Method and application for simultaneous acquisition of viral integrated transcript and detection of RNA modifications based on nanopore sequencing

Abstract

This invention discloses a detection method and application for simultaneously acquiring viral integrated transcripts and RNA modifications based on nanopore sequencing. The method includes: obtaining total RNA from a biological sample; separating and purifying the total RNA to obtain mRNA; ligating the mRNA to a reverse transcription adapter; ligating the reverse transcription adapter to a nanopore sequencing adapter; and using strand-specific sequencing, allowing a single-stranded library containing viral integrated mRNA to pass through a nanopore located on a chip without sequencing the complementary cDNA strand, simultaneously detecting viral integrated transcripts and RNA modification information. This method offers the advantages of long-fragment sequencing while simultaneously acquiring base modification information, achieving simple and accurate single-molecule level detection. Furthermore, this method avoids the biases inherent in reverse transcription and PCR, as well as the loss of RNA modification information during reverse transcription and amplification, preserving the natural properties of RNA and obtaining various base variations, structural variations, and modification information, thereby enabling the differentiation of highly similar isoforms and the identification of novel transcripts.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of nucleic acid detection, and in particular to a detection method for simultaneously obtaining viral integrated transcripts and RNA modifications based on nanopore sequencing and application. BACKGROUND

[0002] Cervical cancer is the most common malignant tumor in gynecology, which seriously threatens the health of women. The integration of human papillomavirus (HPV) DNA into the host genome is considered a key event in the development of cervical cancer. The integration level of HPV is closely related to malignant tumors and precancerous lesions of the reproductive tract epithelium. It takes several years or more from HPV infection to the development of cervical cancer. By checking HPV infection and HPV genome integration status, it is of great significance for the prevention and treatment of cervical cancer.

[0003] The existing HPV detection methods have certain defects, which are as follows:

[0004] 1. Cytological examination (Papanicolaou smear, thin-layer liquid-based cell), which is not sensitive enough, has high false negative rate, is not easy to popularize, and cannot determine the HPV genome integration status.

[0005] 2. Molecular detection (DNA): hybrid capture detection (HC-II), real-time fluorescent quantitative PCR technology (Cobas4800), gene chip method, etc., which have defects such as inability to determine specific HPV types or poor specificity, and inability to determine the HPV genome integration status.

[0006] 3. Detection of genomic insertion fragments based on second-generation NGS sequencing, which has great difficulty in gene fusion analysis, missed detection and misjudgment due to short read length and integration breakpoint located in repeated sequences. DNA level detection cannot determine whether the virus insertion gene still has transcriptional activity, and cannot obtain the expression and modification information of the virus insertion gene. SUMMARY

[0007] In view of the technical problems in the prior art, the inventors have conducted in-depth research and proposed a detection method for simultaneously obtaining viral integrated transcripts and RNA modifications based on nanopore sequencing. Specifically, the present application includes the following contents.

[0008] In a first aspect, the present application provides a detection method for simultaneously obtaining viral integrated transcripts and RNA modifications based on nanopore sequencing, which comprises the following steps:

[0009] (1) obtaining total RNA derived from a biological sample;

[0010] (2) subjecting the total RNA to separation and purification to obtain mRNA;

[0011] (3) linking the mRNA to a reverse transcription adaptor;

[0012] (4) linking the reverse transcription adaptor in step (3) to a nanopore sequencing adaptor; and

[0013] (5) passing the mRNA or a portion thereof through a nanopore located on a chip, wherein the chip is disposed in proximity to an electrode and the electrode is capable of detecting current passing through the nanopore.

[0014] In certain embodiments, the method according to the present application, wherein after linking the reverse transcription adaptor, reverse transcription and reverse transcription product purification are performed, wherein first strand cDNA is synthesized using reverse transcription reagents.

[0015] In certain embodiments, the method according to the present application, wherein further comprising: determining viral integration status and RNA modification information by analysis, wherein the virus is human papillomavirus.

[0016] In certain embodiments, the method according to the present application, wherein the reverse transcription adaptor sequence is set forth in SEQ ID No.: 1-2. In certain embodiments, the reverse transcription adaptor is an ONT platform reverse transcription RTA adaptor. Preferably, the reverse transcription adaptor sequence comprises:

[0017] Oligo A: 5'- / 5PHOS / GGCTTCTCTTTGCTTAGGTAGTAGGTTC (SEQ ID No. 1);

[0018] Oligo A': 5'-GAGGCGAGCGGTCAATTCCTAAGAGCAAGAAGCC (TTTTTTTTTT) (SEQ ID No. 2).

[0019] In certain embodiments, the method according to the present application, wherein the nanopore sequencing adaptor sequence is set forth in SEQ ID No.: 3-4. In certain embodiments, the nanopore sequencing adaptor is an ONT platform RNA direct sequencing RMX adaptor. Preferably, the nanopore sequencing adaptor comprises: Oligo B: 5'-TGATGATGAGGGATAGACGATGGTTGTTTCTGTTGGTGCTGATATTGCTTTTTTTTTTTTTATGATGCAAGATACGCAC-3' (SEQ ID No. 3);

[0020] Oligo B': 5'-GAGGCGAGCGGTCAATTTGCAATATCAGCACCAACAGAAACAACCATCGTCTATCCCTCATCATCAGAACCTACTA-3' (SEQ ID No. 4).

[0021] In some embodiments, according to the method of the present invention, the reaction procedure for connector connection is: reaction at 20-25°C for 5-30 minutes.

[0022] A second aspect of the present invention provides a system for detecting viral infection, comprising:

[0023] A data acquisition unit configured to acquire at least base modification data from RNA of a biological sample;

[0024] A data processing unit, configured to analyze the base modification data to predict viral gene insertion sites, and to determine viral infection or its status based on the prediction results; and

[0025] The data output unit is configured to output the results of the virus infection status.

[0026] In some embodiments, in the system for detecting viral infection according to the present invention, the biological sample is tissue or body fluid collected from a subject, or cells cultured in vitro.

[0027] In some embodiments, the system for detecting viral infection according to the present invention further includes a nanopore sequencer, wherein the data acquisition unit acquires at least base modification data in RNA from a biological sample by retrieving sequencing results from the nanopore sequencer.

[0028] In some embodiments, in the system for detecting viral infection according to the present invention, the data processing unit is capable of further retrieving sequence information near the base modification, comparing it with a reference genome, and determining or confirming the viral gene insertion site based on the comparison results;

[0029] Specifically, when a base modification exists in the sequence, a specified sequence containing the modified base within the range of 1-1000 bp, preferably within the range of 1-500 bp, and even more preferably within the range of 1-100 bp, is compared with a reference genome. If the specified sequence is substantially consistent with the corresponding sequence of the reference genome, it is determined that there is no viral infection or viral integration in the biological sample. If, compared with the corresponding sequence of the reference genome, the specified sequence contains redundant sequences or multiple redundant consecutive bases, it is determined that the virus in the biological sample is in an integrated state.

[0030] The method of this invention leverages the advantages of nanopore sequencing, which offers long-fragment sequencing capabilities with read lengths reaching the megabyte (mb) level. It enables end-to-end sequencing of single-molecule reads from DNA or RNA, simultaneously acquiring base modification information, thus achieving simple and accurate single-molecule level detection. The real-time sequencing and analysis capabilities significantly shorten experimental and data analysis time. Furthermore, the nanopore RNA direct sequencing method avoids the biases inherent in reverse transcription and PCR, preserves the natural properties of RNA, and obtains diverse base modification information; it can distinguish highly similar isoforms and identify novel transcripts.

[0031] The method of this invention reveals differences in base modifications near viral integration sites, and these base modifications can help predict and discover viral integration sites in the genome. Attached Figure Description

[0032] Figure 1 This is a flowchart illustrating an exemplary detection method of the present invention.

[0033] Figure 2 The detection process of the present invention is illustrated for example, wherein reverse transcription is optionally performed.

[0034] Figure 3 This is a schematic diagram illustrating an example of an HPV insertion site.

[0035] Figures 4-5 The results are a comparative analysis of the raw electrical signals from nanopore sequencing. Detailed Implementation

[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0037] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0038] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0039] This invention provides a detection method based on nanopore sequencing technology to simultaneously obtain viral integrated transcripts and RNA modifications, comprising the following steps:

[0040] (1) Obtain total RNA from biological samples;

[0041] (2) The total RNA is separated and purified to obtain mRNA;

[0042] (3) Connect the mRNA to the reverse transcription adapter;

[0043] (4) Connect the reverse transcription adapter from step (3) to the nanopore sequencing adapter; and

[0044] (5) Passing the mRNA or a portion thereof through a nanopore located on a chip, wherein the chip is disposed near an electrode and the electrode is capable of detecting the current passing through the nanopore.

[0045] The steps are explained in detail below.

[0046] Obtaining total RNA from a biological sample

[0047] In step (1) of this invention, total RNA can be extracted using known methods, which are known in the art. Extraction methods can be found in known textbooks, such as Cold Spring Harbor's *Molecular Cloning: A Laboratory Manual*, fourth edition, and other published materials. The total RNA of this invention does not need to be fragmented; therefore, its fragment length is generally controlled to be greater than 1K, for example, 1K-3K, preferably 1.5K-3K, and even more preferably 2K-3K. If its length is too short, the reliability of the sequencing results deteriorates, and it may even be impossible to detect. On the other hand, if the length is too long, although detection is still possible through sequencing, the cost increases and there is no impact on the accuracy of the detection results. Therefore, the total RNA length of this invention is generally controlled to be 1K-3K. Of course, a length greater than 3K is also feasible for the purposes of this invention.

[0048] In the present invention, the biological sample is not limited. Generally speaking, its examples include but are not limited to tissue samples or fluid samples. Tissue samples include somatic cell samples, such as diseased tissues like cancer tissues or normal tissues. Fluid samples include blood or its components such as plasma, serum, etc. The biological sample can be a sample from any mammalian source or a sample from a human.

[0049] In certain embodiments, the OD260 / 280 value of the extracted RNA is 1.7 < OD260 / 280 < 2.2, the RQN value ≥ 8.0, the concentration ≥ 250 ng / μl, and the total amount ≥ 13 μg.

[0050] mRNA isolation and purification

[0051] Step (2) of the present invention is to subject the total RNA to isolation and purification to obtain mRNA. The purification method is not particularly limited, but it is preferably carried out using mRNA capture magnetic beads. Preferably, the total amount of the purified mRNA is 50 - 500 ng.

[0052] Ligation of reverse transcription adapters

[0053] In step (3) of the present invention, the purified mRNA is ligated to a reverse transcription adapter. The reverse transcription adapter has a polyT sequence at the 5'-end. The number of T bases is not particularly limited and can be 5 - 15, such as 6, 7, 8, 9, 10 bases, so as to be complementary paired with the polyA tail from the mRNA. Here, "complementary" can refer to the sequence-specific binding of two nucleic acid sequences through hydrogen bonds, and their purine and / or pyrimidine bases form a double-stranded nucleic acid complex according to the Watson-Crick rule, or it can also refer to a nucleic acid sequence and a modified nucleic acid sequence forming a nucleic acid double-strand with another sequence according to the Watson-Crick rule.

[0054] The present invention thus also provides a ligation system for mRNA and a reverse transcription adapter, which comprises a ligation buffer, an RT Adapter, and T4 DNA ligase. Preferably, the reverse transcription adapter has the sequence shown in SEQ ID No: 1. The reaction procedure for the above ligation is: reacting at 20 - 25°C for 5 - 30 minutes, and more preferably reacting at 21 - 23°C for 8 - 15 minutes.

[0055] In this invention, reverse transcription is not essential to the method. To avoid bias in reverse transcription and PCR amplification, preserve the mutation and modification properties of the integrated RNA molecule, and obtain information on variations and multiple base modifications in the integrated RNA transcript, reverse transcription is preferably omitted. In some embodiments, reverse transcription is performed only on one strand of cDNA to ligate sequencing adapters, ensuring that the strand used for nanopore sequencing is the original RNA strand, not the cDNA strand. This allows for analysis of the relationship between HPV insertion site-specific base mutations or their resulting differential base modifications and cellular carcinogenesis status during subsequent data analysis.

[0056] Therefore, another aspect of the present invention provides a reverse transcription system comprising nuclease-free water, 10 mM dNTPs, 5x first-strand buffer, 0.1 DTT, and reverse transcriptase. The reaction procedure for the above reverse transcription is as follows: reaction at 45-60°C for 30-60 minutes, reaction at 65-75°C for 8-15 minutes, and incubation at 4°C. It is understood that after reverse transcription, a further purification step of the product is included.

[0057] Nanopore sequencing adapter ligation

[0058] Step (4) of this invention is a nanopore sequencing adapter ligation step. Preferably, the nanopore sequencing adapter has the sequence shown in SEQ ID No:2. This invention further provides a sequencing adapter ligation system comprising a ligation reaction buffer, RNA adaptor, nuclease-free water, and T4 DNase. The reaction procedure for the above ligation is: reaction at 20-25℃ for 5-30 minutes, more preferably at 21-23℃ for 8-15 minutes. It is understood that after nanopore sequencing adapter ligation, a library purification step is further included. Preferably, RNA Clean Beads are used for library purification.

[0059] Sequencing steps

[0060] Step (5) of the present invention is to allow the mRNA or a portion thereof to pass through a nanopore located on a chip, wherein the chip is disposed near an electrode and the electrode is capable of detecting the current passing through the nanopore. In a specific embodiment, when the target sequence or a portion thereof passes through a nanoscale channel, the differences in the chemical properties of the different bases A, T, G, and C will cause corresponding changes in the electrochemical parameters of the nanopore. Detecting these changes can convert the original RNA nucleic acid sequence. Such a nanopore sequencing platform can be exemplified by the MinION sequencing platform of Oxford Nanopore Technologies (ONT).

[0061] Example

[0062] This embodiment is used to exemplarily illustrate the method of the present invention, Figure 1 which is a detection flow chart.

[0063] I. Sample Information

[0064] Select a cultured HPV-infected cell line, collect and resuspend it in RNASafer TM Reagent (R4811-03), and store it at 4°C for short-term.

[0065] II. Experimental Steps

[0066] 1. Total RNA Extraction

[0067] After centrifuging to enrich the cells, use MagPure FFPE RNA LQ Kit (R6625-02) and refer to the steps of "Manual Operation of RNA from Paraffin-Embedded Tissues" to extract total RNA (without the dewaxing step). The extracted total RNA is quantified using Nanodrop 2000 and RNA HS Assay Kit and Qubit 3.0 Fluorometer. The Qubit concentration is 288 ng / ul, OD260 / 280 = 2.019. Use Qsep1 (Bioptic) for quality inspection, and the RQN value is 8.58. RNA quality requirements: 1.7 < OD260 / 280 < 2.2, RQN value ≥ 8.0, concentration ≥ 250 ng / ul, total amount ≥ 13 ug.

[0068] 2. mRNA Isolation and Purification

[0069] Take 12.5 ug of the extracted total RNA and use VAHTS mRNA Capture Beads (N401-01) for mRNA isolation and purification. The obtained mRNA is quantified using RNA HS Assay Kit and Qubit 3.0 Fluorometer. The Qubit concentration is 21.8 ng / ul, and the total amount is 305 ng. Use Agilent 2100 Bioanalyzer for quality inspection.

[0070] 3. Sequencing Library Construction

[0071] The library construction adopts the Direct RNA Sequencing Kit (SQK-RNA002, Oxford Nanopore Technologies) kit and experimental process.

[0072] 3.1 Ligate RT Adapter

[0073] Prepare the reaction mixture in a 0.2 ml PCR tube without nuclease, as shown in Table 1 below:

[0074] Reagents Volume NEBNext Quick Ligation Reaction Buffer 3.0ul mRNA 9.5ul RT Adapter (RTA) 1.0ul T4 DNA Ligase 1.5ul Total volume 15ul

[0075] Mix by pipetting and centrifugation, then incubate at 22°C (PCR instrument setting, hot cap off) for 10 minutes.

[0076] 3.2 Reverse transcription

[0077] This step only performs reverse transcription of the first-stranded cDNA to ligate sequencing adapters. The actual strand used in nanopore sequencing is the raw RNA strand, not the cDNA strand. (See...) Figure 4 Prepare the reverse transcription mixture, as detailed in Table 2 below:

[0078]

[0079]

[0080] Add the reverse transcription mixture to a 0.2 ml PCR tube containing the product from step 3.1, mix by pipetting and centrifugation, then add 2 μl of SuperScript III Reverse Transcriptase, mix by pipetting and centrifugation, and then run the reaction program (see Table 3 below).

[0081]

[0082] 3.3 Purification of reverse transcription products:

[0083] 3.3.1 Transfer all the reverse transcription reaction products from the previous step to a new 1.5 ml nuclease-free centrifuge tube.

[0084] 3.3.2 Add 72ul (1.8 times the volume) of RNA Clean Beads (equilibrated to room temperature beforehand), mix by pipetting and aspiration, and then centrifuge briefly.

[0085] 3.3.3 Let stand at room temperature for 5 minutes.

[0086] 3.3.4 Place the centrifuge tubes on the magnetic rack, wait for the magnetic beads to gather, and discard the supernatant after it has clarified.

[0087] 3.3.5 Prepare 200 μL of fresh 70% ethanol. Take 150 μL and add it to a centrifuge tube containing discarded supernatant. Keep the centrifuge tube on the magnetic rack and rotate it 180°. Wait for the magnetic beads to re-adhere to the magnetic rack and gather. Rotate the centrifuge tube 180° again and wait for the magnetic beads to re-adhere to the magnetic rack and gather (return to their original position).

[0088] 3.3.6 Discard 70% ethanol, remove the centrifuge tube, centrifuge, and then place it back on the magnetic rack to remove any remaining liquid.

[0089] 3.3.7 Dry the magnetic beads and resuspend them in 21 μL of nuclease-free water.

[0090] 3.3.8 Let stand at room temperature for 5 minutes.

[0091] 3.3.9 Place the centrifuge tube on a magnetic rack and wait for the magnetic beads to accumulate. After the supernatant becomes clear, transfer 20 μL to a new 0.2 ml PCR tube without nuclease.

[0092] 3.4 Connecting the sequencing adapter

[0093] Add reagents to the PCR tube containing the purified product from step 3.3.9 to prepare the reaction system, as detailed in the table below:

[0094]

[0095]

[0096] Mix by pipetting and centrifugation, then incubate at 22°C (PCR instrument setting, hot cap off) for 10 minutes.

[0097] 3.5 Library Purification

[0098] 3.5.1 Transfer all the reverse transcription reaction products from the previous step to a new 1.5 ml nuclease-free centrifuge tube.

[0099] 3.5.2 Add 40ul (1.0 volume) of RNA Clean Beads (equilibrated to room temperature beforehand), mix by pipetting and aspiration, and then centrifuge briefly.

[0100] 3.5.3 Let stand at room temperature for 5 minutes.

[0101] 3.5.4 Place the centrifuge tubes on the magnetic rack, wait for the magnetic beads to gather, and discard the supernatant after it has clarified.

[0102] 3.5.5 Add 150 μL of Wash Buffer to a centrifuge tube containing discarded supernatant. Remove the centrifuge tube, gently tap to resuspend the magnetic bead, centrifuge briefly, and place it on a magnetic rack. Wait for the magnetic bead to re-attract to the rack and gather. Discard the supernatant after it has clarified.

[0103] 3.3.6 Repeat the previous step once.

[0104] 3.5.7 After centrifuging, remove the centrifuge tube and place it back on the magnetic rack to remove any remaining liquid.

[0105] 3.5.8 Dry the magnetic beads and add 18ul of Elution Buffer to resuspend them.

[0106] 3.5.9 Let stand at room temperature for 5 minutes.

[0107] 3.5.10 Place the centrifuge tube on a magnetic rack and wait for the magnetic beads to accumulate. After the supernatant becomes clear, transfer 17 μL to a new 1.5 ml PCR tube without nuclease.

[0108] 3.3.11 Extract a 1ul library and use... Quantification was performed using the dsDNA HS Assay Kit and a Qubit 3.0 Fluorometer, with a Qubit concentration of 2.24 ng / ul.

[0109] 4. Sequencing

[0110] 4.1 Preparation of reagents and chips for instrumentation

[0111] Thaw RNA Running Buffer (RRB), FB, and FLT at room temperature, mix well, and place on ice for later use. Equilibrate Flongle Flow Cell (FLO-FLG001) at room temperature.

[0112] 4.2 Prepare Flow Cell Priming Mix: Add 117ul FB and 3ul FLT to a 1.5ml centrifuge tube, for a total of 120ul, and mix by pipetting.

[0113] 4.3 Preparing the library for use: Add 15ul of RRB and 20ng of library to a 1.5ml centrifuge tube, and make up the total volume to 30ul with nuclease-free water. Mix well by pipetting.

[0114] 4.3 MinION sequencer preparation: Connect the MinION sequencer to the computer and open the MinKNOW software.

[0115] 4.4 Flow Cell Check: Install the prepared Flongle Flow Cell onto the MinION sequencer using the adapter, run the Flow Cell Check program in the MinKNOW software, and if the check is successful (i.e., the number of effective active wells is ≥50), it can be used for sequencing.

[0116] 4.5 Library Sequencing: Unseal the Flongle Flow Cell, add 120µl of Flow Cell PrimingMix to the sample port, then add 30µl of the library, and reseal the membrane. In the MinKNOW software, enter the experimental information and set the running parameters as prompted: Experiment Name, Sample ID, Flow Cell Id, Run Length (24h), Basecall Model (Fast), data storage location, etc. Finally, verify the settings and start sequencing.

[0117] III. Data Analysis

[0118] 1. Data quality control, see the table below.

[0119] Reads Generated 48.98K Passed Bases 31.69 Mb Failed Bases 8.44 Mb Estimated Bases 45.07 Mb Read Filtering min_qscore = 7 Run Length 1 d 0 h 5 m Estimated N50 1.07K

[0120] 2. Data Analysis

[0121] 2.1 HPV Analysis Information

[0122] The test results only show transcripts with HPV integration as an example. Sequence alignment analysis with the viral genome database and the human genome (hg19) database identified the HPV type as high-risk HPV18. Using nanopore long-fragment sequencing (greater than 1kb), the integration breakpoint between the virus and the human-derived sequence can be accurately identified. Breakpoints in the integrated transcripts are shown in the table below, and an example diagram of HPV insertion sites is shown below. Figure 5 .

[0123]

[0124]

[0125] 2.2 RNA direct-reading base modification analysis

[0126] Comparative analysis of the raw electrical signals from nanopore sequencing revealed significant changes in the peak electrical signals of the fused sequence fragment and its corresponding non-fused gene fragment within the same sequence portion excluding the inserted sequence (see [link to original text]). Figure 4 Especially in the region near the viral insertion breakpoint, a magnified view of a 1-100 bp area reveals more pronounced differences in multiple base modifications (see...). Figure 5 These changes are caused by specific base modifications, including but not limited to methylation and acetylation. Analysis revealed significant differences in base modifications in corresponding regions between RNA transcripts with and without viral integration. Therefore, these modifications, along with viral insertion variations, can serve as biomarkers for disease detection.

[0127] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This application specification and embodiments are merely exemplary.

Claims

1. A detection system for simultaneously acquiring HPV viral integrated transcripts and RNA modifications based on nanopore sequencing, characterized in that, include: Nanopore sequencer; The data acquisition unit is configured to acquire at least base modification data of RNA from a biological sample by retrieving the sequencing results from the nanopore sequencer, the sequencing results being derived from the following steps: (1) obtaining total RNA from the biological sample; (2) purifying the total RNA to obtain mRNA; (3) ligating the mRNA to a reverse transcription adapter, performing reverse transcription and purification of the reverse transcription product after ligating the reverse transcription adapter, wherein a first-strand cDNA is synthesized using a reverse transcription reagent, the reverse transcription adapter sequence including Oligo A: 5'- / 5PHOS / GGCTTCTCTTTGCTTAGGTAGTAGGTTC and Oligo A': 5'-GAGGCGAGCGGTCAATTCCTAAGAGCAAGAAGCCTTTTTTTTTT; (4) ligating the reverse transcription adapter from step (3) to a nanopore sequencing adapter, the nanopore sequencing adapter sequence including: Oligo B: 5'-TGATGATGAGGGATAGACGATGGTTGTTTCTGTTGGTGCTGATATTGCTTTTTTTTTTTTTTTATGATGCAAGATACGCAC-3' and Oligo B': 5'-GAGGCGAGCGGTCAATTTGCAATATCAGCACCAACAGAAACAACCATCGTCTATCCCTCATCATCAGAACCTACTA-3'; (5) Pass the mRNA or a portion thereof through a nanopore located on a chip, wherein the chip is positioned near an electrode and the electrode is capable of detecting the current passing through the nanopore, and the sequence fragment sequenced using the nanopore long fragment sequencing is greater than 1kb; A data processing unit is configured to analyze the base modification data to predict viral gene insertion candidate sites and determine viral infection or its status based on the prediction results. The virus is human papillomavirus (HPV). The data processing unit can further retrieve sequence information near the base modification and compare it with a reference genome. Based on the comparison results, it determines or confirms the viral gene insertion site. Specifically, when a base modification is present in the sequence, a specified sequence within the 1-100 bp range containing the base modification is compared with the reference genome. If the specified sequence is substantially identical to the corresponding sequence in the reference genome, it is determined that there is no viral infection or viral integration in the biological sample. If, compared with the corresponding sequence in the reference genome, the specified sequence contains redundant sequences or multiple redundant consecutive bases, it is determined that the virus in the biological sample is in an integrated state. The data output unit is configured to output the results of the virus infection status.

2. The system according to claim 1, characterized in that, The biological sample is tissue or body fluid collected from the subject, or cells cultured in vitro.

3. The system according to claim 1, characterized in that, The reaction procedure for joint connection is: react at 20-25℃ for 5-30 minutes.

Images