgcagaa gcggtctgat aaaacagaat ttgcctggcg 3240 gcagtagcgc ggtggtccca cctgacccca tgccgaactc agaagtgaaa cgccgtagcg 3300 3360 cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc ggtgaacgct 3420 3480 gggtggcggg caggacgccc gccataaact gccctgcagt tttccatcga tggccg 3536 <210> 5 <211> 3260 <212> DNA <213> Artificial Sequence <400> 5 actgcataat tcgtgtcgct caaggcgcac tcccgttctg gataatgttt tttgcgccga 60 catcataacg gttctggcaa atattctgaa atgagctgtt gacaattaat catcggctcg 120 tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagaa ttcatgcccg 180 ctgaaacgac cgtatccggc gcgcaccccg ccgccaaact gccgatttac atcctgccct 240 gcttcctttg gataggcatc gtccccttta ccttcgcgct caaactgaaa ccgtcgcccg 300 acttttacca cgatgccgcc gccgcagccg gcctgattgt cctgttgttc ctcacggcag 360 gaaaaaaact gtttgatgtc aaaatccccg ccatcagctt ccttctgttt gcaatggcgg 420 cgttttggta tcttcaggca cgcctgatga acctgattta ccccggtatg aacgacatcg 480 tctcttggat tttcatcttg ctcgccgtca gcgcgtgggc ctgccggagc ttggtcgcac 540 acttcggaca agaacgcatc gtgaccctgt ttgcctggtc gctgcttatc ggctccctgc 600 ttcaatcctg catcgtcgtc atccagtttg ccggctggga agacacccct ctgtttcaaa 660. acatcatcgt ttacagcggg caaggcgtaa tcggacacat cgggcagcgc aacaacctcg gacactacct catgtggggc atactcgccg ccgcctacct caacggaca cgaaaaatcc ccgccgccct cggcgtaatc tgcctgatta tgcagaccgc cgttttaggt ttggtcaact 840 cgcgcaccat cttgacctac atagccgcca tcgccctcat ccttcccttc tggtatttcc 900 gttcggacaa atccaacagg cggacgatgc tcggcatagc cgcagccgta ttccttaccg 960 cgctgttcca attttccatg aacaccattc tggaaacctt tactggcatc cgctacgaaa ctgccgtcga acgcgtcgcc aacggcggtt tcacagactt gccgcgccaa atcgaatgga 1080. ataaagccct tgccgccttc cagtccgccc cgatattcgg gcacggctgg aacagttttg 1140 cccaacaaac cttcctcatc aatgccgac agcacaacat attackcgacac ctcctcagca acttgttcac ccattcccac aacatcgtcc tccaactcct tgcagagatg ggaatcagcg gcacgcttct ggttgccgca accctgctga cgggcattgc cgggctgctt aaacgccccc tgacccccgc atcgcttttc ctaatctgca cgcttgccgt cagtatgtgc cacagtatgc 1380 tcgaatatcc tttgtggtat gtctatttcc tcatcccttt cggactgatg ctcttcctgt 1440 cccccgcaga ggcttcagac ggcatcgcct tcaaaaaagc cgccaatctc ggcatactga 1500 ccgcctccgc cgccatattc gcaggattgc tgcacttgga ctggacatac acccggctgg 1560 ttaacgcctt ttcccccgcc actgacgaca gtgccaaaac cctcaaccgg aaaatcaacg 1620 agttgcgcta tatttccgca aacagtccga tgctgtcctt ttatgccgac ttctccctcg 1680 taaacttcgc cctgccggaa taccccgaaa cccagacttg ggcggaagaa gcaaccctca 1740 aatcactaaa ataccgcccc cactccgcca cctaccgcat cgccctctac ctgatgcggc 1800 aaggcaaagt tgcagaagca aaacaatgga tgcgggcgac acagtcctat tacccctacc 1860 tgatgccccg atacgccgac gaaatccgca aactgcccgt atgggcgccg ctgctacccg 1920 aactgctcaa agactgcaaa gccttcgccg ccgcgcccgg tcatccggaa gcaaaaccct 1980 gcaaatgaaa gcttggctgt tttggcggat gagagaagat tttcagcctg atacagatta 2040 aatcagaacg cagaagcggt ctgataaaac agaatttgcc tggcggcagt agcgcggtgg 2100 tcccacctga ccccatgccg aactcagaag tgaaacgccg tagcgccgat ggtagtgtgg 2160 ggtctcccca tgcgagagta gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg 2220 aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct gagtaggaca 2280 aatccgccgg gagcggattt gaacgttgcg aagcaacggc ccggagggtg gcgggcagga 2340 cgcccgccat aaactgccag gcatcaaatt aagcagaagg ccatcctgac ggatggcctt 2400 tttgcgtttc tacaaactct tttgtttatt tttctaaata cattcaaata tgtatccgct 2460 catgagacga gctctgcata attcgtgtcg ctcaaggcgc actcccgttc tggataatgt 2520 tttttgcgcc gacatcataa cggttctggc aaatattctg aaatgagctg ttgacaatta 2580 atcatcggct cgtataatgt gtggaattgt gagcggataa caatttcaca caggaaacag 2640 aattcatgaa gaaaatttgg ctggccttag ccggcctggt tctggcattc agcgccagcg 2700 caaccccgca gaacatcacc gacctgtgcg ccgagtacca caacacccaa atttataccc 2760 tgaacgacaa aatttttagc tacaccgaga gcctggcagg caagcgcgag atggccatca 2820 tcaccttcaa gaacggcgcc attttccagg tggaggtgcc gggcagccag cacatcgaca 2880 gtcagaagaa ggccatcgag cgcatgaagg acaccctgcg catcgcctac ctgaccgagg 2940 ccaaggtgga gaagctgtgc gtgtggaaca acaagacccc gcacgccatc gccgcaatca 3000 gcatggccaa cggcggatcc ggccgcctgc tgctgcgtct ggaagaactg gaacgtcgcc 3060 tggaagagct ggcaaagttc gtggcagcat ggaccctgaa agcggctgcg gttgacctgg 3120 aactggctgc tctgcgtcgt cgtctggagg agctggctcg tggcggttct ggtagcgccg 3180 tgaccgagta ctatctgaac catggcgagt ggccgggtaa taacaccagc gccggcgtgg 3240 ccacaagcag tgagatcaag 3260 <210> 6 <211> 8128 <212> DNA <213> Artificial Sequence <400> 6 gcggccgcaa ggggttcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg 60 cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccacacagat 120 gcgtaaggag aaaataccgc atcaggcgcc attcgccatt cagctgcgca actgttggga 180 agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc 240 aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc 300 cagtgaattg taatacgact cactataggg cgaattcgag ctcggtaccc ggggatcctc 360 tagagtcgac ctgcaggcat gcaagcttga gtattctata gtctcaccta aatagcttgg 420 cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca 480 acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca 540 cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc 600 attaatgaat cggccaacgc gaaccccttg cggccgcccg ggccgtcgac caattctcat 660 gtttgacagc ttatcatcga atttctgcca ttcatccgct tattatcact tattcaggcg 720 tagcaaccag gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc 780 cactcatcgc agtactgttg taattcatta agcattctgc cgacatggaa gccatcacaa 840 acggcatgat gaacctgaat cgccagcggc atcagcacct tgtcgccttg cgtataatat 900 ttgcccatgg tgaaaacggg ggcgaagaag ttgtccatat tggccacgtt taaatcaaaa 960 ctggtgaaac tcacccaggg attggctgag acgaaaaaca tattctcaat aaacccttta 1020 gggaaatagg ccaggttttc accgtaacac gccacatctt gcgaatatat gtgtagaaac 1080 tgccggaaat cgtcgtggta ttcactccag agcgatgaaa acgtttcagt ttgctcatgg 1140 aaaacggtgt aacaagggtg aacactatcc catatcacca gctcaccgtc tttcattgcc 1200 atacgaaatt ccggatgagc attcatcagg cgggcaagaa tgtgaataaa ggccggataa 1260 aacttgtgct tatttttctt tacggtcttt aaaaaggccg taatatccag ctgaacggtc 1320 tggttatagg tacattgagc aactgactga aatgcctcaa aatgttcttt acgatgccat 1380 tgggatatat caacggtggt atatccagtg atttttttct ccattttagc ttccttagct 1440 cctgaaaatc tcgataactc aaaaaatacg cccggtagtg atcttatttc attatggtga 1500 aagttggaac ctcttacgtg ccgatcaacg tctcattttc gccaaaagtt ggcccagggc 1560 ttcccggtat caacagggac accaggattt atttattctg cgaagtgatc ttccgtcaca 1620 ggtatttatt cgcgataagc tcatggagcg gcgtaaccgt cgcacaggaa ggacagagaa 1680 agcgcggatc tgggaagtga cggacagaac ggtcaggacc tggattgggg aggcggtttgc 1740 cgccgctgct gctgacggtg tgacgttctc tgttccggtc acaccacata cgttccgcca 1800 ttcctatgcg atgcacatgc tgtatgccgg tataccgctg aaagttctgc aaagcctgat 1860 gggacataag tccatcagtt caacggaagt ctacacgaag gtttttgcgc tggatgtggc 1920 tgcccggcac cgggtgcagt ttgcgatgcc ggagtctgat gcggttgcga tgctgaaaca 1980 attatcctga gaataaatgc cttggccttt atatggaaat gtggaactga gtggatatgc 2040 tgttttgtc tgttaaacag agaagctggc tgttatccac tgagaagcga acgaaacagt 2100 cgggaaaatc tcccattatc gtagagatcc gcattattaa tctcaggac ctgtgtagcg 2160 tttataggaa gtagtgttct gtcatgatgc ctgcaagcgg taacgaaaac gatttgaata 2220 tgccttcagg aacaatagaa atcttcgtgc ggtgttacgt tgaagtggag cggattatgt 2280 cagcaatgga cagaacaacc taatgaacac agaaccatga tgtggtctgt ccttttacag 2340 ccagtagtgc tcgccgcagt cgagcgacag ggcgaagccc tcgagctggt tgccctcgcc 2400 gctgggctgg cggccgtcta tggccctgca aacgcgccag aaacgccgtc gaagccgtgt 2460 gcgagacacc gcggccggcc gccggcgttg tggatacctc gcggaaaact tggccctcac 2520 tgacagatga ggggcggacg ttgacacttg aggggccgac tcacccggcg cggcgttgac 2580 agatgagggg caggctcgat ttcggccggc gacgtggagc tggccagcct cgcaaatcgg 2640 cgaaaacgcc tgattttacg cgagtttccc acagatgatg tggacaagcc tggggataag 2700 tgccctgcgg tattgacact tgaggggcgc gactactgac agatgagggg cgcgatcctt 2760 gacacttgag gggcagagtg ctgacagatg aggggcgcac ctattgacat ttgaggggct 2820 gtccacaggc agaaaatcca gcatttgcaa gggtttccgc ccgtttttcg gccaccgcta 2880 acctgtcttt taacctgctt ttaaaccaat atttataaac cttgttttta accagggctg 2940 cgccctgtgc gcgtgaccgc gcacgccgaa ggggggtgcc cccccttctc gaaccctccc 3000 ggtcgagtga gcgaggaagc accagggaac agcacttata tattctgctt acacacgatg 3060 cctgaaaaaa cttcccttgg ggttatccac ttatccacgg ggatattttt ataattattt 3120 tttttatagt ttttagatct tcttttttag agcgccttgt aggcctttat ccatgctggt 3180 tctagagaag gtgttgtgac aaattgccct ttcagtgtga caaatcaccc tcaaatgaca 3240 gtcctgtctg tgacaaattg cccttaaccc tgtgacaaat tgccctcaga agaagctgtt 3300 ttttcacaaa gttatccctg cttattgact cttttttatt tagtgtgaca atctaaaaac 3360 ttgtcacact tcacatggat ctgtcatggc ggaaacagcg gttatcaatc acaagaaacg 3420 taaaaatagc ccgcgaatcg tccagtcaaa cgacctcact gaggcggcat atagtctctc 3480 ccgggatcaa aaacgtatgc tgtatctgtt cgttgaccag atcagaaaat ctgatggcac 3540 cctacaggaa catgacggta tctgcgagat ccatgttgct aaatatgctg aaatattcgg 3600 attgacctct gcggaagcca gtaaggatat acggcaggca ttgaagagtt tcgcggggaa 3660 ggaagtggtt ttttatcgcc ctgaagagga tgccggcgat gaaaaaggct atgaatcttt 3720 tccttggttt atcaaacgtg cgcacagtcc atccagaggg ctttacagtg tacatatcaa cccatatctc attcccttct ttatcgggtt acagaaccgg tttacgcagt ttcggcttag 3840 tgaaacaaaa gaatcacca atccgtatgc catgcgttta tacgaatccc tgtgtcagta tcgtaagccg gatggctcag gcatcgtctc tctgaaaatc gactggatca taggcgtta ccagctgcct caaagttacc agcgtatgcc tgacttccgc cgccgcttcc tgcaggtctg 4020 4080. tgttaatgag atcaacagca gaactccaat gcgcctctca tacattgaga aaaagaaagg ccgccagacg actcatatcg tattttcctt ccgcgatatc acttccatga cgacaggata 4140 gtctgagggt tatctgtcac agatttgagg gtggttcgtc acatttgttc tgacctactg 4200 agggtaattt gtcacagttt tgctgtttcc ttcagcctgc atggattttc tcatactttt 4260 tgaactgtaa tttttaagga agccaaattt gagggcagtt tgtcacagtt gatttccttc tctttccctt cgtcatgtga cctgatatcg ggggttagtt cgtcatcatt gatgagggtt 4380 gattatcaca gtttattact ctgaattggc tatccgcgtg tgtacctcta cctggagttt 4440. ttcccacggt ggatatttct tcttgcgctg agcgtaagag ctatctgaca gaacagttct 4500 tctttgcttc ctcgccagtt cgctcgctat gctcggttac acggctgcgg cgagcgctag 4560 tgataataag tgactgaggt atgtgctctt cttatctcct tttgtagtgt tgctcttatt 4620 ttaaacaact ttgcggtttt ttgatgactt tgcgattttg ttgttgcttt gcagtaaatt 4680 gcaagattta ataaaaaaac gcaaagcaat gattaaagga tgttcagaat gaaactcatg 4740 gaaacactta accagtgcat aaacgctggt catgaaatga cgaaggctat cgccattgca 4800 cagtttaatg atgacagccc ggaagcgagg aaaataaccc ggcgctggag aataggtgaa 4860 gcagcggatt tagttggggt ttcttctcag gctatcagag atgccgagaa agcagggcga 4920 ctaccgcacc cggatatgga aattcgagga cgggttgagc aacgtgttgg ttatacaatt 4980 gaacaaatta atcatatgcg tgatgtgttt ggtacgcgat tgcgacgtgc tgaagacgta 5040 tttccaccgg tgatcggggt tgctgcccat aaaggtggcg tttacaaaac ctcagtttct 5100 gttcatcttg ctcaggatct ggctctgaag gggctacgtg ttttgctcgt ggaaggtaac 5160 gacccccagg gaacagcctc aatgtatcac ggatgggtac cagatcttca tattcatgca 5220 gaagacactc tcctgccttt ctatcttggg gaaaggacg atgtcactta tgcaataaag 5280 cccacttgct ggccggggct tgacattatt ccttcctgtc tggctctgca ccgtattgaa 5340 actgagttaa tgggcaaatt tgatgaaggt aaactgccca ccgatccaca cctgatgctc 5400 cgactggcca ttgaaactgt tgctcatgac tatgatgtca tagttattga cagcgcgcct 5460 aacctgggta tcggcacgat taatgtcgta tgtgctgctg atgtgctgat tgttcccag 5520 cctgctgagt tgtttgacta cacctccgca ctgcagtttt tcgatatgct tcgtgatctg 5580 ctcaagaacg ttgatcttaa agggttcgag cctgatgtac gtattttgct taccaaatac 5640 agcaatagca atggctctca gtccccgtgg atggaggac aaattcggga tgcctgggga 5700 agcatggtc taaaaaatgt tgtacgtgaa acggatgaag ttggtaaagg tcagatccgg 5760 atgagaactg tttttgaaca ggccattgat caacgctctt caactggtgc ctggagaaat 5820 gctctttcta tttgggaacc tgtctgcaat gaaattttcg atcgtctgat taaaccacgc 5880 tgggagatta gataatgaag cgtgcgcctg ttattccaaa acatacgctc aatactcaac 5940 cggttgaaga tacttcgtta tcgacaccag ctgccccgat ggtggattcg ttaattgcgc 6000 gcgtaggagt aatggctcgc ggtaatgcca ttactttgcc tgtatgtggt cgggatgtga 6060 agtttactct tgaagtgctc cggggtgata gtgttgagaa gacctctcgg gtatggtcag 6120 gtaatgaacg tgaccaggag ctgcttactg aggacgcact ggatgatctc atcccttctt 6180 ttctactgac tggtcaacag acaccggcgt tcggtcgaag agtatctggt gtcatagaaa 6240 ttgccgatgg gagtcgccgt cgtaaagctg ctgcacttac cgaaagtgat tatcgtgttc 6300 tggttggcga gctggatgat gagcagatgg ctgcattatc cagattgggt aacgattatc 6360 gcccaacaag tgcttatgaa cgtggtcagc gttatgcaag ccgattgcag aatgaatttg 6420 ctggaaatat ttctgcgctg gctgatgcgg aaaatatttc acgtaagatt attacccgct 6480 gtatcaacac cgccaaattg cctaaatcag ttgttgctct tttttctcac cccggtgaac 6540 tatctgcccg gtcaggtgat gcacttcaaa aagcctttac agataaagag gaattactta 6600 agcagcaggc atctaacctt catgagcaga aaaaagctgg ggtgatattt gaagctgaag 6660 aagttatcac tcttttaact tctgtgctta aaacgtcatc tgcatcaaga actagtttaa 6720 gctcacgaca tcagtttgct cctggagcga cagtattgta taagggcgat aaaatggtgc 6780 ttaacctgga caggtctcgt gttccaactg agtgtataga gaaaattgag gccattctta 6840 aggaacttga aaagccagca ccctgatgcg accacgtttt agtctacgtt tatctgtctt 6900 tacttaatgt cctttgttac aggccagaaa gcataactgg cctgaatatt ctctctgggc 6960 ccactgttcc acttgtatcg tcggtctgat aatcagactg ggaccacggt cccactcgta 7020 tcgtcggtct gattattagt ctgggaccac ggtcccactc gtatcgtcgg tctgattatt 7080 agtctgggac cacggtccca ctcgtatcgt cggtctgata atcagactgg gaccacggtc 7140 ccactcgtat cgtcggtctg attattagtc tgggaccatg gtcccactcg tatcgtcggt 7200 ctgattatta gtctgggacc acggtcccac tcgtatcgtc ggtctgatta ttagtctgga 7260 accacggtcc cactcgtatc gtcggtctga ttattagtct gggaccacgg tcccactcgt 7320 atcgtcggtc tgattattag tctgggacca cgatcccact cgtgttgtcg gtctgattat 7380 cggtctggga ccacggtccc acttgtattg tcgatcagac tatcagcgtg agactacgat 7440 tccatcaatg cctgtcaagg gcaagtattg acatgtcgtc gtaacctgta gaacggagta 7500 acctcggtgt gcggttgtat gcctgctgtg gattgctgct gtgtcctgct tatccacaac 7560 attttgcgca cggttatgtg gacaaaatac ctggttaccc aggccgtgcc ggcacgttaa 7620 ccgggctgca tccgatgcaa gtgtgtcgct gtcgacgagc tcgcgagctc ggacatgagg 7680 ttgccccgta ttcagtgtcg ctgatttgta ttgtctgaag ttgtttttac gttaagttga 7740 tgcagatcaa ttaatacgat acctgcgtca taattgatta tttgacgtgg tttgatggcc 7800 tccacgcacg ttgtgatatg tagatgataa tcattatcac tttacgggtc ctttccggtg 7860 atccgacagg ttacggggcg gcgacctcgc gggttttcgc tatttatgaa aattttccgg 7920 tttaaggcgt ttccgttctt cttcgtcata acttaatgtt tttatttaaa ataccctctg 7980 aaaagaaagg aaacgacagg tgctgaaagc gagctttttg gcctctgtcg tttcctttct 8040 ctgtttttgt ccgtggaatg aacaatggaa gtccgagctc atcgctaata acttcgtata 8100 gcatacatta tacgaagtta tattcgat 8128
Claims
1. Application of recombinant plasmids containing DNA molecule A and recombinant plasmids containing DNA molecule B in the preparation of pneumococcal vaccines; The DNA molecule A contains a gene cluster related to the synthesis of CPS of Streptococcus pneumoniae K5 serotype, as shown in sequence 1; The DNA molecule B contains the pglL gene and fusion gene I; the fusion gene I includes, from upstream to downstream, an NP gene and a gene encoding a glycosylation site; the DNA molecule B is shown in sequence 5.
2. Application of recombinant plasmids containing DNA molecule A and recombinant plasmids containing DNA molecule C in the preparation of pneumococcal vaccines; The DNA molecule A contains a gene cluster related to the synthesis of CPS of Streptococcus pneumoniae K5 serotype, as shown in sequence 1; The DNA molecule C contains the pglL gene and fusion gene II; the fusion gene includes, from upstream to downstream, a gene encoding the cholera toxin B subunit and a gene encoding a glycosylation site; the DNA molecule C is shown in sequence 4.
3. The application of a recombinant plasmid containing DNA molecule A, a recombinant plasmid containing DNA molecule B, and Escherichia coli W3110△waaL△wbbH-L in the preparation of a pneumococcal vaccine; wherein the DNA molecule A is as described in claim 1, and the DNA molecule B is as described in claim 1.
4. The application of a recombinant plasmid containing DNA molecule A, a recombinant plasmid containing DNA molecule C, and Escherichia coli W3110△waaL△wbbH-L in the preparation of a pneumococcal vaccine; wherein the DNA molecule A is as described in claim 2, and the DNA molecule C is as described in claim 2.
5. A recombinant bacterium, obtained by introducing a recombinant plasmid containing DNA molecule A and a recombinant plasmid containing DNA molecule B into Escherichia coli W3110△waaL△wbbH-L; wherein the DNA molecule A is as described in claim 1, and the DNA molecule B is as described in claim 1.
6. A recombinant bacterium, obtained by introducing a recombinant plasmid containing DNA molecule A and a recombinant plasmid containing DNA molecule C into Escherichia coli W3110△waaL△wbbH-L; wherein DNA molecule A is as described in claim 2, and DNA molecule C is as described in claim 2.
7. The use of the recombinant bacteria according to claim 5 or 6 in the preparation of a pneumococcal vaccine.
8. A method for preparing a pneumococcal vaccine, comprising the following steps: culturing the recombinant bacteria as described in claim 5 or 6 and collecting glycoproteins to obtain a pneumococcal vaccine.
9. A pneumococcal vaccine, wherein the active ingredient is a glycoprotein obtained by culturing the recombinant bacteria of claim 5 or 6.
10. A kit for preparing a pneumococcal vaccine; the kit comprising a recombinant plasmid having DNA molecule A and a recombinant plasmid having DNA molecule B, or the kit comprising a recombinant plasmid having DNA molecule A and a recombinant plasmid having DNA molecule C; wherein DNA molecule A is as described in claim 1, DNA molecule B is as described in claim 1, and DNA molecule C is as described in claim 2.
Citation Information
Patent Citations
Carrier protein of bacterial polysaccharide conjugate vaccine and application thereof
CN106511994A
Fusion protein capable of being self-assembled into protein nanoparticle and application of fusion protein
CN111333733A
Vaccine containing capsular polysaccharide of type 5 streptococcus pneumoniae and preparation method thereof
CN112741901A