A method for highly efficient and high-purity separation of cellular mitochondrial genomes
Through simplified cell pretreatment and gentle lysis methods, combined with centrifugal separation technology, the complex and impurity of the mitochondrial genome separation in the prior art was solved, and efficient and high-purity mitochondrial genome separation is achieved, which is suitable for the processing of rare samples.
Patent Information
- Application Number
- CN202210636586.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-07
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2042-06-07
AI Technical Summary
The prior art has problems such as complex preprocessing, complicated operation, high equipment requirements, poor fidelity, and poor repeatability when isolating the mitochondrial genome of cells.
Using a method that includes cell pretreatment and gentle lysis, the supernatant is isolated by centrifugation to obtain a high-purity mitochondrial genome, simplifying the operation process, reducing equipment requirements, and improving separation efficiency.
It realizes efficient and high-purity mitochondrial genome separation, reducing sample demand, reducing reagent costs, simplifying operations, and improving repeatability and stability.
Smart Images

Figure CN115161313B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of DNA extraction, and more specifically, relates to a method for efficiently and highly purely separating cell mitochondrial genomes. Background Art
[0002] Human mitochondrial DNA (mtDNA) is a circular double-stranded DNA of about 16,569 bp that is maternally inherited, encoding 37 genes, 22 transfer RNAs, and 2 ribosomal RNAs. It is the second largest independent genomic information source in cells outside the nucleus. The mutation rate of the mitochondrial genome is significantly higher than that of nuclear genomic DNA (ncDNA). At the same time, mitochondria are maternally inherited, which gives mtDNA a unique advantage in individual identification specificity. Mitochondria are one of the ideal materials for human population genetic research, providing unique information for studying human origin, migration, evolution, and racial relationships, and constructing modern genetic archaeology together with nuclear genome analysis. In forensic science, mitochondrial genomic information has unique application value for non-nuclear forensic samples (hair, nails), highly degraded samples (highly decomposed, skeletonized corpses), or some cases that require identification of maternal kinship (sister relationship identification), etc., and plays an important role in population origin analysis, racial analysis, kinship analysis, etc. At the same time, mitochondria are also involved in processes such as cell differentiation, cell cycle, signal transduction, and apoptosis. Abnormal mitochondrial function is closely related to the occurrence of neurodegenerative diseases (Parkinson's disease and Alzheimer's disease), deafness, diabetes, aging, and tumors. Therefore, mitochondrial genome analysis has important value in multiple fields such as genetic disease screening, human genetics, forensic medicine, and archaeology.
[0003] Currently, the acquisition of mitochondrial genomic information mainly relies on high-throughput sequencing technology and bioinformatics analysis. However, there are a large number of nuclear mitochondrial sequences (NUMTs) in the nuclear genome, which increases the complexity of mitochondrial assembly. NUMTs are sequence fragments that are widely present in the nuclear genome and are highly similar to mitochondrial genome genes. There are hundreds to thousands of NUMTs in the human nuclear genome, accounting for 0.87% of the length of the human nuclear genome. Simply using total DNA as a template, obtaining DNA sequences through high-throughput sequencing technology, and then performing mitochondrial genome sequence mining and splicing, there is a possibility of nuclear genome contamination in the obtained mitochondrial genomic information, and the accuracy and reliability of its sequences are uncertain.
[0004] Currently, the main methods for obtaining more refined mitochondrial genomes are through differential centrifugation or density gradient centrifugation. According to the different sedimentation coefficients of the nucleus and mitochondria, by sequentially performing differential centrifugation and density gradient centrifugation, a large amount of purified nuclei and mitochondria can be conveniently obtained from different animal tissues, plants, or yeasts. However, when using differential centrifugation or density gradient centrifugation for mitochondrial isolation, the sample demand is large and the loss is significant. For rare samples, such as teeth from ancient remains or forensic specimens, clinical puncture samples, etc., the sample volume is small, and it is impossible to achieve homogenization and then carry out multi-step centrifugation operations. At the same time, for a large number of tissue samples, complex pretreatment, multi-step separation and purification are also required. Large equipment such as ultracentrifuges is needed, the operation is cumbersome, the equipment requirements are high, and the time consumption is long. Secondly, some literature reports obtaining copies of mitochondrial DNA in samples through specific probe hybridization enrichment and long PCR amplification enrichment, and then obtaining mitochondrial genome information through sequencing. However, these methods can only design specific probes or primers for known mitochondrial sequences and cannot detect unknown mitochondrial sequences. Moreover, using mitochondrial genome-specific probe hybridization enrichment and long PCR amplification to enrich mitochondrial genome information will introduce mutations, and the fidelity of mitochondrial genome information is difficult to guarantee, bringing huge technical risks to work such as fine genetic information tracking. At the same time, carrying out sequence hybridization enrichment and long PCR amplification requires expensive high-fidelity DNA polymerases, and the technical repeatability is poor, and the results between batches are unstable. Therefore, the objective demand for high-precision genetic analysis of mitochondria urgently requires a method for efficiently and highly pure isolation of mitochondrial genomes to provide the most basic and reliable research materials for subsequent mitochondrial-related research, ensuring that mitochondrial genome and nuclear genome information will not interfere with and contaminate each other at the source. Summary of the Invention
[0005] Aiming at the defects of the prior art, the purpose of the present invention is to provide a method for efficiently and highly pure isolating the mitochondrial genome of cells, aiming to solve the problems existing in the existing methods for isolating mitochondrial genomes, such as complex pretreatment, cumbersome operation, high equipment requirements, poor fidelity, or poor repeatability.
[0006] To achieve the above purpose, the present invention provides a method for efficiently and highly pure isolating the mitochondrial genome of cells, including the following steps:
[0007] S1. Pretreat the cell culture with a cell pretreatment reagent to remove extracellular impurity DNA, and collect the cells;
[0008] S2. Lyse the pretreated cells with a cell gentle lysis solution;
[0009] S3. Centrifuge the lysed solution, separate the supernatant, and purify to obtain the mitochondrial genome of the cells;
[0010] Among them, the gentle cell lysis solution includes 0.1% - 15% (v / v) NP-40, 0.001 mol / L - 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride, 0.001 mol / L - 0.2 mol / L ethylenediaminetetraacetic acid, 0.1 mol / L - 1 mol / L sodium acetate, 0.1 mol / L - 0.5 mol / L potassium acetate, and 0.001 mol / L - 0.1 mol / L sodium citrate.
[0011] Preferably, in step S1, the cell pretreatment reagent includes 0.001 mol / L - 0.01 mol / L ethylenediaminetetraacetic acid and 0.01 mol / L - 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride.
[0012] Preferably, step S1 is specifically: centrifuge the cell culture containing 1×10 2 -1×10 5 cells at 1000 rpm - 2000 rpm for 5 min - 10 min, discard the supernatant; then suspend and wash with physiological saline or PBS buffer, centrifuge again at 1000 rpm - 2000 rpm for 5 min - 10 min, discard the supernatant; then suspend and wash with the cell pretreatment reagent, let stand for 5 min - 10 min, centrifuge at 1000 rpm - 2000 rpm for 5 min - 10 min, discard the supernatant, and the precipitate is the pretreated cells.
[0013] Preferably, step S2 is specifically: add 100 μL - 500 μL of the gentle cell lysis solution to the pretreated cells, gently disperse, and then place on ice for 15 min - 30 min, and invert and mix evenly every 5 min during this period.
[0014] Preferably, step S3 includes two centrifugation processes, specifically: centrifuge the lysed solution at 3000 rpm - 3500 rpm for 5 min - 15 min at 4°C, collect the first supernatant; then add 100 μL - 400 μL of PBS buffer to the precipitate, pipette and suspend the precipitate, and then centrifuge again at 3000 rpm - 3500 rpm for 5 min - 15 min, collect the second supernatant, and mix the first supernatant and the second supernatant.
[0015] Preferably, in step S3, the purification process is specifically as follows: Add an equal volume of mitochondrial genome purification reagent to the separated supernatant, vortex for 1 min to 5 min, and perform a water bath treatment at 45°C to 60°C for 3 min to 10 min; then add one volume of isopropanol, mix well, place at -20°C and let stand for 5 min to 20 min, and centrifuge at 10,000 rpm to 15,000 rpm for 10 min to 20 min; remove the supernatant, and the obtained precipitate is the purified mitochondrial genomic DNA.
[0016] Further preferably, the mitochondrial genome purification reagent includes 0.001 mol / L to 0.01 mol / L of ethylenediaminetetraacetic acid, 0.01 mol / L to 0.1 mol / L of tris(hydroxymethyl)aminomethane hydrochloride, 0.02 mol / L of sodium acetate, 0.5% to 5% (v / v) of sodium dodecyl sulfate, and 1 μg / μL to 5 μg / μL of proteinase K.
[0017] Preferably, the method of the present invention further includes step S4, using the separated cell mitochondrial genome as a template, and performing PCR reactions using mitochondrial genome-specific primers and nuclear genome-specific primers as primers respectively to verify the purity of the separated cell mitochondrial genome.
[0018] Further preferably, the mitochondrial genome-specific primers are:
[0019] mitoF: AACATACCCATGGCCAACCT;
[0020] mitoR: AGCGAAGGGTTGTAGTAGCCC.
[0021] Further preferably, the nuclear genome-specific primers are:
[0022] nF: GAGTTTCCTGGACAAATGAG;
[0023] nR: CATTGTTTCATATCTCTGGCG.
[0024] Generally speaking, compared with the prior art by the above technical solutions conceived by the present invention, the following beneficial effects are achieved:
[0025] The method for separating the mitochondrial genome provided by the present invention first uses a cell pretreatment reagent to wash the cells to avoid the contamination of extracellular DNA to the nuclear DNA and mitochondrial DNA in the cells; then uses a gentle cell lysis solution to lyse the cells. This lysis solution can promote the rapid lysis of the cell membrane and mitochondrial membrane, and the mitochondrial genome is released into the solution, while this lysis solution will not damage the nuclear membrane and the nucleus can still remain intact to prevent the contamination of chromosomes during the subsequent separation of the mitochondrial genome; then centrifugation is used to remove the nuclear genome to obtain the mitochondrial genome, and after purification, a high-purity mitochondrial genome is obtained. Compared with the traditional differential centrifugation or density gradient centrifugation, the separation of the mitochondrial genome of the present invention does not require complex and cumbersome cell homogenization and strict density gradient ultracentrifugation. It has low equipment requirements, low reagent costs, no toxic and harmful reagents, is green and environmentally friendly, requires a much lower initial cell amount than other mitochondrial genome separation methods, has a short time-consuming, high efficiency, the finally separated mitochondrial genome has high purity and no nuclear genome contamination, and this method has good repeatability and high technical stability. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 It is a microscopic observation diagram of TPH-1 cells cultured in the embodiment of the present invention.
[0027] Figure 2 It is a microscopic observation diagram of TPH-1 cells after gentle lysis for 5 minutes in the embodiment of the present invention.
[0028] Figure 3 It is a microscopic observation diagram of TPH-1 cells after gentle lysis for 20 minutes in the embodiment of the present invention.
[0029] Figure 4 It is a microscopic observation diagram of the nucleus left after the separation of the mitochondrial genome in the embodiment of the present invention.
[0030] Figure 5 It is the detection result of the purity of mitochondrial genome DNA based on the PCR method in the embodiment of the present invention. Among them, lane 1 is DNA Marker DL200, lane 2 is the product amplified by PCR using the nuclear genome-specific primer with mtDNA as the template, lane 3 is the product amplified by PCR using the mitochondrial genome-specific primer with mtDNA as the template, lane 4 is the product amplified by PCR using the nuclear genome-specific primer with nDNA as the template, and lane 5 is the product amplified by PCR using the mitochondrial genome-specific primer with nDNA as the template. DETAILED DESCRIPTION OF THE INVENTION
[0031] In order to make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0032] A method for efficiently and highly purely separating cell mitochondrial genomes provided by the present invention comprises the following steps:
[0033] S1. Pretreating a cell culture with a cell pretreatment reagent to remove extracellular impurity DNA, including exogenous chromosomal or mitochondrial DNA impurities on the cell surface and in the culture medium, and collecting the cells;
[0034] S2. Lysing the pretreated cells with a cell gentle lysis solution, causing the cell membrane and mitochondrial membrane with consistent physiological and biochemical properties to rupture, releasing the mitochondrial genome, while maintaining the integrity of the nuclear membrane;
[0035] S3. Centrifuging the lysed solution, the supernatant after centrifugation contains the mitochondrial genome, the precipitate is the nucleus, separating the supernatant, and purifying to obtain the cell mitochondrial genome;
[0036] Wherein, the cell gentle lysis solution comprises 0.1% - 15% (v / v) NP-40, 0.001 mol / L - 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl), 0.001 mol / L - 0.2 mol / L ethylenediaminetetraacetic acid (EDTA), 0.1 mol / L - 1 mol / L sodium acetate, 0.1 mol / L - 0.5 mol / L potassium acetate, and 0.001 mol / L - 0.1 mol / L sodium citrate.
[0037] It should be noted that the method of the present invention does not limit the pretreatment of a tissue or biological material containing cells before pretreatment to be suitable for subsequent lysis of biological membranes and separation of mitochondrial genomes. The pretreatment can be operated in a conventional manner in the art, specifically including one or more of material cleaning, freezing or freeze-thawing, drying, grinding, mechanical shearing, enzyme or chemical reagent treatment. Wherein the biological material can include at least one of animal and plant individuals, tissues, organs and symbionts, blood, and artificially cultured or isolated cells, the biological material also includes one or more of microbial populations including fungi, protozoa, etc., the biological material also includes various biological materials containing mitochondrial genomes or mixed biological samples such as soil, sediment, and plant rhizosphere.
[0038] The present invention does not specifically limit the types of sample cells that can be applied. According to representative cell lines in a cell biology laboratory, such as, but not limited to, cell lines like TPH-1, HEK293t, Hela, etc., their dedicated culture media are used for culturing and subculturing. For suspension-cultured cells, they can be directly inoculated for culture and then subsequent separation treatment is carried out. For adherent-cultured cells, first treat them with trypsin to disperse the cells into individual cells, remove the suspended cells, and then add fresh culture medium for culturing. When the cells cover about 80% of the space, subsequent separation treatment can be carried out. The optimal growth state of different cell lines is the state most suitable for carrying out the separation of the mitochondrial genome of cells.
[0039] In some embodiments, step S1 is specifically: subjecting a cell culture containing 1×10 2 ~1×10 5 cells to centrifugation at 1000 rpm to 2000 rpm for 5 min to 10 min, discarding the supernatant; then suspending and rinsing with physiological saline or PBS buffer, centrifuging again at 1000 rpm to 2000 rpm for 5 min to 10 min, and discarding the supernatant; then suspending and rinsing with the cell pretreatment reagent, standing for 5 min to 10 min, centrifuging at 1000 rpm to 2000 rpm for 5 min to 10 min, and discarding the supernatant. The precipitate is the pretreated cells. The cell pretreatment reagent may include, but is not limited to, 0.001 mol / L to 0.01 mol / L ethylenediaminetetraacetic acid and 0.01 mol / L to 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride.
[0040] In some embodiments, step S2 is specifically: adding 100 μL to 500 μL of the cell gentle lysis solution to the pretreated cells, gently blowing and dispersing them, and then placing them on ice for 15 min to 30 min, during which time they are inverted and mixed evenly every 5 min.
[0041] In order to fully separate the mitochondrial genome from the cells, two centrifugation processes may be included in step S3. Specifically: centrifuging the lysed solution at 3000 rpm to 3500 rpm for 5 min to 15 min at 4°C, collecting the first supernatant; then adding 100 μL to 400 μL of PBS buffer to the precipitate, pipetting and suspending the precipitate to fully elute the adsorbed mitochondrial genome in the precipitate, and then centrifuging again at 3000 rpm to 3500 rpm for 5 min to 15 min, collecting the second supernatant. Mix the first supernatant and the second supernatant to obtain a supernatant containing the mitochondrial genome.
[0042] In some embodiments, in step S3, the purification process is specifically as follows: Add an equal volume of mitochondrial genome purification reagent to the separated supernatant, vortex for 1 min to 5 min, and perform a water bath treatment at 45°C to 60°C for 3 min to 10 min; then add one volume of isopropanol, mix well, place at -20°C and let stand for 5 min to 20 min, and centrifuge at 10,000 rpm to 15,000 rpm for 10 min to 20 min; remove the supernatant, and the obtained precipitate is the purified mitochondrial genome DNA. Specifically, the mitochondrial genome purification reagent used includes 0.001 mol / L to 0.01 mol / L ethylenediaminetetraacetic acid, 0.01 mol / L to 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride, 0.02 mol / L sodium acetate, 0.5% to 5% (v / v) sodium dodecyl sulfate, and 1 μg / μL to 5 μg / μL proteinase K. It should be noted that the present invention does not specifically limit the purification method. If the sample to be processed is large, the purification of nuclear DNA or mitochondrial DNA can also be extracted and purified using a commercial kit as needed.
[0043] In some embodiments, the method of the present invention further includes step S4. Using the separated cell mitochondrial genome as a template, perform PCR reactions respectively with mitochondrial genome-specific primers and nuclear genome-specific primers as primers to verify the purity of the separated cell mitochondrial genome. The PCR reaction system can be prepared by oneself, or can use common commercial PCR or qPCR or ddPCR kits on the market, etc.
[0044] According to the human mitochondrial genome information and nuclear genome information, in this embodiment, specific primers designed for the ND1 gene are selected to amplify the mitochondrial genome, and specific primers designed for the ncoa3 gene are selected to amplify the nuclear genome. The human mitochondrial genome has 13 protein-coding genes, including the coding sequences of cytochrome b, 3 subunits of cytochrome oxidase, 2 subunits of ATPase, and 7 subunits of NADH dehydrogenase. The ND1 gene is the gene encoding NADH dehydrogenase subunit 1; the ncoa3 gene is located in the nuclear genome and encodes nuclear receptor coactivator 3 (NCOA3). NCOA3 is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activation function.
[0045] Specifically, the mitochondrial genome-specific primers are:
[0046] mitoF: AACATACCCATGGCCAACCT;
[0047] mitoR: AGCGAAGGGTTGTAGTAGCCC.
[0048] The nuclear genome-specific primers are:
[0049] nF: GAGTTTCCTGGACAAATGAG;
[0050] nR: CATTGTTTCATATCTCTGGCG.
[0051] The above technical solutions will be described in detail below in combination with specific embodiments.
[0052] Regarding the screening methods, buffer preparation, common culture medium formulations, etc. involved in this embodiment, reference can be made to the content described in "Microbiology Experiments" edited by Zhao Bin and He Shaojiang, as well as "Molecular Cloning: A Laboratory Manual" (J. Sambrook et al., 2002, Molecular Cloning: A Laboratory Manual, Third Edition, translated by Jin Dongyan et al., Science Press, Beijing). All other various experimental operations involved in the present invention are conventional techniques in the art. For parts not specifically described in the text, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literature, or relevant specifications, manuals, etc. before the filing date of this invention application for implementation.
[0053] 1. Reagent Preparation
[0054] (1) Cell pretreatment reagent: 0.005 mol / L ethylenediaminetetraacetic acid and 0.01 mol / L tris(hydroxymethyl)aminomethane hydrochloride (pH 7.5).
[0055] (2) Gentle cell lysis solution: 2% (v / v) NP-40, 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride (pH = 7.5), 0.1 mol / L ethylenediaminetetraacetic acid, 0.5 mol / L sodium acetate, 0.2 mol / L potassium acetate, and 0.05 mol / L sodium citrate.
[0056] (3) Mitochondrial genome purification reagent: 0.01 mol / L tris(hydroxymethyl)aminomethane acetate, 0.005 mol / L ethylenediaminetetraacetic acid, 0.02 mol / L sodium acetate, 2% (v / v) sodium dodecyl sulfate, and 2 μg / μL proteinase K.
[0057] 2. Cell Culture
[0058] In this embodiment, TPH-1 suspension cells are used and cultured and passaged with their special culture medium. Before cell culture operation, first preheat the cell culture medium in a 37°C incubator for 30 min. In a sterile biosafety cabinet, carefully add 4 mL of preheated fresh culture medium to the cell culture flask, and inoculate an appropriate amount of suspension cells, and place them in a 37°C incubator for 24 h.
[0059] Figure 1Microscopic observation results of TPH-1 cells after 24 hours of culture. Under a phase contrast microscope, the boundaries of the nucleus and cell membrane are clearly visible.
[0060] 3. Cell isolation and lysis
[0061] Collect 1×10 2 ~1×10 5 cultured cells into a microcentrifuge tube. After collecting the cells, centrifuge at 2000 rpm for 5 minutes and discard the supernatant; then suspend and wash with PBS buffer, centrifuge again at 2000 rpm for 5 minutes and discard the supernatant. Subsequently, carefully add 400 μL of cell pretreatment reagent with a pipette, gently pipette and suspend the cells with a pipette tip, let it stand for 5 minutes, then centrifuge at 2000 rpm for 5 minutes, and carefully aspirate the supernatant with a pipette tip. The precipitate is the treated cells.
[0062] Add 400 μL of gentle cell lysis solution to the above precipitated cells, gently pipette and suspend the cells with a pipette tip, and it can be seen that the precipitated cells quickly become fewer. Place it on ice for 30 minutes and invert and mix once every 5 minutes. Take 1 μL of the system at different treatment times and observe under a microscope to judge whether the cells are gently lysed.
[0063] Figure 2 Microscopic observation picture of gently lysed TPH-1 cells for 5 minutes. In the figure, part of the cell membrane is dissolved, the cell contents are released, part of the nuclear margin is clear, and the nucleus remains intact. As the degree of gentle cell lysis increases, as Figure 3 shown, after 20 minutes, there are almost no cells with cell membranes in the whole field of view, and the nucleus and mitochondria are "freely" separated.
[0064] 4. Isolation and purification of mitochondrial genomic DNA
[0065] Centrifuge and separate the lysis system in step 3 to separate the nuclear and mitochondrial genomes. The specific operation is as follows: centrifuge the gentle cell lysis system at 3000 rpm for 10 minutes at 4°C; then, carefully transfer the supernatant (supernatant 1) to a new centrifuge tube, then add 200 μL of PBS buffer to the precipitate, gently pipette and suspend the precipitate, and then centrifuge under the same conditions again. Combine the supernatant with supernatant 1. At this time, the combined supernatant contains the separated mitochondrial genome, and the precipitate is mainly the nucleus. Figure 4 The microscopic observation picture of the nucleus left after mitochondrial genome separation as shown. It can be seen that the obtained precipitate is mainly nuclei with smooth edges and a large amount of aggregation.
[0066] Equal volumes of a micro nucleic acid purification reagent were added to the above-obtained separated supernatant (mainly containing mitochondrial genome) and precipitate (mainly containing nucleus), and vortexed for 3 min; then treated in a water bath at 50 °C for 5 min; subsequently, one volume of isopropanol was added, mixed well, and placed in a -20 °C refrigerator and allowed to stand for 10 min. Subsequently, centrifuged at 12,000 rpm for 15 min; the supernatant was removed, and the obtained precipitate was the purified mitochondrial DNA or nuclear DNA respectively.
[0067] 5. Characterization of mitochondrial genome purity
[0068] In this example, specific amplification primers were designed for the mitochondrial genome using the ND1 gene; for the nuclear genome, specific amplification primers were designed using the ncoa3 gene. The purity of the mitochondrial genome was analyzed according to the following specific primers or probes.
[0069] The specific amplification primers for the mitochondrial genome were:
[0070] mitoF: AACATACCCATGGCCAACCT
[0071] mitoR: AGCGAAGGGTTGTAGTAGCCC
[0072] The specific amplification primers for the nuclear genome were:
[0073] nF: GAGTTTCCTGGACAAATGAG
[0074] nR: CATTGTTTCATATCTCTGGCG
[0075] The mitochondrial genomic DNA (mtDNA) was subjected to PCR amplification simultaneously using the above specific amplification primers for the mitochondrial genome (mitoF, mitoR) and the specific amplification primers for the nuclear genome (nF, nR). The amplification procedure was as follows:
[0076] 95 °C, pre-denaturation for 10 min;
[0077] 94 °C, 30 s
[0078] 60 °C, 30 s
[0079] 34 cycles
[0080] 25 °C, 5 min
[0081] Meanwhile, for the nuclear genomic DNA (nDNA), the same PCR amplification reaction was also carried out.
[0082] The results were as Figure 5As shown, in the mitochondrial genomic DNA purified by the method of the present invention, there is no amplification product of nuclear genomic DNA, while the amplification product of mitochondrial genomic DNA is obvious. This proves that, under the detection sensitivity based on PCR reaction, the present invention obtains mitochondrial genomic DNA without nuclear genomic contamination, with high purity, high speed and high efficiency. However, at the same time, in the PCR amplification of nuclear genomic DNA, there is still a certain degree of mitochondrial genomic contamination, but the concentration of nuclear genomic DNA has been significantly increased. This result of the present invention is consistent with the understanding in the art regarding the relationship between the copy number of nuclear genomic DNA and mitochondrial genomic DNA, that is, in the same cell, the copy number of mitochondrial genomic DNA is several hundred to several thousand times that of nuclear genomic DNA. At the same time, compared with nuclear genomic DNA, mitochondria are smaller and more difficult to be completely separated from nuclear genomic DNA.
[0083] Generally speaking, by using the method described in the present invention, high-purity mitochondrial genomic DNA can be efficiently obtained from a small amount of cultured cells in a short time, with low equipment requirements, simple operation, good repeatability, and high purity and good effect of the obtained mitochondrial genomic DNA.
[0084] It is easy for those skilled in the art to understand that the above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A method for highly efficient and high-purity separation of cellular mitochondrial genomes, characterized in that, It includes the following steps: S1. Pretreat the cell culture with a cell pretreatment reagent to remove extracellular impurity DNA, and collect the cells; S2. Lyse the pretreated cells with a gentle cell lysis solution; S3. Centrifuge the lysed solution, separate the supernatant, and purify to obtain the cell mitochondrial genome; Among them, the gentle cell lysis solution consists of 2% (v / v) NP-40, 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride, 0.01 mol / L ethylenediaminetetraacetic acid, 0.5 mol / L sodium acetate, 0.2 mol / L potassium acetate, and 0.05 mol / L sodium citrate; Step S3 includes two centrifugation processes, specifically: centrifuge the lysed solution at 3000 rpm - 3500 rpm for 5 min - 15 min at 4°C, and collect the first supernatant; then add 100 μL - 400 μL of PBS buffer to the precipitate, pipette and suspend the precipitate, and then centrifuge again at 3000 rpm - 3500 rpm for 5 min - 15 min to collect the second supernatant, and mix the first supernatant and the second supernatant.
2. The method according to claim 1, characterized in that: In step S1, the cell pretreatment reagent includes 0.001 mol / L - 0.01 mol / L ethylenediaminetetraacetic acid and 0.01 mol / L - 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride.
3. The method according to claim 1, characterized in that, Step S1 is specifically as follows: Centrifuge the cell culture containing 1×10 2 ~1×10 5 cells at 1000 rpm to 2000 rpm for 5 min to 10 min, and discard the supernatant; then suspend and rinse with physiological saline or PBS buffer, centrifuge again at 1000 rpm to 2000 rpm for 5 min to 10 min, and discard the supernatant; then suspend and rinse with the cell pretreatment reagent, let stand for 5 min to 10 min, centrifuge at 1000 rpm to 2000 rpm for 5 min to 10 min, and discard the supernatant. The precipitate is the pretreated cells.
4. The method according to claim 1, characterized in that, Step S2 is specifically: add 100 μL - 500 μL of the gentle cell lysis solution to the pretreated cells, gently disperse, and place on ice for 15 min - 30 min, and invert and mix every 5 min during this period.
5. The method according to claim 1, characterized in that, The purification process in step S3 is specifically: add an equal volume of mitochondrial genome purification reagent to the separated supernatant, vortex for 1 min - 5 min, and treat in a water bath at 45°C - 60°C for 3 min - 10 min; then add one volume of isopropanol, mix well and place at -20°C for 5 min - 20 min, and centrifuge at 10000 rpm - 15000 rpm for 10 min - 20 min; remove the supernatant, and the obtained precipitate is the purified mitochondrial genome DNA.
6. The method according to claim 5, characterized in that: The mitochondrial genome purification reagent includes 0.001 mol / L - 0.01 mol / L ethylenediaminetetraacetic acid, 0.01 mol / L - 0.1 mol / L tris(hydroxymethyl)aminomethane hydrochloride, 0.02 mol / L sodium acetate, 0.5% - 5% (v / v) sodium dodecyl sulfate, and 1 μg / μL - 5 μg / μL proteinase K.
7. The method according to any one of claims 1-6, characterized in that: It also includes step S4, using the separated cell mitochondrial genome as a template, and performing PCR reactions with mitochondrial genome-specific primers and nuclear genome-specific primers as primers respectively to verify the purity of the separated cell mitochondrial genome.
8. The method according to claim 7, characterized in that, The mitochondrial genome-specific primers are: mitoF: AACATACCCATGGCCAACCT; mitoR: AGCGAAGGGTTGTAGTAGCCC。 9. The method according to claim 7, characterized in that, The specific primers for the nuclear genome are as follows: nF: GAGTTTCCTGGACAAATGAG; nR: CATTGTTTCATATCTCTGGCG。
Citation Information
Patent Citations
Modified high-salt method for extracting mitochondria DNA and uses thereof
CN101250522A
Nucleic acid extraction method
CN111560370A
Compositions and methods for mitochondrial genome editing
US20190290780A1