Methods for detecting single-stranded RNA viruses

Abstract

A method for detecting a single-stranded RNA virus in a sample according to one embodiment of the present invention includes a step of contacting a primer set with a sample to perform a reverse transcription loop-mediated isothermal amplification reaction, wherein the primer set is designed based on the base sequence of a target RNA and the base sequence of a nucleic acid complementary to the target RNA, and comprises the following (i) to (v): (i) a FIP primer; (ii) a BIP primer; (iii) an F3 primer as an outer primer; (iv) a B3 primer as an outer primer; and (v) one or more additional outer primers, each of which has the same base sequence as an optional region present at a position closer to the 5' end side than region B3 or region F3 in the nucleic acid complementary to the target RNA. According to the present invention, a single-stranded RNA virus can be detected with high sensitivity.

Description

Technical Field

[0001] The present invention relates to a method for detecting single-stranded RNA viruses. Background Art

[0002] Viruses are organisms that parasitize cells and cannot be cultured alone. Therefore, genetic diagnosis is mainly used as a method to identify the causative virus in a short period of time in the diagnosis of viral infections. In viral genetic diagnosis, the nucleic acid sequence inherent to the virus to be detected is amplified and detected through a nucleic acid amplification reaction.

[0003] As a kind of nucleic acid amplification method, the known loop-mediated isothermal amplification (LAMP (Loop-Mediated Isothermal Amplification)) method (patent document 1). In this method, two inner primers (FIP primer and BIP primer) and two outer primers (F3 primer and B3 primer) are designed based on 6 regions (F3, F2, F1, B1c, B2c and B3c or F3c, F2c, F1c, B1, B2 and B3) of the target nucleic acid, and these primers are used to amplify the target nucleic acid at a constant temperature. In addition, it is known that in the LAMP method, in addition to the above-mentioned inner primer and outer primer, two loop primers (loop primer F and loop primer B) are also used, thereby improving the efficiency of the amplification reaction (patent document 2).

[0004] Viruses are classified into double-stranded DNA viruses, single-stranded RNA viruses, etc. according to the nucleic acid species of the genome. Single-stranded RNA viruses are divided into + strand (positive strand) viruses in which genes are read in the direction from the 5' end to the 3' end and - strand (negative strand) viruses in which genes are read in the direction from the 3' end to the 5' end by complementary strands. In the case of amplifying the nucleic acid of RNA viruses, at the beginning of the amplification reaction, it is necessary to use a reverse transcriptase to synthesize cDNA from the template RNA in a reverse transcription reaction. The LAMP method combined with the reverse transcription reaction is called a reverse transcription loop-mediated isothermal amplification (RT-LAMP) method (e.g., patent document 3).

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: International Publication No. 00 / 28082

[0008] Patent Document 2: International Publication No. 02 / 24902

[0009] Patent Document 3: International Publication No. 2018 / 042598 Summary of the invention

[0010] Problems to be solved by the invention

[0011] Although the LAMP method described in Patent Documents 1 to 3 can detect viruses with relatively high sensitivity, many viral diseases cause severe symptoms, and therefore a method for more reliably detecting the viruses that cause these diseases is needed. Therefore, the present invention aims to detect single-stranded RNA viruses with high sensitivity.

[0012] Methods used to solve problems

[0013] The present inventors have conducted intensive studies and have found that, in addition to the conventional six primers, a specific additional outer primer is used for RT-LAMP reaction, thereby enabling detection of single-stranded RNA viruses with higher sensitivity, thereby completing the present invention. According to the new findings of the present inventors, even if an outer primer is added that anneals to a region on the 3' end side of a nucleic acid complementary to a target RNA of a single-stranded RNA virus, the detection sensitivity does not increase, whereas, when an outer primer is added that anneals to a region on the 3' end side of a target RNA of a single-stranded RNA virus, the detection sensitivity increases.

[0014] The present invention relates to the following [1] to [8]. [1]

[0016] A method for detecting a single-stranded RNA virus in a sample, comprising the steps of contacting a primer set with the sample to perform a reverse transcription loop-mediated isothermal amplification reaction,

[0017] The primer set is designed based on the base sequence of the target RNA of the single-stranded RNA virus and the base sequence of the nucleic acid complementary to the target RNA.

[0018] In the case where the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end, and the nucleic acid complementary to the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end,

[0019] In the case where the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end, and the nucleic acid complementary to the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end,

[0020] The primer set includes the following (i) to (v):

[0021] (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end;

[0022] (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end;

[0023] (iii) an F3 primer as an outer primer having the same base sequence as region F3;

[0024] (iv) a B3 primer as an outer primer having the same base sequence as region B3; and

[0025] (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5′-terminal side of the region B3 or the region F3 in the nucleic acid complementary to the target RNA,

[0026] Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers may be replaced by thymine. [2]

[0028] A method for detecting positive-stranded single-stranded RNA viruses in a sample, comprising the steps of contacting a primer set with the sample to perform a reverse transcription loop-mediated isothermal amplification reaction,

[0029] The primer set is designed based on the base sequence of the target RNA and the base sequence of the nucleic acid complementary to the target RNA.

[0030] The base sequence of the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in order from the 5' end to the 3' end,

[0031] The base sequence of the nucleic acid complementary to the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end,

[0032] The primer set includes the following (i) to (v):

[0033] (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end;

[0034] (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end;

[0035] (iii) an F3 primer as an outer primer having the same base sequence as region F3;

[0036] (iv) a B3 primer as an outer primer having the same base sequence as region B3; and

[0037] (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5′-terminal side of region B3 in the nucleic acid complementary to the target RNA,

[0038] Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers may be replaced by thymine. [3]

[0040] A method for detecting a negative-strand single-stranded RNA virus in a sample, comprising the steps of contacting a primer set with the sample to perform a reverse transcription loop-mediated isothermal amplification reaction,

[0041] The primer set is designed based on the base sequence of the target RNA and the base sequence of the nucleic acid complementary to the target RNA.

[0042] The base sequence of the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in order from the 3' end to the 5' end,

[0043] The base sequence of the nucleic acid complementary to the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end,

[0044] The primer set includes the following (i) to (v):

[0045] (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end;

[0046] (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end;

[0047] (iii) an F3 primer as an outer primer having the same base sequence as region F3;

[0048] (iv) a B3 primer as an outer primer having the same base sequence as region B3; and

[0049] (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5′-terminal side of region F3 in the nucleic acid complementary to the target RNA,

[0050] Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers may be replaced by thymine. [4]

[0052] The method according to any one of [1] to [3], wherein the primer set further comprises:

[0053] (vi) a loop primer F having the same base sequence as an optional region between region F1c and region F2c; and

[0054] (vii) a loop primer B having the same base sequence as an optional region between region B1c and region B2c,

[0055] Among them, uracil that may exist in the base sequences of loop primer F and loop primer B can be replaced by thymine. [5]

[0057] The method according to any one of [1] to [4], wherein the melting temperature of the one or more additional outer primers in (v) is 30 to 55°C. [6]

[0059] The method according to any one of [1] to [5], wherein the primer set comprises an additional outer primer (v). [7]

[0061] The method as described in any one of [1] to [6], further comprising the step of detecting the amplification product of the reverse transcription loop-mediated isothermal amplification reaction. [8]

[0063] A kit for detecting single-stranded RNA viruses, comprising a primer set,

[0064] The primer set is designed based on the base sequence of the target RNA of the single-stranded RNA virus and the base sequence of the nucleic acid complementary to the target RNA.

[0065] In the case where the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end, and the nucleic acid complementary to the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end,

[0066] In the case where the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, the target RNA has optional regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end, and the nucleic acid complementary to the target RNA has optional regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end,

[0067] The primer set includes the following (i) to (v):

[0068] (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end;

[0069] (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end;

[0070] (iii) an F3 primer as an outer primer having the same base sequence as region F3;

[0071] (iv) a B3 primer as an outer primer having the same base sequence as region B3; and

[0072] (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5′-terminal side of the region B3 or the region F3 in the nucleic acid complementary to the target RNA,

[0073] Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers may be replaced by thymine.

[0074] Effects of the Invention

[0075] According to the present invention, single-stranded RNA viruses can be detected with high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] Figure 1 Shown are regions F3, F2, F1, B1c, B2c, B3c, and B4c in the target RNA of the (+)ssRNA virus, regions F3c, F2c, F1c, B1, B2, B3, and B4 in the cDNA complementary to the target RNA, and a primer set (FIP primer, BIP primer, F3 primer, B3 primer, B4 primer, loop primer F, and loop primer B) designed based on these base sequences.

[0077] Figure 2Shown are regions F4c, F3c, F2c, F1c, B1, B2, and B3 in the target RNA of the (-)ssRNA virus, regions F4, F3, F2, F1, B1c, B2c, and B3c in the cDNA complementary to the target RNA, and a primer set (FIP primer, BIP primer, F3 primer, B3 primer, F4 primer, loop primer F, and loop primer B) designed based on these base sequences. DETAILED DESCRIPTION

[0078] A method for detecting a single-stranded RNA virus in a sample according to one embodiment of the present invention is a method for detecting a single-stranded RNA virus in a sample by detecting nucleic acid amplification using the RT-LAMP method, characterized in that, as a primer set, in addition to using conventional primers (i.e., FIP primer, BIP primer, F3 primer, B3 primer, and optionally loop primer F and loop primer B), one or more additional outer primers that anneal to the region on the 3' end side of the target RNA are used. More specifically, a method for detecting a single-stranded RNA virus in a sample according to one embodiment of the present invention includes a step of contacting a primer set with a sample to perform an RT-LAMP reaction, wherein the primer set includes a FIP primer, a BIP primer, a F3 primer, a B3 primer, and one or more additional outer primers described later, and optionally includes loop primer F and loop primer B.

[0079] The single-stranded RNA virus to be detected can be a positive-stranded single-stranded RNA ((+)ssRNA) virus or a negative-stranded single-stranded RNA ((-)ssRNA) virus. (+)ssRNA viruses are not particularly limited, and may be, for example, dengue viruses such as dengue virus type 3 (DENV3), rubella virus, hepatitis C virus, norovirus, chikungunya virus, Zika virus (ZIKV), coronavirus, human immunodeficiency virus (HIV) or hepatitis A virus. (-)ssRNA viruses are not particularly limited, and may be, for example, influenza virus, Sendai virus, measles virus, human metapneumovirus or rabies virus (RABV).

[0080] The sample may be a sample collected from a subject suspected of being infected with a single-stranded RNA virus, such as sputum, body fluid, feces or tissue. The body fluid may be, for example, nasal mucus, saliva, blood, serum, plasma, spinal fluid, urine, semen or amniotic fluid. In addition, the sample may be bronchoalveolar washing fluid, nasal aspirate, nasal washing fluid, nasal swab, throat swab or mouthwash. Alternatively, the sample may be a cell or its culture fluid used in an experiment such as an infection experiment. The sample may be a sample that has been pre-treated by separation, extraction, concentration, purification or the like.

[0081] The target RNA may be the whole or a part of the single-stranded RNA possessed by the single-stranded RNA virus. The length of the target RNA is not particularly limited, and may be, for example, 200 to 30,000 bases, 200 to 1,000 bases, or 200 to 550 bases.

[0082] In this specification, the terms "FIP primer", "BIP primer", "F3 primer", "B3 primer", "loop primer F" and "loop primer B" have the same meaning as these terms in the conventional LAMP method and are terms understood by those skilled in the art. In other words, primers other than the additional outer primers described later can be appropriately designed based on the disclosure of literature and the like known to those skilled in the art.

[0083] Below, refer to Figure 1 and Figure 2 The primer set in the method of this mode is described. The primer set is designed based on the base sequence of the target RNA of single-stranded RNA virus and the base sequence of the nucleic acid complementary to the target RNA. In the target RNA and the nucleic acid complementary to the target RNA, in the chain with the base sequence that can directly become the template of protein synthesis, the optional region that becomes the basis of primer design is successively referred to as region F4, F3, F2, F1, B1c, B2c, B3c and B4c from the 5' end side to the 3' end side. On the other hand, in the chain with the base sequence that can not directly become the template of protein synthesis, the optional region that becomes the basis of primer design is successively referred to as region F4c, F3c, F2c, F1c, B1, B2, B3 and B4 from the 3' end side to the 5' end side. The base sequences of regions F4, F3, F2, F1, B1c, B2c, B3c and B4c are complementary to regions F4c, F3c, F2c, F1c, B1, B2, B3 and B4, respectively. Therefore, in the case where the single-stranded RNA virus to be detected is a (+)ssRNA virus, Figure 1 As shown in FIG. 1 , regions F3, F2, F1, B1c, B2c, B3c and B4c are optional regions that exist in sequence from the 5' end to the 3' end of the target RNA, and regions F3c, F2c, F1c, B1, B2, B3 and B4 are optional regions that exist in sequence from the 3' end to the 5' end of the nucleic acid complementary to the target RNA. On the other hand, in the case where the single-stranded RNA virus to be detected is a (-)ssRNA virus, as Figure 2 As shown, regions F4, F3, F2, F1, B1c, B2c and B3c are optional regions that exist in sequence from the 5' end to the 3' end of the nucleic acid complementary to the target RNA, and regions F4c, F3c, F2c, F1c, B1, B2 and B3 are optional regions that exist in sequence from the 3' end to the 5' end of the target RNA. Figure 1 and Figure 2, cDNA is described as a nucleic acid complementary to a target RNA, but the nucleic acid complementary to a target RNA is not limited to DNA, and may also be RNA.

[0084] In this specification, the term "complementary" does not necessarily mean completely complementary. For example, the scope of "a base sequence complementary to a certain base sequence" includes a base sequence of a nucleic acid that hybridizes with a nucleic acid having a certain base sequence under strict conditions. The strict conditions are not particularly limited, and can be, for example, 50% formamide, 5×SSC (150 mL NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhart's solution, and 10% dextran sulfate.

[0085] In the present specification, the term "identical" does not necessarily mean completely identical. For example, the scope of "a base sequence identical to a certain base sequence" includes a base sequence complementary to a base sequence complementary to the certain base sequence.

[0086] As understood by those skilled in the art, the FIP primer as an inner primer has the same base sequence as region F1c at the 5' end and the same base sequence as region F2 at the 3' end. However, when uracil is present in region F1c or region F2, the corresponding uracil in the FIP primer can be replaced by thymine. Between the base sequence identical to region F1c and the base sequence identical to region F2, there may be one or more nucleotides that serve as a linker, or there may not be any. The nucleotides that serve as a linker may be 1 to 500 bases, 1 to 100 bases, or 10 to 70 bases.

[0087] As is understood by those skilled in the art, the BIP primer as an inner primer has the same base sequence as region B1c at the 5' end and the same base sequence as region B2 at the 3' end. If uracil exists in region B1c or region B2, the corresponding uracil in the BIP primer can be replaced by thymine.

[0088] As is understood by those skilled in the art, the F3 primer as an outer primer has the same base sequence as that of the region F3. However, when uracil exists in the region F3, the corresponding uracil in the F3 primer may be replaced by thymine.

[0089] As is understood by those skilled in the art, the B3 primer as an outer primer has the same base sequence as that of the region B3. However, when uracil exists in the region B3, the corresponding uracil in the B3 primer may be replaced by thymine.

[0090] As understood by those skilled in the art, loop primer F has the same base sequence as the optional region between region F1c and region F2c. If uracil exists in the optional region between region F1c and region F2c, the corresponding uracil in loop primer F can be replaced by thymine.

[0091] As understood by those skilled in the art, loop primer B has the same base sequence as the optional region between region B1c and region B2c. If uracil exists in the optional region between region B1c and region B2c, the corresponding uracil in loop primer B may be replaced by thymine.

[0092] As described above, those skilled in the art can appropriately design FIP, BIP, F3, B3 primers, loop primer F and loop primer B suitable for amplification of target RNA. In other words, those skilled in the art can appropriately select regions suitable as regions F3, F2, F1, B1c, B2c and B3c in the target RNA. The length (number of bases) of each region can be, for example, more than 5 bases, more than 10 bases, 5 to 200 bases, 10 to 25 bases, 10 to 20 bases or 17 to 25 bases. The melting temperature (Tm) of each region can be, for example, 55 to 65°C, 60 to 65°C or 55 to 60°C. The Tm value in this specification is a value calculated by the nearest neighbor method (sodium ion concentration in the reaction solution: 50mM, magnesium ion concentration: 4mM, oligonucleotide concentration: 0.1μM). The CG content of each region can be, for example, 40-60%, 40-50% or 50-60%. The free energy change (dG) of 6 bases from the 5' end of regions F1c and B1c can be -4 kcal / mol or less. In addition, the dG of 6 bases from the 3' end of regions F2, B2, F3 and B3 and the region that forms the design basis of loop primers F or B can also be -4 kcal / mol or less. It is preferred that each primer has a base sequence that does not form an extreme secondary structure. In addition, from the viewpoint of preventing the formation of primer dimers, it is preferred that the 3' end of each primer does not have a base sequence that is complementary to its own 3' end or the 3' end of other primers.

[0093] The distance from the 5' end of region F2 to the 3' end of region B2c can be, for example, 120 to 180 bases. The distance between region F2 and region F3 and between region B2c and region B3c can be, for example, 0 to 20 bases. The distance from the 5' end of region F2 to the 5' end of region F1 and the distance from the 5' end of region B2 to the 5' end of region B1 can be, for example, 40 to 60 bases. The distance from region F1 to region B1c is not particularly limited, and the 3' end of region F1 and the 5' end of region B1c can be directly combined.

[0094] When the single-stranded RNA virus to be detected is a (+)ssRNA virus, the additional outer primer has the same base sequence as an optional region present at the 5' end side of the nucleic acid complementary to the target RNA than region B3. If uracil exists in the region, the corresponding uracil in the additional outer primer can be replaced by thymine. Figure 1 In the method, the B4 primer is the additional outer primer described above, and has the same base sequence as an optional region B4 present on the 5' end side of the region B3 in the cDNA complementary to the target RNA.

[0095] When the single-stranded RNA virus to be detected is a (-)ssRNA virus, the additional outer primer has the same base sequence as an optional region present at the 5' end side of the nucleic acid complementary to the target RNA than region F3. If uracil exists in the region, the corresponding uracil in the additional outer primer can be replaced by thymine. Figure 2 In the method, the F4 primer is the above-mentioned additional outer primer, and the F4 primer has the same base sequence as the optional region F4 present on the 5' end side of the region F3 in the cDNA complementary to the target RNA.

[0096] The Tm value of the additional outer primer can be, for example, 30 to 55°C, 33 to 50°C or 35 to 45°C. The length of the additional outer primer is not particularly limited, and can be, for example, 10 to 18 bases, 11 to 16 bases or 12 to 14 bases. The CG content of the additional outer primer can be, for example, 30 to 70%, 34 to 65% or 38 to 54%. The dG of the 6 bases from the 3' end of the additional outer primer can be less than -4 kcal / mol. It is preferred that the additional outer primer has a base sequence that does not form an extreme secondary structure. In addition, from the viewpoint of preventing the formation of primer dimers, it is preferred that the 3' end of the additional outer primer does not have a base sequence that is complementary to its own 3' end or the 3' end of other primers.

[0097] The optional region (i.e., in Figure 1 In the middle is area B4, Figure 2The position of the region F4 in the above-mentioned primer is not particularly limited as long as part or all of the region is present in the nucleic acid complementary to the target RNA, which is closer to the 5' end side than the region B3 (in the case of (+) ssRNA virus) or the region F3 (in the case of (-) ssRNA virus), and the distance from the region B3 or the region F3 is not particularly limited. The distance from the 5' end of the region B3 or the region F3 to the 3' end of the above-mentioned optional region that serves as the design basis of the additional outer primer can be, for example, -4 to 50 bases, -3 to 35 bases, or -2 to 21 bases. Here, in the case where the above-mentioned optional region that serves as the design basis of the outer primer partially overlaps with the region B3 or the region F3, the distance from the 5' end of the region B3 or the region F3 to the 3' end of the above-mentioned optional region that serves as the design basis of the additional outer primer is expressed as a negative value.

[0098] The above additional outer primers are Figure 1 In the Figure 2 In the present invention, only F4 primer is used, but the number of additional outer primers is not limited, and a plurality of additional outer primers may be contained in the primer set. From the viewpoint of achieving higher detection sensitivity, it is preferred that the additional outer primer contained in the primer set is one.

[0099] A known reagent for RT-LAMP reaction, such as reverse transcriptase, DNA polymerase, and deoxynucleoside triphosphates (dNTP: dATP, dTTP, dCTP, and dGTP), can be brought into contact with the sample together with the primer set.

[0100] The DNA polymerase is not particularly limited as long as it is a template-dependent nucleic acid synthetase with strand displacement activity, and can be, for example, Bst DNA polymerase (large fragment), Bca (exo-) DNA polymerase, Csa DNA polymerase, Klenow fragment of Escherichia coli DNA polymerase I, or a combination thereof.

[0101] As long as reverse transcriptase has the enzyme of the activity of synthesizing cDNA with RNA as template, it is not particularly limited, for example, it can be natural or recombinant reverse transcriptase from natural or recombinant avian myeloblastosis virus (AMV), mouse leukemia virus (MMLV) or human immunodeficiency virus (HIV).As the reverse transcriptase from MMLV, for example, Superscript (registered trademark) II reverse transcriptase, Superscript III reverse transcriptase and Superscript IV reverse transcriptase (all manufactured by Thermo Fisher Scientific) and ReverTra Ace (registered trademark) (manufactured by Toyobo Co., Ltd.) can be enumerated.As the reverse transcriptase from AMV, for example, Thermosript (registered trademark) reverse transcriptase (manufactured by Thermo Fisher Scientific) can be enumerated.As other specific examples of reverse transcriptase, OmniScript (registered trademark) reverse transcriptase and Sensiscript (registered trademark) reverse transcriptase (manufactured by Qiagen) can be enumerated. When an enzyme having both reverse transcriptase activity and DNA polymerase activity such as Bca(exo-)DNA polymerase is used as the DNA polymerase, it is not necessary to use a separate reverse transcriptase.

[0102] Examples of other known reagents for RT-LAMP reaction include buffers or salts that provide appropriate conditions for enzyme reaction and protective agents such as dithiothreitol (DTT) that stabilize the enzyme or template.

[0103] A labeled probe or fluorescent intercalator for detecting the amplification product of the RT-LAMP reaction may be brought into contact with the sample together with the primer set. The labeled probe may be, for example, a fluorescent labeled probe, and the fluorescent labeled probe may be, for example, a fluorescence quenching probe described below.

[0104] The step of bringing the primer set into contact with the sample to perform the RT-LAMP reaction can be performed, for example, by incubating a reaction solution containing the sample and the primer set.

[0105] The reaction solution may include the above-mentioned known reagents for performing the RT-LAMP reaction and the above-mentioned labeled probe or fluorescent intercalator. The incubation time (i.e., the reaction time of the RT-LAMP reaction) depends on the target RNA and the primer set, but is usually less than 60 minutes. The incubation temperature (i.e., the reaction temperature of the RT-LAMP reaction) is usually less than 65°C.

[0106] The concentration of each inner primer in the reaction solution may be, for example, 0.8 to 2.4 μM. The concentration of each outer primer in the reaction solution may be, for example, 0.1 to 0.3 μM. The concentration of each loop primer in the reaction solution may be, for example, 0.4 to 1.2 μM. The concentration of the FIP primer may be, for example, 8 times or more of the concentration of the F3 primer and / or 1 to 4 times of the concentration of the loop primer F. The concentration of the BIP primer may be, for example, 8 times or more of the concentration of the B3 primer and / or 1 to 4 times of the concentration of the loop primer B.

[0107] In one embodiment, the method for detecting a single-stranded RNA virus in a sample may further include the step of detecting an amplification product of an RT-LAMP reaction. When an amplification product of an RT-LAMP reaction is detected, it can be determined that a single-stranded RNA virus is present in the sample. The detection of the amplification product can be performed after the RT-LAMP reaction is completed, or it can be performed in real time during the reaction.

[0108] The method for detecting the amplified product is not particularly limited, and known techniques can be used. The amplified product can be detected, for example, by using a labeled probe, by using a fluorescent intercalator, or by electrophoresis of the reaction solution. Alternatively, in the case where the reaction solution contains magnesium ions, the amplified product can be detected by measuring the turbidity of the reaction solution. Magnesium ions react with pyrophosphate ions as a byproduct of nucleic acid synthesis to generate white magnesium pyrophosphate.

[0109] As a labeled probe, a fluorescent labeled probe such as a fluorescence quenching probe (Quenching Probe: QProbe (registered trademark)) can be used. Since the fluorescence emitted from the fluorescence quenching probe is quenched when hybridizing with the target nucleic acid, the amplification product can be quantified or detected by measuring the reduction of fluorescence. As fluorescent labels that can be used for fluorescence quenching probes, for example, BODIPY (registered trademark), BODIPY-FL, carboxyrhodamine 6G (CR6G), carboxytetramethylrhodamine (TAMRA), パシフィックブルー (registered trademark) and fluorescein-4-isothiocyanate (FITC) can be listed.

[0110] As the fluorescent intercalator, for example, a known fluorescent intercalator such as SYTO (registered trademark) 63 Red Fluorescent Nucleic Acid Stain (manufactured by Thermo Fisher Scientific) can be used.

[0111] Another embodiment of the present invention is a kit for detecting single-stranded RNA viruses comprising the above primer set. The kit may further include the above known reagents for performing RT-LAMP reaction such as reverse transcriptase, DNA polymerase, dNTP, buffer, salt, protective agent, etc. In addition, the kit may further include the above labeled probe or fluorescent intercalator.

[0112] [Example]

[0113] [Test Example 1] Detection of (+)ssRNA virus (DENV3)

[0114] <Reference Example 1>

[0115] Prepare 25 μL of a reaction solution with the following composition in a 0.2 mL reagent tube:

[0116] 20 mM tris(hydroxymethyl)methylglycine (pH 8.6),

[0117] 30mM KCl,

[0118] 8mM MgSO4,

[0119] 1.4mM dNTPs,

[0120] 0.5% Tween 20,

[0121] 1.6mM DTT,

[0122] 1.6μM FIP primer and BIP primer,

[0123] 0.2μM F3 primer and B3 primer,

[0124] 0.8 μM loop primer F and loop primer B,

[0125] AMV reverse transcriptase 1.0 U (20 U / μL, manufactured by Roche),

[0126] Bst DNA polymerase 22.8 U (manufactured by New England Biolabs),

[0127] RNase inhibitor (40 U / μL, manufactured by Promega) 1 μL,

[0128] Template RNA (100 copies) 5 μL,

[0129] PPase 20mU (manufactured by New England Biolabs), and

[0130] 0.04 μM QProbe (registered trademark).

[0131] As FIP primer, BIP primer, F3 primer, B3 primer, loop primer F, loop primer B and QProbe, DENV3_FIPv4, DENV3_BIPv6, DENV3_F3, DENV3_B3a, DENV3_LF, DENV3_LBv1 and DENV3_Qp shown in Table 1 were used, respectively. Template RNA (sequence number 1) was prepared by integrating cDNA produced from DENV3 capsid gene by RT-PCR into a plasmid and transcribing and purifying RNA from the plasmid DNA. Script Max (registered trademark) Thermo T7 transcription kit (manufactured by Toyobo Co., Ltd., code number: TSK-101) was used for transcription, and RNeasy (registered trademark) mini kit (manufactured by Qiagen, catalog number: No. 74104) was used for RNA purification. The 5' end of QProbe was labeled with BODIPY and the 3' end was phosphorylated.

[0132] [Table 1]

[0133]

[0134] The real-time quantitative PCR system Light Cycler (registered trademark) 96 (manufactured by Roche) was used to perform RT-LAMP reaction at 63°C for 60 minutes (N=6). In addition, the concentration of the B3 primer was increased by 2 to 4 times, and the same RT-LAMP reaction was performed (N=6). The amplification product of the RT-LAMP reaction was detected by real-time detection of the quenching of QProbe. The results are shown in Table 2. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 2.

[0135] [Table 2]

[0136]

[0137] In the tables of this specification, SD represents standard deviation, CV represents coefficient of variation, NC represents negative control, and ND represents not detected. In this test example, the case where the quenching of QProbe was not detected within 30 minutes was judged as not detected. As shown in Table 2, the detection sensitivity of template RNA was not improved by increasing the concentration of B3 primer.

[0138] <Example 1>

[0139] The RT-LAMP reaction was carried out in the same manner as in Reference Example 1 except that the B4 primer was added to the reaction solution at a final concentration of 0.2 μM (N=2). As the B4 primer, the primers shown in Table 3 were used. For comparison, the same reaction was carried out without the B4 primer. The results are shown in Table 4. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 4.

[0140] [Table 3]

[0141] B4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) DENV3_B3-m12 9 ATCTAGCCAAGAC 39.13 DENV3_B3-m13 10 CTAGCCAAGATC 40.44 DENV3_B3-m14 11 AGCCAAGACTCCT 44.96 DENV3_B3-m16 12 GACTTCTTGAAGG 37.89 DENV3_B3-m18 13 TCTTGAAGGTTCC 39.79 DENV3_B3-m19 14 TTGAAGGTTCCCC 43.56 DENV3_B3-m20 15 TTCTTGAAGGTTC 36.95 DENV3_B3-m21 16 CTTGAAGGTTCCC 41.53 DENV3_B3-m23 17 AAGGTTCCCCATC 43.16 DENV3_B3-m25 18 TTGAAGGTTCCCC 43.56 DENV3_B3-m26 19 GAAGGTTCCCCAT 43.16 DENV3_B3-m27 20 AGGTTCCCCATCT 44.34

[0142] [Table 4]

[0143]

[0144] As shown in Table 4, the detection sensitivity of the template RNA was improved by adding the B4 primer.

[0145] <Example 2>

[0146] The number of measurements was increased (N=6), and the same RT-LAMP reaction as in Example 1 was performed. B3-m27 was used as the B4 primer. For comparison, the same reaction was performed without the B4 primer. The results are shown in Table 5. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 5.

[0147] [Table 5]

[0148]

[0149] As shown in Table 5, even when the number of measurements was increased, it was confirmed that the detection sensitivity was improved by adding the B4 primer.

[0150] <Comparative Example 1>

[0151] The same RT-LAMP reaction as in Example 1 was performed using the F4 primer shown in Table 6 instead of the B4 primer. For comparison, the same reaction was performed without the F4 primer. The results are shown in Table 7. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 7.

[0152] [Table 6]

[0153] F4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) DENV3_F4-1 21 GACTCGGAAGCTT 44.07 DENV3_F4-2 22 ACTCGGAAGCTTG 44.53 DENV3_F4-3 23 GACTCGGAAGCTTG 47.26 DENV3_F4-4 24 GACTCGGAAGCT 41.69 DENV3_F4-5 25 ACTCGGAAGCTT 40.70 DENV3_F4-6 26 CTCGGAAGCTTG 40.54

[0154] [Table 7]

[0155]

[0156] As shown in Table 7, the detection sensitivity of the template RNA was not improved by adding the F4 primer.

[0157] [Test Example 2] Detection of (-)ssRNA virus (H5N1)

[0158] <Reference Example 2>

[0159] Prepare 25 μL of a reaction solution with the following composition in a 0.2 mL reagent tube:

[0160] 20 mM tris(hydroxymethyl)methylglycine (pH 8.6),

[0161] 30mM KCl,

[0162] 8mM MgSO4,

[0163] 1.4mM dNTPs,

[0164] 0.5% Tween 20,

[0165] 1.6mM DTT,

[0166] 1.6μM FIP primer and BIP primer,

[0167] 0.2μM F3 primer and B3 primer,

[0168] 0.8 μM loop primer F and loop primer B,

[0169] AMV reverse transcriptase 1.0 U (20 U / μL, manufactured by Roche),

[0170] Bst DNA polymerase 22.8 U (manufactured by New England Biolabs),

[0171] RNase inhibitor (40 U / μL, manufactured by Promega) 1 μL,

[0172] Template RNA (200 copies) 5 μL,

[0173] PPase 20mU (manufactured by New England Biolabs), and

[0174] 0.1 μM SYTO 63 red fluorescent nucleic acid stain (manufactured by Thermo Fisher Scientific).

[0175] As the FIP primer, BIP primer, F3 primer, B3 primer, loop primer F and loop primer B, H5N1-FIP, H5N1-BIP, H5N1-F3v7, H5N1-B3, H5N1-LF and H5N1-LB shown in Table 8 were used, respectively. The template RNA (SEQ ID NO. 27) was prepared by integrating cDNA prepared by RT-PCR from a part of the hemagglutinin (HA) gene of H5-type avian influenza virus (A / Viet Nam / 1203 / 2004 (H5N1), Accession No. AY818135) into a plasmid and transcribing and purifying RNA from the plasmid DNA. The Script Max Thermo T7 transcription kit (manufactured by Toyobo Co., Ltd., code number: TSK-101) was used for transcription, and the RNeasy mini kit (manufactured by Qiagen, catalog number: No. 74104) was used for RNA purification.

[0176] [Table 8]

[0177] Primers Serial Number Sequence (from 5' to 3') Tm(℃) H5N1-F3v7 28 CAATTTTTAAAGCCGAATGA 50.82 H5N1-B3 29 GTCGCAAGGACTAATCT 51.85 H5N1-FIP 30 ACCATATTCCAACTCACTTTTCATAATT-TCATTGCACCAGAATATGC 71.32 H5N1-BIP 31 CAAACTCCAATGGGGGC-ATGGTGAGAGGGTGTAT 74.29 H5N1-LF 32 GAGTCCCCTTTCTTGACAAT 56.69 H5N1-LB 33 GATAAACTCTAGTATGCCA 49.94

[0178] The real-time quantitative PCR system Light Cycler (registered trademark) 96 (manufactured by Roche) was used to perform RT-LAMP reaction at 63°C for 60 minutes (N=6). In addition, the concentration of the F3 primer was increased by 2 to 4 times, and the same RT-LAMP reaction was performed (N=6). The amplification product of the RT-LAMP reaction was detected by real-time detection of the fluorescence of the intercalator (SYTO 63 red fluorescent nucleic acid stain). The results are shown in Table 9. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 9.

[0179] [Table 9]

[0180]

[0181] In this test example, the case where the fluorescence of the intercalator was not detected within 30 minutes was judged as undetected. As shown in Table 9, the detection sensitivity of the template RNA was not improved by increasing the concentration of the F3 primer.

[0182] <Example 3>

[0183] The RT-LAMP reaction was performed in the same manner as in Reference Example 2 except that the F4 primer was added to the reaction solution at a final concentration of 0.2 μM (N=6). As the F4 primer, the primers shown in Table 10 were used. For comparison, the same reaction was performed without the F4 primer. The results are shown in Table 11. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 11.

[0184] [Table 10]

[0185] F4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) H5N1-F4v2 34 AAAGTGGAAGGA 35.84 H5N1-F4v6 35 GGGCAAAGTGGA 42.81 H5N1-F4v7 36 CGGGCAAAGTGG 45.50 H5N1-F4v17 37 GATTGGTACCAAG 37.91

[0186] [Table 11]

[0187]

[0188] As shown in Table 11, the detection sensitivity of the template RNA was improved by adding the F4 primer.

[0189] <Comparative Example 2>

[0190] The same RT-LAMP reaction as in Example 3 was performed using the B4 primer shown in Table 12 instead of the F4 primer. For comparison, the same reaction was performed without the B4 primer. The results are shown in Table 13. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 13.

[0191] [Table 12]

[0192] B4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) H5N1-B4v1 38 TTTCTGAGCCCA 40.36 H5N1-B4v6 39 GGCTATTTCTGA 33.65 H5N1-B4v8 40 AGGGCTATTTCT 34.94

[0193] [Table 13]

[0194]

[0195] As shown in Table 13, the detection sensitivity of the template RNA was not improved by adding the B4 primer.

[0196] [Test Example 3] Detection of (+)ssRNA virus (ZIKV)

[0197] <Reference Example 3>

[0198] The same RT-LAMP reaction as in Reference Example 1 of Test Example 1 was performed except that the template RNA and primer set were changed as described below. As FIP primer, BIP primer, F3 primer, B3 primer, loop primer F, loop primer B and Qprobe, ZIKV FIP, ZIKV BIP, ZIKV F3, ZIKV B3, ZIKV LF, ZIKV LB and ZIKV Qp shown in Table 14 were used respectively. Template RNA (SEQ ID NO: 41) was prepared by integrating cDNA made from the NS5 gene of ZIKV using RT-PCR into a plasmid and transcribing and purifying RNA from the plasmid DNA. Script Max Thermo T7 transcription kit was used for transcription, and RNeasy mini kit was used for RNA purification. The 3' end of QProbe was labeled with BODIPY. The results are shown in Table 15.

[0199] [Table 14]

[0200]

[0201] [Table 15]

[0202]

[0203] As shown in Table 15, the detection sensitivity of the template RNA was not improved by increasing the concentration of the B3 primer.

[0204] <Example 4>

[0205] The RT-LAMP reaction was performed in the same manner as in Reference Example 3 except that the B4 primer was added to the reaction solution at a final concentration of 0.2 μM (N=6). As the B4 primer, the primers shown in Table 16 were used. For comparison, the same reaction was performed without the B4 primer. The results are shown in Table 17. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 17.

[0206] [Table 16]

[0207] B4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) ZIKV_B4-3 49 TAGGGAATGTCTGT 42.47 ZIKV_B4-13 50 GAATGTCTGTCC 35.68 ZIKV_B4-14 51 TGTCTGTCCATTT 39.05

[0208] [Table 17]

[0209]

[0210] As shown in Table 17, the detection sensitivity of the template RNA was improved by adding the B4 primer.

[0211] <Comparative Example 3>

[0212] The same RT-LAMP reaction as in Example 4 was performed using the F4 primer shown in Table 18 instead of the B4 primer. For comparison, the same reaction was performed without the F4 primer. The results are shown in Table 19. In addition, as a reference, the detection results when the amount of template RNA was increased to 10,000 copies are also shown in Table 19.

[0213] [Table 18]

[0214] F4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) ZIKV_F4-2 52 CTCCTTTATTTCC 33.98 ZIKV_F4-3 53 AAATCATATGCGCAAAT 48.21

[0215] [Table 19]

[0216]

[0217] As shown in Table 19, the detection sensitivity of the template RNA was not improved by adding the F4 primer.

[0218] [Test Example 4] Detection of (-)ssRNA virus (RABV)

[0219] <Reference Example 4>

[0220] Prepare 25 μL of a reaction solution with the following composition in a 0.2 mL reagent tube:

[0221] 20 mM tris(hydroxymethyl)methylglycine (pH 8.6),

[0222] 30mM KCl,

[0223] 8mM MgSO4,

[0224] 1.4mM dNTPs,

[0225] 0.5% Tween 20,

[0226] 1.6mM DTT,

[0227] 1.6μM FIP primer and BIP primer,

[0228] 0.2μM F3 primer and B3 primer,

[0229] 0.8 μM loop primer B,

[0230] AMV reverse transcriptase 1.0 U (20 U / μL, manufactured by Roche),

[0231] Bst DNA polymerase 22.8 U (manufactured by New England Biolabs),

[0232] RNase inhibitor (40 U / μL, manufactured by Promega) 1 μL,

[0233] Template RNA (10,000 copies) 5 μL,

[0234] PPase 20mU (manufactured by New England Biolabs), and

[0235] 0.1 μM SYTO 63 red fluorescent nucleic acid stain (manufactured by Thermo Fisher Scientific).

[0236] As the FIP primer, BIP primer, F3 primer, B3 primer and loop primer B, RABV1-FIP, RABV1-BIP, RABV1-F3, RABV1-B3 and RABV1-LB shown in Table 20 were used, respectively. These primers are disclosed in Bazartseren B., S. Inoue, A. Yamada, et al (2009): Rapid Detection of Rabies Virus by Reverse Transcription Loop-Mediated Isothermal Amplification. Jpn. J. Infect. Dis., 62, 187-191, 2009. The template RNA (SEQ ID NO. 54) was prepared by integrating cDNA prepared from the N gene of RABV by RT-PCR into a plasmid and transcribing and purifying RNA from the plasmid DNA. The Script Max Thermo T7 transcription kit was used for transcription, and the RNeasy mini kit was used for RNA purification.

[0237] [Table 20]

[0238] Primers Serial Number Sequence (from 5' to 3') Tm(℃) RABV1-F3 55 ACATGTCCGGAAGACT 53.62 RABV1-B3 56 CAGACTCAGGAGAAGACC 54.77 RABV1-FIP 57 ACTAGAGAGTTTGGGGTGA-GGACCAGCTATGGAATCC 73.91 RABV1-BIP 58 ACGGGAATTGGGCTCTGAC-CTAAAGATGCATGTTCAG 73.89 RABV1-LB 59 GGCATGGAATTGACAAGGGACC 63.58

[0239] The RT-LAMP reaction was performed at 63°C for 60 minutes using the real-time quantitative PCR system Light Cycler 96 (N=6). In addition, the concentration of the F3 primer was increased by 2 to 4 times, and the same RT-LAMP reaction was performed (N=6). The amplification product of the RT-LAMP reaction was detected by real-time detection of the fluorescence of the intercalator (SYTO 63 red fluorescent nucleic acid stain). The results are shown in Table 21. In addition, as a reference, the amount of template RNA was increased to 1×10 6 The detection results in the case of copying are also shown in Table 21.

[0240] [Table 21]

[0241]

[0242] In this test example, the case where the fluorescence of the intercalator was not detected within 30 minutes was judged as undetected. As shown in Table 21, the detection sensitivity of the template RNA was not improved by increasing the concentration of the F3 primer.

[0243] <Example 5>

[0244] The RT-LAMP reaction was carried out in the same manner as in Reference Example 4 except that the F4 primer was added to the reaction solution at a final concentration of 0.2 μM (N=6). As the F4 primer, the primers shown in Table 22 were used. For comparison, the same reaction was carried out without the F4 primer. The results are shown in Table 23. In addition, as a reference, the amount of template RNA was increased to 1×10 6 The detection results in the case of copying are also shown in Table 23.

[0245] [Table 22]

[0246] F4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) RABV1-F4v14 60 CAGCAGCAATGCA 47.00

[0247] [Table 23]

[0248]

[0249] As shown in Table 23, the detection sensitivity of the template RNA was improved by adding the F4 primer.

[0250] <Comparative Example 4>

[0251] The same RT-LAMP reaction as in Example 5 was performed using the B4 primer shown in Table 24 instead of the F4 primer. For comparison, the same reaction was performed without the B4 primer. The results are shown in Table 25. In addition, as a reference, the amount of template RNA was increased to 1×10 6 The test results for the cases are shown in Table 25.

[0252] [Table 24]

[0253] B4 Primer Serial Number Sequence (from 5' to 3') Tm(℃) RABV1-B4v3 61 TATTTTGCTCAACC 40.21 RABV1-B4v7 62 TGTCCTGATATTTT 37.00

[0254] [Table 25]

[0255]

[0256] As shown in Table 25, the detection sensitivity of the template RNA was not improved by adding the B4 primer. Sequence Listing <110> Eiken Chemical Co., Ltd. <120> Methods for detecting single-stranded RNA viruses <130> FP20-1002-00 <150> JP 2020-031780 <151> 2020-02-27 <160> 62 <170> PatentIn version 3.5 <210> 1 <211> 411 <212> RNA <213> Artificial sequence <220> <223> Modified sequences of DENV3 capsid <400> 1 guaauacgac ucacuauagg gaguuguuag ucuacgugga ccgacaagaa caguuucgac 60 ucggaagcuu gcuuaacgua gugcugacag uuuuuuauua gagagcagau cucugaugaa 120 caaccaacgg aaaaagacgg gaaaaccguc uaucaauaug cugaaacgcg ugagaaaccg 180 ugugucaacu ggaucacagu uggcgaagag auucucaaaa ggauugcuga acggccaagg 240 accaaugaaa uugguuaugg cguucauagc uuuccucaga uuucuagcca uuccaccaac 300 agcaggaguc uuggcuagau ggggaaccuu caagaagucg ggggccauua agguccugaa 360 aggcuucaag aaggagaaucu caaacaugcu gagcauuauc aacaaacgga a 411 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> DENV3_F3 <400> 2 cttaacgtag tgctgacagt t 21 <210> 3 <211> 18 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3a <400> 3 ctgctgttgg tggaatgg 18 <210> 4 <211> 48 <212> DNA <213> Artificial sequence <220> <223> DENV3_FIPv4 <400> 4 tctcacgcgt ttcagcatat tgagagagca gatctctgat gaacaacc 48 <210> 5 <211> 42 <212> DNA <213> Artificial sequence <220> <223> DENV3_BIPv6 <400> 5 tggcgaagag attctcaaga ggactagaaa tctgaggaaa gc 42 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> DENV3_LF <400> 6 ttcccgtctt tttccgttgg 20 <210> 7 <211> 17 <212> DNA <213> Artificial sequence <220> <223> DENV3_LBv1 <400> 7 attggttatg gcgttta 17 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <220> <223> DENV3_Qp <400> 8 ctgaacggcc aaggaccaat gaaattggtt 30 <210> 9 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m12 <400> 9 atctagccaa gac 13 <210> 10 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m13 <400> 10 ctagccaaga ctc 13 <210> 11 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m14 <400> 11 agccaagact cct 13 <210> 12 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m16 <400> 12 gacttcttga agg 13 <210> 13 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m18 <400> 13 tcttgaaggt tcc 13 <210> 14 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m19 <400> 14 ttgaaggttc ccc 13 <210> 15 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m20 <400> 15 ttcttgaagg ttc 13 <210> 16 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m21 <400> 16 cttgaaggtt ccc 13 <210> 17 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m23 <400> 17 aaggttcccc atc 13 <210> 18 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m25 <400> 18 ttgaaggttc ccc 13 <210> 19 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m26 <400> 19 gaaggttccc cat 13 <210> 20 <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_B3-m27 <400> 20 aggttcccca tct 13 <210> twenty one <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-1 <400> twenty one gactcggaag ctt 13 <210> twenty two <211> 13 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-2 <400> twenty two actcggaagc ttg 13 <210> twenty three <211> 14 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-3 <400> twenty three gactcggaag cttg 14 <210> twenty four <211> 12 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-4 <400> twenty four gactcggaag ct 12 <210> 25 <211> 12 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-5 <400> 25 actcggaagc tt 12 <210> 26 <211> 12 <212> DNA <213> Artificial sequence <220> <223> DENV3_F4-6 <400> 26 ctcggaagct tg 12 <210> 27 <211> 1620 <212> RNA <213> Artificial sequence <220> <223> Hemagglutinin of avian influenza virus (H5N1) <400> 27 auggagaaaa uagugcuucu uuuugcaaua gucagucuug uuaaaaguga ucagauuugc 60 auugguuacc augcaaacaa cucgacagag cagguugaca caauaaugga aaagaacguu 120 acuguuacac augcccaaga cauacuggaa aagaaacaca acgggaagcu cugcgaucua 180 gauggaguga agccucuaau uuugagagau uguagcguag cuggauggcu ccucggaaac 240 ccaaugugug acgaauucau caaugugccg gaauggucuu acauagugga gaaggccaau 300 ccagucaaug accucuguua cccaggggau uucaaugacu augaagaauu gaaacaccua 360 uugagcagaa uaaaccauuu ugagaaaauu cagaucaucc ccaaaaguuc uugguccagu 420 caugaagccu cauuaggggu gagcucagca uguccauacc agggaaaguc cuccuuuuuc 480 agaaaugugg uauggcuuau caaaaagaac aguacauacc caacaauaaa gaggagcuac 540 aauaauacca accaagaaga ucuuuuggua cuguggggga uucaccaucc uaaugaugcg 600 gcagagcaga caaagcucua ucaaaaccca accaccuaua uuuccguugg gacaucaaca 660 cuaaaccaga gauugguacc aagaauagcu acuagaucca aaguaaacgg gcaaagugga 720 aggauggagu ucuucuggac aauuuuaaag ccgaaugaug caaucaacuu cgagaguaau 780 ggaaauuuca uugcuccaga auaugcauac aaaauuguca agaaagggga cucaacaauu 840 augaaaagug aauuggaaua ugguaacugc aacaccaagu gucaaacucc aaugggggcg 900 auaaacucua gcaugccauu ccacaauaua cacccucuca ccauugggga augccccaaa 960 uaugugaaau caaacagauu aguccuugcg acugggcuca gaaauagccc ucaaagagag 1020 agaagaagaa aaaagagagg auuauuugga gcuauagcag guuuuauaga gggaggaugg 1080 cagggaaugg uagaugguug guauggguac caccauagca augagcaggg gaguggguac 1140 gcugcagaca aagaauccac ucaaaaggca auagauggag ucaccaauaa ggucaacucg 1200 aucauugaca aaaugaacac ucaguuugag gccguuggaa gggaauuuaa caacuuagaa 1260 aggagaauag agaauuuaaa caagaagaug gaagacgggu uccuagaugu cuggacuuau 1320 aaugcugaac uucugguucu cauggaaaau gagagaacuc uagacuuuca ugacucaaau 1380 gucaagaacc uuuacgacaa gguccgacua cagcuuaggg auaaugcaaa ggagcugggu 1440 aacgguuguu ucgaguucua ucauaaaugu gauaaugaau guauggaaag uguaagaaau 1500 ggaacguaug acuacccgca guauucagaa gaagcgagac uaaaaagaga ggaaauaagu 1560 ggaguaaaau uggaaucaau aggaauuuac caaauacugu caauuuauuc uacaguggcg 1620 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> H5N1-F3v7 <400> 28 caattttaaa gccgaatga 19 <210> 29 <211> 17 <212> DNA <213> Artificial sequence <220> <223> H5N1-B3 <400> 29 gtcgcaagga ctaatct 17 <210> 30 <211> 47 <212> DNA <213> Artificial sequence <220> <223> H5N1-FIP <400> 30 accatattcc aactcacttt tcataatttc attgcaccag aatatgc 47 <210> 31 <211> 34 <212> DNA <213> Artificial sequence <220> <223> H5N1-BIP <400> 31 caaactccaa tgggggcatg gtgagagggt gtat 34 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> H5N1-LF <400> 32 gagtcccctt tcttgacaat 20 <210> 33 <211> 19 <212> DNA <213> Artificial sequence <220> <223> H5N1-LB <400> 33 gataaactct agtatgcca 19 <210> 34 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-F4v2 <400> 34 aaagtggaag ga 12 <210> 35 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-F4v6 <400> 35 gggcaaagtg ga 12 <210> 36 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-F4v7 <400> 36 cgggcaaagt gg 12 <210> 37 <211> 13 <212> DNA <213> Artificial sequence <220> <223> H5N1-F4v17 <400> 37 gattggtacc aag 13 <210> 38 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-B4v1 <400> 38 tttctgagcc ca 12 <210> 39 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-B4v6 <400> 39 ggctatttct ga 12 <210> 40 <211> 12 <212> DNA <213> Artificial sequence <220> <223> H5N1-B4v8 <400> 40 agggctattt ct 12 <210> 41 <211> 1530 <212> RNA <213> Artificial sequence <220> <223> NS5 of ZIKV <400> 41 guaauacgac ucacuauagg gaucaacaag guucguagca augcagcauu aggggcaaua 60 uuugaagagg aaaaagagug gaagacugca guggaagcug ugaacgaucc aagguucugg 120 gcucuagugg acaaggaaag agagcaccac cugagaggag agugccagag uuguguguac 180 aacaugaugg gaaaaagaga aaagaaacaa ggggaauuug gaaaggccaa gggcagccgc 240 gccaucuggu auauguggcu aggggcuaga uuucuagagu ucgaagcccu uggauucuug 300 aacgaggauc acuggauggg gagagagaac ucaggagg gugugaagg gcugggaua 360 caagacucg gauuguccu agagagaug agucguauac caggaggag gauguauga 420 gaugacacug cuggcuggga cacccgcauu agcagguuug aucuggagaa ugaagcucua 480 aucaccaacc aaauggagaa agggcacagg gccuuggcau uggccauau caaguacaca 540 uaccaaaaaaagguaaaa gguccuuaga ccagcugaaaaaggaaaaaaaaauggac 600 auuauuucga ghaagacca aagggggagc ggacaaguug ucacuuacgc ucuaacaca 660 uuuaccaacc uaguggugca acucauucgg aauauggagg cugaggagu ucuagagaug 720 780 ugggauaggc ucaacgaau ggcagucagu ggagaugauu gcguuggaa gccaauugau 840 gauagguuag cacaugcccu cagguucuug auugauaugg gauagguag gaaggacaca 900 cavagugga accuccaac uggaugggac aacugggaag aaguccgu uugcuccac 960 cacuucaaca agcuccaucu caggacgggg agccuccauug ugguucccug ccgccaccaa 1020 gaugaacuga uuggccgggc ccgcgucucu ccaggggcgg gauggagcau ccgggagacu 1080 gcuugccuag caaaaucaua ugcgcaaaug uggcagcucc uuuauuucca cagaagggac 1140 cuccgacuga uggccaaugc cauuuguuca ucugugccag uugacugggu uccaacuggg 1200 agaacuaccu ggucaaucca uggaaaggga gaauggauga ccacugaaga caugcuugug 1260 guguggaaca gaguguggau ugaggagaac gaccacaugg aagacaagac cccaguuacg 1320 aaauggacag acauucccua uuugggaaaa agggaagacu uguggugugg aucucucaua 1380 gggcacagac cgcgcaccac cugggcugag aacauuaaaa acacagucaa cauggugcgc 1440 aggaucauag gugaugaaga aaaguacaug gacuaccuau ccacccaagu ucgcuacuug 1500 ggugaagaag ggucuacacc uggagugcug 1530 <210> 42 <211> 18 <212> DNA <213> Artificial sequence <220> <223> ZIKV F3 <400> 42 cagaagggac ctccgact 18 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <220> <223> ZIKV B3 <400> 43 cgtaactggg gtcttgtctt 20 <210> 44 <211> 42 <212> DNA <213> Artificial sequence <220> <223> ZIKV FIP <400> 44 ttgaccaggt agttctccca gtatggccaa tgccatttgt tc 42 <210> 45 <211> 42 <212> DNA <213> Artificial sequence <220> <223> ZIKV BIP <400> 45 agggagaatg gatgaccact gactcctcaa tccacactct gt 42 <210> 46 <211> 18 <212> DNA <213> Artificial sequence <220> <223> ZL LF <400> 46 cccagtcaac tggcacag 18 <210> 47 <211> 15 <212> DNA <213> Artificial sequence <220> <223> ZIKV <400> 47 catgcttgtg gtgtg 15 <210> 48 <211> 29 <212> DNA <213> Artificial sequence <220> <223> QUR <400> 48 tggaacccag tcaactggca cagatgaac 29 <210> 49 <211> 14 <212> DNA <213> Artificial sequence <220> <223> ZIKV_B4-3 <400> 49 tagggaatgt ctgt 14 <210> 50 <211> 12 <212> DNA <213> Artificial sequence <220> <223> ZIKV_B4-13 <400> 50 gaatgtctgt cc 12 <210> 51 <211> 13 <212> DNA <213> Artificial sequence <220> <223> ZIKV_B4-14 <400> 51 tgtctgtcca ttt 13 <210> 52 <211> 13 <212> DNA <213> Artificial sequence <220> <223> ZIKV_F4-2 <400> 52 ctcctttatt tcc 13 <210> 53 <211> 17 <212> DNA <213> Artificial sequence <220> <223> ZIKV_F4-3 <400> 53 aaatcatatg cgcaaat 17 <210> 54 <211> 1374 <212> RNA <213> Artificial sequence <220> <223> N gene of RABV <400> 54 auggaugccg acaagauugu guucaaaguc aauaaucagg uggucucuuu gaagccugag 60 auuaucgugg aucaauauga guacaaguac ccugccauca aggauuugaa aaagccuugu 120 aucacccuag ggaaagcccc cgacuugaac aaagcauaca aaucaguuuu aucaggcaug 180 aaugccgcca aacuugaucc ggaugaugua ugcuccuacu uggcagcagc aaugcaguuc 240 uuugagggga cauguccgga agacuggacc agcuauggaa uccugauugc acgaaaagga 300 gacaggauca ccccaaacuc ucuaguggag auaaagcgua cugauguaga cgggaauugg 360 gcucugacag gaggcaugga auugacaagg gaccccacug ucucugaaca ugcaucuuua 420 gucggucuuc uccugagucu guacagguug agcaaaauau caggacagaa cacugguaac 480 uauaagacaa acauugcaga uaggauagag cagauuuucg agacagcacc uuuuguuaag 540 aucguggaac accauacccu aaugacaacu cacaagaugu gugcuaauug gaguacuaua 600 ccgaacuuca gauuuuuuggc cggaaccuac gacauguuuu ucucacggau ugagcaucug 660 uauucggcaa ucagaguggg cacagucguc accgcuuaug aagacugcuc aggacuggua 720 ucguuuacag gguucauaaa gcagaucau cucaccgcaa gggaagcaau acuauauuuuc 780 840 900 ucaucgaaug cugucgguca uggucaau cucauucacu uuguuggaug cuacaugggu 960 caagucagau cucuaaaugc gacgguuauu gcugcaugug ccccucauga gaugucuguu 1020 cuagggggcu auuugggaga ggaauucuuc ggaaaaggga cauuugaaag aagguucuuc 1080 agagacgaga aagaacuuca agaauagag gcggcugaac uaacaaagac cgacguggca 1140 cuggcagaug acggaaccgu caacucugau gacgaggacu auuucucccgg ugaaaccaga 1200 aguccagaag cugucuauac ucgaaucaug augaauggag gucgacugaa gagaucucau 1260 auaccgagau augucucagu caguuccaau caucaagccc guccaaacuc auucgccgaa 1320 uuuuuaaaca agacguauuc gaaugacuca uaacccuaua gugagucgua uuac 1374 <210> 55 <211> 16 <212> DNA <213> Artificial sequence <220> <223> RABV1-F3 <400> 55 acatgtccgg aagact 16 <210> 56 <211> 18 <212> DNA <213> Artificial sequence <220> <223> RABV1-B3 <400> 56 cagactcagg agaagacc 18 <210> 57 <211> 37 <212> DNA <213> Artificial sequence <220> <223> RABV1-FIP <400> 57 actagagagtttggggtgaggaccagctatggaatcc 37 <210> 58 <211> 37 <212> DNA <213> Artificial sequence <220> <223> RABV1-BIP <400> 58 acgggaattg ggctctgacc taaagatgca tgttcag 37 <210> 59 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> RABV1-LB <400> 59 ggcatggaat tgacaaggga cc 22 <210> 60 <211> 13 <212> DNA <213> Artificial sequence <220> <223> RABV1-F4v14 <400> 60 cagcagcaat gca 13 <210> 61 <211> 14 <212> DNA <213> Artificial sequence <220> <223> RABV1-B4v3 <400> 61 tattttgctc aacc 14 <210> 62 <211> 14 <212> DNA <213> Artificial sequence <220> <223> RABV1-B4v7 <400> 62 tgtcctgata tttt 14

Claims

1. A method for detecting a single-stranded RNA virus in a sample, comprising the steps of contacting a primer set with the sample to perform a reverse transcription loop-mediated isothermal amplification reaction, The primer set is designed based on the base sequence of the target RNA of the single-stranded RNA virus and the base sequence of the nucleic acid complementary to the target RNA. In the case where the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, the target RNA has regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end, and the nucleic acid complementary to the target RNA has regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end, In the case where the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, the target RNA has regions F3c, F2c, F1c, B1, B2, and B3 in order from the 3' end to the 5' end, and the nucleic acid complementary to the target RNA has regions F3, F2, F1, B1c, B2c, and B3c in order from the 5' end to the 3' end, Regions F3, F2, F1, B1c, B2c and B3c are complementary to regions F3c, F2c, F1c, B1, B2 and B3, respectively, The primer set includes the following (i) to (v): (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end; (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end; (iii) an F3 primer as an outer primer having the same base sequence as region F3; (iv) a B3 primer as an outer primer having the same base sequence as region B3; as well as (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5' end side of region B3 in the nucleic acid complementary to the target RNA when the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, and each of which has the same base sequence as an optional region present on the 5' end side of region F3 in the nucleic acid complementary to the target RNA when the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers is replaced by thymine or is not replaced.

2. The method of claim 1, wherein: Single-stranded RNA viruses are positive-stranded single-stranded RNA viruses. The target RNA has regions F3, F2, F1, B1c, B2c and B3c in order from the 5' end to the 3' end. The nucleic acid complementary to the target RNA has regions F3c, F2c, F1c, B1, B2 and B3 in order from the 3' end to the 5' end, Each of the additional outer primers has the same base sequence as an optional region present on the 5′-terminal side of the region B3 in the nucleic acid complementary to the target RNA.

3. The method of claim 1, wherein: Single-stranded RNA viruses are negative-stranded single-stranded RNA viruses. The target RNA has regions F3c, F2c, F1c, B1, B2 and B3 in order from the 3' end to the 5' end. The nucleic acid complementary to the target RNA has regions F3, F2, F1, B1c, B2c and B3c in order from the 5' end to the 3' end, Each of the additional outer primers has the same base sequence as an optional region present on the 5′-terminal side of the region F3 in the nucleic acid complementary to the target RNA.

4. The method according to any one of claims 1 to 3, wherein: The primer set also contains: (vi) a loop primer F having the same base sequence as an optional region between region F1c and region F2c; and (vii) a loop primer B having the same base sequence as an optional region between region B1c and region B2c, Here, uracil that may exist in the base sequences of loop primer F and loop primer B is replaced by thymine or is not replaced.

5. The method according to any one of claims 1 to 3, wherein The melting temperature of the one or more additional outer primers of (v) is 30 to 55°C.

6. The method according to any one of claims 1 to 3, wherein: The primer set comprises one (v) additional outer primer.

7. The method according to any one of claims 1 to 3, wherein The method also includes a step of detecting the amplification product of the reverse transcription loop-mediated isothermal amplification reaction.

8. A kit for detecting single-stranded RNA viruses, comprising a primer set, The primer set is designed based on the base sequence of the target RNA of the single-stranded RNA virus and the base sequence of the nucleic acid complementary to the target RNA. In the case where the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, the target RNA has regions F3, F2, F1, B1c, B2c and B3c in the direction from the 5' end to the 3' end, and the nucleic acid complementary to the target RNA has regions F3c, F2c, F1c, B1, B2 and B3 in the direction from the 3' end to the 5' end, In the case where the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, the target RNA has regions F3c, F2c, F1c, B1, B2, and B3 in order from the 3' end to the 5' end, and the nucleic acid complementary to the target RNA has regions F3, F2, F1, B1c, B2c, and B3c in order from the 5' end to the 3' end, Regions F3, F2, F1, B1c, B2c and B3c are complementary to regions F3c, F2c, F1c, B1, B2 and B3, respectively, The primer set includes the following (i) to (v): (i) a FIP primer having a base sequence identical to that of region F1c at its 5′ end and a base sequence identical to that of region F2 at its 3′ end; (ii) a BIP primer having a base sequence identical to that of region B1c at its 5′ end and a base sequence identical to that of region B2 at its 3′ end; (iii) an F3 primer as an outer primer having the same base sequence as region F3; (iv) a B3 primer as an outer primer having the same base sequence as region B3; as well as (v) one or more additional outer primers, each of which has the same base sequence as an optional region present on the 5' end side of region B3 in the nucleic acid complementary to the target RNA when the single-stranded RNA virus is a positive-stranded single-stranded RNA virus, and each of which has the same base sequence as an optional region present on the 5' end side of region F3 in the nucleic acid complementary to the target RNA when the single-stranded RNA virus is a negative-stranded single-stranded RNA virus, Among them, uracil that may exist in the base sequences of the FIP primer, the BIP primer, the F3 primer, the B3 primer and one or more additional outer primers is replaced by thymine or is not replaced.

Images