Novel cell delivery methods
By designing specific amino acid sequences and modifying cell-penetrating peptides (CPPs), the problems of trapping and toxicity of CPPs during in vivo delivery were solved, achieving efficient nuclear delivery and functional readout.
Patent Information
- Application Number
- CN202080093916.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-12-20
- Filing Date
- 2020-12-18
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2040-12-18
AI Technical Summary
Existing cell-penetrating peptides (CPPs) are difficult to deliver effectively to specific tissues in vivo and are easily intercepted by endosomes and lysosomes, resulting in a lack of cell specificity and high toxicity.
An isolated, non-naturally occurring cell-penetrating peptide (CPP) containing a specific amino acid sequence was developed, and its function was enhanced by modifications such as atypical amino acids, fatty acids, detectable markers, oligonucleotides, and reactive groups, enabling it to locate cargo in the cell nucleus for functional readout.
This improved the delivery efficiency and cell specificity of CPP in vivo, reduced endosome/lysosome retention, decreased toxicity, and enabled efficient delivery of cargo to the cell nucleus.
Smart Images

Figure SMS_7 
Figure SMS_8 
Figure SMS_10
Abstract
Description
Technical Field
[0001] This disclosure generally relates to cell-penetrating peptides and related compositions. Background Technology
[0002] Due to their high potency and target specificity, peptides are attractive diagnostic and therapeutic agents. However, one of the challenges to the wider adoption of peptides as therapeutic agents is that most peptides cannot enter different tissues within organs (such as the eye) because various tissue layers typically act as barriers to peptide entry into cells. Furthermore, existing peptides and any associated cargo are often trapped in intracellular compartments and lysosomal compartments.
[0003] Cell-penetrating peptides (CPPs) are a class of peptides that facilitate the cellular uptake / retention of various molecular cargoes, ranging from nanoparticles to small chemical molecules, other peptides, proteins, oligonucleotides, and DNA fragments. The "cargo" is associated with the peptide via covalent chemical bonds or non-covalent interactions. The function of CPPs is to deliver the cargo into the cell, a process that typically occurs via endocytosis. Current applications are limited by the lack of cell specificity in CPP-mediated cargo delivery.
[0004] Most in vitro validated CPP models fail in vivo, as evidenced by the lack of CPP-delivered drugs in clinical practice. The problem is that the transition from single-cell in vitro to the in vivo environment significantly increases the complexity of CPP-mediated delivery. Typical CPPs such as R8, Tat, and penetrating peptides (Penetratin) exhibit both in vitro and in vivo uptake, as demonstrated by fluorescently labeled CPP tracking. However, none of these examples have translated into meaningful functional changes in pathology when coupled with therapeutic cargo. It appears that the utility of CPP-mediated cargo delivery is limited by the available peptides, and any associated cargo is often trapped in intracellular and lysosomal compartments, lacking cell specificity.
[0005] In vivo, linear CPPs, known to consist of charge-dense cationic peptides with adjacent positively charged amino acids, are isolated by carbohydrate binding, trapped in endosomes / lysosomes, and have been shown to bind phospholipid head groups that induce membrane deformation. Enhancing CPP activity by increasing its amphiphilic properties (a known design strategy to increase in vitro uptake) has not improved in vivo delivery, likely due to toxicity resulting from increased membrane deformation and disruption.
[0006] In addition, the widespread presence of trypsin, serine endopeptidase, and other proteases in the body leads to the rapid degradation of cation-rich peptides.
[0007] Therefore, in order to fully utilize the advantages of cell-penetrating peptide delivery therapeutics, there is a continued need for developing compositions and methods for delivering peptides and associated payloads to specific tissues and organs in vivo.
[0008] This invention seeks to provide improved or alternative cell-penetrating peptides.
[0009] The preceding background discussion is intended merely to facilitate understanding of the invention. This discussion does not acknowledge or endorse that any material mentioned was, or was, part of common general knowledge as of the priority date of this application. Summary of the Invention
[0010] This invention provides an isolated, non-naturally occurring cell-penetrating peptide (CPP) comprising the following amino acid sequence:
[0011]
[0012] And sequences that have at least 60% similarity to SEQ ID NO: 1.
[0013] The sequence of the present invention may have at least 65%, 70%, 75%, 80% or 85% similarity to SEQ ID NO: 1 at the amino acid level, preferably at least about 90%, 95% or 98% similarity.
[0014] Preferably, the CPP is modified by one or more of the following: using atypical amino acids, fatty acids, detectable markers, oligonucleotides, cholesterol, and reactive groups.
[0015] Preferably, the CPP is conjugated to a molecule of interest. The molecule of interest may be selected from substances such as therapeutic agents, oligonucleotides, other peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable markers. Preferably, the conjugation is performed using covalent bonds or non-covalent interactions.
[0016] The present invention further provides cells comprising a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, or a CPP having SEQ ID NO: 1 and a modified sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to the molecule of interest.
[0017] The present invention further provides the use of a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to a molecule of interest, or a modified cell containing any of these sequences in the manufacture of pharmaceuticals or diagnostic agents.
[0018] Use of a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to the molecule of interest, or a modified cell containing any of these sequences as a pharmaceutical or diagnostic agent.
[0019] A kit comprising (i) a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to the molecule of interest, or cells modified with any of these sequences; and (ii) instructions for use. Attached Figure Description
[0020] Further features of the invention are described more fully in the following description of several non-limiting embodiments. The description included herein is for illustrative purposes only and should not be construed as a general summary, disclosure, or limitation of the invention as described above. The description will be made with reference to the accompanying drawings, in which:
[0021] Figure 1 This is a graph showing the efficacy of SMN1 exon 7-jumping after treatment with peptide-SMN1 conjugate and SMN1 alone for 48 hours.
[0022] Figure 2 This is a graph showing cell viability after 48 hours of treatment with the peptide-SMN1 conjugate and with SMN1 alone.
[0023] Figure 3 This is a diagram illustrating the efficacy of Smn exon 7-jumping generated by CPP having SEQ ID NO: 1 in RPE / choroidal cells, which is in vivo conjugated to Smn PMO.
[0024] Figure 4 This is a diagram illustrating the effect of Smn exon 7-jumping produced by CPP having SEQ ID NO: 1 in retinal cells, said CPP being in vivo conjugated to Smn PMO.
[0025] Figure 5 This is a graph showing the in vivo toxicity of CPP with SEQ ID NO: 1 in GFAP five days after injection, wherein the CPP is conjugated with SmnPMO.
[0026] Invention Description Detailed Implementation
[0027] Cell-penetrating peptides
[0028] Cell-penetrating peptide (CPP) characteristics, such as linear CPPs containing charge-dense cationic peptides with adjacent positively charged amino acids, are the cause of enhanced in vitro performance but generally do not translate into in vivo results. The efficacy of CPPs is closely related to their toxicity, and successful in vitro and in vivo CPPs require a good balance between efficacy and toxicity. One of the key obstacles to overcome is the retention of the CPP cargo portion in endosomes and lysosomes. Here, we propose an assay that requires the localization of the CPP cargo to the cell nucleus to achieve functional readout, thus demonstrating endosomal / lysosomal escape and / or nuclear delivery, if effective. We have identified CPPs that successfully deliver cargo to the cell nucleus, such as amino acid sequences including antisense oligonucleotides.
[0029] Therefore, an isolated, non-naturally occurring cell-penetrating peptide (CPP) is provided, comprising the following amino acid sequence:
[0030]
[0031] And sequences that have at least 60% similarity to SEQ ID NO: 1.
[0032] Preferably, the CPP contains 10 to 100 residues. For example, the CPP may contain 10 to 50 residues, 20 to 30 residues, 20 to 40 residues, 30 to 70 residues, 40 to 60 residues, or 25 to 50 residues.
[0033] The amino acid sequence analogues of SEQ ID NO: 1 include analogues having an amino acid sequence in which one or more amino acids are replaced by another amino acid, the substitution of which substantially does not alter the biological activity (cell penetration ability) of the molecule. These amino acid sequence analogues preferably have conserved amino acid substitutions compared to SEQ ID NO: 1.
[0034] In the context of this invention, similar sequences are considered to include CCP amino acid sequences having at least 60%, 65%, 70%, 75%, 80%, or 85% similarity, and preferably at least about 90%, 95%, or 98%, over at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 100, or 200 amino acids. Specifically, similarity should generally be considered with respect to regions of adjacent sequences that are known to be essential for the function of the CPP encoded by SEQ ID NO: 1, rather than non-essential ones.
[0035] Similar sequences may have at least about 60%, 65%, 70%, 75%, 80%, 85% identity with SEQ ID NO: 1, and preferably at least about 90%, 95%, or 98% identity (i.e., the same residues). Similarly sequences may have at least about 60%, 65%, 70%, 75%, 80%, 85% similarity with SEQ ID NO: 1, and preferably at least about 90%, 95%, or 98% similarity (i.e., conserved residues with similar physicochemical properties).
[0036] Similarity comparisons can be performed visually or, more commonly, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the % similarity between two or more sequences. Similarity percentages can also be calculated on consecutive sequences, i.e., by aligning one sequence to another and directly comparing each amino acid in one sequence to the corresponding amino acid in the other, comparing one residue at a time. This is called a "vacancy-free" alignment. Typically, such vacancy-free alignments are performed only on a small number of residues (e.g., fewer than 50 consecutive amino acids).
[0037] While this is a very simple and consistent approach, it fails to consider that, for example, in otherwise nearly identical sequence pairs, an insertion or deletion will cause subsequent amino acid residues to be excluded from the alignment, potentially leading to a significant decrease in similarity and identity percentages when performing a global alignment. Therefore, most sequence comparison methods are designed to produce optimized alignments that take into account possible insertions and deletions without unduly disadvantageing the overall similarity score. This is achieved by inserting “gaps” in the sequence alignment in an attempt to maximize local homology.
[0038] The identity and similarity of amino acid sequences can be determined using the EMBOSS alignment algorithm tool, available from the European Institute for Bioinformatics (EMBL-EBI), part of the European Molecular Biology Laboratory. This tool is available at www.ebi.ac.uk / Tools / emboss / align / . This tool utilizes the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970). Default settings are used, including vacancy opening: 10.0 and vacancy extension: 0.5. The default matrix "Blosum62" is used for both the amino acid sequences and the default matrix.
[0039] The term "cell-penetrating peptide" (CPP) refers to a peptide capable of crossing the cell membrane. In one instance, a CPP can be transported across the mammalian cell membrane and enter the cell. In another instance, a CPP can direct conjugates to a desired subcellular compartment. Thus, CPPs can direct or facilitate the penetration of molecules of interest through phospholipid membranes, cell membranes, mitochondrial membranes, endosome membranes, lysosomal membranes, vesicle membranes, or nuclear membranes. CPPs can be transported across membranes with their amino acid sequences intact or alternatively partially degraded.
[0040] CPP can guide molecules of interest across the plasma membrane from outside the cell and into the cytoplasm or desired subcellular compartments. Alternatively, or additionally, CPP can guide molecules of interest across the blood-brain barrier, transmucosal barrier, blood-retinal barrier, skin barrier, gastrointestinal barrier, and / or lung barrier.
[0041] The transmembrane transport capacity of CPPs can be energy-dependent or independent and / or receptor-dependent or independent. In some instances, a CPP is a proven transmembrane transport peptide as identified by the methods described herein. CPPs include: (i) peptides that are internalized by the cell but subsequently trapped in the endosome or lysosome; and (ii) peptides that are not only internalized by the cell but, once internalized, are capable of escaping from the endosome and / or lysosomal compartments and, in addition, mediating intracellular delivery into the cytosol and nucleus, mitochondria, Golgi apparatus, and other intracellular compartments.
[0042] In some instances, the peptide will contain one to two, one to five, or ten conserved amino acid substitutions relative to any of the sequences described herein, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 conserved amino acid substitutions. A conserved substitution (also known as a conserved mutation or conserved replacement) is an amino acid substitution in which one amino acid residue is replaced by another amino acid residue from a side chain that has similar physicochemical properties, resulting in a protein with a different amino acid sequence but similar biochemical properties (e.g., charge, hydrophobicity, and size).
[0043] Amino acid residues with side chains having similar physicochemical properties are known in the art, and include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Conserved amino acid substitutions include those amino acids that have been replaced by non-naturally occurring amino acids and non-proteinogenic amino acids, and therefore are not among the conventional amino acids encoded by the genetic code. Conserved amino acid substitutions further include D-amino acids.
[0044] The term "basic amino acid" refers to any amino acid, including both natural and non-natural amino acids, having an isoelectric point higher than 6.3, the measurement of which is based on Kice and Marvell, "Modern Principles of Organic Chemistry" (Macmillan, 1974), or Matthews and van Holde, "Biochemistry," Cummings Publishing Company, 1996. Included in this definition are arginine, lysine, histidine, and homoarginine (Har) and their derivatives. Suitable descriptions of non-natural basic amino acids are found in US 6,858,396.
[0045] In some instances, the amino acid sequence of any CPP peptide consists of 20 to 100 residues, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or any other number of residues. In other instances, the amino acid sequence of any of the aforementioned peptides consists of 30 to 70 residues, such as 35, 40, 45, 48, 50, 52, 60, 65, or any other number of residues. In still other instances, the amino acid sequence of any of the aforementioned peptides consists of 40 to 60 residues, such as 42, 43, 45, 48, 50, 52, 54, 57, 58, or any other number of residues. In some instances, the amino acid sequence of any of the aforementioned peptides consists of 35 to 50 residues, such as 36, 38, 40, 42, 43, 45, 57, 58 residues or other numbers of 35 to 50 residues. Still in other instances, the amino acid sequence of any of the aforementioned peptides consists of 20 to 50 residues, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 35, 37, 38, 40, 42, 46, 48 residues or other numbers of 20 to 50 residues.
[0046] In one example, the amino acid sequence of the peptide consists of the amino acid sequence corresponding to SEQ ID NO: 1. For the avoidance of doubt, it should be understood that in such examples, although the amino acid sequence of the peptide consists of the amino acid sequence corresponding to SEQ ID NO: 1, the peptide may contain chemical modifications that do not alter the amino acid sequence. Such modifications include, but are not limited to: the use of atypical amino acids, fatty acids, detectable markers, polynucleotides, cholesterol, and reactive groups; conjugation of the CPP to a non-peptide linker; and conjugation of the CPP to a molecule of interest (including therapeutic agents, oligonucleotides, and detectable markers). In other examples, the CPP consists of the amino acid sequence corresponding to SEQ ID NO: 1.
[0047] In one embodiment, the CCP comprises multiple copies of the amino acid sequence corresponding to SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, referred to herein as a multimeric peptide. In some instances, the multimeric peptide comprises two to ten copies of the amino acid sequence corresponding to SEQ ID NO: 1, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the amino acid sequence corresponding to SEQ ID NO: 1. In one embodiment, the CCP comprises multiple copies of the amino acid sequence corresponding to SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1.
[0048] Modified CPP
[0049] CPPs can be modified by using atypical amino acids, fatty acids, detectable markers, polynucleotides, cholesterol, and reactive groups. Such modified peptides can endow CPPs with additional functions, such as promoting peptide entry detection, intracellular localization, enhanced cell entry, and / or reduced in vitro or in vivo peptide degradation.
[0050] Atypical amino acids
[0051] In some instances, CPP is a modified peptide containing atypical amino acids. Suitable atypical amino acids include, but are not limited to, α-amino-n-butyric acid, valine, leucine, alloleucine, tertiary leucine, ornithine, allothreonine, β-alanine, β-amino-n-butyric acid, n-isopropylglycine, isoserine, sarcosine, 6-aminohexanoic acid, γ-aminobutyric acid, and 5-aminovaleric acid.
[0052] reactive groups
[0053] In other instances, the modified CPP may contain reactive groups. Suitable reactive groups include, but are not limited to, azide groups, amine reactive groups, thiol reactive groups, and carbonyl reactive groups. In some instances, the reactive group is part of a chemical tag. Suitable chemical tags include, but are not limited to, SNAP tags, CLIP tags, Halo tags, or TMP tags. In one instance, the chemical tag is a SNAP tag or a CLIP tag. SNAP and CLIP fusion proteins enable almost any molecule-specific covalently linked to a protein or peptide of interest, as described, for example, in [examples not provided]. 2015 (Methods Mol Biol, 1266: 55-79). In another example, the chemical tag is a Halo tag. Halo tags relate to modular protein tagging systems that allow different molecules to be covalently linked, whether in solution, in living cells, or in chemically fixed cells. In another example, the chemical tag is a TMP tag. TMP tags are capable of labeling intracellular proteins with high selectivity, rather than cell surface proteins.
[0054] fatty acid
[0055] In some instances, the modified CPP may contain fatty acids. Suitable fatty acids for modifying peptides include, but are not limited to, palmitic acid, myristic acid, caprylic acid, lauric acid, n-capric acid, and n-decanoic acid.
[0056] cholesterol
[0057] In other instances, the modified CPP may contain cholesterol.
[0058] Oligonucleotides
[0059] In some instances, the modified CPP may contain oligonucleotides. In such cases, the oligonucleotides may be antisense oligonucleotides, siRNA, microRNA, RNAi, single-stranded DNA or RNA oligonucleotides, double-stranded DNA oligonucleotides, mRNA, or plasmids.
[0060] Detectable markers
[0061] In some instances, the modified CPP may contain a detectable marker. The term "detectable marker" refers to any type of molecule that can be detected by optical, fluorescence, isotope imaging, or by mass spectrometry or by a simple enzymatic assay. Any detectable marker known in the art may be used. In some instances, the detectable marker is selected from reporter proteins, fluorophores, fluorescent substrates, luminescent substrates, and biotin.
[0062] The detectable marker can be a reporter protein. Suitable reporter proteins include the fluorescent proteins described herein, β-lactamases, haloalkanes dehalogenases, or luciferases described in Qureshi (2007) Biotechniques, 42(1): 91-95. In some instances, the reporter protein contains the amino acid sequence of a β-lactamase.
[0063] The detectable marker can be a fluorescent tag. For example, the fluorescent tag can be a fluorophore, such as fluorescein isothiocyanate, fluorescein aminothione, rhodamine, Texas red, CyDye (such as Cy3, Cy5 and Cy5.5), Alexa Fluor (such as Alexa488, Alexa555, Alexa594 and Alexa647) or a near-infrared fluorescent dye. Fluorescent tags can be fluorescent proteins, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), AcGFP or TurboGFP, emerald green, Azami green, ZsGreen, EBFP, sapphire, T-sapphire, ECFP, mCFP, sky blue, CyPet, AmCyanl, Midori-Ishi Cyan, mTFPl (Teal), enhanced yellow fluorescent protein (EYFP), topaz, gold (Venus), mCitrine, YPet, PhiYFP, ZsYellowl, mBanana, Kusabira, ange, mOrange, dTomato, dTomato-Tandem, AsRed2, mRFPl, Jred, mCherry, HcRedl, mRaspberry, HcRedl, HcRed-Tandem, mPlum, AQ 143. Fluorescent tags can also be quantum dots. Furthermore, fluorescent tags can be pH-sensitive fluorophores, such as naphthofluorescein, pHrodo... TM Green (ThermoFisher) and pHrodo TM Red (ThermoFisher). Fluorescent tags can be detected using fluorescence microscopes such as epifluorescence microscopes or confocal microscopes, fluorescence scanners such as microarray readers, fluorescence spectrophotometers, microplate readers, and / or flow cytometry.
[0064] The detectable marker can be a luminescent matrix. Suitable luminescent substrates include, but are not limited to, D-luciferin, L-luciferin, and coelenterate.
[0065] The detectable marker can be an epitope tag. For example, an epitope tag can be a polyhedrine tag, such as a hexahedrine or dodecahistidine tag, a FLAG tag, a Myc tag, a HA tag, a GST tag, or a V5 tag. Epitope tags are routinely detected using commercially available antibodies. Those skilled in the art will recognize that epitope tags can facilitate purification and / or detection. For example, CPP containing a hexahedrine tag can be purified using methods known in the art, such as by contacting a protein-containing sample with nickel-nitrotriacetic acid (Ni-NTA), which specifically binds to the hexahedrine tag immobilized on a solid or semi-solid support, washing the sample to remove unbound protein, and subsequently eluting the bound protein. Alternatively, or additionally, ligands or antibodies that bind to the epitope tag can be used in affinity purification methods.
[0066] Detectable markers can be mass tags or isobaric tags. Such tags can be used for relative absolute quantification (iTRAQ). A mass tag is a chemical marker used for the quantification of proteins and peptides based on mass spectrometry. In such methods, the mass spectrometer identifies the mass difference between labeled and unlabeled forms of a protein or peptide, and quantification is achieved by comparing their respective signal intensities, as described, for example, by Bantscheff et al. (2007). Examples of mass tags include TMTzero, TMTduplex, TMTsixplex, and TMT 10-plex. Isobaric tags for relative absolute quantification (iTRAQ) are chemical tags used in quantitative proteomics via tandem mass spectrometry to determine the amount of proteins from different sources in a single experiment, as described, for example, by Wiese et al. (2007).
[0067] Combined goods
[0068] CPPs can be conjugated to molecules of interest (i.e., "cargo") to increase their delivery into the cell. Molecules of interest include: therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable markers. Conjugation can occur via covalent or non-covalent interactions. For example, CPPs can be conjugated to oligonucleotides via "peptide linkers." These moieties can be engineered to act on specific intracellular targets or direct their transport to specific subcellular compartments.
[0069] The molecule of interest can be covalently linked to an amino acid in a CPP peptide. In one example, the covalently linked molecule of interest is covalently linked to the N-terminus of the CPP amino acid sequence. In another example, the covalently linked molecule of interest is covalently linked to the C-terminus of the CPP amino acid sequence. In still other examples, the covalently linked molecule of interest is covalently linked via the side chain of an amino acid residue in the CPP (e.g., at an internal lysine or cysteine residue). Those skilled in the art will recognize that this can be achieved through a variety of chemical reactions, including but not limited to peptide bond formation, amide bond formation, linkage via reactive amines, hydrazone formation, disulfide formation, ether bonding, click chemistry (copper-catalyzed and strain-promoted), Staudinger reaction, native chemical linkage, and conjugation chemistry (such as SpyCatcher / SpyTag isopeptide bond formation).
[0070] In some instances, for example, a molecule of interest is non-covalently linked to a CPP via non-covalent interactions between one or more charged amino acid residues in the CPP and one or more functional groups in the molecule of interest, wherein the one or more functional groups carry opposite charges to the one or more amino acid residues in the CPP. Non-covalent interactions can be electrostatic interactions, van der Waals forces, π-bond interactions, and hydrophobic interactions.
[0071] Therapeutic agents
[0072] In some instances, the conjugated molecule of interest may be a therapeutic agent, preferably a small molecule compound (typically smaller than about 900 Daltons). In some instances, the small molecule therapeutic agent is a chemotherapeutic agent, a cytotoxic molecule, or a cell-inhibiting molecule.
[0073] Oligonucleotides
[0074] In some instances, the conjugated molecule of interest may be an oligonucleotide. Oligonucleotides may be antisense oligonucleotides, siRNA, microRNA, RNAi, single-stranded DNA or RNA oligonucleotides, double-stranded DNA oligonucleotides, mRNA, or plasmids. Oligonucleotides may include morpholino oligonucleotides (PMO), peptide nucleic acids (PNA), locked nucleic acids (LNA), and 2'-O-methyl oligonucleotides. Oligonucleotides may have (i) a modified backbone structure, such as a backbone different from the standard phosphodiester bonds found in naturally occurring oligonucleotides and polynucleotides, and / or (ii) a modified sugar moiety, such as a morpholino moiety different from the ribose or deoxyribose moiety.
[0075] peptides or proteins
[0076] In some instances, the conjugated molecule of interest can be a protein or a peptide. Proteins or peptides can be: pro-apoptotic peptides, target proteins, cytotoxic proteins, enzyme proteins, reporter proteins, peptide-based protein-protein interaction inhibitors, proteolytic targeting chimeric (PROTAC) peptides, and dominant-negative peptides.
[0077] In some instances, the enzyme protein may be ASS-1 (Quinonez and Thoene 2004) or β-lactamase (Stone et al. 2018); the peptide interaction inhibitor may be a KRAS / SOS-1 protein interaction blocking peptide (e.g., Leshchiner et al. 2015); and the proteolytic targeting chimera (PROTAC) peptide sequence may be a sequence from Sakamoto et al. 2001 or Gu et al. 2018.
[0078] In some instances, the protein or peptide may be a pro-apoptotic peptide.
[0079] In some instances, the protein or peptide can be a targeting protein. By binding to a specific cell surface antigen (e.g., a receptor), a targeting protein can provide enhanced specificity against a peptide conjugate, which is then internalized into the endosome. Examples of targeting proteins include, but are not limited to, affinities, scFvs, single-chain antibodies, and other selectively binding proteins that use alternative scaffolds (e.g., peptide aptamers). Alternatively, a targeting protein can be a genome-targeting protein (e.g., a Cas9 genome-targeting protein or a Cpf1 genome-targeting protein).
[0080] In other instances, the protein or peptide may be a cytotoxic protein (e.g., bougainvillea ribosome inactivating protein or diphtheria toxin), which induces rapid cell death upon internalization and escapes from the endosome.
[0081] In some instances, the protein or peptide may be a dominant-negative peptide. Dominant-negative peptides typically function by interfering with one or more functions of the protein from which they are derived and / or interfering with the function of the interacting partner of the full-length protein. They typically function by interfering with the interaction of the protein with one or more of its binding partner. In some instances, dominant-negative transcription factor peptides are anticancer peptides. Suitable anticancer peptides include, but are not limited to: Omomyc, a dominant-negative peptide d / n-ATF5-S1 that activates transcription factor 5 (ATF5), as described by Massler et al. (2016) in Clin Cancer Res, 22(18): 4698-4711; and anti-Ras-p21 dominant-negative peptides, such as ras-p21 96-110 (PNC-2) and ras-p21 35-47, as described by Adler et al. (2008) in Cancer Chemother Pharmacol, 62(3): 491-498.
[0082] reactive groups
[0083] In some instances, the conjugated molecule of interest may be a reactive group. Suitable reactive groups include, but are not limited to, azide groups, amine reactive groups, thiol reactive groups, and carbonyl reactive groups. In some instances, the reactive group is part of a chemical tag. Suitable chemical tags include, but are not limited to, SNAP tags, CLIP tags, Halo tags, or TMP tags. In one instance, the chemical tag is a SNAP tag or a CLIP tag. SNAP and CLIP fusion proteins enable the specific covalent attachment of virtually any molecule to a protein or peptide of interest, as described, for example, in [the following text is missing from the original extract]. 2015 (Methods Mol Biol, 1266: 55-79). In another example, the chemical tag is a Halo tag. Halo tags relate to modular protein tagging systems that allow different molecules to be covalently linked, whether in solution, in living cells, or in chemically fixed cells. In another example, the chemical tag is a TMP tag. TMP tags are capable of labeling intracellular proteins with high selectivity, rather than cell surface proteins.
[0084] fatty acid
[0085] In some instances, the conjugated molecules of interest can be fatty acids. Suitable fatty acids for modifying peptides include, but are not limited to, palmitic acid, myristic acid, caprylic acid, lauric acid, caprylic acid, and capric acid.
[0086] cholesterol
[0087] In some instances, the conjugated molecule of interest could be cholesterol.
[0088] Detectable markers
[0089] In some examples, the conjugated molecule of interest is a detectable marker. A detectable marker can be any type of molecule that can be detected by optical, fluorescence, isotope imaging, or by mass spectrometry or by a simple enzymatic assay. Any detectable marker known in the art can be used. In some instances, the detectable marker is selected from reporter proteins, fluorophores, fluorescent substrates, luminescent substrates, and biotin.
[0090] The detectable marker can be a reporter protein. Suitable reporter proteins include the fluorescent proteins described herein, β-lactamases, haloalkanes dehalogenases, or luciferases described in Qureshi (2007) Biotechniques, 42(1): 91-95. In some instances, the reporter protein contains the amino acid sequence of a β-lactamase.
[0091] The detectable marker can be a fluorescent tag. For example, the fluorescent tag can be a fluorophore, such as fluorescein isothiocyanate, fluorescein aminothione, rhodamine, Texas red, CyDye (such as Cy3, Cy5 and Cy5.5), Alexa Fluor (such as Alexa488, Alexa555, Alexa594 and Alexa647) or a near-infrared fluorescent dye. Fluorescent tags can be fluorescent proteins, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), AcGFP or TurboGFP, emerald green, Azami green, ZsGreen, EBFP, sapphire, T-sapphire, ECFP, mCFP, sky blue, CyPet, AmCyanl, Midori-Ishi Cyan, mTFPl (Teal), enhanced yellow fluorescent protein (EYFP), topaz, gold (Venus), mCitrine, yPet, PhiYFP, ZsYellowl, mBanana, Kusabira, ange, mOrange, dTomato, dTomato-Tandem, AsRed2, mRFPl, Jred, mCherry, HcRedl, mRaspberry, HcRedl, HcRed-Tandem, mPlum, AQ 143. Fluorescent tags can also be quantum dots. Furthermore, fluorescent tags can be pH-sensitive fluorophores, such as naphthofluorescein, pHrodo... TM Green (ThermoFisher) and pHrodo TM Red (ThermoFisher). Fluorescent tags can be detected using fluorescence microscopes such as epifluorescence microscopes or confocal microscopes, fluorescence scanners such as microarray readers, fluorescence spectrophotometers, microplate readers, and / or flow cytometry.
[0092] The detectable marker can be a luminescent matrix. Suitable luminescent substrates include, but are not limited to, D-luciferin, L-luciferin, and coelenterate.
[0093] The detectable marker can be an epitope tag. For example, an epitope tag can be a polyhedrine tag, such as a hexahedrine or dodecahistidine tag, a FLAG tag, a Myc tag, a HA tag, a GST tag, or a V5 tag. Epitope tags are routinely detected using commercially available antibodies. Those skilled in the art will recognize that epitope tags can facilitate purification and / or detection. For example, CPP containing a hexahedrine tag can be purified using methods known in the art, such as by contacting a protein-containing sample with nickel-nitrotriacetic acid (Ni-NTA), which specifically binds to the hexahedrine tag immobilized on a solid or semi-solid support, washing the sample to remove unbound protein, and subsequently eluting the bound protein. Alternatively, or additionally, ligands or antibodies that bind to the epitope tag can be used in affinity purification methods.
[0094] Detectable markers can be mass tags or isobaric tags. Such tags can be used for relative absolute quantification (iTRAQ). A mass tag is a chemical marker used for the quantification of proteins and peptides based on mass spectrometry. In such methods, the mass spectrometer identifies the mass difference between labeled and unlabeled forms of a protein or peptide, and quantification is achieved by comparing their respective signal intensities, as described, for example, by Bantscheff et al. (2007). Examples of mass tags include TMTzero, TMTduplex, TMTsixplex, and TMT 10-plex. Isobaric tags for relative absolute quantification (iTRAQ) are chemical tags used in quantitative proteomics via tandem mass spectrometry to determine the amount of proteins from different sources in a single experiment, as described, for example, by Wiese et al. (2007).
[0095] synthesis
[0096] Any CPP disclosed herein can be synthesized using chemical methods known to those skilled in the art. For example, synthetic peptides can be prepared using known techniques of solid-phase, liquid-phase, or peptide condensation, or any combination thereof, and said synthetic peptides may contain natural and / or non-natural amino acids.
[0097] Any peptide disclosed herein can be expressed recombinantly. For example, the nucleic acid encoding the peptide can be operatively linked to a promoter or other regulatory sequence capable of regulating expression in a cellular system or organism. Typical promoters suitable for expression in bacterial cells include, for example, the lacz promoter, the Ipp promoter, the temperature-sensitive λL or λR promoter, the T7 promoter, the T3 promoter, the SP6 promoter, or semi-artificial promoters such as the IPTG-inducible tac promoter or the lacUV5 promoter. Many other gene construct systems for expressing the peptides of the present invention in bacterial cells are well known in the art and described, for example, by Ausubel et al. (1988) and Sambrook et al. (2001).
[0098] Many expression vectors for expressing recombinant peptides in bacterial cells have been described, including, for example, PKC3, pKK173-3, pET28, pCR vector kit (Invitrogen), pGEM-T Easy vector (Promega), pL expression vector kit (Invitrogen), or the pBAD / thio-TOPO series of vectors (Invitrogen) containing an arabinose inducible promoter.
[0099] Typical promoters suitable for expression in yeast cells include, but are not limited to, the ADH1 promoter, GAL1 promoter, GAL4 promoter, CUP1 promoter, PH05 promoter, nmt promoter, RPR1 promoter, or TEF1 promoter, wherein the yeast cells are selected from the group including Pichia pastoris, Saccharomyces cerevisiae, and Schizosaccharomyces cerevisiae.
[0100] Expression vectors for expression in yeast cells are preferred and include, for example, pACT vector (Clontech), pDBleu-X vector, pPIC vector kit (Invitrogen), pGAPZ vector kit (Invitrogen), pHYB vector (Invitrogen), pYD 1 vector (Invitrogen), and pNMT 1, pNMT41, pNMT81 TOPO vectors (Invitrogen), pPC86-Y vector (Invitrogen), pRH series vectors (Invitrogen), and pYESTrp series vectors (Invitrogen).
[0101] Preferred vectors for expression in mammalian cells include, for example, the pcDNA vector kit (Invitrogen), the pTARGET series of vectors (Promega), and the pSV vector kit (Promega).
[0102] Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (2001) and other laboratory textbooks. In one instance, nucleic acids can be introduced into prokaryotic cells using, for example, electroporation or calcium chloride-mediated transformation. In another instance, nucleic acids can be introduced into mammalian cells using, for example, microinjection, calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, transfection via liposomes such as using Lipofectamine (Invitrogen) and / or cellfectin (Invitrogen), PEG-mediated DNA uptake, electroporation, transduction via adenovirus, herpesvirus, cloacal virus, or retrovirus, and particle bombardment, such as using DNA-coated tungsten or gold particles. Alternatively, conventional techniques such as electroporation and PEG-mediated transformation can be used to introduce nucleic acids into yeast cells.
[0103] After production / expression / synthesis, any protein or peptide disclosed herein may be purified using methods known in the art, such as HPLC, see, for example, Scopes (see: Protein purification: principles and practice, 3rd edition, Springer Verlag, 1994).
[0104] Cellular expression
[0105] This article also describes modified cells that contain any CPP or CPP conjugated to the molecules of interest described herein.
[0106] Therefore, the present invention provides a modified cell comprising a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, or a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to the molecule of interest.
[0107] The present invention further provides the use of a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to a molecule of interest, or a modified cell containing any of these sequences in the manufacture of pharmaceuticals or diagnostic agents.
[0108] In some instances, the modified cells are prokaryotic cells. In other instances, the modified cells are eukaryotic cells. Suitable eukaryotic cells include yeast cells and mammalian cells, including but not limited to human cells. In some instances, the modified mammalian cells are derived from cell lines. Suitable cell lines include, but are not limited to, ARPE-19, CHO-K1, HEK-293, COS7, HeLa, N2a, and NIH 3T3.
[0109] In some instances, the modified cells express one or more genetically encoded CPPs or CPPs conjugated to the molecule of interest. In other instances, the modified cells are primary mammalian cells.
[0110] In other embodiments, the modified cells do not contain exogenous nucleic acids encoding CPP or CPP conjugated to the molecule of interest, but are modified by protein transduction of CPP or CPP conjugated to the molecule of interest.
[0111] Preferably, the modified cells are eukaryotic cells. More preferably, the eukaryotic cells are mammalian cells. Most preferably, the mammalian cells are human cells. In some instances, the human cells are human stem cells. Such human stem cells include, but are not limited to, embryonic stem cells, induced pluripotent stem cells, and mesenchymal stem cells. In further instances, the human cells include, but are not limited to, cardiomyocytes, neurons, hepatocytes, and pancreatic islet cells. In other instances, the mammalian cells are cancer cells (e.g., human cancer cells).
[0112] use
[0113] This disclosure also provides any one of a CPP for use as a pharmaceutical or diagnostic agent, a CPP conjugated to a molecule of interest, or a modified cell. This disclosure also provides any one of a CPP for manufacturing pharmaceuticals or diagnostic agents, a CPP conjugated to a molecule of interest, or a modified cell.
[0114] Therefore, the present invention provides the use of a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to a molecule of interest, or a modified cell containing any of these sequences in the manufacture of pharmaceuticals or diagnostic agents.
[0115] The present invention further provides the use of a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to a molecule of interest, or a modified cell containing any of these sequences as a pharmaceutical or diagnostic agent.
[0116] The sequence of the present invention may have at least 65%, 70%, 75%, 80% or 85% similarity to SEQ ID NO: 1 at the amino acid level, preferably at least about 90%, 95% or 98% similarity.
[0117] Preferably, the CPP is modified by one or more of the following: using atypical amino acids, fatty acids, detectable markers, oligonucleotides, cholesterol, and reactive groups.
[0118] Preferably, the CPP is conjugated to a molecule of interest. The molecule of interest may be selected from substances such as therapeutic agents, oligonucleotides, other peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable markers. Preferably, the conjugation is performed using covalent bonds or non-covalent interactions.
[0119] Reagent test kit
[0120] This disclosure also provides a kit including the CPP of the present invention and instructions for use.
[0121] Therefore, the present invention provides a kit comprising (i) a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP having SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1 conjugated to the molecule of interest, or cells modified to contain any of these sequences; and (ii) instructions for use.
[0122] The sequence of the present invention may have at least 65%, 70%, 75%, 80% or 85% similarity to SEQ ID NO: 1 at the amino acid level, preferably at least about 90%, 95% or 98% similarity.
[0123] Preferably, the CPP is modified by one or more of the following: using atypical amino acids, fatty acids, detectable markers, oligonucleotides, cholesterol, and reactive groups.
[0124] Preferably, the CPP is conjugated to a molecule of interest. The molecule of interest may be selected from substances such as therapeutic agents, oligonucleotides, other peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable markers. Preferably, the conjugation is performed using covalent bonds or non-covalent interactions.
[0125] definition
[0126] The term "typical amino acid" refers to an amino acid directly encoded by a codon in the universal genetic code. Typical amino acids are: alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.
[0127] The terms “endogenous” or “endogenously encoded” for nucleotide or amino acid sequences indicate that the sequence in question is natural to a virus, cell, or organism without experimental modification to encode or express the amino acid sequence in question.
[0128] The term “non-naturally occurring” for peptides will be understood to mean: (i) the absence of an endogenous gene or an open reading frame encoding an amino acid sequence consisting of the amino acid sequence of the peptide in question; and (ii) the absence of an endogenous protein fragment whose amino acid sequence consists of the peptide in question. For example, a peptide consisting of the amino acid sequence of a fragment of an endogenously expressed protein is considered a non-naturally occurring peptide if the protein fragment itself is not naturally expressed or is not typically present as a byproduct of an endogenously expressed protein.
[0129] The term "peptide" is intended to include compounds consisting of amino acid residues linked by amide bonds. The peptide can be natural or non-natural, ribosome-encoded or synthetically derived. Typically, the peptide will consist of 2 to 200 amino acids. For example, the peptide can have a length in the range of 10 to 20 amino acids, 10 to 30 amino acids, 10 to 40 amino acids, 10 to 50 amino acids, 10 to 60 amino acids, 10 to 70 amino acids, 10 to 80 amino acids, 10 to 90 amino acids, or 10 to 100 amino acids, including any length within said range. The peptide can contain or consist of fewer than about 150 amino acids, fewer than about 125 amino acids, fewer than about 100 amino acids, fewer than about 90 amino acids, fewer than about 80 amino acids, fewer than about 70 amino acids, fewer than about 60 amino acids, or fewer than about 50 amino acids.
[0130] The peptides referred to in this article include “inverted” peptides in which all L-amino acids are replaced by corresponding D-amino acids, and “reverse inverted” peptides in which the amino acid sequence is reversed and all L-amino acids are replaced by D-amino acids.
[0131] Peptides can contain amino acids that are L-type and / or D-type. For example, both L-type and D-type can be used for different amino acids in the same peptide sequence. In some instances, the amino acids in the peptide sequence are L-type, such as natural amino acids. In some instances, the amino acids in the peptide sequence are a combination of L-type and D-type. In some instances, all the amino acids in the peptide sequence are D-type.
[0132] Peptides can be synthesized using well-known solid-phase peptide synthesis and purification techniques.
[0133] The term "protein" should be understood to include a single polypeptide chain, that is, a series of consecutive amino acids linked by peptide bonds, or a series of polypeptide chains covalently or nonvalently linked to each other (i.e., a polypeptide complex). For example, a series of polypeptide chains can be covalently linked using suitable chemical bonds or disulfide bonds. Examples of nonvalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions.
[0134] Overview
[0135] Those skilled in the art will understand that the invention described herein is readily adaptable to variations and modifications beyond those specifically described. This invention includes all such variations and modifications. The invention also includes all steps, features, formulations, and compounds individually or collectively mentioned or indicated in this specification, as well as any and all combinations of or any two or more of the stated steps or features.
[0136] Every document, reference, patent application, or patent cited in this article is explicitly and fully incorporated into this article by reference, meaning that the reader should read and consider it as part of this article. Documents, references, patent applications, or patents cited in this article will not be repeated here, solely for the sake of brevity.
[0137] Descriptions, specifications, and product lists of any manufacturer mentioned herein or in any document incorporated herein by reference are hereby incorporated by reference and may be used in the practice of this invention.
[0138] This invention is not limited in scope to any of the specific embodiments described herein. These embodiments are merely illustrative. Functionally equivalent products, formulations, and methods are clearly within the scope of this invention.
[0139] The invention described herein may include one or more ranges of values (e.g., dimensions, displacements, and field strengths). A range of values will be understood to include all values within that range, including the value defining the range and values adjacent to the range that result in the same or substantially the same result as the value immediately adjacent to the boundary defining the range. Therefore, unless otherwise indicated, the numerical parameters set forth in the specification and claims are approximate values that may vary according to the desired characteristics sought to be obtained according to the invention. Thus, "about 80%" means "about 80%", and also "80%". At a minimum, each numerical parameter should be interpreted according to the number of significant figures and common rounding methods.
[0140] Throughout this specification, unless the context otherwise requires, the word “comprise” or variations such as “comprises” or “comprising” will be understood to mean including the stated integers or groups of integers, but not excluding any other integers or groups of integers. It should also be noted that, in this disclosure, particularly in the claims and / or paragraphs, terms such as “comprises,” “comprised,” “comprising,” etc., may have the meanings that fall under the jurisdiction of U.S. patent law; for example, they may mean “includes,” “included,” “including,” etc.; and these terms such as “consisting essentially of” and “consists essentially of” have the meanings that fall under the jurisdiction of U.S. patent law, for example, they allow elements not explicitly stated, but exclude elements found in the prior art or affecting the essential or novel features of the invention.
[0141] Other definitions of the selected terms used herein can be found in the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The term "activator" may refer to one activator or may include two or more activators.
[0142] The following embodiments are provided to more fully describe the ways in which the invention is used, and to illustrate the best modes of implementing various aspects of the invention. It should be understood that these methods are in no way intended to limit the true scope of the invention, but are presented for illustrative purposes.
[0143] Example
[0144] Further features of the invention are described more fully in the following non-limiting embodiments. The description included herein is for illustrative purposes only and should not be construed as limiting the general description of the invention as described above.
[0145] Example 1
[0146] Using strain-promoted (SPAAC) click chemistry (Agard et al. 2004, Dommerholt et al. 2016), potential CPP peptides were linked to phosphodiesteramide (PMO) oligonucleotides targeting exon 7 of the SMN1 gene (Flynn et al. 2018). The peptide-PMO conjugates were incubated for 2 days on ARPE-19 cells in full culture medium. Internalization efficacy was measured by the degree of exon 7 skipping in the SMN1 gene RNA transcript via RNA extraction. Peptides with a higher d7 transcript percentage than those treated with PMO alone were considered CPP.
[0147] Introduction to In Vitro CPP-SMN1 Assay
[0148] The surviving motor neuron (SMN1) gene is widely expressed and plays an important role in spliceosome assembly and ribonucleoprotein biogenesis. The splicing regulation of the SMN1 gene has been elucidated (Singh et al. 2012). A splice variant of SMN1, in which exon-7 is skipped, is a known isoform that produces a shorter SMN protein, denoted as D7-SMN1. Exon skipping using phosphodiamidomorpholino oligomers (PMOs) delivered via cell-penetrating peptides has been established as a feasible approach for testing CPP efficacy (Wu et al. 2007).
[0149] Using the SMN1 gene, we developed an exon-7 exon-jugation assay targeting the SMN1 gene using phosphodiesteramide oligonucleotides (PMOs) conjugated to different CPPs (Flynn et al. 2018). This assay was used to identify CPPs that can efficiently deliver PMO cargo to the nucleus and influence SMN1 exon-jugation. Delivery and function efficiency were determined by measuring changes in D7-SMN1 RNA transcripts using RNA extraction, cDNA generation, and PCR with SMN1-specific primers. Higher efficiency was interpreted as a higher percentage of D7-SMN1 transcripts, indicating better delivery to the nucleus via the CPP.
[0150] Given the nature of this assay, the characteristics of native L-peptides are undesirable due to proteolytic digestion in the presence of the entire culture medium. To fully assess the CPP capacity of peptides, they are synthesized as either a peptide containing a mixture of L / D amino acids, where all basic residues are D-amino acids, or a peptide containing only D amino acids. Both methods protect the peptide from proteolytic degradation during incubation on cells.
[0151] method
[0152] Mammalian tissue culture
[0153] From ATCC ( ARPE-19 cells were obtained using CRL-2302. The cell lines were maintained in a humidified incubator at 37°C with 5% CO2 and cultured in complete medium (DMEM / F12 1:1, 10% FCS; 10 mM HEPES, 1xGlutaMAX). TM Cultured in Pen / Strep 100u / ml (Gibco, Thermo Fisher Scientific, Waltham, MA, USA).
[0154] Peptide and PMO synthesis and PPMO conjugation
[0155] CPP was synthesized using a standard Fmoc SPPS-based method (Pepscan GmbH, Lelystad, The Netherlands and Mimotopes, Mulgrave, VIC, Australia). All sequences contained C-terminal azidolysine residues to allow coupling with PMO; all N-termini were acetylated and C-termini were amidated.
[0156] SMN1 PMO (ACTTTCCTTCTTTTTTATTTTGTCT) [SEQ ID NO: 2] with a 5' cyclooctyne stalk was produced by Gene Tools (Gene Tools LLC, Philomath, OR, USA) using a method developed by Summerton and Weller (1997).
[0157] CPP peptides with C-terminal azidolysine residues were chemically conjugated to 5′-cyclooctyne PMOs using strain-promoted click chemistry (SPAAC; Agard et al. 2004; Dommerholt et al. 2016). The cycloaddition reaction between the azido-functionalized peptide and the cyclooctyne-functionalized PMO was carried out at 37 °C in phosphate-buffered saline containing 5% DMSO for 3–4 days. The peptide-PMO (PPMO) conjugate was separated from the unreacted substance by ion-exchange chromatography (IEX) and desalted. The final fractions were analyzed by analytical reversed-phase HPLC and LC / MS.
[0158] In vitro SMN1 efficacy assay
[0159] Exon skipping assays and PCR detection were performed according to the published protocol (Mann et al. 2002, Gene Med, 4, 644-654).
[0160] Immortalized retinal pigment epithelial cells (ARPE-19) were treated with CPP-PMO conjugates at various concentrations (4 μM, 2 μM, 1 μM, in duplicate), and SMN1 transcript levels were assessed 48 h after treatment by RNA extraction and purification, followed by cDNA generation and PCR.
[0161] Cells were seeded in 24-well plates (ARPE-19, 2.5 x 10⁻⁶). 4 Complete culture medium (DMEM / F12 1:1, 10% FCS; 10mM HEPES, 1xGlutaMAX) per cell / well TM Pen / Strep 100u / ml; Gibco, Thermo Fisher Scientific, Waltham, MA, USA. Incubate cells overnight (37°C, 5% CO2) to allow cell adhesion. On the day of assay, aspirate the culture medium and treat with CPP-PMO or PMO (only in treatment medium (DMEM / F12 1:1, 10% FCS; 10mM HEPES; 1xGlutaMAX)). TM (Pen / Strep 100u / ml; diluted in Gibco, Thermo Fisher Scientific, Waltham, MA, USA) instead, and then incubated (37°C, 5% CO2) for 24 h. The next day, fresh medium was added at a 1:1 ratio, and the cells were returned to the incubator for another 24 h.
[0162] Forty-eight hours after treatment, the cell culture medium was carefully aspirated and the cells were washed with PBS. RNA was obtained from the treated cells using commercial RNA extraction kits (Bio-Rad Aurum Total RNA 96 Kit; Quantify RNA Yield; Quant-iT RNABR Kit) according to the manufacturer's protocol.
[0163] The extracted RNA was purified, quantified, and then diluted to 10 ng / µL. cDNA was generated using a commercial reverse transcription kit according to the manufacturer's protocol (BioRadiScript). The generated cDNA was used as a template, with primers designed to amplify the region of interest to amplify the DNA. The exon skipping efficiency was determined by quantifying the full-length SMN1 gene (FL SMN1) and the exon-7 skipping fragment (D7-SMN1) (LC-GX Nucleic Acid Analyzer) and calculating the percentage. A higher percentage of D7-SMN1 DNA indicates higher CPP delivery efficiency.
[0164] In vitro SMN1 viability assay
[0165] Cells were seeded in 96-well plates (ARPE-19, 4 x 10⁶ cells / well). 3 Complete culture medium (DMEM / F12 1:1, 10% FCS; 10mM HEPES, 1xGlutaMAX) per cell / well TM Pen / Strep 100u / ml; Gibco, Thermo Fisher Scientific, Waltham, MA, USA. Cells were incubated overnight (37°C, 5% CO2) to allow cell adhesion. On the day of assay, the medium was aspirated and treated with CPP-PMO or PMO (only at various concentrations (32, 16, 8, 4, 2, and 1uM) in DMEM / F12 1:1, 10% FCS; 10mM HEPES, 1xGlutaMAX. TM (Pen / Strep 100u / ml; Gibco, ThermoFisher Scientific, Waltham, MA, USA) diluted in water, then incubated (37°C, 5% CO2) for 24 h. The next day, fresh medium was added at a 1:1 ratio, and the cells were returned to the incubator for another 24 h.
[0166] 48 hours after treatment, use commercial The luminescent cell viability assay (Promega, Australia) measures cell viability. In short, the CellTiter-Glo reagent causes cell lysis and generates a luminescent signal that is proportional to the amount of ATP present, which in turn is proportional to the number of viable cells present in the culture. All assays were performed using the known cytotoxic agent melittin (Renata et al. 2007) and a cell-only control. Cell viability was used to determine the level of toxicity induced by the CPP-PMO conjugate, where, correspondingly, high viability is equivalent to low toxicity, and low viability is equivalent to high toxicity.
[0167] result
[0168] exist Figure 1 As shown in Table 1, compared to SMN1 PMO alone, 4 μM, 2 μM, and 1 μM of SEQ ID NO: 1 CPP conjugated with SMN1 PMO produced more truncated D7-SMN1 transcripts. The efficacy of the peptide-PMO conjugates in inducing SMN1 exon skipping followed a dose-response curve for the applied peptide-PMO conjugates. The peptide-PMO conjugates were 1.2-fold more effective than SMN1 PMO treatment alone in inducing SMN1 exon skipping (1.2-fold at 2 μM). Therefore, the peptide described in SEQ ID NO: 1 is an effective cell penetration and nuclear delivery agent.
[0169] exist Figure 2 As shown in Table 2, the viability of the peptide-PMO conjugate compared to PMO alone for 48 hours after treatment with 32 μM clearly demonstrates that the addition of the peptide-PMO conjugate caused less impairment to cell viability than PMO alone (1.05-fold). This indicates that the cell penetration and nuclear delivery of the peptide are harmless to cell health and do not cause the inherent toxicity typically associated with cationic cell-penetrating peptides.
[0170] Table 1: Results of CPP-enhanced SMN1 antisense oligonucleotide delivery efficacy
[0171]
[0172] Table 2: Viability results of CPP-enhanced SMN1 antisense oligonucleotide delivery
[0173]
[0174]
[0175] Example 2
[0176] Given the widespread distribution of the Smn gene in mice, the in vitro SMN1 efficacy assay described in Example 1 is also applicable to the in vivo environment, where Smn is a mouse ortholog of human SMN1. Due to the presence of abundant proteases in vivo, the use of natural L-peptides in the in vivo environment is undesirable. To fully assess the cell penetration ability of the peptide, it was synthesized as either a peptide containing a mixture of L / D amino acids, where all basic residues are D-amino acids, or a peptide containing only D amino acids. Both methods were established to protect the peptide from proteolytic degradation during systemic administration to animals.
[0177] The ability of CPP-PMO to subsequently deliver Smn cargo in vivo to RPE cells in the eye was evaluated by administration to the vitreous fluid of mice and measurement of changes in Smn transcript levels in the retinal, RPE, and choroidal cell layers after days 5, 7, 21, and 28. The CPP of the present invention (SEQ ID NO: 1) and the control CPP Pip6a (SEQ ID NO: 3) (which is conjugated to Smn PMO (SEQ ID NO: 2)) were administered intravitreally at 1.6 μg (0.5 μL volume) per eye. At the desired time points after treatment, animals were selected, and the eyes were dissected, tissue layers were homogenized, and RNA was extracted using the same protocol as in Example 1.
[0178] Compared to CPP Pip6a, which contains non-natural amino acids (X and B):
[0179]
[0180] Arg Ahx Arg Arg beta-Ala Arg Arg Ahx Arg Tyr Gln Phe Leu Ile Arg AhxArg beta-Ala Arg Ahx Arg beta-Ala
[0181] X = Ahx = aminohexanoic acid; B = β-Ala = β-alanine
[0182] Using RNA extraction, cDNA generation, and PCR with Smn-specific primers, the efficiency of delivery and function of Smn RNA transcripts to various organs was determined by measuring the change from full-length to exon-7 skipping fragment (D7-Smn) RNA transcripts. Efficiency was interpreted as a higher percentage of D7-Smn transcripts, indicating better delivery to tissues via CPP.
[0183] Glial fibrillary acidic protein (GFAP) is an intermediate filament cytoskeletal protein. GFAP levels in some cell types are strongly affected by injury or stress, and GFAP expression has become an important marker of central nervous system injury. In the eye, Miller glial cells typically express low levels of GFAP, which increases significantly after retinal injury. Peptides that elicit a relative increase in GFAP expression after intravitreal (IVT) administration are considered to be more toxic.
[0184] method
[0185] Peptide and PMO synthesis and peptide-PMO conjugation
[0186] CPP was synthesized using a standard Fmoc SPPS-based method (Pepscan GmbH, Lelystad, The Netherlands and Mimotopes, Mulgrave, VIC, Australia). All sequences contained C-terminal azidolysine residues to allow coupling with PMO; all N-termini were acetylated and C-termini were amidated.
[0187] Smn PMO (ACTTTCCTTCTTTTTTATTTTGTCT; SEQ ID NO: 2), which has a 5' cyclooctyne stalk, is produced by Gene Tools (Gene Tools LLC, Philomath, OR, USA).
[0188] CPP peptides with C-terminal azidolysine residues were selectively conjugated to 5′-cyclooctyne PMO using strain-promoted click chemistry (SPAAC; Agard et al. 2004; Dommerholt et al. 2016) and purified by ion exchange chromatography and quantified by LC-MS.
[0189] In vivo Smn efficacy assay (IVT administration)
[0190] Exon skipping assay and RT-PCR detection were performed according to the published protocol (Mann et al. 2002, Gene Med, 4, 644-654).
[0191] Mice (C57B / 6; 7 weeks old) were derived from Australian BioResources (ABR). Selected CPP-PMO was injected intravitreally at a dose of 1.6 μg (0.5 μL) per eye, with one to three mice in each treatment group.
[0192] Forty-eight hours after treatment, mice were selected, and the following eye tissues were harvested: retina, RPE layer, or a combination of RPE / choroid. The tissues were homogenized, and RNA was obtained using commercial RNA extraction kits (Bio-Rad Aurum Total RNA 96 Kit; Quantity RNA Yield; Quant-iT RNA BR Kit) according to the manufacturer's protocol.
[0193] The extracted RNA was purified, quantified, and then diluted to 10 ng / µL. cDNA was generated using a commercial reverse transcription kit according to the manufacturer's protocol (BioRadiScript). The generated cDNA was used as a template, with primers designed to amplify the region of interest to amplify the DNA. The exon skipping efficiency was determined by quantifying the full-length Smn gene (FL Smn) and the exon-7 skipping fragment (D7-Smn) (LC-GX Nucleic Acid Analyzer) and calculating the percentage. A higher percentage of D7-Smn DNA indicates higher CPP delivery efficiency.
[0194] GFAP in vivo toxicity assay
[0195] As part of the above-mentioned in vivo Smn efficacy assay, the expression of GFAP mRNA was quantified by amplifying the obtained cDNA. ddPCR was performed using a BioRad droplet generator and reader (QX200 DG8) and thermal cycler (T100), specific probes for mouse Gfap (dMmuCPE5116126) and housekeeping genes Gapdh, Eefla1, and Rp127 (dMmuCPE5195283, dMmuCPE5101732, and dMmuCPE5197083), a ddPCR stock solution mixture of probe (number 1863024), and other ddPCR specific consumables from BioRad (numbers 1863005, 12001925, 1863004, and 1864007).
[0196] Results were obtained using BioRad ddPCR software, expressed as copies / µL. These results were then normalized to housekeeping genes for cross-experimental comparisons. Peptides with relatively increased GFAP expression were considered more toxic.
[0197] result
[0198] exist Figure 3 and Figure 4As shown in Tables 3 and 4, the CPP conjugated with Smn PMO of SEQ ID NO: 1 produced more truncated D7-Smn transcripts compared to Smn PMO alone. In inducing Smn exon skipping, the peptide-PMO conjugate was more effective than Smn PMO treatment alone or the competing agent CPP Pip6a (Betts et al. 2012). Therefore, the peptide described in SEQ ID NO: 1 is an effective in vivo cell-penetrating and nuclear delivery agent.
[0199] exist Figure 5 As shown in Table 5, the CPP conjugated with Smn PMO in SEQ ID NO:1 elicited very low GFAP expression, no higher than that of PMO alone on day 5, and significantly lower than that of the competitor CPP Pip6a. Therefore, the peptide described in SEQ ID NO:1 is considered non-toxic in vivo when administered intravitreal at clinically relevant concentrations.
[0200] Table 3: Efficacy results of CPP-enhanced in vivo delivery of Smn antisense oligonucleotides (RPE / choroid membrane)
[0201]
[0202] Table 4: Efficacy results of CPP-enhanced in vivo delivery of Smn antisense oligonucleotides (retina)
[0203]
[0204] Table 5: Viability results of CPP-enhanced in vivo delivery of Smn antisense oligonucleotides (GFAP)
[0205]
[0206] References:
[0207] Verdurmen WPR, Thanos M, Ruttekolk IR, Gulbins E, Brock R. Cationic cell-penetrating peptides induce ceramide formation via acid sphingomyelinase: implications for uptake. J Control Release. 2010; 147: 171-179. doi: 10.1016 / j.jconrel.2010.06.030.
[0208] Zakeri,B.;Fierer,J.O.;Cellk,E.;Chittock,E.C.;Schwarz-Linek,U.;Moy,V.T.;Howarth,M.Peptide tag forming a rapid covalent bond to a protein,throughengineering a bacterial adhesin.Proc.Natl.Acad.Sci.USA 2012,109,E690-E697
[0209] Milech,N.;Longville,B.A.C.;Cunningham,P.T.;Scoble,M.N.:Bogdawa,H.M.;Winslow,S.;Anastasas,M.;Conner,T.;Ong,F.;Stone,S.R.;et al.GFP-complemenlationassay to detect functional CPP and protein delivery into livingcells.Sci.Rep.2015,5,18329.
[0210] Stone,S.R.et al.β-Lactamase tools for establishing callinternalization and cytosolic delivery of cell penetratingpeptides.Biomolecules8,51-62(2018).
[0211] Hollmann K,Milech N,Juraja SM,Cunningham PT,Stone SR,Francis RW,Anastasas M,Hall CM,Heinrich T.Bogdawa HM,Winslow S,Scobie MN,Dewhurst RE,Florez L,Ong F,Kerloot M,Champain D,Adams AM,Fletcher S,Viola HM,Hool LC,Conner T,Longville BAC,Tan YF,Kroeger K,Morath V,Weiss GA,Skerra A,HopkinsRM,Watt PM.A platform for discovery of functional cell-penetrating peptidesfor efficient multi-cargo intracellular delivery.Sci Rep.2018 Aug 22;8(1):12538.doi:10.1038 / s41598-018-30790-2.PMID:30135446;PMCID:PMC6105642.
[0212] Guidotti G,Brambilla L,Rossi D.Cell-penetrating peptides:from basicresearch to clinics.Trends Pharmacol Sci.2017;38:406-424.dei:10.1016 / j.tips.2017.01.003.
[0213] van den Berg A,Dowdy SF.Protein transduction domain delivery oftherapeutic macromolecules.Curr Opin Biotechnol.2011;22:888-893.doi:10.1016 / j.copbio.2011.03.008.
[0214] Erazo-Oliveras A,et al.Protein delivery into live cells by incubationwith an endosomolytic agent.Nat Methods.2014;11:861-867.doi:10.1038 / nmeth.2998.
[0215] Wu et al.Cell-penetrating peptides as transporters for morpholinooligomers:effects of amino acid composition on intracellular delivery andcytotoxicity,Nucleic Acids Research,2007,Vol.35,No.15:5182-5191 doi:10.1093 / nar / gkm478
[0216] Singh NN,Seo J,Rahn SJ,Singh RN(2012)A Multi-Exon-Skipping DetectionAssay Reveals Surprising Diversity of Splice lsoforms of Spinal MuscularAtrophy Genes.PLoS One 7(11):e49595. https: / / doi.org / 10.1371 / iournal.gone.0049595
[0217] Summerton,J.&Weller,D.,1997.Morpholino antisense oligomers:design,preparation,and properties.Antisense&nucleic acid drug development,7(3),pp.187-195
[0218] Moulton,H.M.et al.,2004.Cellular uptake of antisense morpholinooligomers conjugaied to arginine·rich peptides,Bioconjugate chemistry,15(2),pp.290-299.
[0219] Dommerholt,J.,Rutjes,FPJT&Delft,FL,2016.Strain-Promoted 1,3-Dipolar Cycloaddition of Cycloalkynes and Organic Azides.Topics in CurrentChemistry,374(2),pp.1-20.
[0220] Agard,NJ,Prescher,JA&Bertozzi,CR,2004.A strain-promoted[3+2]azide-alkyne cycloaddition for covalent modification of biomolecules in living systems.Journal of the American Chemical Society,126(46),pp.15046-15047
[0221] Roman C. Hillig, Brice Sautier, Jens Schroeder, Dieter Moosmayer, André Hilpmann, Christian M. Stegmann, Nicolas D. Werbeck, Hans Briem, Ulf Boemer, Joerg Weiske, Volker Badock, Julia Mastouri, Kirstin Petersen, Gerhard Siemeister, Jan D. Kahmann, Dennis Wegener, Niels Knut Eis, Keith Graham, Lars Wortmann, Franzyon Nussbaum, and Benjamin Bader
[0222] PNAS February 12,2019 116(7)2551-2560;first published January 25,2019 https: / / doi.org / 10.107G / onas.1812963116
[0223] Leshchiner ES,Parkhitko A,Bird GH,Luccarelli J,Bellairs JA,EscuderoS,Opoku-Nsiah K,Godes M,Perrimon N,Walensky LD.Direct inhibition of oncogenicKRAS by hydrocarbon-stapled SOS1 helices.Proc Natl Acad Sci US A.2015 Feb10:112(6):1761-6.doi:10.1073 / pnas.1413185112.Epub 2015 Jan 26.PMID:25624485:PMCID:PMC4330742.
[0224] Shanshan Gu,Danrui Cui,Xiaoyu Chen,Xiufang Xiong,and Yongchao Zhao,PROTACs:An Emerging Targeting Technique for Protein Degradation in DrugDiscovery,BioEssays.40(4),2018,https: / / doi.org / 10.1002 / bies.201700247
[0225] KMSakamoto,KBKim,A.Kumagai,F.Mercury,CMCrews,RJDeshaies,Proc.Natl.Acad.Sci.USA 2001,98,8554.
[0226] Renata MSTerra,Jorge A. Hugo Verli,Structural and functionalbehavior of biologically active monomeric melittin,(2007,)Journal ofMolecular Graphics and Modelling,25(6):767-772
[0227] Chandler,R.,Tarasenko,T.,Cusmano-Ozog,K.et al.Liver-directed adeno-associated virus serotype 8 gene transfer rescues a lethal murine model ofcitrullinemia type 1.Gene Ther 20,1188-1191(2013)doi:10.1038 / gt.2013.53
[0228] Stone,S.R.et al.β-Lactamase tools for establishing cellinternalization and cytosolic delivery of cell penetratingpeptides.Biomolecules8,51-62(2018).
[0229] Quinenez SC,Thoene JG.Citrullinemia Type 1.2004 Jul 7[Updated 2016Sap 1].In:Adam MP,Ardinger HH,Pagon RA,et al.,editors. [Internet].Seattle(WA):University of Washington,Seattle;1993-2019.Available from:https; / / www.ncbi.nlm.nih.gov / books / NBK1458 /
[0230] Flynn LL,Mltrpant C,Pltout IL,Fletcher S,Wilton SD.AntisenseOligonucleotide-Mediated Terminal Intron Retention of the SMN2 Transcript.MolTher Nucleic Acids.2018 Jun 1;11:91-102.doi:10.1016 / j.omtn.2018.01.011.Epub2018 Jan 31.PMID:29858094;PMCID:PMC5854547.
[0231] Betts,C.,Saleh,A.F.,Arzumanov,A.A.,Hammond,S.M.,Godirey,C.,Coursindel,T.,et al.(2012).Pip6-PMO,A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity forDMD Treatment.Molecular Therapy-Nucleic Acids,1,e38-13.http: / / doi.org / 10.1038 / mtna.2012.30
Claims
1. An isolated non-naturally occurring cell penetrating peptide, the amino acid sequence of which consists of: RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO: 1].
2. An isolated non-naturally occurring cell penetrating peptide, the amino acid sequence of which consists of: RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO: 1], wherein the amino acids in the cell penetrating peptide are all of the D-form.
3. Use of the cell penetrating peptide of claim 1 or 2 for directing an oligonucleotide across a cell membrane.
4. A pharmaceutical composition comprising the cell penetrating peptide of claim 1 or 2.
5. A kit comprising (i) the cell penetrating peptide of claim 1 or 2; and (ii) instructions for use.
Citation Information
Patent Citations
Positively charged non-natural amino acids, methods of making and using thereof in peptides
US6858396B2
Cell-penetrating peptides and uses therof
CN103096932A