Simultaneous identification of anthracnose, powdery mildew, and brown spot on honeysuckle based on real-time PCR

Through Real-time PCR technology and the design of specific primers and probes using the ITS gene, the problem of rapid identification of the pathogens of honeysuckle anthracnose, powdery mildew and brown spot disease was solved, achieving efficient and accurate pathogen detection and ensuring the stability of honeysuckle yield and quality.

CN115247219BActive Publication Date: 2025-09-12SHANDONG UNIV OF TRADITIONAL CHINESE MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111582499.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-22
Publication Date
2025-09-12
Estimated Expiration
2041-12-22

AI Technical Summary

Technical Problem

The existing technology lacks systematic and in-depth research on the detection methods of the pathogens of honeysuckle anthracnose, powdery mildew and brown spot disease. The detection technology is lagging behind, making it difficult to quickly and accurately identify them, which affects the yield and quality of honeysuckle.

Method used

Real-time PCR technology was used to select the ITS gene as the target gene. Specific primers and TaqMan fluorescent probes were designed. A rapid detection method for identifying the pathogens of anthracnose, powdery mildew and brown spot disease of honeysuckle was established through fluorescent PCR amplification.

Benefits of technology

It achieves rapid and accurate simultaneous identification of three pathogens in the same tube, improves the resolution and sensitivity of detection, reduces the fluorescence background signal intensity of the fluorescent PCR reaction, and ensures the accuracy and reliability of the detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005520507110000041
    Figure GDA0005520507110000041
  • Figure GDA0005520507110000051
    Figure GDA0005520507110000051
  • Figure GDA0005520507110000061
    Figure GDA0005520507110000061
Patent Text Reader

Abstract

The present invention discloses a method for simultaneously identifying anthracnose, powdery mildew, and brown spot diseases of honeysuckle based on real-time PCR. The method detects the three pathogens of honeysuckle, powdery mildew, and brown spot diseases, selects the ITS gene as a target gene, designs primers and TaqMan fluorescent probes, and performs fluorescent PCR amplification to rapidly and accurately identify the pathogens of anthracnose, powdery mildew, and brown spot diseases of honeysuckle. The method is used to rapidly and accurately identify the pathogens of anthracnose, powdery mildew, and brown spot diseases of honeysuckle, lays an etiological foundation for the prevention and treatment of the three diseases of honeysuckle, and is of great significance for ensuring the stable growth of honeysuckle quality and yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a method for simultaneously identifying honeysuckle anthracnose, powdery mildew and brown spot based on Real-time PCR, and belongs to the technical field of pathogen nucleic acid detection. Background Art

[0002] Honeysuckle (Lonicera japonica Thunb.), a member of the Caprifoliaceae family and the genus Lonicera, is one of the 70 nationally recognized precious medicinal materials. Used medicinally, its dried buds or newly opened flowers possess potent heat-clearing and detoxifying, antibacterial, and antiviral properties, earning it a reputation as a broad-spectrum antibiotic. It can be used both as a medicinal herb and as a tea substitute. As a major Chinese medicinal herb and a raw material for daily health products, it holds great promise for development. Shandong is the authentic production area for honeysuckle and a source of supply for numerous pharmaceutical companies. As the area of ​​honeysuckle cultivated continues to expand, the incidence of diseases has also increased annually, becoming a major factor affecting its yield and quality. A survey of honeysuckle diseases in Shandong revealed that anthracnose, powdery mildew, and brown spot are the main leaf diseases affecting the flower. The incidence of brown spot is higher than that of anthracnose and powdery mildew, but all three diseases occur in all honeysuckle-producing areas.

[0003] Honeysuckle is an important traditional Chinese medicinal material in my country, but research reports on its diseases are limited, and there is an even lack of systematic and in-depth research on its three pathogens. Li Zhihong et al. reported the isolation and identification of the pathogen of honeysuckle anthracnose, and Wang Guangjun et al. reported that the diseases occurring on honeysuckle include root rot, powdery mildew, and brown spot. Wu Chaofeng et al. reported that the main diseases occurring on honeysuckle in Henan Province, and Li Zhengmao et al. reported that the main diseases occurring on honeysuckle in Hunan Province were also root rot, powdery mildew, and brown spot. However, these studies reported on etiology and pathogenicity. Fu Yu, through a relatively systematic study, reported that there are two pathogens of honeysuckle anthracnose in Chongzhou City, Sichuan Province: C. capsici and C. gloeosporioides. Hu Zhongchang et al. studied the diseases of Lonicera japonica in the Caprifoliaceae family in Longhui, Hunan Province, and found that the pathogen of anthracnose on large-leaf honeysuckle is C. gloeosporioides. There are very limited reports on the pathogens of honeysuckle and Caprifoliaceae plants, and the detection technology is also quite backward, requiring the pathogens to be cultured and separated, observed under an electron microscope, and identified by morphology. With the development of molecular biology techniques, some biological identification methods based on DNA have gradually become abundant. The DNA molecular method mainly utilizes the different DNA sequence information possessed by various biological species showing biological characteristics to identify. It can break through the limitations of sensory detection and is more objective and accurate than traditional analytical methods. In recent years, the rapid development of real-time fluorescence PCR technology has greatly improved the sensitivity, specificity and accuracy of detection, and made it possible to quantitatively trace the content of ingredients. Therefore, the present invention, based on current research reports, establishes a fluorescent quantitative kit and detection method for rapid identification of honeysuckle anthracnose, powdery mildew and brown spot pathogens, in order to solve the target problem during the prevention and treatment of the three diseases. Summary of the Invention

[0004] The present invention overcomes the deficiencies of the above-mentioned prior art and provides a method for simultaneously identifying honeysuckle anthracnose, powdery mildew and brown spot based on real-time PCR. The method detects the three pathogens of honeysuckle anthracnose, powdery mildew and brown spot, selects the ITS gene as a target gene, designs primers and TaqMan fluorescent probes, and performs fluorescent PCR amplification to quickly and accurately identify the pathogens of honeysuckle anthracnose, powdery mildew and brown spot.

[0005] A method for simultaneously identifying anthracnose, powdery mildew, and brown spot of honeysuckle based on real-time PCR, comprising the following steps:

[0006] 1) Extract DNA from the sample to be tested as a template and select the target gene;

[0007] 2) PCR amplification was performed using primers and probe combinations of the pathogens of honeysuckle anthracnose, powdery mildew, and brown spot as PCR amplification primers;

[0008] 3) Establish positive, negative, and blank controls, analyze the experimental results, and present the fluorescence increase value ΔRn and the amplification curve Ct value at the nth cycle. Determine whether anthracnose, powdery mildew, or brown spot disease of honeysuckle is detected based on the probe fluorescence signal and the amplification curve Ct value.

[0009] Furthermore, the nucleotide sequence of the honeysuckle anthracnose pathogen primer described in step 2) is as follows:

[0010] Colletotrichum_gloeosporioidesF: AGTTTACGCTCTATAACCCTTTG (SEQ ID NO. 1);

[0011] Colletotrichum_gloeosporioidesR:TTATTTGCTTTGTACCACTCAGAA (SEQ ID NO. 2).

[0012] Furthermore, the nucleotide sequence of the primer for the powdery mildew pathogen of honeysuckle described in step 2) is as follows:

[0013] Erysiphe_loniceraeF: CGATTTGTATCTTGTTGCTTTG (SEQ ID NO.3);

[0014] Erysiphe_loniceraeR: AACATGAGTTTTTGGTTAGGTCT (SEQ ID NO. 4).

[0015] Furthermore, the nucleotide sequence of the primers for the pathogen of honeysuckle brown spot disease described in step 2) is as follows:

[0016] Cercospora_sp-F:GAATCTTTGAACGCACATTG (SEQ ID NO.5);

[0017] Cercospora_sp-R: ATGAAATCACAACGCTTAGAGA (SEQ ID NO. 6).

[0018] Furthermore, the nucleotide sequences of the probes for the pathogens of honeysuckle anthracnose, powdery mildew and brown spot disease described in step 2) are as follows:

[0019] Colletotrichum_gloeosporioides P: 5'ROX–TAACTGTTGCTTCGGCGGGTAGG-BHQ23' (SEQ ID NO.7);

[0020] Erysiphe_lonicerae P: 5'JOE–ATGTCGTCGAGCTCCGCAAG-BHQ2 3' (SEQ ID NO.8);

[0021] Cercospora-P: 5'FAM-TCATTTCACCACTCAAGCCTCG-BHQ2 3' (SEQ ID NO. 9).

[0022] Furthermore, the 5' end of the probe sequence is modified with a reporter group, and the 3' end is modified with a quencher group, wherein the reporter group is any one of FAM, JOE, TAMRA, ROX, and CY5, and the quencher group is any one of Dabcyl, BHQ1, and BHQ2. A preferred embodiment of the present invention for the anthrax pathogen is to use the fluorescent group ROX to label the 5' end and the quencher BHQ2 to label the 3' end. A preferred embodiment for powdery mildew is to use the fluorescent group JOE to label the 5' end and the quencher BHQ2 to label the 3' end. A preferred embodiment for brown spot disease is to use the fluorescent group FAM to label the 5' end and the quencher BHQ2 to label the 3' end.

[0023] Furthermore, the reaction amplification system for PCR amplification described in step 2) above is as follows: a 20 μL reaction system is used, including: 10 μL of 2×TaqMan Master Mix, 1 μL each of anthracnose pathogen primers and probe combinations, 1 μL each of powdery mildew pathogen primers and probe combinations, 1 μL each of brown spot pathogen primers and probe combinations, 1 μL of DNA template, and ddH2O to 20 μL.

[0024] Furthermore, the final concentrations of anthracnose, powdery mildew and brown spot primers in the above-mentioned PCR amplification reaction amplification system are 0.25 μM, 0.5 μM and 0.5 μM respectively; the final concentrations of the probe composition in the reaction amplification system are 0.15 μM, 0.25 μM and 0.25 μM respectively, and the DNA dosage is 1 to 100 ng.

[0025] Furthermore, the basis for determining whether honeysuckle anthracnose, powdery mildew, and brown spot disease are detected based on the probe fluorescence signal and the amplification curve Ct value in step 3) is as follows:

[0026] When the FAM fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the brown spot pathogen is detected in the sample to be tested, which is positive; when the JOE fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the powdery mildew pathogen is detected in the sample to be tested, which is positive; when the ROX fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the anthrax pathogen is detected in the sample to be tested, which is positive; if the FAM, JOE, or ROX fluorescent modified probes do not have an amplification curve, or Ct>35, it indicates a negative result.

[0027] Beneficial effects:

[0028] The target gene of the present invention is selected from the internal transcribed spacer ITS gene. Compared with other fungal genes, it is special in the overall structure and function of ribosomal rDNA. It has certain conservatism and high variability, and there are significant differences between species. Therefore, using the ITS sequence as the target gene of the pathogens of honeysuckle anthracnose, powdery mildew and brown spot disease has strong characteristics and high accuracy.

[0029] The present invention utilizes TaqMan probe technology to establish a multiplex real-time fluorescence quantitative PCR rapid detection technology for honeysuckle anthracnose, powdery mildew and brown spot. The 5' end is labeled with different fluorescent reporter groups, and there is no mutual interference between the signals. The highest base difference can be identified, which increases the resolution of the detection. At the same time, the quenching group is a non-fluorescent group and does not produce fluorescence itself, which reduces the fluorescence background signal intensity of the real-time fluorescence PCR reaction and improves its sensitivity. The honeysuckle anthracnose, powdery mildew and brown spot pathogen-specific primers and specific probes designed by the present invention have greatly improved accuracy and reliability. Fluorescence quantitative PCR is detected in the same tube, without opening the lid, and is not easy to contaminate. It has the beneficial effects of accurate and stable operation, high sensitivity, strong specificity, and large throughput, and can quickly and accurately identify honeysuckle disease specimens and sample materials such as soil. In short, the present invention can be used to quickly and accurately identify honeysuckle anthracnose, powdery mildew and brown spot pathogens, laying a pathological foundation for the prevention and treatment of the three diseases of honeysuckle, and is of great significance to ensuring the stable growth of honeysuckle quality and yield. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention is further described below in conjunction with embodiments. The described embodiments are only part of the embodiments of this application, not all of them, and the present invention is not limited to the following embodiments.

[0031] Example 1

[0032] Experimental Materials

[0033] Honeysuckle disease specimens were collected from a honeysuckle cultivation base in Fei County, Linyi, Shandong Province. Leaves showing typical disease symptoms were collected, stored in envelopes, and brought back to the laboratory for storage at 4°C. The pathogen was isolated using a tissue separation method. After rinsing the diseased leaves with running water, a 5-mm-long tissue block was obtained from the junction of the diseased and healthy leaves. After surface disinfection with 70% ethanol and 2% hypochlorous acid solution, the block was rinsed three times with sterile distilled water and aseptically plated on potato dextrose agar (PDA) plates. The plates were then inverted and incubated in an incubator at 28°C for 3 days.

[0034] Reagents and instruments

[0035] PCR reagents such as the plant DNA extraction kit, DNA Maker DL2000, and electrophoresis loading buffer were purchased from Takara Biotechnology (Dalian) Co., Ltd. Primers and probes were synthesized by Shanghai Jierui Biotechnology Co., Ltd. 2× TaqMan Master Mix was from DBI Bioscience. DNA sequencing was performed by the Sequencing Center of the Crop Germplasm Resources Institute, Shandong Academy of Agricultural Sciences.

[0036] Instruments used: ABI 7500 fluorescence quantitative PCR instrument is a product of ABI, Takara PCR instrument is a product of Takara Biotechnology (Dalian) Co., Ltd. 5424D high-speed centrifuge is a product of Eppendorf.

[0037] Example 1 Establishment of a Multiplex Real-Time Fluorescence PCR Detection System for Pathogens of Anthracnose, Powdery Mildew and Brown Spot Disease of Honeysuckle 1. Selection of Target Genes and Design of Primers:

[0038] The ITS sequence is a non-coding sequence located between the 5.8S and 28S rRNA genes. Due to its unique structural and functional nature within the ribosomal rDNA, it exhibits both a degree of conservation and high variability. Its sequence can vary significantly between species and individuals of the same species. Therefore, using ITS sequences as target genes for identifying the pathogens of honeysuckle anthracnose, powdery mildew, and brown spot disease is both simple and reliable. The nucleotide sequences are shown in Table 1.

[0039] Table 1. Primer and probe sequences

[0040]

[0041]

[0042] It should be noted that the above primers and probes were synthesized using conventional methods in the art, and the primers and probes used in this example were commissioned to be synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0043] The instrument used for the real-time fluorescence PCR detection described in the embodiment of the present invention is the fluorescence quantitative PCR instrument ABI7500.

[0044] 2. Based on the above primers, probes and system conditions, a multiplex real-time fluorescence quantitative PCR detection method is provided that can simultaneously detect the pathogens of anthracnose, powdery mildew and brown spot of honeysuckle, comprising the following steps:

[0045] (1) Pathogen DNA extraction

[0046] After culturing symptomatic honeysuckle leaf samples, hyphae were selected and extracted using a fungal genomic DNA extraction kit. Specific procedures are described in the kit instructions. The purity and concentration of the extracted genomic DNA were determined by UV spectrophotometry. The OD260 / OD280 values ​​were consistently between 1.8 and 1.9, with concentrations above 10 ng / μL, indicating high DNA purity and a moderate concentration, meeting the requirements for PCR amplification.

[0047] (2) Using the primers and probes to perform TaqMan multiplex real-time fluorescence quantitative PCR detection

[0048] The multiplex real-time fluorescence quantitative PCR reaction system is 20 μL and includes: 10 μL of 2× TaqMan Master Mix, 1 μL each of the primer and probe combination for the anthracnose pathogen, 1 μL each of the primer and probe combination for the powdery mildew pathogen, 1 μL each of the primer and probe combination for the brown spot pathogen, 1 μL of DNA template, and ddH2O to 20 μL. The final concentration of the primer set is 0.1-0.5 μM, the final concentration of the probe combination is 0.05-0.25 μM, and the DNA dosage is 1-100 ng.

[0049] The multiplex real-time fluorescence quantitative PCR amplification conditions are: 95° C. for 2 min; 95° C. for 10 s, 60° C. for 35 s, during which the fluorescence signal is collected, for 40 cycles.

[0050] Analysis of the test results: Positive controls, negative controls, and blank controls are set up for each test. After the test, the analysis software is opened to analyze the experimental results, and the ΔRn (fluorescence increase value at the nth cycle) and the amplification curve Ct value are given. The positive or negative test sample is determined based on the corresponding probe fluorescence signal and the amplification curve Ct value. When the FAM fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the sample to be tested has detected the brown spot pathogen and is positive; when the JOE fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the sample to be tested has detected the powdery mildew pathogen and is positive; when the ROX fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the sample to be tested has detected the anthrax pathogen and is positive; if the FAM, JOE, or ROX fluorescent modified probes do not have an amplification curve, or if Ct>35, it indicates a negative result.

[0051] Example 2 Specificity test

[0052] The primers and probes designed in this invention were used to perform real-time fluorescence PCR using genomic DNA from fungi such as Colletotrichum gloeosporioides, Selerotium rolfsii Sacc, Cercospora rhamni Fack, Trichoderma spp., Fusarium graminearum, Stemphylium sp., Erysiphe lonicerae, and Aspergillus nige as templates to verify the specificity of the primers and probes. The results are shown in Table 2, which show that the probes and primers designed in this study have strong specificity.

[0053] Table 2. Specificity verification test

[0054]

[0055] Example 3. Sensitivity test:

[0056] Real-time fluorescence quantitative PCR was performed to evaluate the detection limit of the present invention using 50 ng of genomic DNA from the pathogens of anthracnose, powdery mildew, and brown spot. The DNA was diluted in a 5x gradient, with 2.0 μL of each sample used as the template (i.e., 10 ng, 2 ng, 0.4 ng, 0.08 ng, and 0.016 ng). The results showed that the detection limit of the present invention was 0.08 ng, demonstrating the high sensitivity of the method provided by the present invention.

[0057] Example 4 Actual sample test

[0058] Twenty honeysuckle disease specimens were collected from different planting areas in Linyi, Shandong Province. Honeysuckle leaves with typical disease symptoms were collected. After treatment and culture, genomic DNA was extracted. The samples were tested using the kit and detection method provided by the present invention, and the results were verified with the sequencing results, morphological identification and detection methods. The results showed that the present method was completely consistent with the sequencing results, and was more accurate, reliable, sensitive and rapid than the morphological method.

[0059] Table 3. Actual sample test

[0060]

[0061] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention. SEQUENCE LISTING <110> Shandong Academy of Agricultural Sciences <120> Simultaneous identification of anthracnose, powdery mildew, and brown spot on honeysuckle based on real-time PCR <130> 2021 <160> 9 <170> PatentIn version 3.3 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 agtttacgct ctataaccct ttg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 ttatttgctt gtaccactca gaa 23 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 cgatttgtat cttgttgctt tg 22 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence <400> 4 aacatgagtt tttggttagg tct 23 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 gaatctttga acgcacattg 20 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <400> 6 atgaaatcac aacgcttaga ga 22 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <400> 7 taactgttgc ttcggcgggt agg 23 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 atgtcgtcga gctccgcaag 20 <210> 9 <211> twenty two <212> DNA <213> Artificial sequence <400> 9 tcatttcacc actcaagcct cg 22

Claims

1. A method for simultaneously identifying anthracnose, powdery mildew, and brown spot of honeysuckle based on real-time PCR, characterized in that: The steps include: 1) Extract DNA from the sample to be tested as a template and select the target gene; 2) PCR amplification was performed using primers and probe combinations of the pathogens of honeysuckle anthracnose, powdery mildew, and brown spot as PCR amplification primers; 3) Establish positive controls, negative controls, and blank controls, analyze the experimental results, and present the fluorescence increase value ΔRn and the amplification curve Ct value at the nth cycle. Determine whether anthracnose, powdery mildew, or brown spot disease of honeysuckle is detected based on the probe fluorescence signal and the amplification curve Ct value; The nucleotide sequence of the honeysuckle anthracnose pathogen primer described in step 2) is as follows: Colletotrichum_gloeosporioidesF:AGTTTACGCTCTATAACCCTTTG; Colletotrichum_gloeosporioidesR:TTATTTGCTGTACCACTCAGAA; The nucleotide sequence of the primer for the powdery mildew pathogen of honeysuckle described in step 2) is as follows: Erysiphe_loniceraeF:CGATTTGTATCTTGTTGCTTTG; Erysiphe_loniceraeR:AACATGAGTTTTTGGTTAGGTCT; The nucleotide sequence of the primer for the pathogen of honeysuckle brown spot disease described in step 2) is as follows: Cercospora_sp-F:GAATCTTTGAACGCACATTG; Cercospora_sp-R:ATGAAATCACAACGCTTAGAGA; The nucleotide sequences of the probes for the pathogens of honeysuckle anthracnose, powdery mildew and brown spot disease described in step 2) are as follows: Colletotrichum_gloeosporioides P: 5'ROX–TAACTGTTGCTTCGGCGGGTAGG-BHQ23'; Erysiphe_lonicerae P: 5'JOE–ATGTCGTCGAGCTCCGCAAG-BHQ2 3'; Cercospora-P: 5'FAM–TCATTTCACCACTCAAGCCTCG-BHQ2 3'.

2. The method according to claim 1, wherein The PCR amplification reaction system described in step 2) is as follows: a 20 μL reaction system is used, including: 10 μL of 2×TaqMan Master Mix, 1 μL each of anthracnose pathogen primers and probe combinations, 1 μL each of powdery mildew pathogen primers and probe combinations, 1 μL each of brown spot pathogen primers and probe combinations, 1 μL of DNA template, and ddH2O to 20 μL.

3. The method according to claim 2, wherein The final concentrations of anthracnose, powdery mildew and brown spot primers in the reaction amplification system are 0.25 μM, 0.5 μM and 0.5 μM respectively; the final concentrations of the probe composition in the reaction amplification system are 0.15 μM, 0.25 μM and 0.25 μM respectively.

4. The method according to any one of claims 1 to 3, wherein The basis for determining whether honeysuckle anthracnose, powdery mildew, and brown spot disease are detected based on the probe fluorescence signal and the amplification curve Ct value in step 3) is as follows: When the FAM fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the brown spot pathogen is detected in the sample to be tested, which is positive; when the JOE fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the powdery mildew pathogen is detected in the sample to be tested, which is positive; when the ROX fluorescent modified probe has an amplification curve and satisfies Ct≤35, it indicates that the anthrax pathogen is detected in the sample to be tested, which is positive; if the FAM, JOE, or ROX fluorescent modified probes do not have an amplification curve, or Ct>35, it indicates a negative result.

Citation Information

Patent Citations

  • Nucleic acid, kit and method for multiple detection of canker pathogens, cercospora arachidicola and witch's broom phytoplasma

    CN107541560A