Application of porcine STARD7 gene in regulating porcine skeletal muscle development

Abstract

The present invention discloses an application of the STARD7 gene in regulating the development of pig skeletal muscle and thus improving the quality of pork. The present invention studies the regulatory role of the STARD7 gene on the type of pig skeletal muscle fibers. By modifying the STARD7 gene with m6A, the expression of the STARD7 gene in pig skeletal muscle satellite cells is promoted, which can promote the differentiation of pig skeletal muscle satellite cells into oxidative muscle fibers, significantly increase the content of oxidative muscle fibers in pork, and make pork have better quality. The results of the present invention are reliable and highly reproducible, providing new ideas for improving pig meat production performance, laying the foundation for further research on the mechanism of pig skeletal muscle development in the future, and providing a theoretical basis for improving the meat production traits of livestock products and improving the economic benefits of the livestock industry.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to the application of the STARD7 gene in regulating the development of pig skeletal muscle. Background Art

[0002] With improved living standards and changing consumer attitudes, pork with excellent color, aroma, and flavor, as well as safety and nutrition, is increasingly favored by consumers. Therefore, improving pork quality has become a key goal in current high-quality pig breeding. Pork quality is a comprehensive trait, often measured through indicators such as muscle pH, intramuscular fat content, marbling, water holding capacity, shear force, drip loss, meat color, tenderness, and myofiber diameter. Muscle fibers are the basic building blocks of porcine skeletal muscle and can be divided into oxidative and glycolytic types. Different muscle fiber types directly affect pork quality, influencing key meat quality indicators such as tenderness, color, and intramuscular fat. Muscles with a higher content of oxidative myofiber generally have better quality, so increasing the content of oxidative myofiber in porcine muscle can improve pork quality.

[0003] Genetic engineering has demonstrated significant advantages in improving animal morphology. Reports have shown that genetic engineering can be used to promote the growth of myofibers in pig muscle and increase their myofiber content. For example, Wu Zhenfang et al.'s Chinese patent, "Methods and Applications for Regulating Skeletal Muscle Development," overexpresses the RASGRP1 gene through genetic engineering to promote the differentiation of pig skeletal muscle satellite cells into myocytes, thereby increasing the number of myofibers in the muscle. However, this technology cannot precisely regulate myofiber types. Summary of the Invention

[0004] In view of the deficiencies of the existing technology, the present invention aims to provide an application of the STARD7 gene in regulating the development of pig skeletal muscle, thereby increasing the content of oxidative muscle fibers in pig skeletal muscle and improving pork quality.

[0005] The primary purpose of the present invention is to provide an application of the STARD7 gene in regulating the development of pig skeletal muscle, or in preparing a preparation capable of regulating the development of pig skeletal muscle.

[0006] Another object of the present invention is to provide an agent for promoting or activating STARD7 gene expression for use in regulating pig skeletal muscle development, or for use in preparing a preparation capable of regulating pig skeletal muscle development.

[0007] Another object of the present invention is to provide the use of the STARD7 gene in promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, or in preparing a preparation capable of promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers.

[0008] Another object of the present invention is to provide an agent for promoting or activating STARD7 gene expression for use in promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, or for use in preparing a preparation capable of promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers.

[0009] Another object of the present invention is to provide a method for regulating the development of pig skeletal muscle.

[0010] Another object of the present invention is to provide a method for promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers.

[0011] The present invention achieves the above-mentioned purpose through the following technical means:

[0012] The present invention uses real-time fluorescence quantitative PCR to study the differential expression of the STARD7 gene in the soleus muscle (SOL), which mainly contains oxidative muscle fibers, and the extensor digitorum longus (EDL), which mainly contains glycolytic muscle fibers. The MeRIP-qPCR technology is used to study the presence of differential m6A methylation modifications of the STARD7 gene in the two tissues of SOL and EDL. Further experiments have shown that m6A modification can promote the expression of the STARD7 gene. At the same time, it was verified in porcine skeletal muscle satellite cells that interfering with the expression of the STARD7 gene inhibits the oxidative phosphorylation process of myoblasts, reduces the expression of genes related to oxidative muscle fibers, and promotes the expression of genes related to glycolytic muscle fibers. Thus, the conversion of porcine skeletal muscle fibers to oxidative muscle fibers can be promoted by enhancing the expression of the STARD7 gene, thereby improving the quality of pork.

[0013] Therefore, the present invention provides the following applications and solutions:

[0014] The present invention provides the use of the STARD7 gene in regulating the development of pig skeletal muscle, or in preparing a preparation capable of regulating the development of pig skeletal muscle.

[0015] The present invention also provides the use of a reagent for promoting or activating STARD7 gene expression in regulating pig skeletal muscle development, or in preparing a preparation capable of regulating pig skeletal muscle development.

[0016] Preferably, the regulating pig skeletal muscle development is to increase the proportion or content of oxidative muscle fibers in pig muscles.

[0017] Preferably, the reagent that promotes or activates STARD7 gene expression is an m6A modification reagent.

[0018] Preferably, the STARD7 gene increases the content of oxidative myofibers in pig muscle by promoting the differentiation of pig skeletal muscle satellite cells into oxidative myofibers.

[0019] Therefore, the present invention also provides the use of the STARD7 gene in promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, or in preparing a preparation capable of promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers.

[0020] The present invention also provides the use of an agent that promotes or activates STARD7 gene expression in promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, or in preparing a preparation that can promote the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers.

[0021] The present invention also provides a method for regulating pig skeletal muscle development, which regulates pig skeletal muscle development by promoting or activating STARD7 gene expression.

[0022] And a method for promoting the differentiation of pig skeletal muscle satellite cells into oxidative muscle fibers, which regulates pig skeletal muscle development by promoting or activating STARD7 gene expression.

[0023] Preferably, the method increases the expression of the STARD7 gene by increasing the m6A modification level of the STARD7 gene.

[0024] The present invention has the following beneficial effects:

[0025] The present invention provides a new application of the STARD7 gene in regulating the conversion of pig skeletal muscle fiber types, clarifies the positive regulatory effect of m6A modification on the STARD7 gene, and that STARD7 plays an important role in the conversion of pig skeletal muscle fiber types. By promoting the expression of the STARD7 gene in pig skeletal muscle satellite cells, the increase in the expression level of the STARD7 gene promotes the differentiation of pig skeletal muscle satellite cells into oxidative muscle fibers, significantly increases the content of oxidative muscle fibers in pork, and makes pork have better quality.

[0026] This study demonstrates that m6A methylation can enhance STARD7 gene expression, inhibit oxidative phosphorylation in porcine myoblasts, and induce the conversion of porcine skeletal muscle fibers to glycolytic fibers. The results are reliable and reproducible, laying the foundation for further research into the mechanisms of porcine skeletal muscle development and providing new insights into improving pig meat production.

[0027] The present invention clarifies the regulatory role of the STARD7 gene in the type of pig skeletal muscle fibers, which not only provides new ideas for further research on the mechanism of pig skeletal muscle fiber development, but also provides a theoretical basis for improving the meat production traits of livestock products and enhancing the economic benefits of the livestock industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1These are the results of the RT-qPCR study in Example 1 on the difference in expression levels of the STARD7 gene in the pig soleus muscle (SOL) and extensor digitorum longus (EDL) muscle.

[0029] Figure 2 These are the results of MeRIP-qPCR detection of the m6A modification levels of the STARD7 gene in pig soleus muscle (SOL) and extensor digitorum longus (EDL) in Example 2.

[0030] Figure 3 Figure 3 shows the experimental results of detecting the effects of different m6A modification levels on STARD7 gene expression. Figure A shows the experimental structure of the cycloleucine treatment group (low m6A modification level); Figure B shows the experimental results of the betaine treatment group (high m6A modification level).

[0031] Figure 4 This is the effect of inhibiting STARD7 gene expression in Example 6 on the expression of enzymes related to oxidative phosphorylation.

[0032] Figure 5 This is the effect of inhibiting STARD7 gene expression on the expression of oxidative muscle fiber marker genes and glycolytic muscle fiber marker genes detected at the RNA level in Example 7.

[0033] Figure 6 The results of Example 7 show the effect of inhibiting STARD7 gene expression on the expression of oxidative muscle fiber marker genes and glycolytic muscle fiber marker genes at the protein level; Figure A shows the experimental results of protein expression detected by Western blotting; Figure B shows the experimental results of grayscale quantification using ImageJ software. DETAILED DESCRIPTION

[0034] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0035] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0036] Example 1 RT-PCR study of differential expression of gene STARD7

[0037] 1. Experimental Methods

[0038] 1. RNA was extracted from the pig soleus (SOL) and extensor digitorum longus (EDL) muscle tissues respectively.

[0039] Porcine soleus or extensor digitorum longus muscle tissue was obtained from six-month-old Duroc pigs.

[0040] RNA was extracted using Trizol reagent (Invitrogen (Shanghai) Trading Co., Ltd.). The specific steps are as follows:

[0041] (1) Before the experiment begins, place the mortar, grinding rod, tweezers, and medicine spoon in a sterilizer to dry for 2 hours. Confirm that the gun tips and EP tubes used in the experiment are RNase-free.

[0042] (2) In the presence of liquid nitrogen, pig soleus muscle or extensor digitorum longus muscle tissue was placed in a mortar and ground into powder using a grinding rod.

[0043] (3) Take no more than 0.2 g of ground tissue, add 1 mL of Trizol reagent, shake thoroughly to mix, and place on ice for 30 min to lyse.

[0044] (4) Add 200 μL of chloroform to every 1 mL of Trizol reagent, shake vigorously to mix, let it stand for 2 minutes, and then centrifuge at 12,000 rpm for 10 minutes at 4°C.

[0045] (5) At this time, the liquid is separated into layers. Carefully pipette the upper aqueous phase into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol (i.e., 500 μL), gently invert upside down to mix, let it stand for 10 minutes, and then centrifuge at 4°C, 12,000 rpm for 10 minutes.

[0046] (6) Observe the precipitate and carefully discard the supernatant.

[0047] (7) Add 1 mL of 75% ethanol to wash the precipitate, shake gently to suspend the precipitate, and centrifuge at 7500 rpm at 4°C for 5 min.

[0048] (8) Discard the supernatant and air-dry at room temperature. The resulting precipitate is the RNA from the pig soleus or extensor digitorum longus muscle tissue.

[0049] (9) Add 20 μL of DEPC water to dissolve the RNA, place on ice for 5 minutes, and mix thoroughly.

[0050] (10) Determination of RNA concentration by UV spectrophotometry: The concentration of the extracted RNA was determined using a NanoDrop 2000 DNA / RNA concentration meter.

[0051] 2. Preparation of cDNA

[0052] cDNA was synthesized from the RNA extracted from the porcine soleus muscle (SOL) or extensor digitorum longus (EDL) muscle tissue using the Evo M-MLV Reverse Transcription Kit II from Eric Biotech. The specific steps are as follows:

[0053] (1) Removal of genomic DNA

[0054] Prepare the reaction solution according to Table 1, remove genomic DNA from the extracted RNA, and react at 42°C for 2 minutes.

[0055] Table 1 Genomic DNA removal system

[0056]

[0057] (2) Reverse transcription reaction

[0058] Prepare RNA template solution according to Table 2, place in PCR instrument for denaturation and annealing reaction to obtain reverse transcribed DNA (cDNA).

[0059] Table 2 Reverse transcription system

[0060]

[0061]

[0062] The PCR reaction program was: 37°C, 15 min; 85°C, 5 sec; 4°C, 5 min.

[0063] 3. RT-PCR

[0064] The cDNA synthesized above was subjected to fluorescent quantitative PCR. The fluorescent quantitative PCR was performed using a Thermo Fisher Quanstudio 5 fluorescent quantitative PCR instrument. The reaction system volume was 10 μL. The specific reaction system is shown in Table 3.

[0065] Table 3 PCR reaction system

[0066]

[0067] Among them: the sequence of the STARD7 gene forward primer F (i.e. STARD7-F) is:

[0068] AGGAGGAGTTGCAGAGATCCA

[0069] The sequence of the STARD7 gene reverse primer R (i.e., STARD7-R) is:

[0070] ATCACCATCTCCCATGGTTGC

[0071] The PCR reaction program is shown in Table 4:

[0072] Table 4 PCR reaction procedure

[0073]

[0074] 2. Experimental Results

[0075] Using QuantStudio TM Real-Time PCR Software was used to obtain the Ct value of each well in the instrument sample well. The expression of the STARD7 gene was detected using the 2-△△Ct method, β-actin was used as the internal reference gene, and the STARD7 gene specific primers were used to calculate the 2-△△Ct and standard error of the soleus muscle (SOL) and extensor digitorum longus (EDL) muscle samples. The differences in STARD7 gene expression between the soleus muscle (SOL) and extensor digitorum longus (EDL) muscle samples were compared. The experimental results are shown in Figure 2. Figure 1 As shown in the results, there is a significant difference in the expression of the STARD7 gene between the soleus muscle (SOL), which mainly contains oxidative myofibers, and the extensor digitorum longus (EDL), which mainly contains glycolytic myofibers. Furthermore, the expression of the STARD7 gene in the soleus muscle (SOL), which mainly contains oxidative myofibers, is higher than that in the extensor digitorum longus (EDL), which mainly contains glycolytic myofibers. This suggests that the STARD7 gene plays a regulatory role in the conversion of porcine skeletal muscle fiber types.

[0076] Example 2 MeRIP-qPCR Verification of Differentially Expressed Gene STARD7

[0077] 1. Experimental Methods

[0078] 1. MeRIP experiment

[0079] Appropriate amounts of fresh porcine soleus muscle (SOL) and extensor digitorum longus (EDL) tissue samples were collected and placed in 2 mL cryovials, stored in dry ice, and sent to Lianchuan Biological Company for MeRIP experiments.

[0080] 2. RT-qPCR Validation and Analysis

[0081] (1) The cDNA obtained from the MeRIP experiment was used for RT-qPCR experiment using a Thermo Fisher Quanstudio5 fluorescence quantitative PCR instrument. The reaction volume was 10 μL (as shown in Table 5):

[0082] Table 5 PCR reaction system

[0083]

[0084] The PCR reaction program is shown in Table 6:

[0085] Table 6 PCR reaction program

[0086]

[0087] 2. Experimental Results

[0088] Calculation is performed using the △△Ct value method, the formula is: △Ct=Ct IP -(Ct input -Log2[Input DilutionFactor]), where Ct is the sample cycle number; IP is the RNA enriched by the STARD7-specific antibody in the MeRIP experiment; and input is the total RNA used in the MeRIP experiment.

[0089] Then calculate %Input=2 (-△Ct[normalized IP]) , where %Input represents the ratio of IP to Input, and “normalized IP” is the △Ct value calculated above.

[0090] Compare the difference of %Input between SOL and EDL groups. Figure 2 As shown in the figure, IP represents the results of the MeRIP experiment using the specific antibody STARD7; IG represents the results of the MeRIP experiment using the nonspecific antibody IgG. As can be seen, m6A enrichment was detected in the STARD7 gene in both tissues, but the amount of m6A enrichment in the STARD7 gene in the soleus muscle (SOL) was significantly higher than that in the extensor digitorum longus (EDL). This demonstrates that the level of m6A modification in the STARD7 gene is higher in SOL tissue than in the EDL, indicating that the higher expression of the STARD7 gene in SOL is associated with higher levels of m6A modification. This result also suggests that the regulatory effect of the STARD7 gene on porcine skeletal muscle fiber type conversion is mediated by m6A modification.

[0091] Example 3 Verification of m6A Modification Regulation of STARD7 Expression

[0092] 1. Experimental Grouping

[0093] Control group: add sterile water;

[0094] Experimental group:

[0095] a. Cycloleucine experimental group: cycloleucine was added;

[0096] b. Betaine experimental group: betaine was added.

[0097] 2. Experimental Methods

[0098] 1. Treatment of porcine skeletal muscle satellite cells with cycloleucine (m6A methylation inhibitor) or betaine (m6A methylation donor)

[0099] The specific steps are as follows:

[0100] (1) Well-grown porcine skeletal muscle satellite cells were inoculated into a twelve-well cell culture plate and cultured in an incubator at 37°C and 5% CO2.

[0101] (2) When the cell density reaches 60%-80%, the ordinary proliferation medium is replaced with a proliferation medium supplemented with 10 μM cycloleucine or 10 μM betaine, respectively, and the cells are cultured in an incubator at 37°C with 5% CO2.

[0102] (3) When the cells are about to grow, the original proliferation medium containing drugs is discarded, and the experimental group is added with differentiation medium (DMEM containing 2% horse serum) containing 10 μM cycloleucine or 10 μM betaine, respectively. The control group is added with an equal volume of differentiation medium supplemented with aseptic technique to induce differentiation. The cells are then cultured in an incubator at 37°C with 5% CO2.

[0103] (4) After 2 days of differentiation induction, the differentiation medium containing the same drug concentration was replaced and the cells were cultured in an incubator at 37°C and 5% CO2 for another day.

[0104] (5) Collect cells.

[0105] 2. Cell RNA was extracted according to the method of Example 1, cDNA was prepared, and changes in the expression level of the STARD7 gene were detected by RT-qPCR.

[0106] 3. Experimental Results

[0107] The results are as follows Figure 3 As shown, Figure 3 A is the cycloleucine-treated group. After cycloleucine treatment reduced the overall m6A methylation level, the expression of the STARD7 gene decreased; Figure 3 B is the betaine-treated group. After betaine treatment increased the overall m6A methylation level, the expression of the STARD7 gene increased. This proves that m6A modification promotes the expression of the STARD7 gene, thereby promoting STARD7's regulation of pig skeletal muscle fiber types and affecting pork quality.

[0108] Example 4 Design and Synthesis of STARD7 Gene siRNA

[0109] The CDS region sequence of the porcine STARD7 gene (GeneID: 100525865) was searched on the website of the National Institute of Biological Studies (NCBI) (http: / / www.ncbi.nlm.nih.gov / ). Sense and antisense siRNAs were designed against the porcine STARD7 gene using Block-iTRNAiDesigner software (software website: http: / / rnaidesigner.thermofisher.com / rnaiexpress / sort.do) (sequences shown in Table 7). A negative control siRNA-NC was also designed. siRNAs were synthesized by Suzhou Jima Gene Co., Ltd.

[0110] Table 7 Sequences of pig STARD7 gene interference fragments

[0111]

[0112] Example 5 siRNA inhibits STARD7 expression and suppresses oxidative phosphorylation in skeletal muscle satellite cells

[0113] 1. Experimental Grouping

[0114] Control group: transfected with negative control siRNA-NC of Example 4.

[0115] Experimental group: transfected with siRNA-STARD7 synthesized in Example 4.

[0116] 2. Experimental Methods

[0117] 1. Cell transfection with siRNA interference fragments

[0118] The specific steps are as follows:

[0119] (1) One day before transfection, skeletal muscle satellite cells with good morphology and vigorous growth were seeded into twelve-well cell culture plates, proliferation medium was added, and cultured in an incubator at 37°C with 5% CO2.

[0120] (2) Prepare Liquid A and Liquid B

[0121] Solution A: Dilute the siRNA interference fragment prepared in Example 4 (the siRNA interference fragment in the control group is siRNA-NC; the siRNA interference fragment in the experimental group is siRNA-STARD7) with OOpti-MEM medium (ThermoFisher) to prepare a premix solution and mix thoroughly;

[0122] Solution B: Dilute Lipfectamine 3000 reagent with Opti-DEME™ medium and mix thoroughly;

[0123] After solution A and solution B were allowed to stand for 5 minutes respectively, solution A and solution B were mixed and allowed to stand for another 20 minutes to obtain the transfection mixture.

[0124] (3) When the cells are cultured to a cell density of 60-80%, the old proliferation medium in the cell culture plate is discarded and new proliferation medium is added.

[0125] (5) While changing the medium in the cell culture plate, add 125 μL of the transfection mixture prepared in step (3) to each well of the cell culture plate, shake gently, and culture in an incubator at 37°C containing 5% CO2.

[0126] (6) After culturing for 6 h, the transfection mixture was discarded and differentiation medium (DMEM containing 2% horse serum) was added to induce differentiation.

[0127] (7) Induce differentiation for 3 days.

[0128] 2. Extract cellular RNA

[0129] The specific steps are as follows:

[0130] (1) The cells were washed twice with PBS, and 500 μL of Trizol reagent was added to each well of a 12-well plate. The cells were quickly detached by pipetting several times, and then the liquid was transferred to a 1.5 mL centrifuge tube. After vortexing, the tube was allowed to stand for 5 minutes to allow the cells to fully lyse.

[0131] (2) Add 100 μL of chloroform, shake vigorously to mix, let it stand for 2 minutes, and then centrifuge at 4°C and 12,000 rpm for 10 minutes.

[0132] (3) At this time, the liquid is separated into layers. Carefully pipette the upper aqueous phase into a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol (i.e., 500 μL) to the aqueous phase. Gently invert the tube upside down to mix. Let it stand for 10 minutes, and then centrifuge it at 4°C and 12,000 rpm for 10 minutes.

[0133] (4) Observe the precipitate and carefully discard the supernatant.

[0134] (5) Add 1 mL of 75% ethanol to wash the precipitate, shake gently to suspend the precipitate, and then centrifuge at 4°C and 7500 rpm for 5 min.

[0135] (6) Discard the supernatant and air-dry at room temperature. The resulting precipitate is the extracted cellular RNA.

[0136] (7) Add 20 μL of DEPC water to dissolve the RNA, place on ice for 5 min, mix well, and measure the concentration of the extracted RNA using a NanoDrop 2000 DNA / RNA concentration meter.

[0137] 3. Preparation of cDNA

[0138] cDNA was synthesized using Evo M-MLV Reverse Transcription Kit II from Eric Biotech, and the detailed steps were the same as those in the cDNA preparation section of Example 1.

[0139] 4. RT-qPCR

[0140] (1) Real-time fluorescence quantitative PCR was performed using a Thermo Fisher quanstudio5 fluorescence quantitative PCR instrument. The reaction volume was 10 μL. The reaction system is shown in Table 8:

[0141] Table 8 PCR reaction system

[0142]

[0143] Among them, the primers for detecting genes cox5B, cox6B, Ndufb4, and Uqpcr10 are as follows:

[0144] cox5B-F: CTATGGCATCTGGAGGTGGTGT

[0145] cox5B-R:CTATCCGCTTGTTGGTGATGGA

[0146] cox6B-F: GTCAATTGAGCTTCCAGCGGT

[0147] cox6B-R: AGCAGTCATTGCTTTCTCACAGC

[0148] Ndufb4-F:GGACCTACGCAAGATCAGCA

[0149] Ndufb4-R:GAGGGGCCCAATTCCAAAGA

[0150] Uqpcr10-F:CTCCCTGTTGTTTTCGCAGGA

[0151] Uqpcr10-R:TCCCCTGGTTGATGTGTTCG

[0152] The PCR reaction program is shown in Table 9:

[0153] Table 9: PCR reaction program

[0154]

[0155] 3. Experimental Results

[0156] Using QuantStudio TMReal-Time PCR Software was used to obtain the Ct value of each well. The 2-ΔΔCt method was used, and β-actin was used as the internal reference gene. The specific primers for cox5B, cox6B, Ndufb4, and Uqpcr10 genes were used to detect the expression of each gene. The 2-ΔΔCt and standard error of each sample were calculated, and the differences in the expression of cox5B, cox6B, Ndufb4, and Uqpcr10 between the experimental group and the control group were compared. Figure 4 As shown, after si-RNA interfered with the expression of STARD7 gene, the expression levels of oxidative phosphorylation-related enzymes coxB5, Ndufb4 and Uqpcr10 were significantly inhibited, resulting in the inhibition of oxidative phosphorylation process.

[0157] Example 6 Regulatory Effects of siRNA Inhibition of STARD7 Gene Expression on Pig Skeletal Muscle Fiber Differentiation

[0158] 1. Detection of the regulatory effect of siRNA inhibition of STARD7 gene expression on the expression of marker genes of different muscle fiber types at the RNA level

[0159] The experimental groups were the same as in Example 5. The synthesized siRNA interference fragments were transfected into well-grown porcine skeletal muscle satellite cells. After transfection, differentiation was induced for 3 days. Cell samples were collected, RNA was extracted, and RT-qPCR was performed to detect changes in the expression of myofiber type marker genes. The detailed steps were the same as in Example 5, except that the specific primers for the MYHC I, PGC-1α, MYHC 2a, MYHC2b, and SRL genes were used as follows:

[0160] MYHCⅠ-F:AAGGGCTTGAACGAGGAGTAGA

[0161] MYHCⅠ-R:TTATTCTGCTTCCTCCAAAGGG

[0162] PGC-1α-F: CGCAAGCTTCTCTGAGCTTCTTT

[0163] PGC-1α-R:GGATACACTTTGCGCAGGTCGAA

[0164] MYHC 2a-F: GCTGAGCGAGCTGAAATCC

[0165] MYHC 2a-R:ACTGAGACACCAGAGCTTCT

[0166] MYHC 2b-F:CGCCAAGCTACTGAGGCAATAA

[0167] MYHC 2b-R:GTTCCCACCATGGCCAGTTGTTC

[0168] SRL-F:AGGCATCATTGAGAACCGCA

[0169] SRL-R:TGGGGTCGAAGACGACAAAG

[0170] The results are as follows Figure 5 As shown, interfering with STARD7 expression significantly reduced the mRNA expression of oxidative myofiber marker genes (MYHC I and PGC-1α), while significantly increasing the mRNA expression of glycolytic myofiber marker genes (MYHC 2a, MYHC 2b, and SRL). This experiment demonstrated at the RNA level that reduced STARD7 expression increased the expression of glycolytic myofiber marker genes and decreased the expression of oxidative myofiber marker genes in porcine skeletal muscle. This suggests that reduced STARD7 expression increases the differentiation of porcine skeletal muscle satellite cells into glycolytic myofibers and decreases their differentiation into oxidative myofibers. This suggests that STARD7 expression can promote the differentiation of porcine skeletal muscle satellite cells into oxidative myofibers, thereby increasing the content of oxidative myofibers in porcine skeletal muscle and improving pork quality.

[0171] 2. Detection of the regulatory effect of siRNA inhibition of STARD7 gene expression on the expression of marker genes of different muscle fiber types at the protein level

[0172] 1. Experimental Grouping

[0173] Same as Example 5.

[0174] 2. Experimental methods

[0175] (1) Cell transfection with siRNA interference fragments

[0176] The specific steps are the same as those in Example 5, except that in step (5), 250 μL of transfection mixture is added to each well.

[0177] (2) Protein extraction

[0178] S1. Aspirate the culture medium and wash the cells twice with PBS.

[0179] S2. Aspirate the remaining PBS and add an appropriate amount of RIPA lysis buffer containing 1% PMSF to each well. Scrape the cells with a cell scraper and transfer them to a 1.5 mL EP tube.

[0180] S3. Shake vigorously and incubate on ice for 20 min.

[0181] S4. Centrifuge at 12000 rpm for 7 min.

[0182] S5. Take the supernatant, add an appropriate amount of protein loading buffer, mix well, and denature the protein at 95°C for 10 minutes.

[0183] S6. After aliquoting, store the protein samples at -20°C.

[0184] (3) Western blotting to detect protein expression

[0185] The specific steps are as follows:

[0186] S1. Assemble and secure the cleaned glass plate and comb. Prepare a 10% separation gel (prepared using an SDS-PAGE rapid gel preparation kit) based on the molecular weight of the experimental test indicator. Add 4 μl of TEMED to the prepared separation gel, shake well, and pour the gel (leaving approximately 1.5 cm of height for the stacking gel).

[0187] S2. Add 400 μl of anhydrous ethanol to smooth the surface of the separation gel into a straight line.

[0188] S3. After about 20 minutes, a clear gel line will appear between the anhydrous ethanol and the gel, indicating that the separation gel has fully solidified. Pour off the water on the top of the gel and use filter paper to absorb the water between the glass slides.

[0189] S4. Prepare 5% stacking gel, add 4 μl of TEMED and shake well immediately to fill the remaining space with stacking gel. Then insert the comb diagonally into the stacking gel and smooth it out to avoid bubbles.

[0190] S5. After the concentrated gel has solidified, take out the prepared film and the glass plate as a whole and place them in the electrophoresis tank and clamp them. Remove the comb and add enough electrophoresis buffer (the liquid level in the tank must be higher than the gel).

[0191] S6. Use a micropipette to draw 25 μl of the protein sample solution extracted in this example and slowly add it to the sample well.

[0192] S7. Adjust the voltage to 200V for concentrated gel electrophoresis. After about 5 minutes, when the indicator (the protein loading buffer used in step (2) is blue and acts as an indicator) runs into the separation gel, adjust the voltage to 120V. After 60 minutes, when the indicator is about to run out, terminate the electrophoresis.

[0193] Cut a PVDF membrane and four pieces of filter paper of the same size as the gel sample. Soak the membrane in methanol for 5 minutes, then immerse it, along with the filter paper and sponge, in transfer buffer.

[0194] S9. Place a sponge, two layers of filter paper, glue, membrane, two layers of filter paper, and a sponge on the negative terminal (black) in this order and place them on the transfer device; transfer the membrane at 200 mA for 3 hours.

[0195] S10. After transfer, wash the membrane once with 1× TBS for 5 minutes at room temperature on a shaker.

[0196] S11. Block the membrane by soaking it in 5% skim milk powder (prepared in 1×TBST) at 37°C for 3 h.

[0197] S12. Wash the blocked membrane three times with 1× TBS, each time for 10 min.

[0198] S13. Remove the membrane and place it directly in the primary antibody and incubate overnight at 4°C.

[0199] S14. Wash three times with 1× TBST and once with 1× TBS.

[0200] S15. Transfer the membrane to the secondary antibody and incubate at 37°C for 1 h.

[0201] S16. Wash the membrane three times with TBST and once with 1× TBS, each for 10 min; develop the membrane using ECL.

[0202] 3. Experimental results

[0203] Using Tubulin as the internal reference protein, Western blotting was used to detect protein expression. Figure 6 As shown in A, it can be seen that after interfering with STARD7 gene expression, the expression level of oxidative muscle fiber marker protein MYHC I decreased, and the expression level of glycolytic muscle fiber marker protein MYHC Ⅱb increased. The gray value was quantified using ImageJ software and statistical difference analysis was performed. The results are shown in Figure 2. Figure 6 As shown in Figure B, compared with the control group, the expression of MYHC I, a marker protein for oxidative myofibers, was significantly decreased, while the expression of MYHC IIb, a marker protein for glycolytic myofibers, was significantly increased. This experiment demonstrated at the protein level that decreased STARD7 gene expression increased the expression of genes that mark glycolytic myofibers in porcine skeletal muscle, while decreasing the expression of genes that mark oxidative myofibers in porcine skeletal muscle. This suggests that decreased STARD7 gene expression increases the differentiation of porcine skeletal muscle satellite cells into glycolytic myofibers and decreases their differentiation into oxidative myofibers. This suggests that STARD7 gene expression can increase the differentiation of porcine skeletal muscle satellite cells into oxidative myofibers, thereby increasing the content of oxidative myofibers in porcine skeletal muscle and improving pork quality.

[0204] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Use of an agent that promotes or activates STARD7 gene expression in regulating porcine skeletal muscle development, wherein the regulating porcine skeletal muscle development is to increase the proportion or content of oxidative muscle fibers in porcine skeletal muscle. The use is not for the purpose of treating a disease.

2. Use of an agent that promotes or activates STARD7 gene expression in the preparation of a preparation capable of regulating porcine skeletal muscle development, wherein the regulating porcine skeletal muscle development is to increase the proportion or content of oxidative muscle fibers in porcine skeletal muscle.

3. The use according to claim 1 or 2, characterized in that The reagent that promotes or activates the expression of the STARD7 gene is an m6A modification reagent.

4. Use of an agent that promotes or activates STARD7 gene expression in promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, wherein the use is not for the purpose of treating a disease.

5. Use of an agent that promotes or activates STARD7 gene expression in the preparation of a preparation that can promote the differentiation of porcine skeletal muscle satellite cells into oxidative myofibers.

6. A method for regulating pig skeletal muscle development without the purpose of treating a disease, characterized in that: Promoting or activating STARD7 gene expression, and regulating pig skeletal muscle development specifically increases the proportion or content of oxidative muscle fibers in pig skeletal muscle.

7. A method for promoting the differentiation of porcine skeletal muscle satellite cells into oxidative muscle fibers, characterized in that: Promote or activate STARD7 gene expression.

8. The method according to claim 6 or 7, characterized in that STARD7 gene expression is increased by increasing the m6A modification level of the STARD7 gene.

Images