Construction of gene editing system of swine donor cell for epigenetic disorder model of setdb1 gene mutation and application thereof

By constructing a SETDB1 gene mutation model in pig cells using CRISPR/Cas9 technology, the problem of inconsistencies in existing animal models in simulating human diseases has been solved, achieving efficient gene editing and disease simulation, and providing a pig model suitable for drug screening and treatment.

CN115247175BActive Publication Date: 2025-10-17NANJING KGENE GENETIC ENG CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111413849.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-25
Publication Date
2025-10-17
Estimated Expiration
2041-11-25

AI Technical Summary

Technical Problem

Existing animal models, such as mice, differ significantly from human physiological and pathological states, failing to accurately reflect the development of human diseases. Furthermore, primates are costly and difficult to breed, making them unsuitable for effectively studying diseases related to epigenetic regulation.

Method used

Using CRISPR/Cas9 technology combined with SETDB1-gRNA1, SETDB1-gRNA4 and NCN proteins, the SETDB1 gene was knocked out in pig cells by electroporation, and an epigenetic disorder model pig was constructed. Pigs were used as a model animal that is closer to humans, and stable gene-edited cloned pigs were obtained by somatic cell nuclear transfer technology.

Benefits of technology

It achieves high gene editing efficiency, obtaining up to 97% target gene knockout single-cell clones, shortening the model pig production cycle, reducing costs, and providing a disease simulation platform that is closer to humans, suitable for drug screening and gene therapy research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003374524890000121
    Figure BDA0003374524890000121
  • Figure BDA0003374524890000131
    Figure BDA0003374524890000131
  • Figure HDA0003374524900000011
    Figure HDA0003374524900000011
Patent Text Reader

Abstract

The application discloses a gene editing system for constructing an epigenetic disorder model pig nuclear transfer donor cell with a SETDB1 gene mutation and application thereof. The application provides application of SETDB1-gRNA1 shown in SEQ ID NO: 16, SETDB1-gRNA4 shown in SEQ ID NO: 17 and NCN protein in preparation of a kit. The application also provides a method for preparing a recombinant cell: SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein are co-transfected into a pig cell to obtain the recombinant cell. The recombinant cell is a recombinant cell with a SETDB1 gene mutation. The kit is used for: preparing the recombinant cell; preparing an epigenetic disorder model pig; preparing an epigenetic disorder cell model or an epigenetic disorder tissue model or an epigenetic disorder organ model. The application has great application value for research and development of drugs for epigenetic disorder related diseases and revealing pathogenesis of the diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, specifically to the field of gene editing, and more specifically relates to a gene editing system for constructing a porcine nuclear transfer donor cell model of epigenetic disorder of SETDB1 gene mutation and application thereof. BACKGROUND

[0002] Epigenetic modification of genes is an important means of biological regulation of gene expression, which mainly includes epigenetic modification of DNA and histone modification. In human diseases, in addition to some genetic diseases caused by single gene defects, most diseases are related to epigenetic regulation of genes, such as common cancers, cardiovascular diseases and mental diseases.

[0003] Histone methyltransferase SETDB1 mainly contains three domains: two tandem Tudor domains at the N-terminus, MBD domain and conserved SET domain at the C-terminus. On the one hand, SETDB1 can catalyze monomethylation, dimethylation or trimethylation modification of lysine residue at position 9 of histone H3 through its C-terminal SET domain, regulate the degree of chromatin opening and the formation of heterochromatin, and thereby inhibit the expression of genes; on the other hand, SETDB1 can bind to the PHD domain of DNA methyltransferase DNMT3A through its N-terminal MBD domain and localize to the promoter region of genes, thereby synergistically exerting the transcriptional repression effect of DNA methylation modification; in addition, SETDB1 can also catalyze methylation modification of non-histone proteins to regulate gene transcriptional activity. Therefore, SETDB1 gene is an important gene affecting epigenetic regulation of organisms, and knockout of SETDB1 gene will cause epigenetic disorder of organisms.

[0004] In order to study the influence of epigenetic regulation on the occurrence and development of various human diseases and carry out the research and development of corresponding drugs, it is necessary to establish an animal model of epigenetic disorder for research. The commonly used animal model at present is a mouse model, however, mice are quite different from humans in terms of body size, organ size, physiology, pathology and the like, and cannot truly simulate the normal physiological and pathological states of humans. Pigs, as large animals, are similar to humans in terms of body size and physiological functions, are easy to breed in large scale, and have lower requirements in terms of ethics, morality and animal protection, and are ideal model animals for humans.

[0005] Gene editing is a biological technology that has made great progress in recent years, which includes gene editing based on homologous recombination and editing technologies such as ZFN, TALEN and CRISPR / Cas9 based on nucleases, among which CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is increasingly applied to the production of animal models. SUMMARY

[0006] The application aims to provide a gene editing system for constructing a SETDB1 gene mutation epigenetic disorder model pig nuclear transfer donor cell and an application thereof.

[0007] The application provides application of SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein in preparation of a kit.

[0008] The application also provides application of SETDB1-gRNA1, SETDB1-gRNA4 and PRONCN protein in preparation of a kit.

[0009] The application also provides application of SETDB1-gRNA1, SETDB1-gRNA4 and specific plasmid in preparation of a kit.

[0010] The application provides a method for preparing a recombinant cell, comprising the following steps: co-transfecting a pig cell with SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein to obtain the recombinant cell.

[0011] The co-transfection is specifically in the form of electroporation.

[0012] The parameter setting of the electroporation can be specifically 1450V, 10ms and 3pulse.

[0013] The co-transfection can be specifically performed by using a mammalian nucleic transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporation instrument.

[0014] The application provides a kit comprising SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein.

[0015] The application also provides a kit comprising SETDB1-gRNA1, SETDB1-gRNA4 and PRONCN protein.

[0016] The application also provides a kit comprising SETDB1-gRNA1, SETDB1-gRNA4 and specific plasmid.

[0017] The kit can further comprise a pig cell.

[0018] The kit can be used for the following purposes (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing an epigenetic disorder model pig; (c) preparing an epigenetic disorder cell model or an epigenetic disorder tissue model or an epigenetic disorder organ model.

[0019] The ratio of SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein is 0.8-1.2 μg SETDB1-gRNA1: 0.8-1.2 μg SETDB1-gRNA4: 3-5 μg NCN protein in turn.

[0020] The ratio of SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein is 1 μg SETDB1-gRNA1: 1 μg SETDB1-gRNA4: 4 μg NCN protein in turn.

[0021] The ratio of pig cells, SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein is 100,000 pig cells: 0.8-1.2 μg SETDB1-gRNA1: 0.8-1.2 μg SETDB1-gRNA4: 3-5 μg NCN protein in turn.

[0022] The ratio of pig cells, SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein is 100,000 pig cells: 1 μg SETDB1-gRNA1: 1 μg SETDB1-gRNA4: 4 μg NCN protein in turn.

[0023] The SETDB1-gRNA1 of any of the above is sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 16.

[0024] Specifically, the SETDB1-gRNA1 is as shown in SEQ ID NO: 16.

[0025] Specifically, the SETDB1-gRNA1 is as shown in SEQ ID NO: 10.

[0026] The SETDB1-gRNA4 of any of the above is sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 17.

[0027] Specifically, the SETDB1-gRNA4 is as shown in SEQ ID NO: 17.

[0028] Specifically, the SETDB1-gRNA4 is as shown in SEQ ID NO: 13.

[0029] The NCN protein of any of the above is Cas9 protein or fusion protein with Cas9 protein.

[0030] Specifically, the NCN protein is as shown in SEQ ID NO: 3.

[0031] The pig cell according to any one of the above is a pig fibroblast.

[0032] The pig cell according to any one of the above is a primary pig fibroblast.

[0033] The pig cell according to any one of the above is a primary pig fibroblast obtained from a newborn pig.

[0034] The preparation method of the NCN protein comprises the following steps:

[0035] (1) introducing the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium;

[0036] (2) culturing the recombinant bacterium in a liquid medium at 30°C, then adding IPTG and inducing culture at 25°C, and then collecting the bacterial bodies;

[0037] (3) subjecting the collected bacterial bodies to bacterial body disruption, and collecting a crude protein solution;

[0038] (4) purifying the fusion protein with His6 tag from the crude protein solution by affinity chromatography;

[0039] (5) subjecting the fusion protein with His6 tag to enterokinase enzyme cutting with His6 tag, and then removing the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein;

[0040] The fusion gene shown in SEQ ID NO: 1 at positions 5209-9852 is in the plasmid pKG-GE4.

[0041] The preparation method of the NCN protein specifically comprises the following steps:

[0042] (1) introducing the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium.

[0043] (2) inoculating the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin and subjecting to shaking culture;

[0044] (3) inoculating the bacterial liquid obtained in step (2) into a liquid LB medium, and subjecting to shaking culture at 30°C and 230 rpm until the OD value is 1.0, then adding IPTG to make the concentration in the system be 0.5 mM, and then subjecting to shaking culture at 25°C and 230 rpm for 12 hours, and then centrifuging to collect the bacterial bodies; 600nm

[0045] (4) taking the bacterial bodies obtained in step (3), and washing with PBS buffer;

[0046] ​(5) Taking the bacteria obtained in step (4), adding a crude extraction buffer and suspending the bacteria, then performing bacteria disruption, then centrifuging to collect the supernatant, filtering with a 0.22 μm pore size filter membrane, and collecting the filtrate;

[0047] (6) Purifying the fusion protein (fusion protein shown in SEQ ID NO: 2) having a His6 tag from the filtrate obtained in step (5) using affinity chromatography;

[0048] (7) Taking the post-column solution collected in step (6), concentrating using an ultrafiltration tube, and then diluting with 25 mM Tris-HCl (pH 8.0);

[0049] (8) Adding the recombinant bovine enterokinase having a His6 tag to the solution obtained in step (7) and performing enzyme digestion;

[0050] (9) Mixing the solution in which step (8) is completed with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;

[0051] (10) Taking the supernatant obtained in step (9), concentrating using an ultrafiltration tube, and then adding an enzyme storage solution, which is an NCN protein solution.

[0052] The specific method for purifying the fusion protein having a His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0053] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution at a flow rate of 1 ml / min; then load 50 ml of the filtrate obtained in step (5) at a flow rate of 0.5-1 ml / min; then wash the column with 5 column volumes of equilibration solution at a flow rate of 1 ml / min; then wash the column with 5 column volumes of buffer at a flow rate of 1 ml / min to remove impure proteins; and then elute with 10 column volumes of elution solution at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0054] Any of the above-described PRONCN proteins sequentially includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease enzyme digestion site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0055] The signal peptide functions to promote protein secretion expression. The signal peptide can be selected from the group consisting of E. coli alkaline phosphatase (phoA) signal peptide, S. aureus protein A signal peptide, E. coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the intracellular protein from the bacteria, and the target protein secreted into the bacterial periplasmic cavity is soluble expression, which can be cleaved by the signal peptide enzyme in the bacterial periplasmic cavity.

[0056] The molecular chaperone functions to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin, which can act as a molecular chaperone to help the co-expressed target protein (such as Cas9 protein) form disulfide bonds, improve protein stability, folding accuracy, increase solubility and activity of the target protein.

[0057] The protein tag functions for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, further preferably a His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein.

[0058] The protease cleavage site functions to remove the non-functional segment after purification to release the native form of the Cas9 protein. The protease can be selected from the group consisting of enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, further preferably enterokinase. EK is the enterokinase cleavage site, which facilitates the removal of the fused TrxA-His segment using enterokinase to obtain the native form of the Cas9 protein. After the application uses commercial enterokinase with His tag to cleave the fusion protein, the TrxA-His segment and the enterokinase with His tag can be removed by one-step affinity chromatography to obtain the native form of the Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0059] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. The NLS is a nuclear localization signal, and one NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.

[0060] The Cas9 protein can be a saCas9 or a spCas9, preferably a spCas9 protein.

[0061] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0062] The specific plasmid of any of the above includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.

[0063] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, which can efficiently drive the expression of an exogenous gene.

[0064] The operator can be specifically a Lac operator. The Lac operator is a regulatory element for lactose-induced expression, which can be used to induce the expression of the target protein at low temperature after the bacteria grow to a certain amount, thereby avoiding the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improving the solubility of the expressed target protein.

[0065] The ribosome binding site is the ribosome binding site during protein translation, which is necessary for protein translation.

[0066] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of the target gene at the end of the target gene, thereby avoiding the transcription and translation of other downstream sequences other than the target gene.

[0067] For the codons of the spCas9 protein, the codons thereof are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21(DE3), thereby improving the expression level of the Cas9 protein.

[0068] The T7 promoter is shown in SEQ ID NO: 1 at nucleotides 5121-5139.

[0069] The Lac operator is shown in SEQ ID NO: 1 at nucleotides 5140-5164.

[0070] The ribosome binding site is shown in SEQ ID NO: 1 at nucleotides 5178-5201.

[0071] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0072] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0073] The coding sequence of the His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0074] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0075] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0076] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0078] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.

[0079] Specifically, the specific plasmid is plasmid pKG-GE4.

[0080] The plasmid pKG-GE4 has a DNA molecule shown as nucleotides 5121-9949 in SEQ ID NO: 1.

[0081] Specifically, the plasmid pKG-GE4 is shown as SEQ ID NO: 1.

[0082] The present application also protects the recombinant cell prepared by any of the above-mentioned methods.

[0083] The recombinant cell is a recombinant cell with a mutated SETDB1 gene.

[0084] Specifically, the recombinant cell can be each single cell clone of the hybrid type, the double allele same mutation type or the double allele different mutation type in Table 1.

[0085] The present application also protects the use of the recombinant cell in preparing an epigenetic disorder model pig.

[0086] The recombinant cell is used as a nuclear transfer donor cell for somatic cell cloning, and a cloned pig, i.e., an epigenetic disorder model pig, can be obtained.

[0087] The present application also protects a pig tissue of a model pig prepared by using the recombinant cell, i.e., an epigenetic disorder tissue model.

[0088] The present application also protects a pig organ of a model pig prepared by using the recombinant cell, i.e., an epigenetic disorder organ model.

[0089] The present application also protects a pig cell of a model pig prepared by using the recombinant cell, i.e., an epigenetic disorder cell model.

[0090] The present application also protects the use of the recombinant cell, the epigenetic disorder tissue model, the epigenetic disorder organ model, the epigenetic disorder cell model, or the epigenetic disorder model pig for (d1) or (d2) or (d3) or (d4) as follows:

[0091] (d1) screening drugs for treating an epigenetic disorder related disease;

[0092] (d2) performing efficacy evaluation of drugs for an epigenetic disorder related disease;

[0093] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for an epigenetic disorder related disease;

[0094] (d4) studying the pathogenesis of an epigenetic disorder related disease.

[0095] The pig according to any one of the above embodiments can be specifically a Congjiang pig.

[0096] The pig according to any one of the above embodiments can be specifically a newborn Congjiang pig.

[0097] The epigenetic disorder according to any one of the above embodiments is caused by a mutation of a SETDB1 gene.

[0098] Pig SETDB1 gene information: encoding histone lysine methyltransferase SET domain branch type 1; located on chromosome 4; Gene ID is 100157920, Sus scrofa.

[0099] The amino acid sequence encoded by the pig SETDB1 gene is shown as SEQ ID NO: 8.

[0100] The pig SETDB1 gene has a DNA segment shown as SEQ ID NO: 9.

[0101] The mutation according to any one of the above embodiments is deletion and / or insertion and / or substitution of one or more nucleotides.

[0102] The mutation according to any one of the above embodiments is deletion of one or more nucleotides.

[0103] Any of the above mutations is a deletion of one or more nucleotides.

[0104] Any of the above mutations is a deletion and insertion of one or more nucleotides.

[0105] Compared with the prior art, the present application has at least the following beneficial effects:

[0106] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).

[0107] Rodents such as mice are very different from humans in terms of body size, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice are ineffective in human clinical trials. As for large animals, primates are the animals most closely related to humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and high feeding costs. In addition, primate cloning is low in efficiency, difficult, and high in cost.

[0108] Pigs, as model animals, do not have the above-mentioned shortcomings. Pigs are the animals most closely related to humans except primates, and their body size, weight, organ size, etc. are similar to those of humans, and they are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, etc. At the same time, pigs mature early (4-6 months), have high reproductive capacity, and can form a large population within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.

[0109] (2) The vector constructed by the application uses the strong promoter T7-lac which can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the target protein from the intracellular protein of the bacterium, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, and the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, so as to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, so as to obtain the natural form of the Cas9 protein, which avoids the damage and loss of the target protein caused by multiple purifications and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the E. coli BL21(DE3) strain is selected as the target protein expression strain, which can efficiently express the foreign genes cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codons of the Cas9 protein are optimized to adapt to the codon bias of the expression strain, so as to improve the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain number, which can avoid the influence of the premature expression of the target protein on the growth of the host bacteria, and the induction expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.

[0110] (3) The Cas9 high-efficiency protein combination constructed and expressed by the application is combined with the in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized, and finally the ratio of the gene editing single cell clone reaches as high as 97%, which is much higher than the conventional gene editing efficiency (10-30%).

[0111] (4) The target gene knockout single cell clone strain obtained by the application can be directly used for somatic cell nuclear transfer animal cloning to obtain a cloned pig with a target gene knockout, and the gene variation can be stably inherited.

[0112] The method of fertilized egg microinjection of gene editing material and then embryo transfer in the mouse model making has a relatively low probability of directly obtaining gene mutant offspring, and needs hybrid breeding of offspring, and is not suitable for long gestation period of large animals (such as pigs) model making. Therefore, the application adopts the primary cell in vitro editing with high technical difficulty and high challenge, and the Cas9 protein and double gRNA cutting and screening positive editing single cell clone method, and then directly obtains the corresponding disease model pig through the somatic cell nuclear transfer animal cloning technology, so that the model pig making cycle can be greatly shortened and the manpower, material resources and financial resources can be saved.

[0113] The application adopts the CRISPR / Cas9 technology combined with double gRNA editing to knockout the SETDB1 gene, simulates the genetic characteristics of epigenetic disorder, and obtains the single cell clone of the SETDB1 gene knockout, so as to lay a foundation for cultivating the epigenetic disorder model pig through the somatic cell nuclear transfer animal cloning technology in the later period. The application will help to research and reveal the pathogenesis of the epigenetic disorder related diseases caused by the abnormal function of the SETDB1 gene, and can be used for drug screening, drug efficacy evaluation, gene therapy and cell therapy research, and can provide effective experimental data for further clinical application, and further provides a powerful experimental means for successfully treating human epigenetic disorder related diseases. The application has great application value for the research and development of epigenetic disorder related disease drugs and the revelation of the pathogenesis of the diseases. BRIEF DESCRIPTION OF DRAWINGS

[0114] Figure 1 It is an electrophoresis map of PCR amplification of different primer pairs using the ear tissue of a pig named 1 in Example 1 as a template.

[0115] Figure 2 It is an electrophoresis map of PCR amplification of the primer pair composed of SETDB1-E4-JDF246 and SETDB1-E4-JDR626 using the genomic DNA of 18 pigs as a template in Example 1.

[0116] Figure 3 It is the alignment result of forward sequencing of the single cell clone numbered 19 and the wild type sequence.

[0117] Figure 4 It is the alignment result of forward sequencing of the single cell clone numbered 6 and the wild type sequence.

[0118] Figure 5 It is the alignment result of forward sequencing of the single cell clone numbered 10 and the wild type sequence.

[0119] Figure 6 It is the alignment result of forward sequencing of the single cell clone numbered 1 and the wild type sequence.

[0120] Figure 7 Figure 3 is a structural schematic diagram of plasmid pET-32a.

[0121] Figure 8 Figure 4 is a structural schematic diagram of plasmid pKG-GE4.

[0122] Figure 9 Figure 5 is an electropherogram of gRNA and NCN protein dosage ratio optimization in Example 3.

[0123] Figure 10 Figure 6 is an electropherogram of NCN protein and commercial Cas9 protein gene editing efficiency comparison in Example 3. DETAILED DESCRIPTION

[0124] The application will be further described in conjunction with the specific embodiments, and the examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0125] The experimental methods in the following examples are all routine methods, unless otherwise specified, according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. The recombinant plasmids constructed in the examples have been sequenced and verified. Commercial Cas9-A protein is a commercially available Cas9 protein with good effect. Commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 in a constant temperature incubator.

[0126] The pig primary fibroblasts used in the examples were prepared from the ear tissue of a newborn Jiangxiang pig. The method for preparing the pig primary fibroblasts was as follows: ① 0.5 g of pig ear tissue was obtained, the hair and bone tissue were removed, and then the tissue was immersed in 75% alcohol for 30-40 s, then washed 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and then washed once with PBS buffer; ② the tissue was cut into small pieces with scissors, and then digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuged at 500g for 5 min, and the supernatant was discarded; ③ the precipitate was resuspended with 1 mL of complete culture medium, and then plated into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), and then cultured until the cells covered about 60% of the bottom of the dish; ④ after step ③ was completed, the cells were trypsinized and collected, and then resuspended in complete culture medium. The cells were used for subsequent electroporation experiments.

[0127] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a self-cleavage polypeptide P2A (the amino acid sequence of the self-cleavage polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a self-cleavage polypeptide T2A (the amino acid sequence of the self-cleavage polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleavage polypeptide P2A and the self-cleavage polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.

[0128] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in cells to obtain a gRNA.

[0129] Example 1, Screening of high-efficiency gRNA target sites of SETDB1 gene

[0130] Pig SETDB1 gene information: encoding histone lysine methyltransferase SET domain branch type 1, located on chromosome 4, Gene ID is 100157920, Sus scrofa. The amino acid sequence of the protein encoded by pig SETDB1 gene is shown in SEQ ID NO: 8. In pig genomic DNA, SETDB1 gene has 23 exons, of which 21 are coding exons, and the 4th coding exon and its upstream and downstream 300 bp are shown in SEQ ID NO: 9.

[0131] I. Analysis of the conservation of the preset deletion region of SETDB1 gene and adjacent genomic sequence

[0132] 18 newborns from Jiangxiang pigs, of which 10 were female (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) and 8 were male (named A, B, C, D, E, F, G, and H, respectively).

[0133] SETDB1-E4-JDF276: ATTTCCCTCATCCCCTTCATTACAG;

[0134] SETDB1-E4-JDR570: GGAAACCGAGCAGACAAAAGAC;

[0135] SETDB1-E4-JDF235: TTATTCACAAACTGTTTTTAGCCCG;

[0136] SETDB1-E4-JDR581: AAACGGTATTTGGAAACCGAGC;

[0137] SETDB1-E4-JDF246: CTGTTTTTAGCCCGTGCTATTTT;

[0138] SETDB1-E4-JDR626: CTCTCTAACCTGCACCTGGAA;

[0139] SETDB1-E4-JDF245: ACTGTTTTTAGCCCGTGCTATTTTA;

[0140] SETDB1-E4-JDR625: TCTCTAACCTGCACCTGGAA;

[0141] SETDB1-E4-JDF236: TATTCACAAACTGTTTTTAGCCCG;

[0142] SETDB1-E4-JDR626: CTCTCTAACCTGCACCTGGAAG.

[0143] The genomic DNA of the pig named 1 was extracted from the ear tissue as a template, PCR amplification was performed using different primer pairs, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 1 . Figure 1 Group 1: using a primer pair composed of SETDB1-E4-JDF276 and SETDB1-E4-JDR570; Group 2: using a primer pair composed of SETDB1-E4-JDF235 and SETDB1-E4-JDR581; Group 3: using a primer pair composed of SETDB1-E4-JDF246 and SETDB1-E4-JDR626; Group 4: using a primer pair composed of SETDB1-E4-JDF245 and SETDB1-E4-JDR625; Group 5: using a primer pair composed of SETDB1-E4-JDF236 and SETDB1-E4-JDR626. The results show that the primer pair composed of SETDB1-E4-JDF246 and SETDB1-E4-JDR626 is preferably used for amplification of the target fragment.

[0144] The genomic DNA of 18 pigs was used as a template, and a primer pair composed of SETDB1-E4-JDF246 and SETDB1-E4-JDR626 was used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 2 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the SETDB1 gene sequence in the public database. The conserved region common to 18 pigs was selected for gRNA target site design.

[0145] II. Screening of target sites

[0146] Through screening NGG (avoiding possible mutation sites), several target sites were preliminarily screened, and 4 target sites were further screened through pre-experiments.

[0147] The 4 target sites are as follows:

[0148] SETDB1-E4-gRNA1: TATGGCTGCCTTAAGAAAGT;

[0149] SETDB1-E4-gRNA2: TCAAGATGTCCAGAAGTTCA;

[0150] SETDB1-E4-gRNA3: CAACAAGAAGAGCAGTTCCC;

[0151] SETDB1-E4-gRNA4: GGAACTGCTCTTCTTGTTGA.

[0152] III. Preparation of gRNA

[0153] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (a linear large fragment of about 3 kb) was recovered.

[0154] SETDB1-E4-gRNA1-S and SETDB1-E4-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA (SETDB1-E4-gRNA1). The plasmid pKG-U6gRNA (SETDB1-E4-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 SETDB1-E4-gRNA1 .

[0155] sgRNA SETDB1-E4-gRNA1 (SEQ ID NO: 10):

[0156] UAUGGCUGCCUUAAGAAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0157] SETDB1-E4-gRNA2-S and SETDB1-E4-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA (SETDB1-E4-gRNA2). The plasmid pKG-U6gRNA (SETDB1-E4-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 SETDB1-E4-gRNA2 .

[0158] sgRNA SETDB1-E4-gRNA2 (SEQ ID NO: 11):

[0159] GGAACUGCUCUUCUUGUUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0160] SETDB1-E4-gRNA3-S and SETDB1-E4-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(SETDB1-E4-gRNA3). The plasmid pKG-U6gRNA(SETDB1-E4-gRNA3) expresses sgRNA represented by SEQ ID NO: 12 SETDB1-E4-gRNA3 .

[0161] sgRNA SETDB1-E4-gRNA3 (SEQ ID NO: 12):

[0162] GGAACUGCUCUUCUUGUUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0163] SETDB1-E4-gRNA4-S and SETDB1-E4-gRNA4-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(SETDB1-E4-gRNA4). The plasmid pKG-U6gRNA(SETDB1-E4-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 SETDB1-E4-gRNA4 .

[0164] sgRNA SETDB1-E4-gRNA4 (SEQ ID NO: 13):

[0165] GGAACUGCUCUUCUUGUUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0166] SETDB1-E4-gRNA1-S: caccgTATGGCTGCCTTAAGAAAGT;

[0167] SETDB1-E4-gRNA1-A:aaacACTTTCTTAAGGCAGCCATAc;

[0168] SETDB1-E4-gRNA2-S:caccgTCAAGATGTCCAGAAGTTCA;

[0169] SETDB1-E4-gRNA2-A:aaacTGAACTTCTGGACATCTTGAc;

[0170] SETDB1-E4-gRNA3-S:caccgCAACAAGAAGAGCAGTTCCC;

[0171] SETDB1-E4-gRNA3-A:aaacGGGAACTGCTCTTCTTGTTGc;

[0172] SETDB1-E4-gRNA4-S:caccGGAACTGCTCTTCTTGTTGA;

[0173] SETDB1-E4-gRNA4-A:aaacTCAACAAGAAGAGCAGTTCC.

[0174] SETDB1-E4-gRNA1-S, SETDB1-E4-gRNA1-A, SETDB1-E4-gRNA2-S, SETDB1-E4-gRNA2-A, SETDB1-E4-gRNA3-S, SETDB1-E4-gRNA3-A, SETDB1-E4-gRNA4-S, and SETDB1-E4-gRNA4-A are all single-stranded DNA molecules.

[0175] 4. Comparison of Editing Efficiency of Different Target Combinations

[0176] 1. Co-transfection

[0177] Group 1: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (SETDB1-E4-gRNA1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SETDB1-E4-gRNA1): 1.08 μg plasmid pKG-GE3.

[0178] The second group: the plasmid pKG-U6gRNA (SETDB1-E4-gRNA2) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA (SETDB1-E4-gRNA2): 1.08 μg of the plasmid pKG-GE3.

[0179] The third group: the plasmid pKG-U6gRNA (SETDB1-E4-gRNA3) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA (SETDB1-E4-gRNA3): 1.08 μg of the plasmid pKG-GE3.

[0180] The fourth group: the plasmid pKG-U6gRNA (SETDB1-E4-gRNA4) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA (SETDB1-E4-gRNA4): 1.08 μg of the plasmid pKG-GE3.

[0181] The fifth group: the porcine primary fibroblasts are subjected to the electric conversion operation without the plasmid under the same electric conversion parameters.

[0182] The co-transfection is performed by the electric shock transfection, and the mammalian nuclear transfection kit (Neon kit, Thermofisher) and the Neon TM transfection system electric converter (the parameter setting is 1450V, 10ms, 3pulse) are used.

[0183] 2. After the completion of step 1, the complete culture solution is used for the culture for 12-18 hours, and then the new complete culture solution is used for the culture. The total culture time after the electric conversion is 48 hours.

[0184] 3. After the completion of step 2, the cells are collected by the trypsin digestion and lysed, the genomic DNA is extracted, the primer pair composed of SETDB1-E4-JDF246 and SETDB1-E4-JDR626 is used for the PCR amplification, and then the 1% agarose gel electrophoresis is performed. The cell target gene mutation is detected.

[0185] The target product was cut and recovered, and then sent to a sequencing company for sequencing. Then the sequencing results were analyzed using the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first to fourth groups was 55%, 14%, 52%, and 54%, respectively, and the fifth group did not occur gene editing. The results showed that the editing efficiency of SETDB1-E4-gRNA1 and SETDB1-E4-gRNA4 was higher.

[0186] Example 2, Preparation of SETDB1 gene knockout Congjiang pig single cell clone

[0187] Two high-efficiency gRNA target points (SETDB1-E4-gRNA1 and SETDB1-E4-gRNA4) screened in Example 4 were selected.

[0188] I. Preparation of gRNA

[0189] 1. Preparation of SETDB1-T7-gRNA1 transcription template and SETDB1-T7-gRNA4 transcription template

[0190] The SETDB1-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0191] The SETDB1-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0192] 2. In vitro transcription to obtain gRNA

[0193] Take the SETDB1-T7-gRNA1 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM TranscriptionClean-Up Kit (Thermo, AM1908) for recovery and purification to obtain SETDB1-gRNA1. SETDB1-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0194] SETDB1-gRNA1 (SEQ ID NO: 16):

[0195] GGUAUGGCUGCCUUAAGAAAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0196] Take the SETDB1-T7-gRNA4 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM TranscriptionClean-Up Kit (Thermo, AM1908) to recover and purify, and obtain SETDB1-gRNA4. SETDB1-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0197] SETDB1-gRNA4 (SEQ ID NO: 17):

[0198] GGGGAACUGCUCUUCUUGUUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0199] II. Transfection of porcine primary fibroblasts

[0200] 1. Co-transfect SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg SETDB1-gRNA1: 1 μg SETDB1-gRNA4: 4 μg NCN protein. Co-transfection is performed by electroporation, using mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TMtransfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse). The NCN protein is prepared in Example 3.

[0201] 2. After completing step 1, culture with complete culture medium for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0202] 3. After completing step 2, trypsinize and collect the cells, then wash with complete culture medium, then resuspend with complete culture medium, then pick each monoclonal and transfer to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium), culture for 2 weeks (replace with new complete culture medium every 2-3 days).

[0203] 4. After step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well were seeded into a 6-well plate containing complete medium, and the remaining 1 / 3 was collected in a 1.5 mL centrifuge tube).

[0204] 5. Take the 6-well plate of step 4, culture until the cells grow to 80% confluence, trypsinize and collect the cells, and freeze the cells using cell freezing solution (90% complete medium + 10% DMSO, by volume).

[0205] 6. Take the centrifuge tube of step 4, take the cells, perform cell lysis and extract genomic DNA, perform PCR amplification using the primer pair consisting of SETDB1-E4-JDF246 and SETDB1-E4-JDR626, and then perform electrophoresis. Pig primary fibroblasts are used as wild type control (WT).

[0206] 7. After step 6, recover the PCR amplification product and sequence.

[0207] The sequencing result of pig primary fibroblasts is only one, and the genotype is wild type (also referred to as homozygous wild type). If the sequencing result of a single cell clone has two, one is consistent with the sequencing result of pig primary fibroblasts, and the other is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of pig primary fibroblasts, the genotype of the single cell clone is heterozygous; if the sequencing result of a single cell clone is two, both are mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of pig primary fibroblasts, the genotype of the single cell clone is double allele different mutant; if the sequencing result of a single cell clone is one, and it is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of pig primary fibroblasts, the genotype of the single cell clone is double allele same mutant; if the sequencing result of a single cell clone is one, and it is consistent with the sequencing result of pig primary fibroblasts, the genotype of the single cell clone is wild type (also referred to as homozygous wild type).

[0208] The results are shown in Table 1. The genotype of single cell clone No. 19 is wild type. The genotypes of single cell clones No. 6, 22, 26, 29, 31, 32 are heterozygous. The genotypes of single cell clones No. 2, 4, 5, 10, 12, 14, 21, 23, 25, 28, 34 are double allele different mutant. The genotypes of single cell clones No. 1, 3, 7, 8, 9, 11, 13, 15, 16, 17, 18, 20, 24, 27, 30, 33 are double allele same mutant. The ratio of obtaining SETDB1 gene editing single cell clones is 97%.

[0209] An exemplary sequencing alignment result is shown in Figures 3 to 6 . Figure 3 is the alignment result of forward sequencing of clone No. 19 with the wild type sequence, which is determined as wild type. Figure 4 is the alignment result of reverse sequencing of clone No. 6 with the wild type sequence, which is determined as heterozygous type. Figure 5 is the alignment result of reverse sequencing of clone No. 10 with the wild type sequence, which is biallelic different mutant type. Figure 6 is the alignment result of forward sequencing of clone No. 1 with the wild type sequence, which is biallelic same mutant type.

[0210] Table 1 Genotype determination results of SETDB1 gene editing single cell clones

[0211]

[0212]

[0213] The above-mentioned single cell clones of heterozygous type, biallelic same mutant type and biallelic different mutant type are all target single cell clones. The cells can be used as nuclear transfer donor cells for somatic cloning, and a cloned pig can be obtained, which is an epigenetic disorder model pig.

[0214] Example 3, Preparation, purification and performance of NCN protein

[0215] I. Construction of prokaryotic Cas9 high-efficiency expression vector

[0216] The structural diagram of plasmid pET-32a is shown in Figure 7 .

[0217] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the structural diagram is shown in Figure 8 .

[0218] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the E. coli BL21 (DE3) strain.

[0219] The main modifications of the plasmid pKG-GE4 are as follows: 1) the coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; a coding sequence of a phoA signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; 2) a coding sequence of a His-Tag is added after the coding sequence of the TrxA protein, which can be used for enrichment of the expressed target protein; 3) a coding sequence of an enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of the His-Tag, and the purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; 4) a codon-optimized Cas9 gene suitable for expression in the E. coli BL21 (DE3) strain is inserted, and a nuclear localization signal coding sequence is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.

[0220] The fusion gene in the plasmid pKG-GE4 is shown in nucleotides 5209-9852 of SEQ ID NO: 1, which encodes a fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the phoA signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form a protein shown in SEQ ID NO: 3, which is named NCN protein.

[0221] II. Inducing expression

[0222] 1. Introducing plasmid pKG-GE4 into E. coli BL21(DE3) to obtain recombinant bacteria.

[0223] 2. Inoculating the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and culturing at 37°C with 200 rpm shaking overnight.

[0224] 3. Inoculating the bacterial solution obtained in step 2 into liquid LB medium, and culturing at 30°C with 230 rpm shaking until the OD value = 1.0, then adding isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then culturing at 25°C with 230 rpm shaking for 12 hours, then centrifuging at 4°C and 10000 g for 15 minutes to collect the bacterial bodies. 600nm

[0225] 4. Washing the bacterial bodies obtained in step 3 with PBS buffer.

[0226] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0227] 1. Taking the bacterial bodies obtained in step two, adding crude extraction buffer and suspending the bacterial bodies, then crushing the bacterial bodies with a homogenizer (1000 par cycles for three times), then centrifuging at 4°C and 15000 g for 30 min to collect the supernatant, filtering the supernatant with a 0.22 μm pore size filter membrane to collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet bacterial bodies.

[0228] Crude extraction buffer: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 1 mM PMSF, and the rest is ddH2O.

[0229] 2. Purifying the fusion protein by affinity chromatography.

[0230] First, equilibrating the Ni-NTA agarose column with 5 column volumes of equilibration liquid (flow rate 1 ml / min); then loading 50 ml of the filtrate obtained in step 1 (flow rate 0.5-1 ml / min); then washing the column with 5 column volumes of equilibration liquid (flow rate 1 ml / min); then washing the column with 5 column volumes of buffer (flow rate 1 ml / min) to remove impurities; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collecting the post-column solution (90-100 ml).

[0231] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, with a filler of 10 ml.​

[0232] Equilibration buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, the rest is ddH2O.

[0233] Buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, the rest is ddH2O.

[0234] Elution buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, the rest is ddH2O.

[0235] IV. Enzymatic digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0236] 1. Take 15 ml of the solution collected after passing through the column in step three, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). A total of 6 ml is obtained using 6 ultrafiltration tubes.

[0237] 2. Add commercially available recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, recombinant bovine enterokinase light chain, His) to the solution obtained in step 1 (about 6 ml), and incubate at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.

[0238] 3. Take the solution after completing step 2 (about 6 ml), mix with 480 μl of Ni-NTA resin (Genscript, L00250 / L00250-C), rotate for 15 min at room temperature, then centrifuge at 7000 g for 3 min, collect the supernatant (4-5.5 ml).

[0239] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add enzyme storage solution, and adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.

[0240] Sequencing shows that the protein in the NCN protein solution has the N-terminal 15 amino acid residues as shown in SEQ ID NO: 3, i.e., NCN protein.

[0241] The NCN protein used in Example 2 was provided by an NCN protein solution.

[0242] Enzyme stock solution (pH 7.4): 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, remainder ddH2O.

[0243] V. Performance of NCN protein

[0244] Two gRNA target sites targeting the TTN gene were selected as follows:

[0245] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0246] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0247] Primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:

[0248] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0249] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0250] 1. Preparation of gRNA

[0251] (1) Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0252] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0253] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0254] (2) In vitro transcription to obtain gRNA

[0255] The TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification, and TTN-gRNA1 was obtained. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0256] TTN-gRNA2 was obtained by using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to transcribe the TTN-T7-gRNA2 transcription template in vitro, and then using MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to recover and purify, to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0257] 2. Optimization of the ratio of gRNA to NCN protein

[0258] (1) Co-transfection of porcine primary fibroblasts

[0259] Group 1: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0260] Group 2: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0261] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0262] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0263] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0264] Co-transfection was performed by electroporation, using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).

[0265] (2) After step (1) is completed, use complete culture solution to culture for 12-18 hours, and then replace the new complete culture solution for culture. The total culture time after electroporation is 48 hours.

[0266] (3) After step (2) is completed, use trypsin to digest and collect cells, extract genomic DNA, use primer pair TTN-F55 and TTN-R560 for PCR amplification, and then perform 1% agarose gel electrophoresis.

[0267] The electrophoretogram is shown in Figure 9 . The 505bp band is the wild type band (WT), and the 254bp band (251bp is theoretically missing from the wild type band 505bp) is the deletion mutant band (MT).

[0268] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. The first group of gene deletion mutation efficiency is 19.9%, the second group of gene deletion mutation efficiency is 39.9%, the third group of gene deletion mutation efficiency is 79.9%, and the fourth group of gene deletion mutation efficiency is 44.3%. The fifth group did not occur mutation.

[0269] The results show that when the mass ratio of two gRNAs to NCN protein is 1:1:4, and the actual amount used is 1 μg:1 μg:4 μg, the gene editing efficiency is the highest. Therefore, the optimal amount of two gRNAs and NCN protein is determined to be 1 μg:1 μg:4 μg.

[0270] 3. Comparison of gene editing efficiency of NCN protein and commercial Cas9 protein

[0271] (1) Co-transfecting porcine primary fibroblasts

[0272] Cas9-A group: co-transfecting TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.

[0273] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0274] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0275] Control group: TTN-gRNA1, TTN-gRNA2 are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0276] Co-transfection is carried out by electroporation, and mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) are used.

[0277] (2) After step (1) is completed, culture with complete culture solution for 12-18 hours, and then replace the new complete culture solution for culture. The total culture time after electroporation is 48 hours.

[0278] (3) After step (2) is completed, the cells are digested with trypsin and collected, genomic DNA is extracted, PCR amplification is carried out by using a primer pair composed of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis is carried out.

[0279] The electrophoretogram is shown in Figure 10 The gene deletion mutation efficiency using commercial Cas9-A protein is 28.5%, the gene deletion mutation efficiency using NCN protein is 85.6%, and the gene deletion mutation efficiency using commercial Cas9-B protein is 16.6%.

[0280] The results show that compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.

[0281] The application has been described in detail above. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives special examples, it should be understood that the application can be further improved. In summary, according to the principle of the application, the present application is intended to include any changes, uses or improvements of the application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims. SEQUENCE LISTING <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing epigenetic disorder model pig nuclear transfer donor cell with SETDB1 gene mutation and application thereof <130> GNCYX213212 <160> 17 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 55 CAGTAAGGCA ACCCCGCCAG CCTAGCCGGG TCCTCAACGA CAGGAGCACG ATCATGCGCA 3300 CCCACCGGAA GGAGCTGACT GGTTGAAGGC TCTCAAGGGC ATCGGTCGAG 3600 GACCAGTGAC GAAGGCTTGA GC GAGGGCGTG CAAGATTC G AATACC G AAGCGACAGG 3420 CGATCATCGT CGCGCTCCAG CGAAAGCGGT CCTCGCCGAA AATGACCCAG AGCGCTGCCG 3480 GCACCTGTCC TACGAGTTGC ATGATAAAGA AGACAGTCA TAAGTGCGGC GACGATAGTC 3540 TGCCCCGCAC CACC G AAG GAGCTGACT G G TTAAGGC TCTCAAGGGC ATCGGTCGAG 3600 ATCCCGGTGC CT AATGAGTGA GCTAAGTTAC TTAATTGCGT TGCCTCCTAC TGCCCGCTT 3660 TCCAGTCGGG AAACCTGTCG TGCCAGCTGC ATTAATGAA TCGGCCAAGC GCGGGGAGAG 3720 GCGGTTTGCG TATTGGGCAC CAGGTTGTTT TTCTTTTCAC CAGTGAGAC GGGCAACAGC 3780 TGATTGCCCT TCACC GCCT G GCCCTGAGAG AGTTGCAGCA AGCGGTCCAC GCTG GTTTGC 3840 CCCAGCAGGC GAAAATCCTG TTTGATGGTG GTTAACGGCG GGATATAACA TGAGCTGTCT 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380 tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500 gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560 gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680 taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740 ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800 atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980 gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160 ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 GAGAATCTTC ATGATGATGA AAGAAGAAGA AGAAGAAGAA GAAGAAGAAG 60 GATGAAATCG CTGACGAATA TCAGGGCAAA CTGACCCTTG CAAAGCTGAA 60 AACCCTGGCA CTGCGCCGAA ATATGGCATC Cgtggtatcc cgactctgct gctgttcaaa 60 AACGgtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg aaagagttc 60 CTCGACGCTA CCTGGCCGGT TCTGgttctg gccatatgca ccatcatcat catgac 60 GATGACGATA AGATGCCCAA AAAGAAACGA AAGGTGGGTA TCCACGGAGT CCCAGCAGCC 60 GACAAAAAAT ATAGCATCGG CCTGGACATC GGTACCAACA GCgttggctg ggcagtgatc 60 ACTGATGAAT ACAAAGTTCC ATCCAAAAAA TTAAAGTAC TGGGCAACAC CGACCgtcac 60 TCTATCAAAA AAACCTGATT GGTGCTCTGC TGTttgacag cggcgaaact gctgaggct 60 ACCCGTCTGA AACGTACGGC TCGCCGTCGC tacactcgtc gtaaaaaccg catctgttat 60 CTGCAGGAAA TTTTCTCTAA CGAAATGGCA AAAGTTGATG ATAGCTTCTT Tcatcgtctg 60 GAAGAGAGCT TCCTGgtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 60 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 GCGGCTTTCA AGTACTTTGA TACCACCAT TGACCgCAAGC GTTACACCTC CACTAAAGAA 9720 GTGCTGGACG CGACTCTGAT CCACCAGTCC ATCACCgGTc TGTACGAGAC CCgtATCGAT 9780 CTGAGCCAGC TGGGCGGTGA CAAAGGCCGG CGGCCACGAA AAAGGCCGGC CAGGC AAAA 9840 AAGAAAAAGT GACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA 9900 ACTAGCATAA CCCCTTGGGG CCTCTAAACG GGTCTTGAGG GGTtttttGCT GAAAGGAAGG 9960 AAGAAAAAGT GACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA 9900 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gin Ser Thr He Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys He He His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala He Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met He Ala Pro He Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gin Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gin Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gin Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gin Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Gin Gin Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gin Leu Val 340 345 350 Gln Thr Tyr Asn Gin Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gin Leu lie His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp lie Gin Lys Ala Gin Val Ser Gly Gin Gly 865 870 875 880 Asp Ser Leu His Glu His lie Ala Asn Leu Ala Gly Ser Pro Ala lie 885 890 895 Lys Lys Gly lie Leu Gin Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn lie Val lie Glu Met Ala Arg 915 920 925 Glu Asn Gin Thr Thr Gin Lys Gly Gin Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg lie Glu Glu Gly lie Lys Glu Leu Gly Ser Gin lie Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gin Leu Gin Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gin Asn Gly Arg Asp Met Tyr Val Asp Gin Glu Leu Asp 980 985 990 lie Asn Arg Leu Ser Asp Tyr Asp Val Asp His lie Val Pro Gin Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser lie Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gin Leu Leu Asn Ala Lys Leu lie Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe lie Lys Arg Gin Leu Val Glu Thr Arg 1075 1080 1085 Gln lie Thr Lys His Val Ala Gin lie Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu lie Arg Glu Val Lys Val lie Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gin Phe Tyr 1125 1130 1135 Lys Val Arg Glu lie Asn Asn Tyr His His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Ala Lys Ser Glu Gin Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gin Val Asn Ile Val Lys Lys Thr Glu Val Gin 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gin Lys Gin Leu Phe Val Glu Gin 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gin Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> 人工序列(Artificial Sequence) <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gin Glu Leu Asp He Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His He Val Pro Gin Ser Phe Leu Lys Asp 850 855 860 Asp Ser He Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gin Leu Leu Asn Ala Lys Leu He Thr Gin Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe He Lys Arg Gin Leu Val Glu Thr Arg Gin He Thr Lys 930 935 940 His Val Ala Gin He Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu He Arg Glu Val Lys Val He Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gin Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gin Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gin Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gin Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gin Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 1292 <212> PRT <213> His sow <400> 8 Met Ser Ser Leu Pro Gly Cys Ile Gly Leu Asp Ala Ala Ala Ala Ala 1 5 10 15 Met Glu Ser Glu Glu Eye Wing Glu Leo Gln Gln Wing Val Val Glu Glu 20 25 30 Leu Gly Is Met Glu Glu Leu Arg Gln Phe Ile Asp Glu Glu Leu 35 40 45 Glu Lys Met Asp Cys Val Gln Gln Arg Lys Lys Gln Leu Ala Glu Leu 50 55 60 Glu Thr Trp Val Ile Gln Lys Glu Ser Glu Val Ala His Val Asp Gln 65 70 75 80 Leu Phe Asp Asp Ala Ser Lys Ala Val Thr Asn Cys Glu Ser Leu Val 85 90 95 Lys Asp Phe Tyr Ser Lys Leu Gly Leu Gln Tyr Arg Asp Ser Ser Ser 100 105 110 Glu Asp Glu Ala Ser Arg Pro Thr Glu lie lie Glu lie Pro Asp Glu 115 120 125 Asp Asp Asp Val Leu Ser lie Asp Ser Gly Asp Ala Gly Ser Arg Thr 130 135 140 Pro Lys Asp Gin Lys Leu Arg Glu Ala Met Ala Ala Leu Arg Lys Ser 145 150 155 160 Ala Gin Asp Val Gin Lys Phe Met Asp Ala Val Asn Lys Lys Ser Ser 165 170 175 Ser Gin Asp Leu His Lys Gly Thr Leu Ser Gin Met Thr Gly Glu Leu 180 185 190 Thr Lys Asp Gly Asp Leu Thr Val Gly Met Arg lie Leu Gly Lys Lys 195 200 205 Arg Thr Lys Thr Trp His Lys Gly Thr Leu lie Ala lie Gin Thr Val 210 215 220 Gly Pro Gly Lys Lys Tyr Lys Val Lys Phe Asp Asn Lys Gly Lys Ser 225 230 235 240 Leu Leu Ser Gly Asn His lie Ala Tyr Asp His His Pro Pro Val Asp 245 250 255 Lys Leu Tyr Val Gly Ser Arg Val Val Ala Lys Tyr Lys Asp Gly Asn 260 265 270 Gln Val Trp Leu Tyr Ala Gly Ile Val Ala Glu Thr Pro Asn Val Lys 275 280 285 Asn Lys Asn Arg Phe Leu Ile Phe Phe Asp Asp Gly Tyr Ala Ser Tyr 290 295 300 Val Thr Glu Ser Glu Leu Tyr Pro Ile Cys Arg Pro Leu Lys Lys Thr 305 310 315 320 Trp Glu Asp Ile Glu Asp Ile Ser Cys Arg Asp Phe Ile Glu Glu Tyr 325 330 335 Ile Thr Ala Tyr Pro Asn Arg Pro Met Val Leu Leu Lys Ser Gly Gln 340 345 350 Leu Ile Lys Thr Glu Trp Glu Gly Thr Trp Trp Lys Ser Arg Val Glu 355 360 365 Glu Val Asp Gly Ser Leu Val Arg Ile Leu Phe Leu Asp Asp Lys Arg 370 375 380 Cys Glu Trp Ile Tyr Arg Gly Ser Thr Arg Leu Glu Pro Met Phe Ser 385 390 395 400 Met Lys Thr Ser Ser Ala Ser Ala Leu Glu Lys Lys Gln Gly Gly Gln 405 410 415 Leu Arg Thr Arg Pro Asn Met Gly Ala Val Arg Ser Lys Gly Pro Val 420 425 430 Val Gin Tyr Thr Gin Asp Leu Thr Ser Thr Gly Thr Gin Phe Lys Pro 435 440 445 Leu Glu Pro Pro Gin Pro Thr Ala Ser Pro Val Pro Pro Ala Pro Ala 450 455 460 Pro Pro Gly Pro Pro Leu Ser Pro Gin Ala Gly Asp Asn Gin Ser Leu 465 470 475 480 Glu Ser Gin Leu Ala Gin Ser Arg Lys Gin Val Ala Lys Lys Ser Thr 485 490 495 Ser Phe Arg Pro Gly Ser Val Gly Ser Gly His Ser Ser Pro Thr Ser 500 505 510 Pro Ala Leu Ser Glu Thr Ala Pro Val Gly Lys Pro Gly He Asn Gin 515 520 525 Thr Tyr Arg Ser Pro Leu Gly Ser Thr Thr Ser Ala Pro Thr Pro Pro 530 535 540 Ala Pro Pro Ala Pro Pro Ala Phe His Gly Met Leu Glu Arg Ala Pro 545 550 555 560 Ala Glu Pro Ser Tyr Arg Ala Pro Met Glu Lys Leu Phe Tyr Leu Pro 565 570 575 His Val Cys Ser Tyr Thr Cys Leu Ser Arg Val Arg Pro Met Arg Asn 580 585 590 Glu Gln Tyr Arg Gly Lys Asn Pro Leu Leu Val Pro Leu Leu Tyr Asp 595 600 605 Phe Arg Arg Met Thr Ala Arg Arg Arg Val Asn Arg Lys Met Gly Phe 610 615 620 His Val Ile Tyr Lys Thr Pro Cys Gly Leu Cys Leu Arg Thr Met Gln 625 630 635 640 Glu Ile Glu Arg Tyr Leu Phe Glu Thr Gly Cys Asp Phe Leu Phe Leu 645 650 655 Glu Met Phe Cys Leu Asp Pro Tyr Val Leu Val Asp Arg Lys Phe Gln 660 665 670 Pro Tyr Lys Pro Phe Tyr Tyr Ile Leu Asp Ile Thr Tyr Gly Lys Glu 675 680 685 Asp Val Pro Leu Ser Cys Val Asn Glu Ile Asp Thr Thr Pro Pro Pro 690 695 700 Gln Val Ala Tyr Ser Lys Glu Arg Ile Pro Gly Lys Gly Val Phe Ile 705 710 715 720 Asn Thr Gly Pro Glu Phe Leu Val Gly Cys Asp Cys Lys Asp Gly Cys 725 730 735 Arg Asp Lys Ser Lys Cys Ala Cys His Gin Leu Thr lie Gin Ala Thr 740 745 750 Ala Cys Thr Pro Gly Gly Gin lie Asn Pro Asn Ser Gly Tyr Gin Tyr 755 760 765 Lys Arg Leu Glu Glu Cys Leu Pro Thr Gly Val Tyr Glu Cys Asn Lys 770 775 780 Arg Cys Lys Cys Asp Pro Asn Met Cys Thr Asn Arg Leu Val Gin His 785 790 795 800 Gly Leu Gin Val Arg Leu Gin Leu Phe Lys Thr Gin Asn Lys Gly Trp 805 810 815 Gly lie Arg Cys Leu Asp Asp lie Ala Lys Gly Ser Phe Val Cys lie 820 825 830 Tyr Ala Gly Lys lie Leu Thr Asp Asp Phe Ala Asp Lys Glu Gly Leu 835 840 845 Glu Met Gly Asp Glu Tyr Phe Ala Asn Leu Asp His lie Glu Ser Val 850 855 860 Glu Asn Phe Lys Glu Gly Tyr Glu Ser Asp Ala Pro Cys Ser Ser Asp 865 870 875 880 Ser Ser Gly Val Asp Leu Lys Asp Gin Glu Asp Gly Asn Ser Gly Thr 885 890 895 Glu Asp Pro Glu Glu Ser Asn Asp Asp Ser Ser Asp Asp Asn Phe Cys 900 905 910 Lys Asp Glu Asp Phe Ser Thr Ser Ser Val Trp Arg Ser Tyr Ala Thr 915 920 925 Arg Arg Gln Thr Arg Gly Gln Lys Glu Asn Gly Leu Ser Glu Met Pro 930 935 940 Ser Lys Asp Ser Arg Pro Pro Asp Leu Gly Pro Pro His Ile Pro Val 945 950 955 960 Ser Pro Ser Ile Pro Val Gly Ser Cys Asn Pro Pro Ser Ser Glu Glu 965 970 975 Thr Pro Lys Asn Lys Val Ala Ser Trp Leu Ser Cys Asn Ser Val Asn 980 985 990 Glu Gly Gly Phe Ala Asp Ser Asp Ser Arg Ser Ser Phe Lys Thr Ser 995 1000 1005 Glu Gly Gly Glu Gly Arg Ala Gly Gly Ser Arg Gly Glu Ala Glu Lys 1010 1015 1020 Ala Ser Ser Ser Gly Leu Gly Phe Lys Asp Glu Gly Asp Ile Lys Gln 1025 1030 1035 1040 Ala Lys Lys Glu Asp Pro Asp Asp Arg Ser Lys Met Ser Ile Val Thr 1045 1050 1055 Glu Ser Ser Arg Asn Tyr Gly Tyr Asn Pro Ser Pro Val Lys Ile Glu 1060 1065 1070 Gly Leu Arg Arg Pro Pro Ser Lys Thr Ser Met His Gln Ser Arg Arg 1075 1080 1085 Leu Leu Ala Phe Ala Gln Ser Asn Pro Asp Asp Ile Leu Thr Leu Ser 1090 1095 1100 Ser Ser Thr Glu Ser Glu Gly Glu Ser Gly Thr Ser Arg Lys Pro Thr 1105 1110 1115 1120 Ala Gly Gln Thr Ser Ala Thr Ala Val Asp Ser Asp Asp Ile Gln Thr 1125 1130 1135 Ile Ser Ser Gly Ser Glu Gly Asp Asp Phe Glu Asp Lys Lys Asn Met 1140 1145 1150 Ser Gly Pro Val Lys Arg Gln Val Ala Val Lys Ser Thr Arg Gly Phe 1155 1160 1165 Ala Leu Lys Ser Thr His Gly Ile Ala Ile Lys Ser Thr Asn Met Ala 1170 1175 1180 Ser Val Glu Lys Gly Glu Ser Ala Pro Val Arg Lys Asn Thr Arg Gln 1185 1190 1195 1200 Phe Tyr Asp Gly Glu Glu Ser Cys Tyr He He Asp Ala Lys Leu Glu 1205 1210 1215 Gly Asn Leu Gly Arg Tyr Leu Asn His Ser Cys Ser Pro Asn Leu Phe 1220 1225 1230 Val Gin Asn Val Phe Val Asp Thr His Asp Leu Arg Phe Pro Trp Val 1235 1240 1245 Ala Phe Phe Ala Ser Lys Arg He Arg Ala Gly Thr Glu Leu Thr Trp 1250 1255 1260 Asp Tyr Asn Tyr Glu Val Gly Ser Val Glu Gly Lys Glu Leu Leu Cys 1265 1270 1275 1280 Cys Cys Gly Ala He Glu Cys Arg Gly Arg Leu Leu 1285 1290 <210> 9 <211> 700 <212> DNA <213> Sus scrofa <400> 9 tttacttttg aaaagaagag ggtttttatt gtttaggctt ttgagggggg gcaatggggg 60 gttggtttgt ttttatggcc agccacccct gcacatggaa gttcctgggc cagcagttga 120 atctgagcca cagcttcagc aacgcaggat cctttaaccc actgcgctgg gctggggttc 180 GAACCTGCGC CTCCACAGCA ACCCAAGCTG CTGCAGTCAG AAAAAGAAAA TTCTTATTCC 240 ACAAACTGTT TT TAGCCC GT GCT ATTTT AA AATT TATTTC CCTCATCCCC TTC ATTAG 300 CTTCGTGAAG CTATGGCTGC CTTAAGAAAG TCGGCTCAAG ATGTCCAGAA GTT CATGGAT 360 GCCGTCAACA AGAAGAGCAG TTCCCAGGAT CTTCACAAAG GTTAGGGTCA AGAGGTT CCT 420 AAGTATAGGG AGGGGT CATGAATT CCTACAGAGA TTTCATGGGT GACTGGTTTT GTTTTG 480 GCATTT CAGA ATCCTTCACC TCTCTTGAGT TCTTTTAACA CCACAGGTTT TCCTTGCTAT 540 CTACTTAAGT CTTTTGTCTG CTCGTTTCC AAATACCGTT TTAGCTCCAT GTTTATGATC 600 TCTTCTTCCA GGTGCAGGTT AGAGAGAAGA CAGTGACTCA AAAC TCTTAAAAG AGGTGT 660 GGCAAAGCTT TGTA GAA TGGTGCTGT TAAG AGATCTCTCT 700 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 UAUGGCU GCCUUAAGAAAGU G UUUUAGAGC UAGAAAUAGC AAGUUA AAAU AAGGCUAGUC 60 CGUUAUCAAC UUGAAAAAGU GGCACC GAGUCGGUGCUUUU 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 ucaagauguc cagaaguuca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 caacaagaag agcaguuccc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 ggaacugcuc uucuuguuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 225 <212> DNA <213> Artificial Sequence <400> 14 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggtatgg ctgccttaag aaagtgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 15 <211> 225 <212> DNA <213> Artificial Sequence <400> 15 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggggaac tgctcttctt gttgagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 16 <211> 102 <212> RNA <213> Artificial Sequence <400> 16 gguauggcug ccuuaagaaa guguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 17 <211> 102 <212> RNA <213> Artificial Sequence <400> 17 ggggaacugc ucuucuuguu gaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. Application of SETDB1-gRNA1, SETDB1-gRNA4, and NCN protein in the preparation of kits; The SETDB1-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the SETDB1-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17; the NCN protein is shown as SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography; (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing epigenetic disorder model pigs; (c) preparing epigenetic disorder cell models or epigenetic disorder tissue models or epigenetic disorder organ models.

2. A method for preparing recombinant cells, comprising the following steps: co-transfecting SETDB1-gRNA1, SETDB1-gRNA4 and NCN protein into pig cells to obtain recombinant cells; SETDB1-gRNA1 is the SETDB1-gRNA1 described in claim 1; SETDB1-gRNA4 is the SETDB1-gRNA4 described in claim 1; and NCN protein is the NCN protein described in claim 1.

3. A kit comprising SETDB1-gRNA1, SETDB1-gRNA4, and NCN protein; SETDB1-gRNA1 is the SETDB1-gRNA1 described in claim 1; SETDB1-gRNA4 is the SETDB1-gRNA4 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing epigenetic disorder model pigs; (c) preparing epigenetic disorder cell models or epigenetic disorder tissue models or epigenetic disorder organ models.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • Application of gRNA target combinations in construction of hemophilia model pig cell line

    CN112442515A