Novel coronavirus double detection kit

Abstract

The application discloses a kit and a method for multiplex detection of novel coronavirus nucleic acid, which can simultaneously detect two nucleic acid targets of the novel coronavirus, has extremely high sensitivity and specificity, and significantly improves the accuracy of virus identification.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology and molecular diagnosis, and particularly relates to a primer probe combination and a kit for detecting a novel coronavirus 2019-nCoV. BACKGROUND

[0002] The novel coronavirus (2019 novel corona virus, 2019-nCoV, SARS-CoV-2) belongs to the beta genus coronavirus, has an envelope, and the particles are round or oval, often pleomorphic, with a diameter of 60-140 nm. The S protein is one of the main proteins of the virus, and its encoding gene is used for virus typing. The molecular mechanism of the S-protein interacting with human ACE2 to infect human respiratory epithelial cells, and the human infected with the coronavirus often has signs such as fever, cough, shortness of breath, and difficulty breathing. Severe infection can lead to pneumonia, severe deformity respiratory syndrome, kidney failure, and even death. This novel coronavirus has a strong infectivity to humans, and the lung infection caused thereby is named as "novel coronavirus pneumonia" (COVID-19).

[0003] At present, the main confirmed diagnosis method for infection of the novel coronavirus is CT lung imaging, but for the outbreak of the epidemic, there are the following defects:

[0004] 1. CT is easy to cause cross infection, unless a completely closed separate instrument is used, and disinfection is performed at all times, which is beyond the equipment and manpower of most epidemic areas;

[0005] 2. CT positive also has the possibility of misdiagnosis, and if the patient is an ordinary influenza patient, the CT image also has ground glass shadow;

[0006] 3. CT instrument is expensive, and the epidemic areas in remote and underdeveloped areas cannot match the related instruments.

[0007] And the fluorescent PCR method can make up for these deficiencies. Real-time fluorescent PCR technology is to add a specific fluorescent probe in the nucleic acid reaction tube at the same time as a pair of primers. The probe is an oligonucleotide, and the two ends are labeled with a reporter fluorescent group and a quencher fluorescent group. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; at the beginning, the probe is combined on any single strand of DNA; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme degrades the probe to make the reporter fluorescent group and the quencher fluorescent group separate, so that the fluorescent monitoring system can receive the fluorescent signal, that is, one fluorescent molecule is formed for each DNA strand amplification, and the accumulation of fluorescent signal is completely synchronized with the formation of PCR product. Fluorescent PCR technology is a nucleic acid detection technology with higher sensitivity, specificity and precision, which has accurate detection results, high repeatability, can reflect the changes of pathogens, and avoids the need for post-processing of traditional PCR, and reduces the possibility of pollution.

[0008] Therefore, it is necessary to develop a product with high sensitivity, strong specificity and good repeatability for nucleic acid detection of the novel coronavirus. SUMMARY

[0009] The purpose of the present application is to provide a novel coronavirus double detection kit, so as to efficiently and specifically detect patients infected with the novel coronavirus 2019-nCoV at low cost.

[0010] In a first aspect of the present application, a primer pair set for detecting nucleic acid of the novel coronavirus 2019-nCoV is provided, and the primer pair set comprises:

[0011] The first primer pair group comprises:

[0012] The forward primer as shown in SEQ ID NO. 1; and the reverse primer as shown in SEQ ID NO. 2.

[0013] In another preferred embodiment, the primer pair set further comprises:

[0014] The second primer pair group comprises:

[0015] The forward primer as shown in SEQ ID NO. 4; and the reverse primer as shown in SEQ ID NO. 5.

[0016] In another preferred embodiment, the primer pair set further comprises:

[0017] The internal standard primer pair group comprises:

[0018] a forward primer as set forth in SEQ ID NO. 7; and a reverse primer as set forth in SEQ ID NO. 8.

[0019] In a second aspect of the present application, a probe set for multiplex detection of nucleic acid of novel coronavirus 2019-nCoV is provided, the probe set comprising a first probe with a nucleotide sequence as set forth in SEQ ID NO. 3.

[0020] In another preferred embodiment, the probe set further comprises a second probe with a nucleotide sequence as set forth in SEQ ID NO. 6.

[0021] In another preferred embodiment, the probe set further comprises an internal control probe with a nucleotide sequence as set forth in SEQ ID NO. 9.

[0022] In another preferred embodiment, the 5' end of each probe comprises a fluorescent reporter group; and / or, the 3' end of each probe comprises a fluorescent quencher group.

[0023] In another preferred embodiment, the fluorescent reporter groups of the probes are different from each other.

[0024] In a third aspect of the present application, a kit for multiplex detection of nucleic acid of novel coronavirus 2019-nCoV is provided, the kit comprising the primer pair set according to the first aspect of the present application.

[0025] In another preferred embodiment, the kit further comprises the probe set according to the second aspect of the present application.

[0026] In another preferred embodiment, the kit comprises a first container containing a primer-probe mixture, the primer-probe mixture comprising the polynucleotide sequences as set forth in SEQ ID NO. 1-6.

[0027] In another preferred embodiment, the kit comprises a first container containing a primer-probe mixture, the primer-probe mixture further comprising the polynucleotide sequences as set forth in SEQ ID NO. 7-9.

[0028] In another preferred embodiment, the primer-probe mixture is prepared using a PCR buffer.

[0029] In another preferred embodiment, the kit further comprises a second container containing a PCR enzyme system, the PCR enzyme system comprising a hot-start enzyme, and a reverse transcriptase C-MMLV; preferably further comprising an RNase inhibitor.

[0030] In another preferred embodiment, the kit further comprises a third container containing a positive control.

[0031] In another preferred embodiment, the kit further comprises a fourth container containing a negative quality control.

[0032] In a fourth aspect of the present application, a method for multiplex detection of nucleic acid of novel coronavirus 2019-nCoV is provided, the method comprising steps of:

[0033] (1) providing a nucleic acid sample of a subject to be detected;

[0034] (2) preparing a PCR reaction system and performing PCR detection:

[0035] wherein the PCR reaction system comprises the nucleic acid sample provided in step (1), the primer pair set of the first aspect of the present application, and the probe set of the second aspect of the present application.

[0036] In another preferred embodiment, the nucleic acid sample can be from a throat swab sample, a bronchoalveolar lavage sample, a blood sample, a sputum sample, or an environmental sample.

[0037] In another preferred embodiment, the method is a detection method for non-diagnostic purposes.

[0038] In another preferred embodiment, the PCR reaction system further comprises a positive quality control and / or a negative quality control.

[0039] In another preferred embodiment, the PCR reaction system further comprises a PCR enzyme system.

[0040] In a fifth aspect of the present application, the primer pair set of the first aspect of the present application and / or the probe set of the second aspect of the present application are used for preparing a PCR detection kit for detecting nucleic acid of novel coronavirus 2019-nCoV.

[0041] It should be understood that, within the scope of the present application, the above-mentioned technical features of the present application and the technical features specifically described in the following (e.g., the examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 : detection limit of ORF1ab gene;

[0043] Figure 2 : detection limit of N gene;

[0044] Figure 3 : test results of internal standard;

[0045] Figure 4 : specific test results of ORF1ab gene and N gene;

[0046] Figure 5 Results of internal standard test for specific detection of ORF1ab and N genes;

[0047] Figure 6 Result of ORF1ab gene precision detection;

[0048] Figure 7 : N gene precision detection results;

[0049] Figure 8 : Results of accurate ORF1ab gene testing;

[0050] Figure 9 : Accuracy test results for the N gene;

[0051] Figure 10 Result of ORF1ab gene interference detection;

[0052] Figure 11 : Results of N gene interference detection;

[0053] Figure 12 Clinical sample test results;

[0054] Figure 13 Results of detection using the ORF1ab gene control primer pair;

[0055] Figure 14 Results of detection using the ORF1ab gene control primer pair. Detailed Implementation

[0056] Through extensive and in-depth research, the inventors have developed a kit and method for multiplex detection of the novel coronavirus 2019-nCoV nucleic acid. This kit can simultaneously detect two nucleic acid targets of the novel coronavirus 2019-nCoV. It can also verify the results between different targets to prevent false positives and confirm missed detections that may be caused by mutations, thus significantly improving the accuracy of virus identification.

[0057] Before describing this invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be limiting; the scope of the invention will be limited only by the appended claims.

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. As used herein, the term "about," when used in reference to a particular recited numerical value, means that the value can vary from the recited value by not more than 1%. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0059] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are herein described.

[0060] Multiplex PCR

[0061] Multiplex PCR (multiplex PCR), also known as multiplex primer PCR or composite PCR, is a PCR reaction that adds two or more pairs of primers in the same PCR reaction system, and simultaneously amplifies multiple nucleic acid fragments. The reaction principle, reaction reagents and operation process are the same as general PCR.

[0062] There are many factors that affect the multiplex PCR reaction, such as:

[0063] (1) Unbalanced reaction system. The unbalanced reaction system leads to the rapid amplification of some dominant primers and their templates in the early several rounds of reaction, obtaining a large amount of amplification products, and these amplification products are also good inhibitors of DNA polymerase. Therefore, with the large amount of amplification products, the polymerization ability of the polymerase is more and more strongly inhibited, so the primers and their templates that are in a disadvantageous position at the early stage are more difficult to react, and eventually lead to very small amount of amplification products, so as to be unable to be detected.

[0064] (2) Primer specificity. If the primer has a stronger binding force with other non-target gene fragments in the system, the ability of the primer to bind the target gene will be affected, thereby leading to a decrease in amplification efficiency.

[0065] (3) Different optimal annealing temperatures. When multiple pairs of primers are placed in one system for amplification, since the annealing temperature for PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.

[0066] (4) Primer dimer. It includes primer dimer and hairpin structure formed by the primer itself, and a third-party DNA mediated dimer. These dimers and non-specific primers will interfere with the competition of the primer with the target binding site, and affect the amplification efficiency.

[0067] Although the above mentioned several factors affect the amplification efficiency, more factors are not yet clear. So far, there is no effective method that can clearly predict the amplification efficiency.

[0068] According to the diagnosis and treatment guidelines for the new coronavirus, the nucleic acid detection of the new coronavirus is the gold standard for diagnosis. The present application develops a detection kit for simultaneously detecting ORF1ab gene and N gene of the new coronavirus, which simultaneously includes an endogenous internal standard detection system for monitoring the specimen collection, nucleic acid extraction process and PCR amplification process, so as to reduce the occurrence of false negative results. The kit is a double fluorescence detection kit, which has the characteristics of high sensitivity, strong specificity and good repeatability.

[0069] The present application provides a specific detection of ORF1ab gene and N gene combination in a sample and a kit comprising the combination, wherein the primer sequence for detecting ORF1ab gene is:

[0070] SEQ ID NO. 1: TCAAAGTAGCCACTGTACAGTC and SEQ ID NO. 2: TTAGCTAAGAGAATGTCAT,

[0071] The corresponding detection probe sequence is SEQ ID NO. 3: AGTGCACATCAGTAGTCTTACTCTCAG.

[0072] The primer sequence for detecting N gene is:

[0073] SEQ ID NO. 4: TCTTACAACCAGAACTCA and SEQ ID NO. 5: AGGTAAGAACAAGTCCTGAG,

[0074] The corresponding detection probe sequence is SEQ ID NO. 6: TAATTCTTTCACACGTGGTGTTTATTAC.

[0075] The probe labels of each pathogen of the present application are not limited to the listed single labels of the same wavelength, and include different combinations of different labels for multiplex detection.

[0076] In one embodiment, the kit further comprises an internal standard quality control and amplification primer and detection probe; the internal standard quality control amplification primer sequences are respectively:

[0077] SEQ ID NO. 7: AGTATTGGAGCACCGTGCG and SEQ ID NO. 8: GTGGCGGACTCGCCAGTTCT,

[0078] The corresponding detection probe sequence is SEQ ID NO. 9: ATCGTACCTAGGACTCTAGCGCG.

[0079] The internal standard can monitor both sample collection and sample extraction process, preventing false negative caused by sample nucleic acid extraction failure.

[0080] In a preferred embodiment of the present application, the nucleic acid sequence of the internal standard fragment is as follows:

[0081] AGTATTGGAGCACCGTGCGGTCAACGTAAGGGAGCAGAGGCGGCAGTCAAATAACTTCCTCAAGGAACAACACGTACCTAGGACTCTAGCGCGGACTAGAACTGGCGAGTCCGCCAC (SEQ ID NO.: 14)

[0082] In one embodiment, the kit comprises a positive control containing the ORF1ab gene fragment and / or the N gene fragment, and a negative control (sterilized physiological saline).

[0083] In a preferred embodiment of the present application, the nucleic acid sequence of the ORF1ab gene fragment in the positive control is as follows:

[0084] TCAAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA (SEQ ID NO.: 15).

[0085] In a preferred embodiment of the present application, the nucleic acid sequence of the N gene fragment in the positive control is as follows:

[0086] TCTTACAACCAGAACTCAATTACCCCGGACTCGCCAGTCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTCTAGGACTCTATTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCT (SEQ ID NO.: 16).

[0087] In one of the embodiments, the kit comprises PCR reaction solution containing ORF1ab gene and N gene and internal standard gene primers, probes, dNTPs (dATP: dCTP: dGTP: dTTP = 1:1:1:1) and PCR buffer solution and PCR enzyme system containing hot start Hot.Taq enzyme and C-MMLV enzyme, wherein the concentration of primers and probes is 0.1-1 μM, the concentration of dNTPs is 0.2-0.4 mM, the concentration of MgCl2 is 2-5 mM, C-MMLV enzyme is 1-3 U, and hot start Hot.taq is 2.5-10 U.

[0088] The application also provides a use method of the ORF1ab gene and N gene double detection kit, comprising the following steps: extracting the sample to be detected (the extraction reagent is nucleic acid extraction or purification reagent (Yue Sui Machine No. 20170583) produced by Zhuhai University of Daan Gene Co., Ltd., to obtain a nucleic acid sample (positive and negative quality controls are extracted synchronously) ; 5 μL is taken and added into the above-mentioned PCR reaction solution (17 μL) and enzyme system mixture (3 μL), and amplification reaction is carried out in a real-time fluorescent PCR instrument, the fluorescence channels are selected as VIC, FAM and Cy5 in turn, and the PCR amplification program is as follows:

[0089] 50℃, 15min, 95℃, 15min; 1 cycle

[0090] 94℃, 15sec, 55℃, 45sec (collecting fluorescence); 45 cycles.

[0091] After the PCR is completed, the different fluorescence channel curves and Ct values are used to judge the positive and negative of the corresponding pathogen DNA, the detection result can be used for the auxiliary diagnosis of novel coronavirus infection and the observation of drug efficacy, and a reliable basis is provided for research.

[0092] In the application, the gene sequence of the novel coronavirus 2019-nCoV is GISAID: BetaCov / Wuhan / WH01 / 2019|EPI_ISL_406798, and the oligonucleotide sequence information about the N, ORF1ab and E genes can refer to the literature (Roujian Lu, Xiang Zhao, Juan Li, et.al, Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020 Jan 30).

[0093] The kit composition is shown in Table 1 and Table 2, 2 target genes of the new coronavirus 2019-nCoV can be detected at the same time, the false positive can be prevented by mutual verification between different targets, the missed detection caused by mutation can be confirmed, and the accuracy of virus identification is significantly improved.

[0094] Table 1 Kit composition

[0095]

[0096] The primer and probe sequences required by the kit are shown in Table 2:

[0097] Table 2 Primer, probe and sequence number

[0098] Primer probe name Primer / probe sequence SEQ ID NO. ORF1ab-F1 TCAAAGTAGCCACTGTACAGTC 1 ORF1ab-R1 TTAGCTAAGAGAATGTCAT 2 ORF1ab-P 5’VIC-AGTGCACATCAGTAGTCTTACTCTCAG BHQ1-3’ 3 N-F1 TCTTACAACCAGAACTCA 4 N-R1 AGGTAAGAACAAGTCCTGAG 5 N-P 5’FAM-TAATTCTTTCACACGTGGTGTTTATTAC BHQ1-3’ 6 Internal standard-F1 AGTATTGGAGCACCGTGCG 7 Internal standard-R1 GTGGCGGACTCGCCAGTTCT 8 Internal standard-P 5’Cy5-ATCGTACCTAGGACTCTAGCGCG-BHQ2-3’ 9

[0099] Preferably, the fluorescent group is selected from the group consisting of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY5.

[0100] Preferably, the quenching gene is selected from the group consisting of MGB, BHQ-1, BHQ-2 and BHQ-3.

[0101] In the primer design of the application, specific primers and probes are screened by a large number of experiments, and they are combined, optimized and verified, and finally a multiplex detection optimal primer probe combination with no mutual interference after combination, high amplification efficiency and good specificity is preferred.

[0102] The kit of the application is used to determine the effective standard for detection:

[0103] Negative quality control and positive quality control are detected at the same time each time, when the positive quality control of the detection result is positive and the negative quality control is negative, it indicates that the experimental result is effective.

[0104] The use method of the kit of the application comprises the following steps:

[0105] (1) Extracting total nucleic acid in the detection sample to obtain a nucleic acid sample.

[0106] (2) Mixing the nucleic acid sample with PCR reaction liquid and PCR enzyme system to prepare a PCR reaction system.

[0107] (3) Real-time fluorescent PCR reaction, the program is as follows:

[0108] First stage: 50 DEG C for 2-15 min, 95 DEG C for 10-15 min, 1 cycle;

[0109] Second stage: 94 DEG C for 10-15 s, 55-60 DEG C for 45 s, 45 cycles.

[0110] PCR ends through different fluorescence channel curve and Ct value judgment corresponding pathogen nucleic acid positive and negative give detection results.

[0111] The beneficial effects of the present application are:

[0112] The current detection reagent is mostly single target detection reagent, the 2 targets of novel coronavirus 2019-nCoV are detected at the same time, the false positive can be prevented through mutual verification between different targets, the accuracy and specificity of virus identification are significantly improved. Meanwhile, the endogenous internal standard quality control system is contained in the system, the whole process of sampling, sample preservation, nucleic acid extraction and PCR amplification can be monitored, and the false negative can be prevented.

[0113] The present application is suitable for the detection of novel coronavirus 2019-nCoV nucleic acid, and provides a reliable basis for virus identification and prevention and control, and is worth popularization and application. In addition, the method of the present application is also suitable for non-diagnostic purposes, for example, in the process of epidemic prevention and control, the virus nucleic acid in the environment is detected by using the detection method of the present application, and the virus nucleic acid information can be used as the need of public health management.

[0114] The present application will be further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples are not specified, which are usually carried out according to the conventional conditions, such as the conditions described in Sambrook.J et al. Molecular Cloning Laboratory Manual (Huang Peitang et al. Translation, Beijing: Science Press, 2002) or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples are commercially available unless otherwise specified.

[0115] Example 1 Limit of detection test of ORF1ab gene and N gene double detection kit

[0116] The ORF1ab gene and N gene pseudovirus with a fixed value are diluted to a concentration of 10 5 copies / ml, and then diluted to 10 4 , 10 3 , 500, 250, 100 copies / ml, respectively, and 10 4 copies / ml of plasmid containing internal standard amplification fragment is added to each concentration sample as a sample to be detected, and the sensitivity of the double detection kit is tested.

[0117] Detection results are referred to Figure 1-3 :

[0118] Figure 1 : limit of detection of ORF1ab gene;

[0119] Figure 2 : N gene detection limit;

[0120] Figure 3 : Internal standard test results.

[0121] The test results show that the lowest concentration that can be detected is 250 copies / ml when detecting positive control samples of different concentrations of ORF1ab gene and N gene.

[0122] Example 2 Specificity test of ORF1ab gene and N gene double detection kit

[0123] SARS virus, rhinovirus, adenovirus, influenza A virus, influenza B virus, parainfluenza virus, coronavirus OC43, respiratory syncytial virus, human coronavirus NL63 type, and human coronavirus HKU1 type were used as specificity reference samples to test the specificity of the ORF1ab gene and N gene double detection kit.

[0124] Test results are shown in Table 3. Figure 4-5 :

[0125] Figure 4 : ORF1ab gene and N gene specificity test results;

[0126] Figure 5 : Internal standard test results of ORF1ab gene and N gene specificity detection.

[0127] The test results show that the detection of the specificity reference samples (normal saline, SARS virus, rhinovirus, adenovirus, influenza A virus, influenza B virus, parainfluenza virus, coronavirus OC43, respiratory syncytial virus, human coronavirus NL63 type, and human coronavirus HKU1 type) were all negative, and the internal standard control was positive.

[0128] Example 3 Precision test of ORF1ab gene and N gene double detection kit

[0129] The ORF1ab gene and N gene pseudo-viruses were diluted to 10 5 and 10 3 copies / ml, respectively, as precision reference samples, each repeated 10 times, and the coefficient of variation of each concentration precision reference sample was calculated.

[0130] Test results are shown in Table 4. Figure 6-7 :

[0131] Figure 6 : ORF1ab gene precision test results

[0132] Figure 7: N gene precision detection results

[0133] The coefficients of variation of the high-concentration and low-concentration precision reference products of the tested ORF1ab gene pseudovirus were 0.55% and 0.65% respectively; the coefficients of variation of the high-concentration and low-concentration precision reference products of the N gene were 0.44% and 0.96% respectively; the coefficients of variation of the precision reference products of the two kinds of gene pseudoviruses at different concentrations were all less than 5%.

[0134] Example 4 Accuracy test of the ORF1ab gene and N gene double detection kit

[0135] Five different concentrations of ORF1ab gene and N gene pseudoviruses were prepared respectively as positive reference products, and after extraction, the accuracy of the kit was verified by the ORF1ab gene and N gene double detection kit.

[0136] Detection results reference Figure 8-9 :

[0137] Figure 8 : ORF1ab gene accuracy detection results

[0138] Figure 9 : N gene accuracy detection results

[0139] The results showed that the results of the corresponding positive reference products of each pathogen were all positive, and there was no cross reaction with other pathogens.

[0140] Example 5 Interfering substance test of the ORF1ab gene and N gene double detection kit

[0141] 5% of whole blood, 5% of mucus, spectinomycin (100 mg / L), penicillin (0.5 mg / ml), tetracycline (5 mg / L), ofloxacin (3.06 mg / L) and azithromycin (0.45 mg / L) were added respectively to 10 3 copies / ml of ORF1ab gene and N gene pseudovirus as interfering substance test samples, and samples without interfering substances were used as controls to test the influence of interfering substances on primer probe amplification.

[0142] Detection results reference Figure 10-11 :

[0143] Figure 10 : ORF1ab gene interference detection results

[0144] Figure 11 : N gene interference detection results

[0145] The results show that the samples with 5% whole blood, 5% mucus, spectinomycin (100 mg / L), penicillin (0.5 mg / ml), tetracycline (5 mg / L), ofloxacin (3.06 mg / L) and azithromycin (0.45 mg / L) have no obvious interference on the detection results, and do not affect the result interpretation.

[0146] Example 6: Detection of clinical samples

[0147] Extraction of nucleic acid of the detection sample:

[0148] (1) Extraction of nucleic acid template of the clinical sample to be detected

[0149] 22 suspected clinical samples of throat swabs were collected, and the detection sample was extracted (the extraction reagent was a nucleic acid extraction or purification reagent (Yue Sui Machine No. 20170583) produced by Zhongshan University Daan Gene Co., Ltd.), and the nucleic acid sample (positive and negative controls were extracted synchronously); 5 μL was added to the above-mentioned PCR reaction liquid (17 μL) and enzyme mixture (3 μL), and amplification reaction was carried out in a real-time fluorescent PCR instrument, the fluorescence channels were selected as VIC, FAM and Cy5 in turn, and the PCR amplification program was as follows:

[0150] 50℃, 15min, 95℃, 15min; 1 cycle

[0151] 94℃, 15sec, 55℃, 45sec (collect fluorescence); 45 cycles.

[0152] After the PCR was completed, the Ct value and the curve of different fluorescence channels were used to judge the positive and negative of the corresponding pathogen DNA.

[0153] Among the 22 suspected clinical samples detected, 17 new coronavirus 2019-nCoV nucleic acid positive clinical samples were detected. The typical detection results are shown in Figure 12 .

[0154] The sequencing verification results show that the detection accuracy of the detection system of the present application reaches 100%, which further proves the clinical detection accuracy of the detection system of the present application.

[0155] Comparative Example 1

[0156] In the research process, the present inventors screened dozens of groups of PCR primers and probes for the target nucleic acid sequence of the new coronavirus 2019-nCoV, and finally obtained a primer and probe combination with sensitivity and specificity that can meet the clinical detection requirements and can perform multiplex detection.

[0157] For the N, ORF1ab gene detection target of new coronavirus 2019-nCoV, the inventors have carried out a large number of screening and combination. For example, for the ORF1ab gene, some typical primer sequences designed are as follows: ORF1ab gene control upstream primer ORF1ab-F2: CTAAAATGTCAGATGTAAAG (SEQ ID NO. 10) ORF1ab gene control downstream primer ORF1ab-R2: TGTAACTGGACACATTGAGC (SEQ ID NO. 11) ORF1ab gene control upstream primer ORF1ab-F3: TTGTATCAAAGTAGCCAC (SEQ ID NO. 12) ORF1ab gene control downstream primer ORF1ab-R3: ATTGAGCCCACAATTTAG (SEQ ID NO. 13)

[0158] The specific detection steps, detection conditions and probe sequences are the same as those in the above examples, and PCR detection test is carried out.

[0159] The detection results of using ORF1ab-F2 and ORF1ab-R2 are as shown in Figure 13 The detection results show that the primer pair has poor specificity. The detection results of using ORF1ab-F3 and ORF1ab-R3 show that the primer pair has better specificity and sensitivity to the ORF1ab gene target nucleic acid in a single detection system, but the amplification of the low concentration of ORF1ab gene target nucleic acid is obviously inhibited in a multiplex detection system. The single and multiplex system detection results are as shown in Figure 14 It is shown that the control primer pair ORF1ab-F3 and ORF1ab-R3 cannot be applied to the multiplex detection system.

[0160] All the documents mentioned in the present application are cited as references in the present application, just as each document is cited as a reference individually. In addition, it should be understood that those skilled in the art can make various modifications or changes to the present application after reading the above teaching of the present application, and these equivalent forms also fall within the scope defined by the claims attached to the present application.

Claims

1. A kit for multiplex detection of novel coronavirus nucleic acid, characterized in that, The kit comprises a primer pair set and a probe set, The primer pair set comprises a first primer pair set, a second primer pair set and an internal standard primer pair set: The first primer pair set comprises: a forward primer as shown in SEQ ID NO. 1 and a reverse primer as shown in SEQ ID NO. 2; The second primer pair set comprises: a forward primer as shown in SEQ ID NO. 4 and a reverse primer as shown in SEQ ID NO. 5; The internal standard primer pair set comprises: a forward primer as shown in SEQ ID NO. 7 and a reverse primer as shown in SEQ ID NO. 8; The probe set comprises a first probe with a nucleotide sequence as shown in SEQ ID NO. 3, a second probe with a nucleotide sequence as shown in SEQ ID NO. 6 and an internal control probe with a nucleotide sequence as shown in SEQ ID NO. 9; The kit further comprises an internal standard quality control, which comprises an internal standard fragment with a nucleic acid sequence as shown in SEQ ID NO.

14.

2. The kit of claim 1, wherein The kit further comprises a positive quality control comprising an ORF1ab gene fragment and / or an N gene fragment.

3. The kit of claim 2, wherein The nucleic acid sequence of the ORF1ab gene fragment is as shown in SEQ ID NO.

15.

4. The kit of claim 3, wherein The nucleic acid sequence of the N gene fragment is as shown in SEQ ID NO.

16.

5. The kit of claim 4, wherein The kit comprises a first container, which comprises a primer probe mixture, and the primer probe mixture comprises polynucleotides with sequences as shown in SEQ ID NO. 1-9.

6. The kit of claim 5, wherein The kit further comprises a second container, which comprises a PCR enzyme system, and the PCR enzyme system comprises a hot start enzyme and a reverse transcriptase C-MMLV.

7. The kit of claim 6, wherein The second container comprises an RNAase inhibitor.

8. The kit of claim 6, wherein The kit further comprises a third container, which comprises a positive quality control, and the positive quality control comprises a pseudo virus containing the ORF1ab gene fragment, a pseudo virus containing the N gene fragment and a pseudo virus containing the internal standard fragment.

9. The kit of claim 8, wherein The kit further comprises a fourth container, which comprises a negative quality control, and the negative quality control comprises a pseudo virus containing the internal standard fragment.

10. The kit of claim 5, wherein The primer probe mixture further comprises dNTPs.

Images